DOCSLIB.ORG

In Human Erythrocytes (Red Cell/Metabolism/Membrane) E

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
In Human Erythrocytes (Red Cell/Metabolism/Membrane) E Proc. Nati. Acad. Sci. USA Vol. 75, No. 6, pp. 2825-2828, June 1978 Cell Biology Existence of only a single functional pool of adenosine triphosphate in human erythrocytes (red cell/metabolism/membrane) E. BEUTLER, E. GUINTO, W. KUHL, AND F. MATSUMOTO Department of Hematology, City of Hope Medical Center, Duarte, California 91010 Contributed by Ernest Beutler, March 21, 1978 ABSTRACT The question of whether separate "membrane" sium-ATPase activity exerted on 32P-labeled ATP by pre- and "soluble" pools of ATP exist in erythrocytes has been ex- treatment in the cold with nonradioactive ATP (2) have been amined. Phosphoglycerate kinase (EC 2.7.2.3)derived ("mem- cited as evidence for the existence of two ATP pools. However, brane") ATP was labeled by short-term incubation with inor- ganic [32P]phosphate. Pyruvate kinase (EC 2.7.1.40)derived a study of phosphoglycerate kinase-deficient erythrocytes failed ("soluble") ATP is not labeled under these circumstances. The to show any decrease in ion pumping (4). specific activity of the 'y-phosphate of "soluble" ATP was then We have now devised a technique that allows us to examine evaluated by the addition of 2-deoxyglucose and measurement under more physiological circumstances the possible existence of the specific activity of 2-deoxyglucose-6432Plphosphate of two ATP pools in erythrocytes. This method depends upon formed. This specific activity was essentially the same as the the fortunate circumstance that the inorganic phosphate con- overall specific activity of erythrocyte ATP y-phosphate, indi- cating that no functional pools of phosphoglycerate kinase- sumed during glycolysis is quickly incorporated into the y- derived and pyruvate kinase-derived ATP exist in erythro- phosphate of ATP formed in the phosphogylycerate kinase cytes. reaction. In contrast, the phosphate transferred from phos- phoenolpyruvate to ADP is derived almost entirely from Lacking nucleus, mitochondria, and other intracellular or- phosphate esterified to glucose in the early stages of glycolysis ganelles, the erythrocyte was long considered to be a simple, (Fig. 1). Thus, it is possible to selectively label ATP formed in single metabolic unit. However, the association of certain gly- the phosphoglycerate kinase reaction with [32P]phosphate. The colytic enzymes with the erythrocyte membrane (1) spawned specific activity of the putative soluble ATP pool may readily an interesting hypothesis. It was proposed that two pools of ATP be estimated by measuring the labeling of 2-deoxyglucose exist in erythrocytes and that a membrane-associated pool of phosphorylated in the hexokinase reaction to its nonmetaboliz- ATP is preferentially involved in the pumping of sodium and able derivative, 2-deoxyglucose-6-phosphate. potassium ions. The ATP in this pool would be replenished by the action of phosphoglycerate kinase (EC 2.7.2.3) (2-5). A MATERIALS AND METHODS second, soluble pool of ATP, replenished in the pyruvate kinase (EC 2.7.1.40) reaction, presumably provides ATP for phos- Blood from normal human donors was collected in 1 mg of phorylation of glucose in the initial steps of glycolysis. EDTA per ml of erythrocytes and passed through a column of Certain features of this model are attractive. The ATP used microcrystalline cellulose-a-cellulose (8) to remove the leuko- for sodium and potassium transport would be produced in cytes and platelets. The erythrocytes were then washed three proximity to the sitewhere it functions. Moreover, the amount times at 250 in a buffered saline solution prepared by mixing of ATP required for glucose phosphorylation very closely ap- nine parts of 0.154 M NaCl solution with one part of 0.15 M proximates