Nitric Oxide-Dependent Mechanisms of Cocaine-Induced Place Preference and Mu Opioid Receptor Expression in the Nucleus Accumbens

by

Rachel-Karson Thériault

A Thesis presented to The University of Guelph

In partial fulfilment of requirements for the degree of Master of Science in Biomedical Sciences and Neuroscience

Guelph, Ontario, Canada

© Rachel-Karson Thériault, July, 2017

ABSTRACT

THE INVESTIGATION OF NITRIC OXIDE-DEPENDENT MECHANISMS OF COCAINE-INDUCED PLACE PREFERENCE AND MU OPIOID RECEPTOR EXPRESSION

Rachel-Karson Thériault Advisors: Dr. Bettina Kalisch and University of Guelph, 2017 Dr. Francesco Leri

Cocaine administration increases both mu opioid receptor (MOR) expression and nitric oxide (NO) production in brain areas associated with reward. This thesis explores the effect of acute and ‘subchronic’ cocaine administration on MOR and neuronal NO synthase (nNOS) expression, and the role of NO in cocaine reward and the cocaine-mediated expression of MOR and nNOS in rats. Acute cocaine (20 mg/kg) administration increased MOR and nNOS mRNA and protein expression in the nucleus accumbens (NAc), within 72 hours. Following 4 days of conditioning, cocaine (20 mg/kg) produced a conditioned place preference (CPP) and an increase in MOR mRNA in the rat NAc. Both effects were attenuated in rats pre-treated with the nNOS inhibitor, 7-nitroindazole (7-NI) (25 mg/kg and 50 mg/kg). Taken together, these results indicate that acute cocaine administration modulates MOR and nNOS expression at the transcriptional and translational level, and that nNOS plays a role in both cocaine CPP and the cocaine-induced

MOR mRNA expression.

ACKNOWLEDGMENTS

First and foremost, I would like to thank my advisors Dr. Bettina Kalisch and Dr.

Francesco Leri for their constant support, guidance, and encouragement in pursuing a Master’s degree. Thank you for always challenging me and reminding me that patience is a virtue in research. You have both solidified my love of learning, research, and academia, and for that I will always be grateful.

Thank you to all the lab members and staff without whom this work would not have been possible: Carolyn Creighton and Faisal Alibhai for their guidance with qPCR and RNA work,

Thomas Horman for training me on animal/behavioural work, and Cheryl Limebeer for teaching me how to complete tissue extractions. Last but not least, a big shout out to Ari Mendell for constantly answering my endless number of questions for 3 years.

I would also like to give a big thank you to all the members of the Leri lab, as well as the graduate students and faculty members in the department of Biomedical Sciences, for making this an incredible and memorable two years.

To my family, friends, and cats: thank you for all your love, support, and confidence in me. Finally, I would like to acknowledge the funding provided by the Canadian Institute of

Health Research (CIHR) and Ontario Veterinary College (OVC).

III DECLARATION OF WORK PERFORMED I declare that all the work reported in this thesis was performed by me.

IV TABLE OF CONTENTS

ABSTRACT ...... II ACKNOWLEDGMENTS ...... III DECLARATION OF WORK PERFORMED ...... IV TABLE OF CONTENTS ...... V LIST OF FIGURES ...... VII LIST OF ABBREVIATIONS ...... VIII Introduction ...... 1 Review of the Literature ...... 3 1.0. Drug abuse and addiction ...... 3 1.1. Cocaine addiction ...... 4 1.2. The neuropharmacology of cocaine and the reward system ...... 6 1.3. Cocaine-induced neuroadaptations ...... 11 2.0. The endogenous opioid system ...... 13 2.1. The endogenous opioid system and cocaine addiction ...... 15 2.2. Regulation of the mu opioid receptor by cocaine: Biochemical evidence ...... 17 2.3. The role of the mu opioid receptor in cocaine addiction: Behavioural evidence ...... 20 3.0. The nitrergic system ...... 22 3.1. Nitric oxide signalling in the brain ...... 23 3.2. The effect of cocaine on the nitrergic system ...... 25 3.3. The role nitric oxide in cocaine-motivated behaviours ...... 27 3.4. The link between the cocaine-induced nitric oxide efflux and the endogenous opioid system ...... 30 Rationale ...... 32 Hypothesis ...... 35 Objectives ...... 35 Materials and Methods ...... 36 Materials ...... 36 Subjects ...... 36 Drugs ...... 37 Testing Apparatus ...... 37 Activity Chambers/Conditioned Place Preference ...... 37 Biochemical Assays ...... 38 Quantitative Polymerase Chain Reaction (qPCR) analysis ...... 38 Immunoblot analysis ...... 41 Procedures ...... 44 Experiment 1: Cocaine-induced locomotor activity ...... 44 Experiment 2: Effect of nNOS inhibition on the development of cocaine CPP ...... 44 Data and Statistical Analyses ...... 45 Results ...... 46

V Experiment 1: The effect of acute cocaine administration on locomotion, and MOR and nNOS mRNA and protein expression in the NAc ...... 46 Cocaine-induced locomotor activity ...... 46 Qualitative detection and quantification of MOR and nNOS mRNA ...... 46 MOR and nNOS protein expression ...... 47 Experiment 2: The role of nNOS in cocaine-induced locomotion, CPP, and MOR and nNOS mRNA and protein expression in the NAc ...... 48 The effect of nNOS inhibition on cocaine-induced locomotor activity ...... 48 The effect of nNOS inhibition on the development of cocaine CPP ...... 49 Cocaine-induced MOR and nNOS mRNA expression ...... 49 Cocaine-induced MOR and nNOS protein expression ...... 50 Figure Legends ...... 51 Figures ...... 53 Discussion ...... 61 Summary of results ...... 61 Acute cocaine administration modulates MOR and nNOS expression ...... 62 Inhibition of nNOS attenuates cocaine CPP ...... 66 ‘Subchronic’ cocaine administration and nNOS inhibition modulate MOR and nNOS expression...... 69 Summary and Significance ...... 74 Limitations ...... 74 Future directions ...... 75 Conclusions ...... 77 References ...... 78 Appendix: Supplementary Data ...... 102

