Floral Transmission of Erwinia Tracheiphila by Cucumber Beetles in a Wild Cucurbita Pepo

PLANTÐINSECT INTERACTIONS Floral Transmission of Erwinia tracheiphila by Cucumber Beetles in a Wild Cucurbita pepo

1 2 1 3 4 M. A. SASU, I. SEIDL-ADAMS, K. WALL, J. A. WINSOR, AND A. G. STEPHENSON

Environ. Entomol. 39(1): 140Ð148 (2010); DOI: 10.1603/EN09190 ABSTRACT Cucumber beetles, Acalymma vittatum (F.) and Diabrotica undecipunctata howardi (Barber), are specialist herbivores of cucurbits and the vector of Erwinia tracheiphila (E.F. Smith) Holland, the causative agent of wilt disease. Cucumber beetles transmit E. tracheiphila when infected frass falls onto leaf wounds at the site of beetle feeding. We show that E. tracheiphila also can be transmitted via the ßoral nectaries of Cucurbita pepo ssp. texana L. Andres (Texas gourd). Under Þeld conditions, we found that beetles aggregate in ßowers in the late morning, that these beetles chew the anther Þlaments that cover the nectaries in male ßowers thereby exposing the nectary, and that beetle frass accumulates on the nectary. We use real-time polymerase chain reaction to show that most of the ßowers produced during the late summer possess beetle frass containing E. tracheiphila. Greenhouse experiments, in which cultures of E. tracheiphila are deposited onto ßoral nectaries, show that Texas gourds can contract wilt disease through the ßoral nectaries. Finally, we use green ßuorescent proteinÐtransformed E. tracheiphila to document the movement of E. tracheiphila through the nectary into the xylem of the pedicel before the abscission of the ßower. Together, these data show that E. tracheiphila can be transmitted through infected frass that falls on or near the ßoral nectaries. We hypothesize that the concentration of frass from many beetles in the ßowers increases both exposure to and the concentration of E. tracheiphila and plays a major role in the dynamics of wilt disease in both wild populations and cultivated squash Þelds.

KEY WORDS Acalymma vittatum, bacterial wilt disease, Cucurbita pepo ssp. texana, Erwinia tracheiphila, real-time polymerase chain reaction

The leaves and other organs of plants in the Cucur- tances (Andersen and Metcalf 1986, 1987; Lampman bitaceae produce cucurbitacins (oxygenated tetracy- and Metcalf 1988; Metcalf and Lampman 1991). In the clic triterpenes). Cucurbitacins are among the most mid to late mornings, the beetles aggregate in the bitter compounds known, detectable by humans at ßowers of Cucurbita species to feed and mate levels of 1 ppb, and are toxic to most herbivores (Tal- (Andersen and Metcalf 1987). Foliar feeding by these lamy 1985, Metcalf and Rhodes 1990). However, cu- beetles results in a characteristic pattern of small holes cumber beetles (Diabrotica spp. and Acalymma spp.) in the portions of the leaves serviced by the smallest are adapted to feed on cucurbitacins in the cotyledons, veins. Beetle damage has been shown to substantially leaves, ßowers, and fruits of Cucurbita species and are reduce yield in cultivated cucurbits (cucumbers, mel- found throughout the native ranges of Cucurbita spe- ons, squash, and pumpkins) and reproductive output cies (Tallamy 1985, Metcalf and Rhodes 1990, Eben in wild Cucurbita (Tallamy and Krischik 1989, Que- and Barbercheck 1996). Cucumber beetles are at- sada et al. 1995, Stephenson et al. 2004, Du et al. 2008). tracted to cucurbitacins in the foliage of Cucurbita In addition to reducing photosynthetic leaf area, and, when ßowers are present, it has been shown that herbivory by cucumber beetles on wild and cultivated ßoral volatiles not only attract bees (the pollinators) cucurbits also increases exposure to a variety of patho- but also cucumber beetles over relatively large dis- gens, including Erwinia tracheiphila (E.F. Smith) Hol- land (Enterobacteriaceae) (Fleischer et al. 1999, 1 Department of Biology and Center for Chemical Ecology, 208 Stephenson et al. 2004, Du et al. 2008). Erwinia tra- Mueller Laboratory, The Pennsylvania State University, University cheilphila is the causative agent of bacterial wilt dis- Park, PA 16802. ease that is an economically signiÞcant disease vec- 2 Department of Entomology and Center for Chemical Ecology, tored by cucumber beetles (Brust 1997c, Fleischer Chemical Ecology Laboratory, The Pennsylvania State University, University Park, PA 16801. et al. 1999, Mitchell and Hanks 2009). After entering 3 Department of Biology, Department of Biology, The Pennsylvania the plant the bacteria proliferate in the xylem where State University, Altoona, PA 16601. they secrete an exopolysaccharide matrix that cuts off 4 Corresponding author: Department of Biology and Center for the water supply resulting in wilting. Wilt symptoms Chemical Ecology and Center for Infectious Disease Dynamics, 208 Mueller Laboratory, The Pennsylvania State University, University typically develop 7Ð15 d after infection and the disease Park, PA 16802 (e-mail: [email protected]). is nearly always fatal once symptoms appear (Yao et