the amount of ADP that is phosphorylated to ATP triethanolamine hydrochloride, pH 7.8 (25°), and containing in the pyruvate kinase step. Attractive as the two-compartment 0.3 mM glucose. Sixty milliliters of a 45% suspension of the model of ATP metabolism in the erythrocyte may be, no direct erythrocytes was prepared in the same buffer and 180,Ci of experimental evidence supports its existence. The purported H32P04 (ICN, Irvine, CA) was added. After 4 min of incuba- existence of a specific linkage between ATPase activity and tion at 370, 20 ml of the erythrocyte suspension was rapidly ATP generated in the phosphoglycerate kinase step was initially transferred into 80 ml of ice-cold 4% perchloric acid. 2.1 ml of based upon the failure of ouabain to inhibit lactate production 2 M 2-deoxyglucose in 0.77 M K2HPO4/0.23 M KH2PO4 was from phosphoenolpyruvate in crude hemolysates. However, immediately added to the remaining 40 ml of the erythrocyte this interpretation failed to take into account the reversibility suspension; after 2 min this suspension was mixed rapidly with of the phosphoglycerate kinase step, and reinterpretation of the 160 ml of ice-cold 4% perchloric acid. The acid-extracted data shows them to be irrelevant to the question of selective erythrocytes were centrifuged in the cold and the supernatant linkage of ATP produced in the phosphoglycerate kinase step was adjusted to pH 7.0 with KOH. Aliquots were removed for to ion pumping (6). Other data that have been presented to measurement of lactate and ATP concentrations (9). The ex- support the existence of a membrane-associated ATP pool are tracts were then diluted with 6 vol of water and applied to quite indirect. For example, the effect of ouabain on crossover Dowex-1 formate (1.5 X 25 cm) columns at a flow rate of 1 plots (7), the lack of effective ion transport in substrate-depleted ml/min. Chromatography was carried out by modifications of erythrocytes in which 2,3-diphosphoglycerate was the source the methods described by Bartlett (10). First each extract was of glycolytic energy (5), and the blocking of sodium-magne- eluted with a 2-liter linear gradient of 0-5 M formic acid/ ammonium formate (4:1) adjusted to pH 2.9 with 5 M ammo- nium formate. The peak containing 2-deoxyglucose-6-phos- The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked phate, eluting just before the inorganic phosphate peak, was "advertisement" in accordance with 18 U. S. C. §1734 solely to indicate pooled and lyophilized. After the sample was reconstituted with this fact. 3.0 ml of water, 0.03 ml of 0.5 M MgCI2, 0.5 ml of 1 M Tris.HCl 2825 Downloaded by guest on September 30, 2021 2826 Cell Biology: Beutler et al. Proc. Nati. Acad. Sci. USA 75 (1978) /Aldolose TPI rNAD G (NADH (1,3-OPG) A-R-P-P DPGM (ADP) I -OOH C-OOH ofmembrane A-R-P-P ATP (ATP) (9 - ® C-® (3-PGA) C - OOH c- @ (2-PGA) C - OH f I ENOLASE I t C -OOH I (PEP) A-R-P-P C-1H2 (ADP) I PK soluble" A-R-P-P ® ATP (ATP) FIG. 1. A portion ofthe glycolytic pathway of erythrocytes showing the manner in which inorganic 32p preferentially enters ATP synthesized in the phosphoglycerate kinase (PGK) reaction. This putative pool of heavily labeled ATP has been designated "membrane" ATP. In contrast, ATP synthesized in the pyruvate kinase (PK) step, designated "soluble" ATP, is labeled only to the extent that 32P has gained access to the large 2,3-diphosphoglycerate (2,3-DPG) pool through the diphosphoglycerate mutase (DPGM) reaction. TPI, triosephosphate isomerase; DPGP, diphosphoglycerate phosphatase; MPGM, monophosphoglycerate mutase; GAP, glyceraldehyde phosphate; GAPD, glyceraldehyde phosphate dehydrogenase; PEP, phosphoenolpyruvate; 3-PGA, 3-phosphoglyceric acid. (pH 8, with 5 mM EDTA), 0.6 unit of glucosephosphate isom- chloride, was added to 0.5 ml of the neutralized fraction and erase and 0.6 units of yeast glucose-6-phosphate