Phylogenetic Analysis of Several Thermus Strains from Rehai of Tengchong, Yunnan, China

881

Phylogenetic analysis of several Thermus strains from Rehai of Tengchong, Yunnan, China

Lianbing Lin, Jie Zhang, Yunlin Wei, Chaoyin Chen, and Qian Peng

Abstract: Several Thermus strains were isolated from 10 hot springs of the Rehai geothermal area in Tengchong, Yunnan province. The diversity of Thermus strains was examined by sequencing the 16S rRNA genes and comparing their sequences. Phylogenetic analysis showed that the 16S rDNA sequences from the Rehai geothermal isolates form four branches in the phylogenetic tree and had greater than 95.9% similarity in the phylogroup. Secondary structure comparison also indicated that the 16S rRNA from the Rehai geothermal isolates have unique secondary structure characteristics in helix 6, helix 9, and helix 10 (reference to Escherichia coli). This research is the first attempt to reveal the diversity of Thermus strains that are distributed in the Rehai geothermal area. Key words: Thermus, diversity, phylogenetic analysis, RNA secondary structure.

Résumé : Plusieurs souches de Thermus ont été isolées de sources d’eau chaude dans la région géothermique de Re- hai, comté de Tengchong, province de Yunnan. La diversité des souches de Thermus a été examinée par séquençage des gènes codant les ARNr 16S et comparaison de leurs séquences. L’analyse phylogénique a démontré que les séquen- ces des ADNr 16S des isolats géothermiques de Rehai forment quatre branches dans l’arbre phylogénique (plus de 95,9 % de similarité est retrouvée au sein d’un groupe phylogénique). La comparaison des structures secondaires a aussi indiqué que les ARNr 16S des isolats géothermiques de Rehai ont des caractéristiques uniques au sein de la structure secondaire des hélices 6, 9 et 10, si on les compare à Escherichia coli. Cette recherche constitue la première tentative visant à révéler la diversité des souches de Thermus distribuées dans les régions géothermiques de Rehai. Mots clés : Thermus, diversité, analyse phylogénique, structure secondaire des ARN. [Traduit par la Rédaction] Lin et al. 886

Introduction 1995). Recently, several Thermus strains have been isolated and reported by us from the hot springs of the Rehai geo- In China, high-temperature geothermal resources are pri- thermal area (Lin et al. 2002; Guo et al. 2003) hot springs. marily located in Tibet, western Yunnan, and western Sichuan At the time of writing this paper, eight valid species of the provinces. The Tengchong hot springs is the only volcanic genus Thermus have been published: T. aquaticus, geothermic region in Yunnan province. About 20 boiling T. thermophilus, T. filiformis, T. scotoductus, T. brockianus, springs distributed in three sites are located in the Tengchong T. oshimai, T. igniterrae, and T. antranikianii (Chung et al. Rehai geothermal area (Tong and Zhang 1989; Liao and 2000; da Costa et al. 2001). Phylogenetic analysis of the 16S Zhao 1999). The water chemistry is mainly HCO3-Cl-Na rRNA genes and a comparison of their secondary structure type and Cl-HCO3-Na type; the pH value ranges from 1.5 to has been shown as a useful tool for the determination of 10.5. Since 1969, many thermophilic bacterial strains have Meiothermus spp. (Chen et al. 2003). Based on the phylo- been isolated from natural and artificial environments (Brock genetic analysis and a comparison of secondary structures in and Freeze 1969; Kristjansson and Alfredsson 1983; hypervariable regions of 16S rRNA gene sequences, we Kristjansson et al. 1994), and many others have even been report the diversity of Thermus spp. in this geothermal area. isolated from abyssal geothermal sites (Marteinsson et al.