VI LIST OF FIGURES Figure 1: Simplified schematic of the major connections involved in the “reward” system and

associated structures...... 7

Figure 2: Summary of NO signaling in pre- and post-synaptic neurons...... 25

Figure 3: Locomotor activity following acute cocaine exposure ...... 53

Figure 4: Qualitative gene detection ...... 54

Figure 5: Relative MOR and nNOS mRNA expression in the NAc following acute cocaine

exposure ...... 55

Figure 6: Representative immunoblots and relative MOR and nNOS protein expression in the

NAc following acute cocaine exposure ...... 56

Figure 7: Locomotor activity during CPP conditioning sessions ...... 57

Figure 8: Time spent in drug-paired compartment during CPP testing ...... 58

Figure 9: Relative MOR and nNOS mRNA expression in the NAc following cocaine CPP ...... 59

Figure 10: Representative immunoblots and relative MOR and nNOS protein expression in the

NAc following cocaine CPP ...... 60

VII LIST OF ABBREVIATIONS b-END b-Endorphins

5-HT 5-Hydroxytryptamine

7-NI 7-nitroindazole

AC Adenylyl cyclase

Amy Amygdala cAMP Cyclic adenosine monophosphate

CBP CREB binding protein cGMP Cyclic guanosine monophosphate

CPP Conditioned place preference

CPu Caudate putamen

CRE CREB response element

CREB cAMP response element-binding protein

CRF Corticotropin releasing factor

CS Conditioned stimulus

CTAP D-Phe-Cys-Tyr-D-Trp-Arg-Thr-Pen-Thr-NH2

CTOP D-Phe-Cys-Tyr-D-Trp-Orn-Thr-Pen-Thr-NH2

DA Dopamine

DAMGO [D-Ala2, N-MePhe4, Gly-ol]-enkephalin

DAT Dopamine transporter

DOR Delta opioid receptor

DYN Dynorphin eNOS Endothelial nitric oxide synthase

VIII ENK Enkephalin

EOS Endogenous opioid system

ERK Extracellular signal-regulated kinase

Hp Hippocampus

HPRT Hypoxanthine-guanine phosphoribosyltransferase iNOS Inducible nitric oxide synthase

KO Knock-out

KOR Kappa opioid receptor

LTM Long-term memory

LTP Long-term potentiation

MOR Mu opioid receptor mRNA Messenger ribonucleic acid

NAc Nucleus accumbens

NE Norepinephrine

NET Norepinephrine transporter

NMDA N-methyl-D-aspartate nNOS Neuronal nitric oxide synthase

NO Nitric oxide

PCR Polymerase chain reaction

PDYN Prodynorphin

PENK Proenkephalin

PET Positron emission tomography

PFC Prefrontal cortex

IX PKA Protein kinase A

PKG Protein kinase G

POMC Proopiomelanocortin

PSD95 Presynaptic density protein 95 qPCR Quantitative polymerase chain reaction sGC Soluble guanylyl cyclase

SERT Serotonin transporter

TH Tyrosine hydroxylase

UCS Unconditioned stimulus

VTA Ventral tegmental area

WT Wild-type

X Introduction

Drug addiction is a chronically relapsing disorder characterized by the compulsion to seek drugs and the loss of control over drug intake, despite the associated negative consequences

(Koob et al., 2004; Koob & Volkow, 2009). One of the most abused and addictive illicit drugs is cocaine. Over the last few decades, substantial evidence has demonstrated that cocaine induces long-term neuroadaptations in the brain that persist following prolonged drug abstinence, and that these regulatory changes contribute to the transition from drug abuse to addiction (Koob &

Volkow, 2009; Pierce & Kumaresan, 2006). These persistent physiological changes in the brain likely underlie the relapsing nature of cocaine addiction as well (Kreek et al., 2012; Nestler,

2005).

One key neuroadaptation is the cocaine-induced increase in mu opioid receptor (MOR) mRNA levels (Azaryan et al., 1998; Leri et al., 2006; 2009), binding (Azaryan et al., 1996;

Unterwald, 1992) and activation (Bailey et al., 2007; Schroeder et al., 2003) in the brain-reward circuitry, which persists long after cocaine use has ceased. This cocaine-induced MOR expression has been reported to mediate cocaine-induced sensitization, self-administration, and conditioned reward (Corrigall & Coen, 1991; Houdi et al., 1989; Hummel et al., 2006; Kim et al., 1997; Leri et al., 2006; 2009; Ramsey et al., 1999; Schroeder et al., 2007; Soderman &

Unterwald, 2007), and is positively correlated with self-reported levels of cocaine craving

(Gorelick et al., 2005) and impulsivity in human addicts (Love et al., 2009). However, the exact mechanism by which cocaine increases MOR expression remains unknown.