dehydrogenase the mixture was incubated at 370 for 2 hr. The pH was then (Sigma Type VII), and 0.03 ml of 100 mM- NADP were added adjusted to between 3 and 4 with 4 M HCl, and the mixture was and the mixture was incubated for 30 min to oxidize glucose- boiled for 1 min. After centrifugation the extract was neutral- 6-phosphate and fructose-6-phosphate to 6-phosphogluconic ized with potassium carbonate, and the 2-deoxyglucose content acid. Ammonium ions were then removed by passing the so- was measured in a volume of 1 ml containing 0.1 M Tris-HCl lution through a column of Dowex-50 in the hydrogen form. (pH 8), 0.5 mM EDTA, 5 mM MgCl2, 2 mM ATP, 1 mM After the mixture was diluted to 150 ml with distilled water, phosphoenolpyruvate, 0.2 mM NADH, 12 units of pyruvate the 2-deoxyglucose-6-phosphate was applied to a 1 X 8 cm kinase, and 20 units of lactate dehydrogenase. After the ab- Dowex-1 column and rechromatographed with a 1-liter gra- sorbance was recorded, at 340 nm, the reaction was started by dient of 0-1 M formic acid. The peaks containing 2-deoxy- the addition of 15 units of yeast hexokinase (Sigma). In this glucose-6-phosphate were lyophilized and dissolved in a small system 1 mole of ADP is formed in the hexokinase reaction for quantity of distilled water, and the 2-deoxyglucose-6-phosphate each mole of 2-deoxyglucose phosphorylated. The ADP is content and radioactivity were determined. 2-Deoxyglucose- measured in the pyruvate kinase reaction linked to the lactate 6-phosphate was measured by hydrolyzing the phosphate group dehydrogenase reaction. One mole of NADH is therefore oxi- with alkaline phosphatase and measuring the ADP formed in dized for each mole of 2-deoxyglucose present. the hexokinase reaction when the 2-deoxyglucose was rephos- ATP was located in the original chromatogram by use of the phorylated.
Load more

Recommended publications
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Yeast As a Tool to Understand the Significance of Human Disease
    G C A T T A C G G C A T genes Review Yeast as a Tool to Understand the Significance of Human Disease-Associated Gene Variants Tiziana Cervelli and Alvaro Galli * Yeast Genetics and Genomics Group, Laboratory of Functional Genetics and Genomics, Institute of Clinical Physiology CNR, Via Moruzzi 1, 56125 Pisa, Italy; [email protected] * Correspondence: [email protected] Abstract: At present, the great challenge in human genetics is to provide significance to the growing amount of human disease-associated gene variants identified by next generation DNA sequencing technologies. Increasing evidences suggest that model organisms are of pivotal importance to addressing this issue. Due to its genetic tractability, the yeast Saccharomyces cerevisiae represents a valuable model organism for understanding human genetic variability. In the present review, we show how S. cerevisiae has been used to study variants of genes involved in different diseases and in different pathways, highlighting the versatility of this model organism. Keywords: yeast; Saccharomyces cerevisiae; functional assays; Mendelian disease; cancer; human gene variants 1. Introduction The advent of next generation DNA sequences technologies allows us to identify Citation: Cervelli, T.; Galli, A. Yeast individual genetic variants, and this revolutionized the strategy for discovering the cause as a Tool to Understand the of several genetic and multifactorial diseases. The association between genetic variants Significance of Human and disease risk can potentially overturn our understanding of common disease. The Disease-Associated Gene Variants. discovery of pathways and processes that are causally involved in a disease, so far not Genes 2021, 12, 1303. https:// linked, may open the way towards the development of targeted therapies and prevention doi.org/10.3390/genes12091303 strategies.