Received 7 January 2005. Revision received 27 June 2005. Materials and methods Accepted 4 August 2005. Published on the NRC Research Press Web site at http://cjm.nrc.ca on 8 November 2005. Media L. Lin,1 Y. Wei, and C. Chen. Biotechnology Research Based on the medium described by Wiegel, the modified Center, Faculty of Biological and Chemical Engineering, medium (MD) was prepared as follows (Wiegel 1986). Bailong campus, Kunming University of Science and Nitrilotriacetic acid, 100 mg; NaCl, 8 mg; Na2HPO4, 111 mg; Technology (KUST), Kunming, 650224, P.R. China. MgSO4·7H2O, 100 mg; KNO3, 103 mg; NaNO3, 689 mg; J. Zhang. Department of Biotechnology, School of Life Na2MoO4·2H2O, 0.025 mg; FeCl3, 0.28 mg; CuSO4, 0.016 mg; Science, Yunnan University, Kunming, 650091, P.R. China. MnSO4·H2O, 2.2 mg; H3BO3, 0.5 mg; ZnSO4·7H2O, 0.5 mg; Q. Peng. The Key Laboratory for Microbial Resources of CoCl ·6H O, 0.046 mg; CaSO ·H O, 60 mg; tryptone, 1 g; Ministry of Education, P.R. China, Yunnan Institute of 2 2 4 2 and yeast extract, 1 g, were weighed. The ddH2O was added Microbiology, Yunnan University, Kunming, 650091, P.R. up to 1000 mL, and the pH value was adjusted to 7.8–8.0 China. with 3 mol NaOH/L. The medium was autoclave at 121 °C 1Corresponding author (e-mail: [email protected]). for 40 min.

Isolation of bacterial strains Fig. 1. Neighbor-joining tree of Thermus spp. 16S rDNA. The As described by Chung et al. (2000), 100 mL of water Thermus isolates from Rehai are underlined. Four branches was filtered through membrane filters (Gelman type GN-6; formed by strains from Tengchong were labeled A, B, C, and D. pore size 0.45 µm, diameter 47 mm), which were placed on A total of 1000 bootstrap replicates were performed. The se- the surface of MD agar plates containing 4% agar. These quences of Meiothermus were used as the outgroups in the preparations were wrapped in plastic bags and incubated at phylogenetic analysis. 70 °C for 4 days. Cultures were purified by subculturing the laboratory and were preserved at –70 °C in MD containing 15% glycerol.