0046-225X/10/0140Ð0148$04.00/0 ᭧ 2010 Entomological Society of America February 2010 SASU ET AL.: FLORAL TRANSMISSION OF E. tracheiphila BY CUCUMBER BEETLES 141 al. 1996). Death occurs 1Ð3 wk after symptoms appear. that disease progression occurs when E. tracheiphila is In the eastern United States, E. tracheiphila overwin- placed onto the nectaries of ßowers; and we trans- ters in the digestive track of cucumber beetles (Gar- formed E. tracheiphila with green ßuorescent protein cia-Salazar et al. 2000). Serological studies have shown and track the movement of the bacteria through the that Ϸ7Ð11% of the Acalymma vittatum (F.) that nectary and into the xylem. emerged from the soil in the spring tested positive for E. tracheiphila (Fleischer et al. 1999). Transmission is Materials and Methods thought to occur when fecal pellets containing E. tracheiphila land on leaf wounds at the sites of feeding Study Species and Field Plots. The Texas gourd, damage (Leach 1964). A recent study using an end- Cucurbita pepo subsp. texana, is an annual monoecious point polymerase chain reaction (PCR)-based tech- vine with indeterminate growth and reproduction. It nique showed that the frass of A. vittatum that had fed is native to northern Mexico, Texas, and the lower on infected plants contained E. tracheiphila and that Mississippi River drainage area and is thought to be the frass was capable of causing infection using pin- either the wild progenitor of the cultivated squashes prick inoculations (Mitchell and Hanks 2009). Fleis- (C. pepo subsp. pepo) or an early escape from culti- cher et al. (1999) estimated that the proportion of vation (Decker and Wilson 1987, Decker-Walters beetles harboring E. tracheiphila is typically Þve times 1990, Lira et al. 1995, Decker-Walters et al. 2002). greater than the proportion of beetles that actually After germination and seedling emergence, there is a transmit disease when an individual beetle is placed period of vegetative growth (Þve to seven nodes). into a cage with a cucurbit seedling. Other studies Thereafter, most nodes produce one large yellow have shown that the efÞciency of transmission de- ßower (either male or female) in the axils of each leaf. pends on the size of the wound, the inoculum dose, The ßowers last for only one morning and are polli- and the amount of time the infected beetles feed on nated by bees, especially squash bees of the genera the plant (Lukezic et al. 1996; Brust 1997a, b). Peponapis and Xenoglossa (Winsor et al. 2000, Avila- Over the last 7 yr, we studied the inter-relationships Sakar et al. 2001). Male ßowers are oriented vertically among inbreeding, herbivory by cucumber beetles [A. and are displayed above the leaves on long pedicels. vittatum and Diabrotica undecipunctata howardi (Bar- The base of the three fused Þlaments of the androe- ber)], and the incidence of bacterial wilt disease in a cium surrounds and covers the nectary, which is only wild gourd, Cucurbita pepo ssp. texana L. Andres accessible to the tongues of the bees through three (Texas gourd) in a series of large Þeld scale studies narrow slits. The female ßowers are oriented horizon- (Hayes et al. 2004; Stephenson et al. 2004; Ferrari et al. tally and the nectary forms a ring around the base of 2006, 2007; Du et al. 2008). These studies have con- the style (Nepi et al. 1996). The ßowers abscise 24Ð48 sistently shown that inbred plants grew more slowly, h after anthesis and then the pedicel begins to senesce produced fewer ßowers and fruits, and suffered (except on pollinated female ßowers where the ovary greater levels of leaf damage by cucumber beetles and pedicel persist). than outbred plants but that outbred plants had a Field studies were conducted in four 1-acre Þelds at greater incidence of wilt disease. Controlled inocula- The Pennsylvania State University Agriculture Re- tion studies showed that there were no signiÞcant search Farm at Rock Springs, PA. In late May 2008, we differences between inbred and outbred plants in re- transplanted 18 Texas gourd plants and 18 backcrossed sistance to E. tracheiphila and spatially explicit auto- (backcross 4) plants (Texas gourd X cultivated squash correlation models of disease spread in our Þelds with Texas gourd as the recurrent parent) from each showed that differences in the incidence of wilt dis- of Þve maternal families (180 plants per Þeld, 720 total ease were not caused by spatial artifacts (Ferrari et al. plants). The Þelds were not sprayed with insecticide, 2007). Retrospective analyses of our Þeld data showed and viral and wilt diseases were allowed to occur that there were no differences in the incidence of wilt naturally. The plants in each Þeld were monitored disease on inbred and outbred plants before the ini- throughout the growing season for incidence of wilt tiation of ßowering (late June) but, once ßowering disease (Þeld diagnosis conÞrmed by isolating Erwinia began, those plants that were producing the most from diseased plants and using the isolate to infect ßowers per week were the most likely to contract wilt greenhouse grown plants (see Ferrari et al. 2007 for disease. Together these Þndings suggested that E. tra- techniques). To determine the number of beetles that cheiphila could be transmitted through the ßowers aggregate in the ßowers, we counted the number of when A. vittatum aggregate in the ßowers to feed and beetles in one male and one female ßower on all mate in the mid to late morning. The goal of the healthy (no visible symptoms of viral or wilt disease) research described here is to determine whether E. plants that produced at least one ßower on 1, 10, and tracheiphila can be transmitted through the nectary of 18 August (N ϭ 856 male ßowers; N ϭ 397 female Texas gourd ßowers. SpeciÞcally, we develop a real- ßowers). If a plant produced two or more male or time PCR-based technique to identify E. tracheiphila female ßowers, we randomly selected the male and in beetle frass, and we use this technique to show that female ßower before looking into the ßower to count a high proportion of ßowers in the Þeld contain E. the beetles. These counts were made between 0900 tracheiphila