    [Show full text]
  • 2 Points Chem 465 Biochemistry II Test 1 Spring 2017 Multiple Choice
    Name: 2 points Chem 465 Biochemistry II Test 1 Spring 2017 Multiple choice (4 points apiece): 1. Which of the following statements about the oxidative decarboxylation of pyruvate in aerobic conditions in animal cells is correct? A) One of the products of the reactions of the pyruvate dehydrogenase complex is a thioester of acetate. B) The methyl (-CH3) group is eliminated as CO2. C) The process occurs in the cytosolic compartment of the cell. D) The pyruvate dehydrogenase complex uses all of the following as cofactors: NAD+, lipoic acid, pyridoxal phosphate (PLP), and FAD. E) The reaction is so important to energy production that pyruvate dehydrogenase operates at full speed under all conditions. 2. In comparison with the resting state, actively contracting human muscle tissue has a: A) higher concentration of ATP. B) higher rate of lactate formation. C) lower consumption of glucose. D) lower rate of consumption of oxygen E) lower ratio of NADH to NAD+. 3.The metabolic function of the pentose phosphate pathway is: A) act as a source of ADP biosynthesis. B) generate NADPH and pentoses for the biosynthesis of fatty acids and nucleic acids. C) participate in oxidation-reduction reactions during the formation of H2O. D) provide intermediates for the citric acid cycle. E) synthesize phosphorus pentoxide. 4. Gluconeogenesis must use "bypass reactions" to circumvent three reactions in the glycolytic pathway that are highly exergonic and essentially irreversible. Reactions carried out by which three of the enzymes listed must be bypassed in the gluconeogenic pathway? 1) Hexokinase 2) Phosphoglycerate kinase 3) Phosphofructokinase-1 4) Pyruvate kinase 5) Triosephosphate isomerase A) 1, 2, 3 B) 1, 2, 4 C) 1, 4, 5 D) 1, 3, 4 E) 2, 3, 4 5.
    [Show full text]
  • Physiological and Proteomic Responses of Diploid and Tetraploid Black Locust (Robinia Pseudoacacia L.) Subjected to Salt Stress
    Int. J. Mol. Sci. 2013, 14, 20299-20325; doi:10.3390/ijms141020299 OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Article Physiological and Proteomic Responses of Diploid and Tetraploid Black Locust (Robinia pseudoacacia L.) Subjected to Salt Stress Zhiming Wang 1,†, Mingyue Wang 1,†, Likun Liu2 and Fanjuan Meng 1,* 1 College of Life Science, Northeast Forestry University, Harbin 150040, China; E-Mails: [email protected] (Z.W.); [email protected] (M.W.) 2 Department of Medical Biotechnology, College of Biomedical Science, Kangwon National University, Chuncheon, Gangwon-do 200-701, Korea; E-Mail: [email protected] † These authors contributed equally to this work. * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +86-451-8219-2170; Fax: +86-451-8643-3905. Received: 17 June 2013; in revised form: 31 August 2013 / Accepted: 9 September 2013 / Published: 14 October 2013 Abstract: Tetraploid black locust (Robinia pseudoacacia L.) is adaptable to salt stress. Here, we compared morphological, physiological, ultrastructural, and proteomic traits of leaves in tetraploid black locust and its diploid relatives under salt stress. The results showed that diploid (2×) plants suffered from greater negative effects than those of tetraploid (4×) plants. After salt treatment, plant growth was inhibited, photosynthesis was reduced, reactive oxygen species, malondialdehyde content, and relative electrolyte leakage increased, and defense-related enzyme activities decreased in 2× compared to those in 4×. In addition, salt stress resulted in distorted chloroplasts, swollen thylakoid membranes, accumulation of plastoglobules, and increased starch grains in 2× compared to those in 4×.