16S rRNA gene sequence determination and phylogenetic analyses The following primers of 16S rRNA gene were designed according to Robb and Place (1995): forward primer c1 (39 bases including a polylinker) 5′-GCGGATCCGCGGCCG CTGCAGAGTTTGATCCTGGCTCAG-3′ and reverse primer c2 (37 bases including a polylinker) 5′-GGCTCGAGCGGC CGCCCGGGTTACCTTGTTACGACTT-3′, complementing positions 8–27 and 1510–1492, respectively, of Escherichia coli 16S rRNA. PCR amplification of the 16S rRNA gene was carried out in a thermocycler (iCYCLE) using the La Taq PCR kit (Takara Bio Inc., Japan). The temperature pro- file was set as follows: 1 cycle at 95 °C for 5 min, 30 cycles each (94 °C for 30 s, 55 °C for 30 s, 68 °C for 30 s), 1 cycle at 68 °C for 15 min, and a final soak at 4 °C for 15 min. The PCR product was ligated with pCR4-TOPO vector using the 02, RH-1214, and RH-1514 (Guo et al. 2003), were isolated TOPO TA cloning Kit (Invitrogen, USA). A reaction solu- from Rehai, Tengchong. tion (2 µL) was transformed into the competent cell TOPO10. The recombinant plasmid was isolated using the 16S rRNA secondary structure prediction Qiaprep spin Miniprep kit. Sequences were finished by Shi- The 16S rRNA secondary structures were predicted by us- madzu corporate and the full length sequences were assem- ing free-energy minimization algorithm with the program bled by program Editseq 4.01 and Seqman 4.03 (DNASTAR RNA Structure 3.71 (Mathews et al. 1999) at positions from Inc., Madison, Wisconsin, USA). The 16S rDNA sequences 70 to 100 and from 178 to 220 (refer to the positions in the obtained in this study were aligned against previously deter- E. coli 16S rRNA). Program RnaViz (De Rijk and De Wachter mined sequences in the public databases by BLASTn 1997) was used to display the model structures. The struc- (BLASTn 2.2.9 program in NCBI. The 16S rDNA sequences tures of helix 6, helix 9, and helix 10 focused on the appear- of other species of Thermus and (or) Meiothermus (Nobre et ance of their internal loop, terminal loop, and the number of al. 1996; Chung et al. 2000) available from the public data- base pairs in the helix. bases were chosen for phylogenetic analysis. A phylogenetic dendrogram was generated by using the treeing algorithm Results contained in the ClustalX v1.8 (Thompson et al. 1997) and TreeView v1.5 package (Page 1996). Isolation of strains and morphological characteristics Twenty isolates were obtained from water samples from 10 hot spring. These isolates formed yellow or orange, round, Nucleotide sequence accession numbers smooth colonies with a diameter of 2–4 mm. Short rods of The strain designations and accession numbers of the 16S 0.5–0.8 µm in width and 3.0–8.0 µm in length were seen by rDNA and 16S rRNA reference sequences used in the phylo- phase-contrast microscopy. These strains were not motile genetic and secondary structure analyses are Meiothermus and no spores were produced. In this study, six strains ruber DSM 1279T, L09672; M. cerbereus GY-1T or DSM (named RH-0401 to RH-0406) isolated from different hot 11376, Y13594; M. chliarophilus ALT-8T or DSM 9957T, springs were selected for 16S rRNA gene sequence determi- X84212; M. silvanus VI-R2T or DSM 9946T, X84211; nation and analysis. M. taiwanensis WR-220, AF418002; T. oshimai SPS-17T, Y18416; T. igniterrae RF-4T, Y18406; T. brockianus 15038T, 16S rRNA gene sequence determination and analysis Y18409; T. aquaticus YT-1T, L09663; T. antranikianii HN3-7T, The almost complete 16S rRNA gene sequences approxi- Y18415; T. scotoductus ITI-252T, Y18410; T. thermophilus mate to 1475 nucleotides were determined for the six HB8T, X07998; T. filiformis Wai33.AlT, L09667; “T. rehai” Thermus strains. Then the sequences were deposited into RH99-02, AF331969; RH-1214, AF6521187; RH-1514, NCBI GenBank under accession Nos. AY731822 for RH- AF521188; RH-0401, AY731822; RH-0402, AY731823; 0401, AY731823 for RH-0402, AY731824 for RH-0403, RH-0403, AY731824; RH-0404, AY731825; RH-0405, AY731825 for RH-0404, AY731826 for RH-0405, and AY731826; RH-0406, AY731827. Nine strains, RH-0401, Y731827 for RH-0406. The sequences were aligned against RH-0402, RH-0403, RH-0404, RH-0405, RH-0406, RH99- other sequences in the public databases by the BLASTn pro-

Fig. 2. Comparative secondary structures of the nine 16S rRNAs from Rehai geothermal area and some other Thermus species at positions 178–220 (positions and helix numbers refer to Escherichia coli).

gram. The 16S rRNA gene sequence similarity values close to T. brockianus (similarity 99%). These four mono- among the nine strains isolated from the Rehai geothermal phyletic branches were supported with bootstrap values of area and the other validly described Thermus species were in 95.9%, 98.9%, 98.0%, and 98.5%, respectively. a range of 92%–99%. Phylogenetic analysis showed that the partial Thermus 16S rDNA sequences from the Rehai geo- Secondary structure comparison thermal area formed four branches in the phylogenetic tree Comparison of the 16S rRNA secondary structures showed (Fig. 1). Branch A included strains RH-0406 and RH-0405, that the strains RH-1214, RH-1514, RH99-02, RH-0401, and which was close to T. oshimai (similarity 98%). Branch B RH-0402 had unique structural features at positions 178–220 included strains RH-0403 and RH-0404, which clustered (Fig. 2). At positions 178–198 (helix 9) characterized by the with “T. rehai” (similarity 99%), and their similarity to appearance of the internal loop (four bases), these were T. thermophilus was 97%. Branch C included strains RH- more similar to T. filiformis than to other taxa of genus 1214 and RH-1514 and appeared to form the monophyletic Thermus. But there were differences in the number of base branch among other Thermus species (similarity 96%). pairs of the helix region between the internal loop and the Branch D included RH-0401 and RH-0402 and was very terminal loop. Another helix (helix 10) at positions 199–220