contaminated frass; we determined that and 1100 hours and represent the number of beetles at most ßowers under Þeld conditions contain frass any one time in a ßower (i.e., these are not cumulative that has fallen directly onto the nectary; we showed numbers of beetles that visit a ßower over the course 142 ENVIRONMENTAL ENTOMOLOGY Vol. 39, no. 1 of one morning). To determine the effects of ßower samples were considered to contain trace amounts of type (male or female), date (1, 10, and 18 August), and E. tracheiphila and if the melting curves showed no their interaction on the number of beetles per ßower, detectable product the samples were considered neg- we performed an analysis of variance (ANOVA; Proc ative for E. tracheiphila. Mixed; SAS Institute 2002). Nectary Inoculations of E. tracheiphila. To deter- On 1, 10, and 18 August, we also surveyed male mine whether E. tracheiphila on the nectaries of Texas ßowers in our Þelds and recorded the proportion of gourds could result in wilt disease, we grew 250 Texas ßowers in which beetles had damaged (chewed) the gourd plants in 1-gal pots in Pro-Mix BX with fungicide base of the anther Þlaments and exposed the nectary (Premier Horticulture, Riviere-du-Loup, Quebec, and the number of ßowers in which beetle frass was Canada) potting soil in a greenhouse. At Ϸ10 wk after found on the nectary pad and/or in the nectary. emergence, we began to inoculate the nectaries of Voucher specimens were placed in the Frost Ento- male ßowers. On the day that a ßower was inoculated, mological Museum, Pennsylvania State University. we removed the nectar using a 50-␮l capillary tube and Real-Time PCR Method for Identifying E. tra- placed 100 ␮lofE. tracheiphila inoculum onto the cheiphila in Beetle Frass. To determine the proportion nectary with a blunt 18-gauge needle and 1-ml Tu- of ßowers that were exposed to beetle frass containing berculin syringe. The inoculum was prepared from E. E. tracheiphila, we collected a random sample of 16 tracheiphila isolated the previous summer from Þeld male ßowers on 1 August and 10 and 9 September in grown plants. The isolates were grown in nutrient the late morning (48 total ßowers, although one sam- broth supplemented with extra peptone and placed in ple was later discarded). We removed the beetle frass a 15% glycerol solution and frozen at Ϫ80ЊC (Ferrari from ßowers with clean toothpicks, placed it into et al. 2007). Samples of the frozen isolates were 1.5-ml microcentrifuge tubes, and froze the samples at thawed and streaked onto plates of Difco (Sparks, MI) Ϫ20ЊC. DNA was extracted from these samples in nutrient agar supplemented with extra agar and pep- 50Ð100 ␮l extraction buffer according to the recom- tone (NAP) (De Mackiewicz et al. 1998) for 5Ð7 d. For mended protocol with the PREPGEM Bacteria kit greenhouse inoculations, the resulting colonies were (ZyGEM, Hamilton, New Zealand). To break up the dislodged with a sterile L-rod and transferred into frass and release the DNA, an initial incubation step at distilled deionized water (diH2O). The average con- 72ЊC for 15 min was incorporated before adding the centration of E. tracheiphila cells in each inoculum was lysozyme. 5.35 ϫ 108 cells/ml and was determined using a spec- We used real-time PCR to detect E. tracheiphila trophotometer at OD 600. Each day, we also per- genomic DNA. We chose to amplify the outer mem- formed two control inoculations: one plant was inoc- brane protein (EtOMP), because gene sequences for ulated with diH20 and another plant was inoculated EtOMP from several different strains of E. tracheiphila directly through the vasculature by using a thin nee- are published (NCBI Accessions AF220817ÐAF220822). dle, piercing leaf and stem vasculature with the E. Primers were designed to anneal to conserved regions of tracheiphila suspension used that day. Five ßowers EtOMP of E. tracheiphila, such that all published strains were inoculated on each plant unless a plant devel- of E. tracheiphila are indiscriminately detected (Et73: oped symptoms of wilt disease in which case we per- GGCGATCACGACACAGTTGT, Et140: CAGTTTTT- formed no additional ßoral inoculations. We recorded GGTCAGGGCATACTC). the Þrst day of wilt symptoms and wilt disease devel- PCRs were run in 20-␮l reactions using the 2ϫ opment. To be certain that wilting was caused by E. SybrGreen Mastermix (Bio-Rad, Hercules, CA), 0.5 tracheiphila, we reisolated the bacteria from inocu- ␮M Þnal primer concentration, and 5 ␮l of the DNA lated plants, conÞrmed colony morphology, and in- preparation as template. The cycling program con- fected additional plants using vasculature inocula- sisted of an initial denaturation at 95ЊC for 3 min, 40 tions. A few months later, we repeated the above cycles of 95ЊC for 15 s, 58ЊC for 15 s, and 72ЊC for 30 s, experiment using female ßowers that had been either and a Þnal extension at 72ЊC for 5 min. Fluorescence pollinated or unpollinated. This experiment used a reads were taken at the end of each extension step. new set of plants and E. tracheiphila that recently had The identity of the PCR products was veriÞed by been isolated from Þeld infected plants. cloning and subsequent sequencing. In addition, the GFP-Transformed E. tracheiphila and Infection speciÞcity of our primers was veriÞed using E. coli, Through the Nectary. To examine the progression of ßoral tissue, and uninfected beetle frass as negative E. tracheiphila through the nectary and into the xylem controls, and all Þve of our 2006Ð2008 Þeld isolates of of the pedicel of ßowers, Þeld-collected E. tracheiphila E. tracheiphila and the