1 Cocaine administration also has been shown to increase nitric oxide (NO) efflux in the brain (Lee et al., 2010; Lee et al., 2011; Sammut & West, 2008); an effect that may underlie processes necessary for drug reward and the development of drug addiction (Itzhak, 1996; Liddie et al., 2013). Previous studies have demonstrated that the NO efflux induced by cocaine plays a significant role in drug conditioned reward (Itzhak, 1998), the reconsolidation of drug-associated memories (Itzhak & Anderson, 2007; Shen et al., 2012), and oxidative stress resulting from cocaine use (Vitcheva et al., 2015). Furthermore, our laboratory previously established that the inhibition of NO production blocks the cocaine-mediated elevation in MOR mRNA and protein expression in PC12 cells (Winick-Ng et al., 2012), indicating that NO modulates the cocaine- induced expression of MOR in vitro. However, whether this mechanism occurs in vivo has not been elucidated. Thus, the aim of this thesis is to determine if NO regulates the cocaine-induced increase in MOR expression in vivo, and whether this mechanism is necessary for the development of conditioned reward.

2 Review of the Literature

1.0. Drug abuse and addiction Substance dependence or drug addiction is defined by the Diagnostic and Statistical

Manual of Mental Disorders (DSM) as a chronically relapsing disorder that is characterized by

1) the compulsion to seek and use a drug of abuse, 2) the loss of control in drug intake, and 3) the emergence of a negative emotional state when the drug is not accessed (American Psychiatric

Association; Koob & Le Moal, 1997). Additionally, drug use will persist even at the expense of negative consequences (Liddie et al., 2013; Pierce & Kumaresan, 2006). Overall, addiction is described as a three stage cycle: binge/intoxication, withdrawal/negative affect, and preoccupation/anticipation. Over time, these stages interact and intensify, and promote progressive drug use (Koob & Le Moal, 1997). Notably, recreational and limited abuse of an illicit drug is clinically distinct from the loss of control and compulsive drug-seeking associated with addiction (Koob & Volkow, 2009). This is illustrated by the fact that about 15.6% of North

Americans will abuse an illicit drug at some point in their lives, however only about 2.9% will become dependent or addicted to illicit drugs (Grant et al., 2004).

From a psychiatric perspective, addiction may be understood by a motivational framework that proposes that the transition from drug abuse to addiction stems from a shift from impulsive drug use that is motivated by positive reinforcement (i.e. drug-induced euphoria) to compulsive drug seeking that is motivated by negative reinforcement (i.e. withdrawal symptoms)

(Koob, 2004; Koob & Volkow, 2009). Although, the exact cause of this shift is unknown, the emergence of the negative affect during drug withdrawal is considered an indication of an individual’s transition into drug dependence (Koob & Le Moal, 2001).

3 It has also been suggested that the transition from drug abuse to addiction reflects an allostatic response in the brain (McEwen, 2000). Allostasis is a “state of chronic deviation of the regulatory systems from their normal state of operation with establishment of a new set point”

(Koob et al., 2004). Thus, in the context of addiction, long-term alterations in the reward and stress neurocircuitry may be the primary source of allostatic changes that underlie the progression of drug abuse to addiction (see section 1.3.) (McEwen, 2000). However, the exact mechanisms responsible for the development of drug dependence remain unknown.

1.1. Cocaine addiction In North America, cocaine is the second most abused illicit drug (Canadian Centre on

Substance Abuse; CCSA, 2015), with about one in six recreational cocaine users developing an addiction (Dackis & O’Brien, 2001). Cocaine addiction presents significant societal and health problems worldwide, including incarceration, job loss, financial struggle, severe medical complications, and risk of death due to drug overdose (Dackis & O’Brien, 2001). In fact, cocaine use is accountable for the most hospital emergency department visits and the most drug-related deaths (Lange & Hillis, 2001). Unfortunately, there are no effective treatment strategies or pharmacotherapies for cocaine addiction. One major problem with treating cocaine addiction is that even with prolonged drug abstinence, pervasive drug cravings and thoughts of drug use can drive an individual to relapse (Koob et al., 2004). This vulnerability and relapse to drug use can be triggered by use of the drug itself, exposure to cues previously associated with drug administration, and stressful stimuli (Shaham et al., 2003).

Cocaine is a psychostimulant that is abused for its ability to produce feelings of euphoria, increased energy and alertness, and a sense of well-being (CCSA, 2015; Ritz et al., 1990).

Depending on the route of administration, these effects may last from 30 to 60 minutes. In

4 cocaine-addicted individuals, drug use occurs in a binge-like and uncontrollable pattern with the development of tolerance, followed by an acute withdrawal (Gawin & Kleber, 1986; Koob & Le

Moal, 1997). This withdrawal is defined by severe symptoms of depression, anxiety, irritability, and anhedonia, and is often referred to as a “crash” (Gawin & Kleber, 1986). A “crash” may last several hours to days, and is likely a major motivating factor to resume cocaine use and maintain the addiction cycle previously described (Gawin & Kleber, 1986; Koob & Le Moal, 1997).

Attempts to best capture this human pattern of cocaine use led to the development of several animal models of addiction. Studies predominantly aim to elucidate the mechanisms involved in the transition from recreational drug use to loss of control and addiction. Although no animal model perfectly mimics this transition, several models do permit the investigation of specific elements of addiction, such as drug reward, drug seeking, and relapse and withdrawal

(Koob & Volkow, 2009).