© 2005 NRC Canada 884 Can. J. Microbiol. Vol. 51, 2005 a Secondary structure characteristics ber of bases in the terminal loop. The num- spp. Terminal loop Nucleic acid sequence Thermus Internal loop a Secondary structure characteristics Helix 6 Helix 9 Helix 10 GG—GTAGGTTTATGCCT—-ACCCGG—GCAGGTTTATACCT—-GTTCGGCTGCGGGGTTTTACTCCGTGGTC 8(4)GGCCGCGGGGTTTTACTCCGTGGTC 8(4)GG——GTGGTTCGCCAC——-CC 8(5)[4] 10(5) 6(4) UGUG UUUGGGCCGTGGGGTATCTCAC—-GGTCGGCCGTGGGGTATCTCAC—-GGTC UGUG GGG-TGAAGAG-CCCGGGCCATGGGGTTTTACTCCGTGGTC UGUG 9(4) 9(4) GGGGTGGATAGCCCCG 10(5) 4(5) GGG-TGGATAGCCC-G 5(5) CUUG 4(5) GGG-CTTTG—-CCCG GGCC—-AAAAGCC-G 4(3) 3(5) UGUG UGUG UGUG GGGTT—-TTGCCC-G GGGTG-ACGAG-CCCG GGGC—GAGAG-TCCG 3(5) 4(5) 4(4) ” GGCCGTGGGGAATCTCAC—-GGTC 9(4) GUGU UGUG GGGGTTTAGATCCC-G 4(6) T. rehai T. antranikianii T. scotoductus T. filiformis T. thermophilus T. oshimai T. aquaticus T. igniterrae T. brockianus Comparison of special fragments of 16S rDNAs and their secondary structure at helices 6, 9, and 10 in The number outside the parentheses and square brackets indicates the number of base pairs in the helix. The number in the parentheses indicates the num a ber in the square brackets indicates the number of bases in the internal loop. Table 1. Branch— Species— — — A A Nucleic acidA sequence B“ B RH-0405B RH-0406CC RH-0403— RH-0404— GG——GTGGTTCGCCAC——-CC RH-1214D GG——GTGGTTCGCCAC——-CC RH-1514DD GGCCGTGGGGTATCTCAC—-GGTC 6(4) GGCCGTGGGGTATCTCAC—-GGTC 6(4) GGCCGTGGGGTATCTCAC—-GGTC 9(4) RH-0401 GGCCGTGGGGTATCTCAC—-GGTC 9(4) RH-0402 9(4) 9(4) GGCCATGGGGTTTTACTCCGTGGTC GGCCATGGGGTTTTACTCCGTGGTC 10(5) 10(5) GUGU CCUG GUGU UGUG UUGUG CCUG GGCC—-AAACGCC-G UUGUG CCUG GGCC—-AAACGCC-G GUGU GGGGC—-GA-CCC-G GUGU GGGGC—-GA-CCC-G GGGGTTTAGATCCC-G 3(5) GGGGTTTAGATCCC-G UGUG 3(5) 3(4) UGUG 4(6) 3(4) 4(6) GGGCC-GAGGGGTCTG GGGC—GAGAG-TCCG 5(4) 4(4)