E. tracheiphila, we transformed were transformed with a high copy number plasmid with green ßuorescent protein (GFP; see below) as (pfdC4ZÕ-gfp)-expressing GFP. The plasmid pfdC4ZÕ- positive controls. Every sample was analyzed in trip- gfp contains the GFP mutant2 coding sequence with licate. If the CT values of all three technical replicates the T7 gene 10 ribosomal binding site just upstream of were within one cycle of each other and the melting the ATG start codon and a chloramphenicol resistance curves showed a clean peak at the correct melting gene. The mutant2 GFP protein has a 19-fold higher temperature, the samples were considered to contain ßuorescence emission intensity than the wild-type E. tracheiphila, given that the three replicates had GFP protein at 488 nm (Cormack et al. 1998). Plasmids clear melting curves in all three technical replicates. If for transformation of E. tracheiphila were maintained the CT values varied by more than one cycle, the and multiplied in E.coli (One Shot Top10 cells; In- February 2010 SASU ET AL.: FLORAL TRANSMISSION OF E. tracheiphila BY CUCUMBER BEETLES 143 vitrogen, Carlsbad, CA). Transformants in E.coli were and examined on both sides for presence of E. tra- screened for successful transformation by PCR with cheiphila expressing GFP at ϫ40 under the light mi- the following primers: GFPL-502, CTGGGTATCTCG- croscope with a GFP Þlter. CAAAGCAT; GFPR-670, GGTGATGTTAATGGGCA- CAA. Electro-competent E. tracheiphila were generated Results following standard procedures. Brießy, to transfer E. tracheiphila into liquid culture 1 ml of liquid nutrient A mixed-effects model ANOVA showed that male broth (8 g nutrient broth, 5 g peptone/liter distilled ßowers had signiÞcantly more beetles per ßower than water) was inoculated with E. tracheiphila, which had female ßowers (2.4 Ϯ 0.1 versus 1.9 Ϯ 0.1; least square been propagated on plates. These liquid starter cul- means Ϯ SE; F ϭ 8.49; df ϭ 1,1247; P Ͻ 0.004; Fig. 1A). tures were incubated overnight at 28ЊC, with vigorous Our surveys of ßowers in the late morning, just before shaking. The following morning, 10 ml of nutrient the ßowers closed, showed that the beetles had broth was inoculated with 250 ␮l of this starter culture chewed the base of the anther Þlaments so that all or and incubated overnight at 28ЊC, with vigorous shak- part of the nectary was exposed on 68% of the male ing. The following morning the overnight cultures ßowers (342 of 500) (Fig. 1B and C). On 52% of the were washed and concentrated. For each wash, the male ßowers, frass was visible on the nectary pad or in bacterial suspension was centrifuged at 5,000g for 10 the nectary (260 of 500; Fig. 1C and D). In some min at 4ЊC, the supernatant was discarded, and the ßowers, there was evidence that beetles had fed on bacteria were resuspended, Þrst in 2.5 ml, then in 2 ml nectary tissue and in a few ßowers the nectary had ice cold, sterile, double distilled water, and Þnally in been chewed so severely that the vascular bundles in 1 ml ice cold, sterile 10% glycerol. Final bacterial the pedicel were visible. Therefore, in the majority of pellets were resuspended in 200 ␮l ice cold, sterile, the male ßowers all the prerequisites are met for 10% glycerol. Aliquots of 40 ␮l of this Þnal bacterial E. tracheiphila from the frass to enter the plant through suspension were transformed with 200 ng of the plas- the vascular bundles of the pedicel. mid pfdC4ZÕ-gfp by electroporation with voltage set at From early August until early September, the per- 2,500 V for 5 ms (actually delivered voltage was 2,470 centage of plants with symptoms of wilt disease in- V). Directly after electroporation the bacterial sus- creased from 6 to 19%, whereas the cumulative inci- pension was transferred toa2mlEppendorff tube dence of wilt disease (living plants with symptoms plus containing 500 ␮l nutrient broth. Bacteria were al- plants that died of wilt disease) increased from 18 to lowed to recuperate for1hatroom temperature 43% (Table 1). On 1 and 10 August and 9 September, shaking horizontally on a rotary shaker. To select for we collected frass from 47 male ßowers and screened GFP-expressing E. tracheiphila, 4.5 ml of nutrient it for presence of E. tracheiphila using real-time PCR. broth containing 250 ␮l chloramphenicol (20 ␮g/␮lin We detected E. tracheiphila unequivocally in 39 sam- ethanol) were inoculated with the suspension of recu- ples, trace amounts in 6 samples, and were unable to perated E. tracheiphila and incubated overnight at 28ЊC, detect E. tracheiphila in 2 samples. To verify that E. vigorously shaking. Twenty-one hours later, aliquots of tracheiphila was present in the frass samples with trace this bacterial suspension were visually inspected with a amounts, we ran these samples twice, and we were Zeiss Axiover light microscope at ϫ40 for live E. tra- able to duplicate the results. In short, 95% of a ran- cheiphilaÐexpressing GFP. For further maintenance and domly sampled set of male ßowers in our Þelds during propagation of GFP-expressing E. tracheiphila, bacteria August and early September contained cucumber were streaked on nutrient plates containing chloram- beetle frass containing E. tracheiphila. phenicol (Þnal concentration of 1 ␮g/␮l). Glycerol The greenhouse inoculation experiment, in which stocks were made for long-term storage. cultured E. tracheiphila were placed directly onto the We grew 30 Texas gourds in the greenhouse and nectary after nectar removal, showed that inoculated used the same procedure as in the greenhouse inoc- plants contracted wilt disease through both