One of the most popular and well established behavioural models used to study drug reinforcement is the conditioned place preference (CPP) paradigm (Itzhak & Martin, 2002;

Tzschentke, 1998). CPP uses the principles of classic Pavlovian learning, in which an unconditioned stimulus (UCS) (i.e. cocaine) is repeatedly paired with a neutral environmental conditioned stimulus (CS) (Tzschentke, 1998). Upon subsequent choice of environment, animals will prefer the CS, indicating the development of a place preference and a reinforcing effect of the UCS (Itzhak & Martin, 2002; Tzschentke, 1998). It has been well established that cocaine produces a significant and robust place preference in a variety of species and across a range of doses (Balda et al., 2006; Itzhak, 2008; Leri et al., 2006; Mueller & Stewart, 2000; Solinas et al.,

2008; Sticht et al., 2010). This cocaine-conditioned response is considered to be applicable to human drug-seeking behaviour and relapse following the exposure of drug-associated

5 cues/environmental stimuli (Itzhak & Martin, 2002). Furthermore, Mueller & Stewart (2000) later established that in rats, cocaine-induced CPP can be extinguished and reinstated with a priming injection of cocaine. This served as a novel additional model to investigate drug-seeking behaviours and relapse (Mueller & Stewart, 2000). Furthermore, as the development of CPP requires the learning of drug-associated cues, this method is also used to examine the formation and reconsolidation of long-term memories in a drug associated context (Liddie et al., 2013).

The second most common and validated animal model of addiction is intravenous cocaine self-administration. This model is thought to be homologous to human drug taking by mimicking the transition from drug abuse to addiction (Koob, 2009). In self-administration studies, animals learn to express an operant response in order to receive a drug reinforcer (i.e. cocaine), typically administered intravenously (Pierce & Kumaresan, 2006). The reinforcing and incentive properties of cocaine can be studied using the self-administration model (Koob, 2009).

1.2. The neuropharmacology of cocaine and the reward system The work of Olds and Milner (1945), who used a model of intra-cranial self-stimulation, is credited with the identification of the reward system in the brain. These findings provided the framework for our understanding of the neurocircuitry involved in reward and the reinforcing effects of drugs of abuse. All drugs of abuse produce their reinforcing effects by acting on the mesolimbic pathway of the brain, also known as the reward pathway (see Figure 1). In this system, dopaminergic (DAergic) neurons from the ventral tegmental area (VTA) innervate the nucleus accumbens (NAc), the hippocampus (Hp), the prefrontal cortex (PFC), and the amygdala

(Amy). Also in this circuit, the Amy, Hp, and PFC send glutamatergic projections to the NAc, which sends GABAergic efferents to the VTA and substantia nigra (Heimer et al., 1997).

6

Figure 1. Simplified schematic of the major connections involved in the “reward” system and associated structures. The primary connection that mediates reward is the dopaminergic projections from the ventral tegmental area (VTA) to the nucleus accumbens (NAc), which increase dopamine release in response to rewarding stimuli. The VTA also has dopaminergic innervations to the hippocampus (Hipp), amygdala (Amy), and the medial prefrontal cortex (mPFC). The NAc has inhibitory GABA projections to the VTA, as well as the substantia nigra (not shown). Furthermore, the NAc receives various glutamatergic inputs from the mPFC, Amy, and Hipp. These glutamatergic projections mediate reward-associated memory and perception. Figure adapted and modified from Russo & Nestler (2013) Nature Reviews Neuroscience,14:609-625. The mechanism of action by which the mesolimbic system is activated is dependent on the drug of abuse. Cocaine inhibits the activity of the dopamine (DA), serotonin (5-HT), and norepinephrine (NE) transporters (DAT, SERT, and NET, respectively), resulting in significantly increased extracellular levels of these biogenic amines (Ritz et al., 1990). However, studies strongly support that it is the increase in DA neurotransmission between the VTA and the NAc that predominantly mediates the reinforcing effects of cocaine (Ritz et al., 1987).

Known as the DA hypothesis of drug reinforcement, studies dating back to the late 1970’s demonstrate that cocaine’s reinforcing potency is correlated with its affinity for the DAT, but not the SERT or NET (Fibiger, 1978; Ritz et al., 1987; Wise, 1978). In fact, in humans, there is a

7 positive correlation between the level of DAT inhibition by cocaine and the individual’s reported level of “high” following intravenous administration (Volkow et al., 1997). Furthermore, re- uptake inhibitors that are selective for the DAT are readily self-administered by rodents and monkeys (Bergman et al., 1989; Howell & Byrd, 1991; Ritz et al., 1987; Woolverton et al.,

2001). Transgenic DA D1 receptor knock-out (KO) mice do not self-administer cocaine or express cocaine-induced hyperactivity (Caine et al., 2007; Xu et al., 1994), whereas transgenic mice with a non-functional DAT mutation do not express cocaine conditioned reward (Chen et al., 2006). Additionally, DA receptor agonists are self-administered by rats (Self & Stein, 1992;

Self et al., 1996; Wise et al., 1990) and non-human primates (Grech et al., 1996; Sinnot et al.,

1999; Weed & Wolverton, 1995; Woolverton et al., 1984), whereas DA receptor antagonists significantly reduce the reinforcing efficacy of cocaine (Bergman et al., 1990; Britton et al.,

1991; Koob et al., 1987; Woolverton, 1987). In human brain imaging studies, it was demonstrated that rapid DA changes in the ventral striatum are associated with an individual’s perception of reward, whereas slow elevations in DA levels are not (Grace, 2000; Volkow &

Swanson, 2003). This may explain the binge pattern of cocaine intake, in which the drug is taken every 30 to 60 minutes (Fowler et al., 2008) via a route of rapid drug delivery to the brain (i.e. injection, snorting) that would induce quick alterations in DA levels (Volkow et al., 2000).