© 2005 NRC Canada Lin et al. 885 consisted of a different shorter helix region, and the se- tively. Thermus brokianus strains were firstly discovered in quences of the terminal loop varied from species to species. Yellowstone National Park, and similar strains have also been Analysis of the structure of helix 6 was conducted but not found in New Mexico, Portugal, and the Azores. These results shown in this paper. In helices 6, 9 and 10 the differences in indicated that factors other than mere geographical isolation the secondary structures and nucleic acid sequences were might play important roles in the colonization of hot springs prominent (Table 1). Based on the secondary structures of by different Thermus species (Williams et al. 1996). helices 6, 9, and 10, a key to the species was proposed. Ac- In the Rehai geothermal area, the water chemistry is main- cording to the key, the nine strains from Tengchong fall into ly HCO3-Cl-Na type and Cl-HCO3-Na type and the pH value branches A, B, C, and D. This result is consistent with the ranges from 1.5 to 10.5. This varied chemical characteristics comparison of the similarity of the 16S rDNA molecules. may be the main reason for the distribution of Thermus The key was shown as follows: strains. The phylogenetic tree that was obtained showed that all nine 16S rRNA sequences of Thermus strains from the 1. Helix 6, 6 (4) Branch A Rehai geothermal area fell into four distinct groupings. The a. Helix 9, STL (CCUG) T. oshimai phylogenetic diversity was also demonstrated by the com- b. Helix 9, SIL (UGUG) RH-0405, RH-0406 parison of the 16S rRNA secondary structure. Based on the 2. Helix 6, 9 (4) secondary structure of helices 6, 9, and 10, a key was pro- a. Helix 10, 4 (6) Branch B posed to classify the Thermus species. According to this key, a) Helix 9, Internal loop (+) “T. rehai” those nine strains from Rehai also fell into branches A, B, C, b) Helix 9, Internal loop (–) RH-0403, RH-0404 and D. These results demonstrated that the comparison of b. Helix 10, 3 (4) Branch C (RH-1214, RH-1514) the 16S rRNA sequence of hypervariable regions combined c. Helix 10, 3 (5) T. aquaticus with the secondary structure analysis should be a very useful d. Helix 10, 4 (5) T. igniterrae tool to identify the Thermus species. These nine Tengchong 3. Helix 6, 10 (5) Rehai strains were isolated from hot springs with different a. Helix 10, 4 (3) T. thermophilus pH values and water temperature. For the further investiga- b. Helix 10, 4 (4) or 5 (4) Branch D tion of the diversity of Thermus spp. in Rehai hot springs, a) Helix 9, Internal loop (+) RH-0401, RH-0402 the chemical composition of the hot spring may be a useful b) Helix 9, Internal loop (–) T. brockianus clue to determine what influences the distribution of Thermus 4. Helix 6, 8 (4) strains. a. Helix 10, 5(5) T. antranikianii b. Helix 10, 4(5) T. scotoductus 5. Helix 6, 8 [4](5) T. filiformis Acknowledgements or Helix 10, 4(5), Helix 9, Internal loop (+) T. filiformis This research was funded by the National Natural Science Foundation of China (Project No. 30360004). Part of this In the key, the number outside of the parentheses and research was done in the Institute for Chemical Research, square brackets indicates the number of base pairs in the he- Kyoto University. We are grateful to Professor Nobuyoshi lix. The number in parentheses indicates the number of base Esaki for help. sequences in the terminal loop. The number in the square brackets indicates the number of base sequences in the internal loop. The “STL” indicates the sequence of bases of the References terminal loop. The “SIL” indicates the sequence of bases of the internal loop. The opening quote indicates the appear- Chen, C., Lin, L., Peng, Q., Ben, K., and Zhao, S. 2002. Meio- ance of the internal loop in the helix. The closing quote indi- thermus rosaceus sp. nov. isolated from Tengchong Rehai in cates the disappearance of the internal loop in the helix. Yunnan, China. FEMS Microbiol. Lett. 216: 263–268. Chen, C., Zhao, S., and Ben, K. 2003. Phylogenetic analysis of the family Thermaceae with an emphasis on signature position and Discussion secondary structure of 16S rRNA. FEMS Microbiol. Lett. 221: The Rehai geothermal area is one of the most famous vol- 293–298. canic geothermic regions in China. Previous research had Chung, A.P., Rainey, F.A., Valente, M., Nobre, M.F., and da Costa, M.S. 2000. Thermus igniterrae sp. nov., and Thermus antran- shown that some of the Thermus spp. were identified in ikianii sp. nov., two new species from Iceland. Int. J. Syst. Evol. those hot springs with water temperatures ranging from 50 Microbiol. 50: 209–217. to 80 °C and with pH ranging from neutral to alkaline. The da Costa, M.S., Nobre, M.F., and Rainey, F. 2001. Genus 1. Thermus. Meiothermus strains (Chen et al. 2002) and thermoacido- In Bergey’s manual of systematic bacteriology. 2nd ed. Vol. 1. philic archaeon Sulfolobus tengchongensis strains have also The archaea and the deeply branching and phototrophic bacteria. been isolated from hot springs (Xiang et al. 2003) in this Edited by D.R. Boone and R.W. Castenholz. Springer Verlag, area. da Costa et al. (2001) proposed that chemical and bio- New York. pp. 404–414. logical parameters of the hydrothermal area are two impor- De Rijk, P., and De Wachter, R. 1997. RnaViz, a program for the tant factors for the distribution of Thermus species over the visualization of RNA secondary structure. Nucleic Acids Res. globe. The number of Thermus species is widely distributed, 25: 4679–4684. but others have a circumscribed geographical distribution. Guo, C., Wang, T., Zhu, W., Zhang, D., Cui, X., Xu, L., and Peng, Q. Strains of T. filiformis and T. aquaticus were only isolated 2003. The phylotype of Thermus from Rehai geothermal area, from New Zealand and Yellowstone National Park, respec- Tengchong, China. J. Microbiol. 41: 152–156.