male and ulation experiments to inoculate through the nectaries females ßowers (Table 2). Plants receiving nectary of male ßowers. We inoculated 1Ð5 ßowers on each inoculations through pollinated female ßowers had a plant for a total of 75 ßowers. We collected the male greater probability of contracting wilt disease than ßowers and their pedicels at 24 h after inoculation. plants inoculated through unpollinated female ßowers Each pedicel ranged from 7.9 to 12 cm in length. (␹2 ϭ 5.04; df ϭ 1; P Ͻ 0.025). Plants that were inoc- Immediately after collection of the ßowers, we used a ulated through female ßowers (either pollinated or tool made of 10 razor blades soldered together with a unpollinated) had a greater probability of contracting 1-mm distance between the blades to make cross- wilt than plants pollinated through the nectaries of section cuts at 1-mm intervals along the pedicel start- male ßowers (both ␹2 Ͼ 18; df ϭ 1; both P Ͻ 0.001). ing at the nectaries to 1 cm below the nectary on 71 It should be noted, however, that the male and female of the ßowers. The tool was sterilized using 70% EtOH ßowers were inoculated in separate greenhouse ex- after every cut. On the remaining four ßoral pedicels, periments using different E. tracheiphila isolates from we used the razor blade tool to longitudinally slice the the Þeld. entire length of the pedicel that resulted in three to six After nectary inoculations of 75 male ßowers with longitudinal slices per pedicel. Each longitudinal slice GFP-transformed E. tracheiphila, we found that two of and each 1-mm cross-sectioned segment was mounted the four longitudinally sectioned pedicels had GFP-ex- on a slide in a drop of water (to prevent desiccation) pressing E. tracheiphila in the Þrst 1 mm below the nec- 144 ENVIRONMENTAL ENTOMOLOGY Vol. 39, no. 1

Fig. 1. Cucumber beetles in Texas gourd ßowers and feeding damage to ßoral tissues. (A) Male ßower with cucumber beetles inside corolla (1a) and feeding damage to the petals (2a). (B) Close-up of two beetles inside male ßower corolla. (C) Anther and anther Þlament with beetle damage exposing nectary tissue and cucumber beetle frass inside nectary. (D) Female ßower with ßoral tissue damage and cucumber beetle feeding on nectary tissue. tary but no bacteria were detected any further down the tissue in which they had been associated was damaged by pedicel at 24 h after inoculation (Fig. 2A). These Þndings the longitudinal section). Consequently, the remaining suggested to us that the movement of GFP-transformed 71 pedicels were cross-sectioned in 1-mm segments from E. tracheiphila through the nectaries and into the pedicel the nectary to 1 cm below the nectary. No GFP-express- was rather frequent and that we should concentrate our ing E. tracheiphila were observed Ͼ5 mm from the nec- examinations on the 1 cm of pedicel directly below the tary at 24 h after inoculation. We found GFP-expressing nectary. In the longitudinal sections, however, it was E. tracheiphila on the surface of one to four cross-sections difÞcult to determine where the E. tracheiphila were [i.e., the top or bottom of one to four 1-mm segment(s)] actually located in the pedicel (Fig. 2A) because many from 26 different pedicels. In these cross-sections, we of the bacteria were ßoating in the drop of water (i.e., the

Table 2. Percentage of plants infected with E. tracheiphila Table 1. Percentage of plants with wilt disease and the cumu- through ﬂoral nectaries under greenhouse conditions lative incidence of wilt disease on the three dates of cucumber beetle frass collection from male ﬂowers Type of ßower No. plants with inoculated on N symptoms after Date in 2008 1 Aug. 10 Aug. 9 Sep. each plant 20 d (%) No. living plants 627 593 514 Pollinated female 62 43 (69%) No. plants that died 93 127 206 Unpollinated female 90 46 (51%) from wilt disease Male 143 34 (24%) No. living plants with 40 (6%) 79 (13%) 100 (19%) Total ßowers 295 123 (42%) wilt disease (%) Vascular inoculation 21 21 (100%) Cumulative incidence of 0.18 0.29 0.43 Inoculum with no 21 0 (0%) wilt disease E. tracheiphila February 2010 SASU ET AL.: FLORAL TRANSMISSION OF E. tracheiphila BY CUCUMBER BEETLES 145

Fig. 2. Images of E. tracheiphila expressing GFP inside pedicel vascular bundles of C. pepo ssp. texana (Texas gourd) 24 h after inoculation at ϫ40 under light microscopy using a GFP Þlter. Each image is from a different pedicel, was not cropped, and includes a scale of 100 ␮m. (A) Longitudinal section of the pedicel immediately below the nectary. Nectary would be positioned in the top right corner. (1a) Spiral thickenings of intact xylem column. (2a) Colonies of E. tracheiphila cells inside xylem column. (3a) E. tracheiphila cells released from other xylem columns when the vascular bundle was longitudinally sectioned. These cells are ßoating freely in water as a result of the longitudinal cut. (B) Cross-section of vascular bundle 1 mm below nectary. (1b) Colonies of E. tracheiphila cells inside xylem column. (C) Cross section of vascular bundle with colony forming at 3 mm below nectary. (1c) GFP-expressing E. tracheiphila are ßuorescing inside nearly all xylem columns. Same image with vascular bundle columns circled. (D) Cross-section of vascular bundle 5 mm below nectary with GFP-expressing E. tracheiphila ßuorescing inside one xylem column. observed that the bacteria aggregate in small colonies could not be detected against this background ßuo- (Ͻ20 ␮m across) inside the vascular (xylem) tissue (Fig. rescence. 