As previously stated, the acute reinforcing properties of cocaine are largely mediated by the increased DA levels within the NAc (Koob & Volkow, 2009). This is supported by the fact that

DA-depleting lesions of the NAc block the acquisition of drug-seeking in cocaine self- administration studies (Whitelaw et al., 1996). In rodents, cocaine is directly self-administered into the NAc (McKinzie et al., 1999) and a CPP develops when cocaine is infused into the NAc

(Koob & Volkow, 2009). Selective DA re-uptake inhibitors and DA receptor agonists are also

8 readily self-administered directly into the NAc in rats (Carlezon et al., 1995; Ikemoto et al.,

1997), whereas co-infusion of cocaine and DA receptor antagonists blocks this intra-accumbal self-administration (Phillips et al., 1994; Rodd-Henricks et al., 2002). Additionally, in vivo microdialysis studies in both rodents and primates demonstrate an increase in the NAc DA levels during cocaine self-administration, as well as a rapid decrease in NAc DA levels post-drug administration (Bradberry et al., 2000; Czoty et al., 2000; Di Ciano et al., 1995; Hemby et al.,

1997; Hurd et al., 1989; Pettit & Justice, 1989).

As illustrated in Figure 1, the Hp also receives DAergic input from the VTA, and is critical in the development of contextual conditioning (Koob & Volkow, 2009). In other words, the Hp is involved in the learning of associations between contextual cues and drug-taking experiences

(Koob & Volkow, 2009; Liddie et al., 2013; Pierce & Kumaresan, 2006;) This is supported by human brain imaging studies that found increases in blood flow to the Hp when cocaine users are shown drug-related stimuli (Kilts et al., 2001). Furthermore, studies using positron emission tomography (PET) have demonstrated that cue-elicited cravings and/or acute intoxication in cocaine users is associated with activation of the Hp (Volkow et al., 2004). Cocaine addicted humans were also reported to have impairments in spatial, verbal, and recognition memory, which are mediated by the Hp (Aharonovich et al, 2006), and the severity of these deficits positively correlate with treatment outcome and recovery (Bolla et al, 2003). In animal models of cocaine addiction, extended drug access leads to the development of deficits in Hp-dependent object recognition tasks (Briand et al., 2008; George et al., 2008), and lesions to the Hp impair the acquisition of cocaine self-administration (Caine et al., 2001). Moreover, there is strong evidence that cocaine use inhibits neurogenesis within the adult rodent Hp (Canales et al., 2007).

9 As previously mentioned, the PFC is another structure that receives DAergic input from the

VTA, and thus, is known to play a large role in cocaine-motivated behaviours. In cocaine- addicted humans, imaging studies have found that acute cocaine injections (Breiter et al., 1997), as well as the exposure to cocaine-related cues produce an increase in PFC activity (Garavan et al., 2000; Kilts et al., 2001; Wexler et al., 2001). Furthermore, the intensity of cocaine-cue reactivity in the PFC is positively correlated with the risk of relapse (Marhe et al., 2013). During drug withdrawal, human cocaine users have decreased function and metabolism in the PFC, which is associated with poor impulse control and decision making (Volkow & Li, 2004).

Cocaine addicts also have decreased grey matter volume in the PFC, which is inversely correlated with the need for immediate gratification (Bjork et al., 2009). These results support a study that found that cocaine addicted humans have impaired performances in delayed reward discounting tasks (Aharonovich et al, 2006). The role of the PFC in cocaine addiction has also been validated in animal models, as rodents self-administer cocaine and DA D1 receptor agonists directly into this brain region (Goeders and Smith, 1983).

The PFC also send projections to the caudate putamen (CPu) (Koob & Volkow, 2009). The

CPu, a structure within the dorsal striatum, is not involved in the acute reinforcing effects of cocaine (Everitt et al., 2008). Rather, the CPu appears to be critical in the transition from impulsive to compulsive drug use (Everitt et al., 2008). In vivo microdialysis studies found increased DA release in the CPu following prolonged cocaine seeking in rodents (Ito et al.,

2002). Similar results have been found in cocaine addicted humans. Using brain imaging techniques, studies demonstrated that increases in CPu DA levels are induced by the presentation of drug-associated cues, and that the magnitude of DA increase in the CPu positively correlates with self-reported levels of drug craving and the degree of addiction severity (Heinz et al., 2004;

10 Volkow et al., 2008). Thus, these results highlight the role of the CPu and the DAergic system in drug conditioned responses in human addicts. Additionally, evidence strongly suggests the involvement of glutamate neurotransmission in the CPu, in both habit learning and the development of context-dependent cravings (Volkow et al., 2006).

1.3. Cocaine-induced neuroadaptations As described in section 1.1., many cocaine addiction studies examine the effects of chronic cocaine use, with the goal of replicating the transition from drug abuse to addiction and dependence. As a result, researchers have elucidated that prolonged cocaine use causes the dysregulation of several neurochemical systems, which in turn could promote the development of addiction. Not surprisingly, the major circuit compromised by chronic cocaine exposure is the mesolimbic DAergic reward system. Although cocaine acutely decreases the threshold of brain reward stimulation (i.e. increased reward), chronic cocaine administration gradually increases the baseline reward threshold (i.e. a larger drug dose is required to produce reward) (Koob & Le

Moal, 2001). This effect is hypothesized to be a result of the decreased DAergic neurotransmission in the NAc associated with prolonged drug use, as evidenced by in vivo microdialysis studies using a rodent model (Koob & Le Moal, 2001). Brain imaging studies in human cocaine addicts have also reported DAergic hypofunction, as demonstrated by decreased

DA levels and reduced expression of DA receptors (Martinez et al., 2004; 2005). This alteration in neurotransmission may explain the dysphoria, anhedonia, fatigue, and psychomotor retardation experienced by addicts during withdrawal periods (Koob & Le Moal, 2005). It is this negative motivational state during withdrawal that is thought to be responsible for the decreased motivation for non-drug related stimuli, the increase in sensitivity to drugs of abuse, and the vulnerability to relapse (Barr & Philips, 1999; Koob & Le Moal, 2005; Melis et al., 2005).