    [Show full text]
  • Downregulation of Phosphoglycerate Kinase 1 by Shrna Sensitizes U251 Xenografts to Radiotherapy
    ONCOLOGY REPORTS 32: 1513-1520, 2014 Downregulation of phosphoglycerate kinase 1 by shRNA sensitizes U251 xenografts to radiotherapy YI-JUN CHENG1, HAO DING1, HUA-QING DU2, Hua YAN1, JIN-BING ZHAO1, WEN-BIN ZHANG1, YUAN-JIE ZOU1, HONG-YI LIU1 and HONG XIAO2 1Department of Neurosurgery and 2Neuro-Psychiatric Institute, Nanjing Brain Hospital Affiliated to Nanjing Medical University, Nanjing, Jiangsu, P.R. China Received April 6, 2014; Accepted July 9, 2014 DOI: 10.3892/or.2014.3353 Abstract. Phosphoglycerate kinase 1 (PGK1) has been demon- radiotherapy is one of the standard treatments for glioma. Yet, strated to be involved in radioresistance. The present study was the prognosis remains dismal due to the ability of gliomas to designed to investigate the effect of PGK1 on the radioresis- infiltrate diffusely into the normal brain parenchyma, a direct tance in vivo. U251 glioma cells were transfected with the short consequence of the transformation into genetic higher-grade hairpin RNA (shRNA)-PGK1 and pcDNA3.1-PGK1 using gliomas and recurrence (4-6). As known, radioresistance is Lipofectamine 2000. The radiosensitivity of U251 xenografts a common phenomenon in gliomas and, to date there are no was observed by tumor growth curve following radiotherapy. valid biomarkers for evaluating radiosensitivity. Quantitative PCR, western blot analysis and immunohisto- In fact, radiotherapy which relies on the generation of chemistry were performed to evaluate PGK1 expression in the oxygen super-radicals, often fails to kill tumor cells, due to xenografts from the different tumor models. The expression inadequate oxygen stress within the tumor cell mass (7,8). of PGK1 was maximally inhibited in response to shRNA4 at However, in tumor microenvironments where oxygen is scarce 24 h after the transfection in vitro.
    [Show full text]
  • De Novo Transcriptome Analysis of Chlorella Sorokiniana: Efect of Glucose Assimilation, and Moderate Light Intensity Siti Nor Ani Azaman1,2, Darren C
    www.nature.com/scientificreports OPEN De novo transcriptome analysis of Chlorella sorokiniana: efect of glucose assimilation, and moderate light intensity Siti Nor Ani Azaman1,2, Darren C. J. Wong3, Sheau Wei Tan4, Fatimah M. Yusof5,6, Norio Nagao2,7 & Swee Keong Yeap8* Chlorella can produce an unusually wide range of metabolites under various nutrient availability, carbon source, and light availability. Glucose, an essential molecule for the growth of microorganisms, also contributes signifcantly to the metabolism of various metabolic compounds produced by Chlorella. In addition, manipulation of light intensity also induces the formation of secondary metabolites such as pigments, and carotenoids in Chlorella. This study will focus on the efect of glucose addition, and moderate light on the regulation of carotenoid, lipid, starch, and other key metabolic pathways in Chlorella sorokiniana. To gain knowledge about this, we performed transcriptome profling on C. sorokiniana strain NIES-2168 in response to moderate light stress supplemented with glucose under mixotrophic conditions. A total of 60,982,352 raw paired-end (PE) reads 100 bp in length was obtained from both normal, and mixotrophic samples of C. sorokiniana. After pre-processing, 93.63% high-quality PE reads were obtained, and 18,310 predicted full-length transcripts were assembled. Diferential gene expression showed that a total of 937, and 1124 genes were upregulated, and downregulated in mixotrophic samples, respectively. Transcriptome analysis revealed that the mixotrophic condition caused upregulation of genes involved in carotenoids production (specifcally lutein biosynthesis), fatty acid biosynthesis, TAG accumulation, and the majority of the carbon fxation pathways. Conversely, starch biosynthesis, sucrose biosynthesis, and isoprenoid biosynthesis were downregulated.