2BÐD). Because colony size is small and because we In the male ßowers of C. pepo an abscission layer could only visualize superÞcial colonies of GFP-express- forms between the end of the pedicel (bottom of the ing E. tracheiphila (i.e., colonies located at either end of nectary) and they abscise within 24Ð48 h after the a 1-mm segment), we suspect that our Þndings greatly ßowers close. Our data indicate that E. trachephila are underestimate the number of colonies per pedicel and, able to move through the nectary tissue and some of possibly, the proportion of pedicels with GFP-expressing the pedicel before the formation of the abscission E. tracheiphila and the distance from the nectary that the layer. bacteria have traveled in 24 h. We also attempted to examine the movement of Discussion GFP-expressing E. tracheiphila from the surface of the nectary to the pedicel below the nectary. Unfortu- Strong circumstantial evidence supports the long- nately, the tissue of the nectary autoßuoresced so held presumption that E. tracheiphila is transmitted by brightly that individual GFP-expressing bacterial cells cucumber beetles through foliar feeding when frass- 146 ENVIRONMENTAL ENTOMOLOGY Vol. 39, no. 1 containing E. tracheiphila falls onto the open wounds proximity with the nectary) but do not chew the (Leach 1964). For example, caged bioassays indicated stigma/style of female ßowers. that a single beetle can transmit wilt disease (Brust In central Pennsylvania, and throughout the north- 1997b, Fleischer et al. 1999); A. vittatum is known to eastern United States, cucumber beetle populations harbor E. tracheiphila in its gut (Fleischer et al. 1999, increase through the growing season as the resident Garcia-Salazar et al. 2000); and the frass of A. vittatum beetles undergo successive generations (A. vittatum) contains E. tracheiphila and the frass is capable of and other species (mostly D. undecipunctata howardi) causing wilt disease after pin prick inoculation (Mitch- migrate into cucurbit Þelds (Ferrari et al. 2007). In a ell and Hanks 2009). The study presented here pro- 3-yr study, Fleischer et al. (1999) found that 7Ð10% of vides strong circumstantial evidence that cucumber newly emerged beetles in the spring tested positive for beetles also transmit E. tracheiphila through the ßoral E. tracheiphila and this number increased to 39Ð78% nectaries on C. pepo ssp. texana. SpeciÞcally, we during the growing season. Yao et al. (1996) found a showed, under Þeld conditions, that the beetles ag- strong positive relationship between cucumber beetle gregate in the ßowers in the mid to late morning, that density and the incidence of wilt disease over the a large proportion of the ßowers by late morning course of the growing season. In this study, we found contain frass contaminated with E. tracheiphila, that 95% of the male ßowers in AugustÐearly September the beetles frequently damage the base of the anther had frass containing E. tracheiphila and that 52% of the Þlaments exposing the nectary, and that frass often ßowers had frass on or in the nectary. Our previous accumulates on or in the nectaries of male ßowers. studies have shown that leaf damage by cucumber Moreover, we show that greenhouse grown plants beetles accumulates on all plants in our Þelds through- contract wilt disease when E. tracheiphila is deposited out the growing season and that healthy plants are onto nectaries of both male and female ßowers and making multiple male ßowers per day in August (Ste- that GFP-transformed E. tracheiphila, when placed phenson et al. 2004, Du et al. 2008). Consequently, it onto the nectary of male ßowers, enter into the nec- is likely that, by August, virtually every plant in this tary and proceed down the pedicel before ßoral ab- study is exposed to E. tracheiphila on a daily basis scission. Interestingly, Erwinia amylovora (Burr.) and through the leaves and/or the ßowers. Not surpris- Erwinia pyrifoliae (Kim et al. 1999), the causative ingly, the percentage of living plants with wilt disease increased from 6 to 19% from 1 August to 9 September, agents of Þre blight and Asian pear blight, respectively, whereas the cumulative incidence of wilt disease in- are also known to enter their hosts through the nec- creased from 18 to 43% over the same time period. taries (Thomson 1986, Kim et al. 1999, Bubanetal. ´ Although bacterial wilt disease was clearly epi- 2003). demic in our Þelds, it also is evident that only a small Our greenhouse inoculation experiments showed proportion of the Þeld exposures to E. tracheiphila that E. tracheiphila can be transmitted through the result in disease progression. Single beetle caged bio- nectaries of male ßowers and through unpollinated assays, in which individual beetles are placed into a and pollinated (ovary retained between the pedicel cage with a seedling under greenhouse conditions, and nectary) female ßowers. It should be noted, how- show that the proportion of beetles that test positive ever, that the difference between male and female for E. tracheiphila is Þve times greater than the pro- ßowers that we observed in the probability of con- portion that transmit wilt disease (Fleischer et al. tracting wilt disease could be an artifact. The green- 1999). Moreover, it is generally agreed that tender house inoculations of male and female ßowers used greenhouse seedlings, such as those used in caged different Þeld isolates, and the isolates differed in the bioassays, are far more susceptible to wilt disease than amount of time that they were cultured and stored in Þeld hardened mature plants (Rand and Endlows the laboratory. Our casual observations over the last 1920). Early in the growing