11 Moreover, the reduction in DA receptor expression in the NAc and PFC is significantly associated with the deficits in learning, memory, and attention characterized in addiction (Briand et al., 2008; Heinz et al., 2004).

Although the exact mechanism by which cocaine induces DAergic hypofunction is unknown, it is postulated that chronic cocaine administration causes long-term changes in synaptic plasticity within the DA system (Wolf, 2002). These changes may then promote a shift in the reward circuitry in which cue-induced learning will persist regardless of adverse consequences

(Everitt & Wolf, 2002; Hyman et al., 2006).

Prolonged cocaine use also dysregulates the stress neurocircuitry (Heinrichs & Koob, 2004).

In fact, rats that self-administer cocaine have significantly reduced levels of the stress hormone corticotropin releasing factor (CRF) during drug intake (Richter & Weiss, 1999). However, during withdrawal, CRF levels in cocaine-dependent rats significantly increase to about 400% of baseline (Richter & Weiss, 1999). This dysregulation is thought to greatly contribute to the negative motivational effects of cocaine withdrawal, particularly anxiety, and vulnerability to relapse, as previously discussed (Koob, 2008; Koob & Kreek, 2007).

Another major system that is dysregulated in cocaine addiction is the endogenous opioid system (EOS). This system also has links to DA neurotransmission and is discussed in detail in the sections below (see section 2.0.)

In order to elucidate how cocaine use disrupts these neural circuits, many molecular targets and their role in addiction have been investigated. One key molecular target is nitric oxide (NO).

Cocaine administration mediates NO efflux to induce downstream molecular effects, which are discussed further in section 3.0. The transcription factor cyclic adenosine monophosphate response-element binding protein (CREB) is also notable, due to the fact that chronic cocaine

12 exposure activates CREB in the NAc and the Amy, which subsequently regulates gene expression (Edwards et al, 2007; Shaw-Lutchman et al, 2002). Moreover, CREB activation in the

NAc has been linked to the EOS and the nitrergic system, as well as several intracellular messenger pathways, such as the extracellular signal-regulated kinase (ERK) pathway. (Edwards et al, 2007; Nestler, 2005; Shaw-Lutchman et al, 2002).

Stimulated ERK phosphorylates and activates CREB, and activation of this messenger pathway has also been largely implicated in cocaine’s effects, such as cocaine-induced synaptic plasticity, behavioural sensitization, cocaine reward, and the incubation of cocaine craving (Lu et al., 2006; Li et al., 2008). Both ERK and CREB are further discussed in section 3.1.

Although numerous other molecular targets are implicated in cocaine addiction, the remainder of this literature review focuses on two key players: the mu opioid receptor (MOR) and NO.

2.0. The endogenous opioid system The existence of the EOS was confirmed in 1973, when the three classical membrane receptors for opiate drugs were first identified in the brain by three independent groups (Pert &

Snyder, 1973; Simon et al., 1973; Terenius, 1973). These opioid receptors are now widely recognized as the MOR, the delta opioid receptor (DOR), and the kappa opioid receptor (KOR).

A few years following their discovery, it was established that the opioid receptors possess different opioid ligand binding sites, thus confirming that these receptors are not a homogenous population (Lord et al., 1977; Martin et al., 1976). The opioid receptors have since been cloned and extensively characterized (Chen et al., 1993; Evans et al., 1992; Kieffer et al., 1992; Meng et al., 1993; Thompson et al., 1993; Yasuda et al., 1993).

The opioid receptors are expressed on pre- and post-synaptic cell membranes and possess

13 a seven trans-membrane domain (Le Merrer et al., 2009; Trigo et al., 2010). They are coupled to

the inhibitory GTP-binding protein Gi/Go and thus, belong to the superfamily of G-protein coupled receptors (Le Merrer et al., 2009; Trigo et al., 2010). At the molecular level, stimulation of the opioid receptors generally causes inhibition of cyclic adenosine monophosphate (cAMP) production and voltage-gated calcium channels, as well as the activation of potassium channels and the ERK pathway (Law et al., 2000). This results in the overall reduction in neuronal activity and neurotransmitter release (Trigo et al., 2010).

The endogenous peptide ligands that target and bind the opioid receptors have also been identified, cloned, and largely characterized. The enkephalins (ENK), the dynoprhins (DYN), and the b-endorphins (b-END) are produced via the proteolytic cleavage of the large peptide precursors proenkephalin (PENK), prodynorphin (PDYN), and proopiomelanocortin (POMC), respectively (Le Merrer et al., 2009). Although derived from different precursor proteins, all opioid ligands have a conserved N-terminal sequence, which is necessary for the activation of opioid receptors (Akil et al., 1997). Notably, these endogenous opioid peptides have different affinities for each opioid receptor. The ENK peptides have a 20-fold greater affinity for the

DOR, relative to the MOR and KOR, b-END exhibit the greatest affinity for the MOR, and DYN are regarded as the major ligands for the KOR (Akil et al., 1997; Trigo et al., 2010).