    [Show full text]
  • Name: Chem 465 Biochemistry II Test 1 Spring 2019 Multiple Choice (4 Points Apiece): 1. in an Anaerobic Muscle Preparation, Lact
    Name: Chem 465 Biochemistry II Test 1 Spring 2019 Multiple choice (4 points apiece): 1. In an anaerobic muscle preparation, lactate formed from glucose labeled in C-3 and C-4 would be labeled in: A) all three carbon atoms. B) only the carbon atom carrying the OH. C) only the carboxyl carbon atom. D) only the methyl carbon atom. E) the methyl and carboxyl carbon atoms. 2. In an anaerobic muscle preparation, lactate formed from glucose labeled in C-2 would be labeled in: A) all three carbon atoms. B) only the carbon atom carrying the OH. C) only the carboxyl carbon atom. D) only the methyl carbon atom. E) the methyl and carboxyl carbon atoms. 3. All of the following enzymes involved in the flow of carbon from glucose to lactate (glycolysis) are also involved in the reversal of this flow (gluconeogenesis) except: A) 3-phosphoglycerate kinase. B) aldolase. C) enolase. D) phosphofructokinase-1. E) phosphoglucoisomerase. 4. Cellular isozymes of pyruvate kinase are allosterically inhibited by: A) high concentrations of AMP. B) high concentrations of ATP. C) high concentrations of citrate. D) low concentrations of acetyl-CoA. E) low concentrations of ATP. 5. Which of the following is not true of the reaction catalyzed by the pyruvate dehydrogenase complex? A) Biotin participates in the decarboxylation. B) Both NAD+ and a flavin nucleotide act as electron carriers. C) The reaction occurs in the mitochondrial matrix. D) The substrate is held by the lipoyl-lysine "swinging arm." E) Two different cofactors containing -SH groups participate. 6. (20 points) This page is blank because I want you to fill it in with the glycolytic pathway from glucose to pyruvate showing the structure of all intermediates.
    [Show full text]
  • O O2 Enzymes Available from Sigma Enzymes Available from Sigma
    COO 2.7.1.15 Ribokinase OXIDOREDUCTASES CONH2 COO 2.7.1.16 Ribulokinase 1.1.1.1 Alcohol dehydrogenase BLOOD GROUP + O O + O O 1.1.1.3 Homoserine dehydrogenase HYALURONIC ACID DERMATAN ALGINATES O-ANTIGENS STARCH GLYCOGEN CH COO N COO 2.7.1.17 Xylulokinase P GLYCOPROTEINS SUBSTANCES 2 OH N + COO 1.1.1.8 Glycerol-3-phosphate dehydrogenase Ribose -O - P - O - P - O- Adenosine(P) Ribose - O - P - O - P - O -Adenosine NICOTINATE 2.7.1.19 Phosphoribulokinase GANGLIOSIDES PEPTIDO- CH OH CH OH N 1 + COO 1.1.1.9 D-Xylulose reductase 2 2 NH .2.1 2.7.1.24 Dephospho-CoA kinase O CHITIN CHONDROITIN PECTIN INULIN CELLULOSE O O NH O O O O Ribose- P 2.4 N N RP 1.1.1.10 l-Xylulose reductase MUCINS GLYCAN 6.3.5.1 2.7.7.18 2.7.1.25 Adenylylsulfate kinase CH2OH HO Indoleacetate Indoxyl + 1.1.1.14 l-Iditol dehydrogenase L O O O Desamino-NAD Nicotinate- Quinolinate- A 2.7.1.28 Triokinase O O 1.1.1.132 HO (Auxin) NAD(P) 6.3.1.5 2.4.2.19 1.1.1.19 Glucuronate reductase CHOH - 2.4.1.68 CH3 OH OH OH nucleotide 2.7.1.30 Glycerol kinase Y - COO nucleotide 2.7.1.31 Glycerate kinase 1.1.1.21 Aldehyde reductase AcNH CHOH COO 6.3.2.7-10 2.4.1.69 O 1.2.3.7 2.4.2.19 R OPPT OH OH + 1.1.1.22 UDPglucose dehydrogenase 2.4.99.7 HO O OPPU HO 2.7.1.32 Choline kinase S CH2OH 6.3.2.13 OH OPPU CH HO CH2CH(NH3)COO HO CH CH NH HO CH2CH2NHCOCH3 CH O CH CH NHCOCH COO 1.1.1.23 Histidinol dehydrogenase OPC 2.4.1.17 3 2.4.1.29 CH CHO 2 2 2 3 2 2 3 O 2.7.1.33 Pantothenate kinase CH3CH NHAC OH OH OH LACTOSE 2 COO 1.1.1.25 Shikimate dehydrogenase A HO HO OPPG CH OH 2.7.1.34 Pantetheine kinase UDP- TDP-Rhamnose 2 NH NH NH NH N M 2.7.1.36 Mevalonate kinase 1.1.1.27 Lactate dehydrogenase HO COO- GDP- 2.4.1.21 O NH NH 4.1.1.28 2.3.1.5 2.1.1.4 1.1.1.29 Glycerate dehydrogenase C UDP-N-Ac-Muramate Iduronate OH 2.4.1.1 2.4.1.11 HO 5-Hydroxy- 5-Hydroxytryptamine N-Acetyl-serotonin N-Acetyl-5-O-methyl-serotonin Quinolinate 2.7.1.39 Homoserine kinase Mannuronate CH3 etc.