season when A. vittatum 7 yr have indicated that isolates can vary in virulence populations are small, males release aggregation pher- and that virulence tends to decrease with culturing omones when feeding on the leaves of cucurbit seed- and storage. However, even if the three-fold differ- lings that attract both male and female cucumber ence between male and female ßowers in the proba- beetles (Smyth and Hoffmann 2003). This leads to bility of contracting wilt disease is not an artifact, we concentrated feeding on some seedlings. Brust suspect that plants are more likely to contract wilt (1997b) observed that wilt disease is more likely to disease through male ßowers under Þeld conditions occur on seedlings where concentrated feeding oc- because (1) Texas gourds (and C. pepo in general) curs. These Þndings suggest that the dosage of E. produce approximately seven male ßowers for every tracheiphila is important for disease transmission un- female ßower (Avila-Sakar et al. 2001; Stephenson der Þeld conditions. As Cucurbita plants grow, how- et al. 2004); (2) male ßowers are oriented vertically ever, foliar feeding becomes less concentrated (Du (frass accumulates on the bottom of the ßower near et al. 2008) and, perhaps, the leaves become more the nectaries), whereas female ßowers are oriented resistant to E. tracheiphila invasion. However, cucum- horizontally; (3) male ßowers attract signiÞcantly ber beetles are attracted to the ßowers of C. pepo over more beetles per ßower than female ßowers that relatively long distances (Andersen and Metcalf 1986, would increase both exposure to and the amount of E. Lampman et al. 1987, Lampman and Metcalf 1988) tracheiphila in male ßowers; and (4) beetles chew the where they aggregate to mate and feed. Although our Þlaments of the anthers (which brings the beetles into real-time PCR analyses of E. tracheiphila on ßoral February 2010 SASU ET AL.: FLORAL TRANSMISSION OF E. tracheiphila BY CUCUMBER BEETLES 147 tissue provide no quantitative measure of the dose of (Burr.) Winslow et al.: a mini review. Plant Syst. Evol. 238: E. tracheiphila found in ßowers, we suspect that the 183Ð194. aggregation of cucumber beetles in ßowers effectively Cormack R. S., I. E. Somssich, and K. Hahlbrock. 1998. Iso- concentrates the frass (and consequently E. tra- lation of putative plant transcriptional coactivators using cheiphila) from many beetles in the vicinity of the a modiÞed two-hybrid system incorporating a GFP re- nectaries, which, in turn, provides access to the vas- porter gene. Plant J. 14: 685Ð692. cular system that supplies the nectaries. If true, this Decker, D. S., and H. D. Wilson. 1987. Allozyme variation in Cucurbita pepo complex C. pepovar. overifera vs. C. second mode of transmission would play a key role in texana.. Syst. Bot. 12: 263Ð273. the maintenance of wilt disease epidemics in Þelds at Decker-Walters, D. S. 1990. Evidence for multiple domes- a time when the plants are becoming more resistant to tication of Cucurbita pepo. Evidence for multiple domes- foliar transmission of E. tracheiphila. tication of Cucurbita pepo, pp. 96Ð101. In D. M. Bates, Finally, our previous studies (Stephenson et al. R. W. Robinson, and C. Jeffrey (eds.). Biology and uti- 2004; Ferrari et al. 2007; Du et al. 2008) showed that lization of the Cucurbitaceae. Cornell University Press, inbred Texas gourds experienced greater leaf damage Ithaca, NY. by cucumber beetles than outbred gourds but had a Decker-Walters, D. S., J. E. Straub, S-M. Chung, E. Nakata, lower incidence of wilt diseaseÑa disease that was and H. D. Quemada. 2002. Diversity in free-living pop- only known to be transmitted through foliar feeding. ulations of Cucurbita pepo (Cucurbitaceae) as assessed by Transmission of E. tracheiphila through ßoral nectaries random ampliÞed polymorphic DNA. Syst. Bot. 27: 19Ð28. resolves this conundrum. The outbred plants pro- De Mackiewicz, M Blua, S. J. Fleischer, F. L. Lukezic, and F. E. Gildow. 1998. Herbaceous weeds are not impor- duced signiÞcantly more ßowers than the inbred tant reservoirs of Erwinia tracheiphila. Plant Dis. 82: 521Ð plants (which would increase the frequency of expo- 529. sure). Moreover, we showed that the ßowers of the Du, D., J. A. Winsor, M. Smith, A. DeNicco, and A. G. outbred plants produce signiÞcantly more of the vola- Stephenson. 2008. Resistance and tolerance to her- tiles that are known to attract cucumber beetles to the bivory changes with inbreeding and ontogeny in a wild ßowers (Ferrari et al. 2006), which, in turn, would gourd (Cucurbitaceae). Am. J. Bot. 95: 84Ð92. increase both exposure to and the dose of E. tra- Eben, A., and M. E. Barbercheck. 1996. Field observations cheiphila in the ßowers. on host plant associations and enemies of Diabroticite beetles (Chrysomelidae: Luperini) in Vera Cruz, Mexico. Acta Zool. Mex. 67: 47Ð65. Acknowledgments Ferrari, M. J., C. M. De Moraes, A. G. Stephenson, and M. C. Mescher. 2006. Inbreeding effects on blossom volatiles We thank F. Lichtner for Þeld and greenhouse assistance; in Cucurbita pepo ssp. texana. Am. J. Bot. 93: 1768Ð1774. J. Tumlinson for use of his real-time PCR machine; R. Cyr for Ferrari, M., J. A. Winsor, D. Du, and A. G. Stephenson. 2007. guidance and use of microscopy equipment; K. Geider for the GFP plasmids; B. Oberheim and his staff for use of the Inbreeding alters host plant quality and incidence of an Horticulture Farm at the PSU Experimental Farms at Rock insect borne pathogen in Cucurbita pepo ssp. texana. Int. Springs, PA; and T. Omeis for advice, assistance, and use of J. Plant Sci. 168: 603Ð610. the Biology Greenhouses. This research was supported by Fleischer, S. J., D. de Mackiewicz, F. E. Gildow, and F. L. NSF Grant DEB02-35217 to A.G.S. and J.A.W. Lukezic. 