The endogenous opioid receptors and ligands are widely distributed throughout the central and peripheral nervous system (Le Merrer et al., 2009; Trigo et al., 2010; Yoo et al.,

2012). This large distribution reflects the number of important physiological functions in which the EOS plays a role. Of note, the EOS is involved in nociception and analgesia, stress responses, gastrointestinal transit, as well as immune and endocrine functions (Le Merrer et al., 2009).

However, the most significant role of the EOS in relation to drug addiction, is the modulation of

14 mood and the brain reward processes (Mansour et al., 1995). Thus, it follows that the receptors and ligands of the EOS are highly expressed in areas of reward and motivation in the brain, and have been implicated in the neurochemical effects of several drugs of abuse (Mansour et al.,

1995). Specifically, the EOS overlaps anatomically with the DAergic system (Mansour et al.,

1987), and opioid receptors/ligands have been identified within the NAc, VTA, PFC, and Amy

(Delfs et al.,1994; Mansour et al., 1993; 1994; 1995). As such, the role of the EOS in drug abuse and addiction has been extensively studied.

2.1. The endogenous opioid system and cocaine addiction It is well established that the EOS has a central role in modulating reward and addictive behaviors for all drugs of abuse (Nobel et al., 2015). Regarding psychostimulants, evidence suggests that the DAergic system and the EOS converge in order to mediate the rewarding and reinforcing drug properties (Boutrel, 2008). Furthermore, studies have demonstrated that acute and chronic cocaine administration induce adaptive changes in opioid receptor/ligand densities, activity, and gene expression within brain reward structures (see below). However, discrepancies in results reported in the literature have been a major issue in elucidating the exact role of the

EOS in cocaine addiction. One possible explanation for these inconsistencies is that the observed neuroadaptations are largely dependent on species/animal strain, the pattern of drug administration, and the length of the withdrawal period (Nobel et al., 2015).

One of the most reliable findings in regards to cocaine-induced regulation of opioid ligand gene expression is the upregulation in PDYN mRNA levels and immunoreactivity in the

CPu, regardless of the drug administration pattern (Bailey et al., 2005; Daunais & McGinty,

1995; Mathieu-Kia & Besson, 1998; Sivam, 1989; Smiley et al., 1990; Steiner & Gerfen, 1993;

Svensson & Hurd, 1998). This increase in PDYN was also detected in the CPu of post-mortem

15 brains of cocaine addicted humans (Frankel et al., 2008; Hurd & Herkenham, 1993). Although some studies have found elevated PDYN levels in the NAc following chronic cocaine administration (Hurd et al., 1992; Smiley et al., 1990; Turchan et al., 2002), this finding has not been consistent (Bailey et al., 2005; Schlussman et al., 2005). Behaviourally, it is thought that the cocaine-induced increase in DYN expression is involved in aversive effects of drug withdrawal, due to its predominant activation of the KOR (Koob, 2008).

KOR stimulation in the brain produces aversive affects in animals and humans

(McLaughlin et al., 2003; Shippenberg et al., 2007; Zimmer et al., 2001), and KOR agonists have been found to decrease cocaine CPP (Suzuki et al., 1992) and the rate of cocaine self- administration (Glick et al., 1995; Schenk et al., 1999). Conversely, KOR antagonists attenuate the depressive-like behaviours characteristic of cocaine-withdrawal, in rats (Chartoff et al.,

2012). Thus, this cocaine-induced increase in the PDYN/KOR system may represent a compensatory mechanism to counteract the rewarding effect of cocaine and may contribute to the withdrawal-associated dysphoria (Gawin et al., 1991; Nobel et al., 2015; Yoo et al., 2012).

Elevated PENK mRNA levels have been reported in the CPu, following acute cocaine administration (Hurd & Herkenham, 1992). However, the effect of chronic cocaine treatment on

PENK expression is highly variable between studies (Bailey et al., 2005; Hurd et al., 1992;

Mathieu-Kia & Besson, 1998). Moreover, cocaine does not alter DOR mRNA expression

(Azaryan et al., 1996), receptor binding levels (Unterwald et al., 1994), or receptor activity

(Schroeder et al., 2003). However, the DOR has been implicated in the reinforcing effects of cocaine. Specifically, DOR antagonists reduce cocaine CPP (Menkens et al., 1992; Suzuki et al.,

1994) and cocaine self-administration (Reid et al., 1995). In addition, infusion of a selective

DOR antagonist into the NAc reduce cocaine self-administration, but increases this behaviour

16 when injected into the VTA (Ward & Roberts, 2007). Thus, the role of the DOR in cocaine reinforcement is site-specific.

Acute cocaine treatment (Olive et al., 2001) and cocaine self-administration (Roth-Deri et al., 2003) are both reported to increase b-END release in the NAc. This suggests that b-END may be involved in cocaine reinforcement. Also, abstinent human cocaine addicts have been found to have increased plasma b-END levels (Vescovi et al., 1992). Although the overall role of b-END in cocaine addiction has not been well established, the critical role of the MOR in drug abuse and addiction has been investigated extensively in animal models and humans. The findings provide compelling support that the MOR is largely involved in the reinforcing effects of cocaine, drug cravings, and vulnerability to relapse, and is discussed in detail in the following sections.