    [Show full text]
  • Phase II of Glycolysis
    BCH 4054 Fall 2000 Chapter 19 Lecture Notes Slide 1 Chapter 19 Glycolysis Slide 2 aka = “also known as” Overview of Glycolysis aka The Embden-Meyerhoff Pathway • First pathway discovered • Common to almost all living cells • Occurs in cytoplasm of Eukaryotes • Overall reaction: + Glucose + 2 NAD + 2 ADP + 2 Pi ¯ 2 Pyruvate + 2 NADH + 2 ATP Slide 3 Glycolysis Overview, con’t. • Ten reactions overall • Same in all cells, but relative rates and regulation varies among species and even between tissues (i.e. liver and muscle). • Intermediates all bound to phosphate • Membrane impermeable • Important in energy conversion to ATP • Occurs in two stages (or phases) Chapter 19, page 1 Slide 4 Phases of Glycolysis • Phase 1 – Preparatory Phase • Glucose converted to equilibrium mixture of triose phosphates • Investment of 2 ATP’s required • Phase 2 – Energy Yielding Phase • Triose phosphates converted to pyruvate • An oxidation step occurs • Yield of 4 ATP’s, two for each triose phosphate Slide 5 Reactions of Glycolysis (Summary) • Overall Pathway (Figure 19.1) • List of Enzymes (Table 19.1a) • Energetics of Reactions (Table 19.1b) • Intermediate structures, first phase • (Figure 19.2) Slide 6 Phosphorylation of Glucose • Energetics: “Driven” by ATP hydrolysis DGo’ kJ/mol glucose + Pi ¾ glucose-6-P + H2O 13.9 ATP + H2O ¾ ADP + P i -30.5 glucose +ATP ¾ glucose-6-P +ADP -16.7 • At Q of cell, DG can be much larger, -33.9 for erythrocytes, for example (Table 19.1b). The reaction is removed from equilibrium. • (Review discussion of phosphate transfer energetics, Table 3.3, pp.67-69) • Remember induced fit mechanism, Figure 15.1.