Kristjansson, J.K., and Alfredsson, G.A. 1983. Distribution of Thermus philus comb. nov., respectively, and emendation of the genus spp. in Icelandic hot springs and a thermal gradient. Appl. Envi- Thermus. Int. J. Syst. Bacteriol. 46: 604–606. ron. Microbiol. 45: 1785–1789. Page, R.D.M. 1996. Treeview: an application to display phylogen- Kristjansson, J.K., Hjoirleifsdottir, S., Marteinsson, V.T., and etic trees on personal computers. Comput. Appl. Biosci. 12: Alfredsson, G.A. 1994. Thermus scotoductus,sp.nov.,apigment- 357–358. producing thermophilic bacterium from hot tap water in Iceland Robb, F.T., and Place, A.R. 1995. Archaea thermophiles: a labora- and including Thermus sp. X-1. Syst. Appl. Microbiol. 17: 44– tory manual. Cold Spring Harbor Laboratory Press, Cold Spring 50. Harbor, New York. pp. 202–204. Liao, Z.J., and Zhao, P. 1999. Yunnan Tibet geothermal belt- Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., and geothermal resources and case histories. Science Press, Beijing. Hinggis, D.G. 1997. The CLUSTAL X windows interface: flexi- Lin, L., Chen, C., Peng, Q., Ben, K., and Zhou, Z. 2002. Thermus ble strategies for multiple sequence alignment aided by quality rehai sp. nov. isolated from Tengchong Rehai in Yunnan, China. analysis tools. Nucleic Acids Res. 25: 4876–4882. J. Basic Microbiol. 42: 337–344. Tong, W., and Zhang, M.T. 1989. Tengchong Hot Spring. Science Marteinsson, V.T., Birrien, J.L., Kristjansson, J.K., and Prieur, D. Press, Beijing. 1995. First isolation of thermophilic aerobic non-sporulating hetero- Wiegel, J. 1986. Methods for isolation study of thermophiles. In trophic bacteria from deep-sea hydrothermal vents. FEMS Thermophiles general, molecular and applied microbiology. Edited Microbiol. Ecol. 18: 163–174. by T.D. Brock. John Wiley & Sons, New York. Mathews, D.H., Sabina, J., Zuker, M., and Turner, D.H. 1999. Ex- Williams, R.A.D., Smith, K.E., Welch, S.G., and Micallef, J. 1996. panded sequence dependence of thermodynamic parameters im- Thermus oshimai sp. nov., isolated from hot springs in Portugal, proves prediction of RNA secondary structure. J. Mol. Biol. Iceland and the Azores, and comment on the concept of a lim- 288: 911–940. ited geographical distribution of Thermus species. Int. J. Syst. Nobre, M.F., Truper, H.G., and Da Costa, M.S. 1996. Transfer of Bacteriol. 46: 403–408. Thermus ruber (Loginova et al. 1984), Thermus silvanus (Ten- Xiang, X., Dong, X., and Li, H. 2003. Sulfolobus tengchongensis reiro et al. 1995), and Thermus chiliarophilus (Tenreiro et al. sp. nov., a novel thermoacidophilic archaeon isolated from a hot 1995) to Meiothermus gen. nov. as Meiothermus ruber comb. spring in Tengchong, China. Extremophiles, 7: 493–498. nov., Meiothermus silvanus comb. nov., and Meiothermus chilaro-