1999. Serological estimates of the seasonal dynamics of Erwinia tracheiphila in Acalymma vittata (Coleoptera: Chrysomelidae). Environ. Entomol. 28: References Cited 470Ð476. Garcia-Salazar, C., F. E. Gildow, S. J. Fleischer, D. Cox- Andersen, J. F., and R. L. Metcalf. 1986. IdentiÞcation of a Foster, and F. L. Lukezic. 2000. Alimentary canal of volatile attractant for Diabrotica (Coleoptera, Chry- adult Acalymma vittata (Coleoptera: Chrysomelidae): somelidae) and Acalymma (Coleoptera, Chrysomelidae) morphology and potential role in survival of Erwinia spp from blossoms of Cucurbita maxima Duchesne. tracheiphyla (Enterobacteriaceae). Can. Entomol. 132: J. Chem. Ecol. 12: 687Ð699. 1Ð13. Andersen, J. F., and R. L. Metcalf. 1987. Factors inßuencing Hayes, C. N., J. A. Winsor, and A. G. Stephenson. 2004. distribution of Diabrotica Spp (Coleoptera, Chyrsomeli- dae) in blossoms of cultivated Cucurbita spp. J. Chem. Inbreeding inßuences herbivory in Cucurbita pepo ssp Ecol. 13: 681Ð699. texana (Cucurbitaceae). Oecologia (Berl.) 140: 601Ð608. Avila-Sakar, G., G. A. Krupnick, and A. G. Stephenson. 2001. Kim, W. S., L. Gardan, S. L. Rhim, and K. Geider. 1999 Resource allocation to growth and reproduction in Erwinia pyrifoliae sp. Nov., a novel pathogen that affects Cucurbita pepo ssp. texana: effects of fruit removal. In- Asian pear trees (Pyrus pyrifolia Nakai). Int. J. Syst. Bac- ternat. J. Plant Sci. 162: 1089Ð1095. teriol. 49: 899Ð905. Brust, G. E. 1997a. Interaction of Erwinia tracheiphila and Lampman, R. L., and R. L. Metcalf. 1988. The comparative muskmelon plants. Environ. Entomol. 26: 849Ð854. response of Diabrotica species (Coleoptera, Chrysomeli- Brust, G. E. 1997b. Seasonal variation in percentage of dae) to volatile attractants. Environ. Entomol. 7: 644Ð648. striped cucumber beetles (Coleoptera: Chrysomelidae) Lampman, R. L., R. L. Metcalf, and J. F. Andersen. 1987. that vector Erwinia tracheiphila. Environ. Entomol. 26: Semiochemical attractants of Diabrotica undecimpunctata 580Ð584. Howardi Barber, Southern corn rootworm, and Di- Brust, G. E. 1997c. Differential susceptibility of pumpkins to abrotica virgifera virgifera Leconte, the Western corn bacterial wilt related to plant growth stage and cultivar. rootworm (Coleoptera, Chrysomelidae). J. Chem. Ecol. Crop Protect. 16: 411Ð414. 13: 959Ð975. Buba´n, T., Zs. Orosz-Kova´cs, and A´ . Farkas. 2003. The nec- Leach, J. G. 1964. Observations on cucumber beetles as vec- tary as the primary site of infection by Erwinia amylovora tors of cucurbit wilt. Phytopathology 54: 606Ð607. 148 ENVIRONMENTAL ENTOMOLOGY Vol. 39, no. 1

Lira, R., T. C. Andres, and M. Nee. 1995. Cucurbita, pp. Rand, F. V., and E.M.A. Endlows. 1920. Bacterial wilt of 1Ð115. In R. Lira (ed.), Systematic and ecogeographic cucurbits. U.S. Dep. Agric. Bull. 828. United States De- studies on crop genepools. Volume 9. International Plant partment of Agriculture, Washington, DC. Genetic Resources Institute, Rome, Italy. SAS Institute. 2002. SAS userÕs guide. SAS Institute, Cary, Lukezic, F. L., W. M. Sackett, S. J. Fleischer, M. D. Orzolek, NC. and F. E. Gildow. 1996. Inßuence of concentration of Smyth, R. R., and M. P. Hoffmann. 2003. A male-produced Erwinia tracheiphila cells on the development of wilt aggregation pheromone facilitating Acalymma vittatum F. symptoms in Þeld-grown cucumbers and cantaloupe (Coleoptera: Chrysomelidae) early-season host plant col- plants. Phytopathol. Abstr. 86: S123. onization. J. Insect. Behav. 16: 347Ð359. Metcalf, R. L., and A. M. Rhodes. 1990. Coevolution of Cu- Stephenson, A. G., B. Leyshon, S. E. Travers, C. N. Hayes, and curbitaceae and Luperini (Coleoptera: Chrysomelidae): J. A. Winsor. 2004. Interrelationships among inbreeding, basic and applied aspects, pp. 167Ð182. In D. M. Bates, herbivory, and disease on reproduction in a wild gourd. R. W. Robinson, and C. Jeffrey (eds.), Biology and uti- Ecology 85: 3023Ð3034. Tallamy, D. W. 1985. Squash beetle feeding behavior: an lizaton of the Cucurbitaceae. Cornell University Press, adaptation against induced cucurbit defenses. Ecology Ithaca, NY. 66: 1574Ð1579. Metcalf, R. L., and R. L. Lampman. 1991. Evolution of di- Tallamy, D. W., and V. A. Krischik. 1989. Variation and abroticite rootworm beetle (Chrysomelidae) receptors function of cucurbitacins in Cucurbita: an examination of for Cucurbita blossom volatiles. Proc. Nat. Acad. Sci. current hypotheses. Am. Nat. 133: 766Ð786. U.S.A. 88: 1869Ð1872. Thomson, S. V. 1986. The role of the stigma in Þre blight Mitchell, R. F., and L. M. Hanks. 2009. Insect frass as a infection. Phytopathology 76: 476Ð482. pathway for transmission of bacterial wilt of cucurbits. Winsor, J. A., S. Peretz, and A. G. Stephenson. 2000. Pollen Environ. Entomol. 38: 395Ð403. competition in a natural population of Cucurbita foetidis- Nepi, M., F. Ciampolini, and E. Pacini. 1996. Development sima (Cucurbitaceae). Am. J. Bot. 87: 527Ð532. and ultrastructure of Cucurbita pepo nectaries of male Yao, C. B., G. Zehnder, E. Bauske, and J. Klopper. 1996. ßowers. Ann. Bot. 78: 95Ð104. Relationship between cucumber beetle (Coleoptera: Quesada, M. R., K. Bollman, and A. G. Stephenson. 1995. Chrysomelidae) density and incidence of bacterial wilt of Leaf damage decreases pollen production and hinders cucurbits. J. Econ. Entomol. 89: 510Ð514. pollen performance in Cucurbita texana. Ecology 76: 437Ð 443. Received 10 July 2009; accepted 25 September 2009.