    [Show full text]
  • Gluconeogenesis Is Essential for Trypanosome Development in The
    Gluconeogenesis is essential for trypanosome development in the tsetse fly vector Marion Wargnies, Eloise Bertiaux, Edern Cahoreau, Nicole Ziebart, Aline Crouzols, Pauline Morand, Marc Biran, Stefan Allmann, Jane Hubert, Oriana Villafraz, et al. To cite this version: Marion Wargnies, Eloise Bertiaux, Edern Cahoreau, Nicole Ziebart, Aline Crouzols, et al.. Gluco- neogenesis is essential for trypanosome development in the tsetse fly vector. PLoS Pathogens, Public Library of Science, 2018, 14 (12), pp.e1007502. 10.1371/journal.ppat.1007502. pasteur-01963538 HAL Id: pasteur-01963538 https://hal-pasteur.archives-ouvertes.fr/pasteur-01963538 Submitted on 21 Dec 2018 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution| 4.0 International License RESEARCH ARTICLE Gluconeogenesis is essential for trypanosome development in the tsetse fly vector 1,2 3 4 5 Marion Wargnies , Eloïse Bertiaux , Edern CahoreauID , Nicole Ziebart , 3 2 2 1,5 4 Aline Crouzols , Pauline MorandID , Marc BiranID , Stefan Allmann , Jane Hubert
    [Show full text]
  • Nonmetabolic Functions of Metabolic Enzymes in Cancer Development Sean Lu and Yugang Wang*
    Lu and Wang Cancer Commun (2018) 38:63 https://doi.org/10.1186/s40880-018-0336-6 Cancer Communications REVIEW Open Access Nonmetabolic functions of metabolic enzymes in cancer development Sean Lu and Yugang Wang* Abstract Metabolism is a fundamental biological process composed of a series of reactions catalyzed by metabolic enzymes. Emerging evidence demonstrates that the aberrant signaling in cancer cells induces nonmetabolic functions of meta- bolic enzymes in many instrumental cellular activities, which involve metabolic enzyme-mediated protein post-trans- lational modifcations, such as phosphorylation, acetylation, and succinylation. In the most well-researched literatures, metabolic enzymes phosphorylate proteins rather than their metabolites as substrates. Some metabolic enzymes have altered subcellular localization, which allows their metabolic products to directly participate in nonmetabolic activities. This review discusses how these fndings have deepened our understanding on enzymes originally classi- fed as metabolic enzymes, by highlighting the nonmetabolic functions of several metabolic enzymes responsible for the development of cancer, and evaluates the potential for targeting these functions in cancer treatment. Keywords: Metabolic enzymes, Function, Protein kinase, Metabolite products, Phosphorylation, Acetylation, Succinylation, Mitochondria Introduction reactions in which they were originally characterized to Metabolism, regulated by metabolic enzymes, supports work on. For instance, several metabolic enzymes use cell
    [Show full text]
  • Ydrate an Aid to Nutrition in the Future
    CarboYthetic ydrate An Aid to Nutrition in the Future Prepared Under Stanford University Ames Research Center Summer Faculty Program in Engineering Systems Design NASA Ccntract NGR-05020-409 School of Engineering, Stanford University 1972 The Stanford-Ames NASA/ASEE Summer Faculty Systems Design Workshop FINAL REPORT SYNTHETIC CARBOHkBRATE AN AID TO NUTRITION IN THE FUTURE January 1973 Gerald A. Berman Kate H. Murashige editors PARTICIPANTS Rodney W. Ballard L. Daniel hletz Assaciate Professor, .4ssistant Professor, Microbiology Department General Engineering California State Lniversity University of Illinois San Jose, California Urbana, Illinois Gerald A. Berman Peter $1. Moretti Associate Professor, Assistant Professor, E lec t rica1 Eng inee ring Mec han ica 1/Aerospace Eng rg . University of Detroit Oklahoma State Lniversity Detroit, Michigan Stillwater, Oklahoma James P. Chandler Kate H. Murashige Assistant Professor, Chairman, Physical Science Div. School of Law College of San Mate0 University of Maryland San Mateo, California Baltimore, Maryland Peter J. Reilly Nicholas Dinos Assistant Professor, Professor, Chemical Engrg . Chemical Engineering Ohio University University of Nebraska Athens, Ohio Lincoln, Nebraska William A. Drewry Errol D. Rodda Associate Professor, Associate Professor, Civil Engineering Agricultural Engineering The University of Temessee Un iversity of I11 inois Know i lle, Tennessee Urbana, Illinois William G. Gensler Dewey D.Y. Ryu Associate Professor, Associate Professor, Electrical Engineering Chemical Engineering University of Arizona Massachusetts Institute of Tech. Tucson, Arizona Cambridge, Massachusetts Leo J. Hirth Shirley Stoner Associate Professor, Assistant Prof ., Economics Chemic a 1 Engi nee r ing California State university Auburn University San Jose, California Auburn, Alabama Keith R. Wellman Marshall M. Lih Associate Professor, Associate Professor, Chemistry Department Chemical Engineering University of Miami The Catholic Univ.
    [Show full text]