2.2. Regulation of the mu opioid receptor by cocaine: Biochemical evidence There is substantial evidence demonstrating that MOR expression and activity is altered by cocaine administration and the DAergic system, and that the magnitude of these alterations is dependent on the dose and pattern of cocaine administration, as well as the length of the drug- withdrawal period. Chronic continuous cocaine treatment that is administered systemically for three days produces a significant increase in MOR mRNA levels in the NAc of rats; an effect that is abolished by selective D1, D2, and D3 receptor antagonists (Azaryan et al., 1996a). A follow-up study replicated these findings and subsequently demonstrated that three days of chronic continuous treatment of selective D1 and D2 receptor agonists also produces an elevation in MOR mRNA levels in the NAc, however to a lesser extent relative to cocaine alone

(Azaryan et al., 1996b). Thus, it is evident that cocaine activation of the DAergic reward system mediates MOR expression. When the time-dependent changes in MOR expression were

17 examined with chronic continuous cocaine administration, it was found that MOR mRNA levels in the NAc were maximally enhanced at 72 hours and returned to baseline levels by 96 hours

(Azaryan et al., 1998). Once again, this effect was mimicked by selective DA receptor agonists

(Azaryan et al., 1998). In addition, the level of MOR binding in the NAc was elevated by 30% at

72 hours, relative to control levels, and returned to baseline at 96 hours (Azaryan et al., 1998).

Similarly, two weeks of chronic continuous cocaine exposure dose-dependently increased MOR binding levels in the NAc, although there was a dose-dependent decrease in the VTA (Hammer,

1989).

Fourteen days of chronic ‘binge’ cocaine treatments in rats also increases MOR binding and density in the NAc, the CPu, and the Amyg, as measured by in vitro autoradiography

(Unterwald et al., 1992; 1994). Bailey et al. (2007) also found enhanced MOR activity following fourteen days of chronic ‘binge’ cocaine administration, however this effect was blocked when the PDYN gene was deleted. This ‘binge’ pattern of cocaine administration has also been shown to increase MOR-mediated G-protein activity (Schroeder et al., 2003). At the mRNA and protein level, repeated intermittent ‘binge’ treatment of cocaine significantly increased MOR expression in vitro (Winick-Ng et al., 2012).

Conversely, when rats were given a single acute injection of cocaine, a time and dose- dependent decrease in MOR binding is observed in the NAc (Soderman & Unterwald, 2009).

These results may be explained by the increase in release of endogenous opioids in response to cocaine administration, which subsequently bind to the MOR and promote receptor desensitization and internalization (Soderman & Unterwald, 2009). Furthermore, this acute decrease in MOR binding was attenuated with the administration of a selective D2 receptor antagonist, but not a D1 receptor antagonist, suggesting that cocaine indirectly activates the

18 MOR via D2 receptor activation (Soderman & Unterwald, 2009). This may also explain the decreased MOR binding, as increased D2 receptor activation via cocaine administration has been shown to cause desensitization of other G-protein coupled receptors (Unterwald et al., 2001;

Rogers et al., 2000). Notably, Leri et al. (2006; 2009) first reported that the administration of methadone, a partial MOR agonist, can block the cocaine-induced increase in MOR mRNA expression in the rat NAc. Therefore, it is clear that the mechanism of cocaine-induced activation and regulation of MOR is complicated and involves several molecular players.

The effect of cocaine withdrawal on MOR expression and activity has not been well characterized in animal models. One study reported elevated MOR mRNA levels in rats that were three hours into drug withdrawal following chronic ‘binge’ cocaine exposure (Bailey et al.,

2005). However, this increase in mRNA expression was not prevented by the selective MOR antagonist, naloxone (Bailey et al., 2005). Moreover, increased MOR mRNA levels were found in the NAc following ten days of cocaine withdrawal (Leri et al., 2006). This evidence of cocaine’s persistent effect on the EOS during drug withdrawal in animal models is also supported in human studies.

Zubieta et al. (1996) was the first to demonstrate an increase in MOR binding in the CPu and PFC of cocaine-dependent men, which persisted after four weeks of monitored cocaine abstinence. Results also indicated that the magnitude of MOR binding positively correlated with the severity of the individual’s reported level of drug craving (Zubieta et al., 1996). These findings were confirmed by Gorelick et al. (2005), who identified an increase in MOR binding in cocaine-dependent men after twelve weeks of drug abstinence. Once again, the level of MOR binding positively correlated with the intensity of drug craving (Gorelick et al., 2005).

Interestingly, MOR binding also positively correlates with an individual’s percentage of days of

19 cocaine use and the average amount of cocaine used per day (Gorelick et al., 2005). Elevated

MOR density and heightened activation of the EOS in regions associated with drug abuse positively correlates with high impulsivity as well (Love et al., 2009). Lastly, the extent of MOR binding may predict treatment outcome, as greater levels of MOR binding were found to be associated with shorter cocaine abstinence in humans (Ghitza et al., 2010). Moreover, specific polymorphisms in the MOR human gene have been identified to alter an individual’s response to reward stimuli and reinforcement learning (Lee et al., 2011). This further supports the role of

MOR in substance abuse in humans.

2.3. The role of the mu opioid receptor in cocaine addiction: Behavioural evidence Immunoperoxidase staining in the rat striatum indicates that the MOR and DA receptors are co-localized in neurons (Ambrose et al., 2004). Therefore, it is not surprising that manipulating MOR activity and expression can significantly influence reward behaviours mediated by the striatal DA system. Hence, numerous studies have reported that selective MOR

antagonists (D-Phe-Cys-Tyr-D-Trp-Arg-Thr-Pen-Thr-NH2 (CTAP), D-Phe-Cys-Tyr-D-Trp-Orn-

Thr-Pen-Thr-NH2 (CTOP), and naloxonazine) and preferential MOR antagonists (naloxone and naltrexone) attenuate cocaine-induced sensitization (Houdi et al., 1989; Hummel et al., 2006;

Kim et al., 1997), as well as cocaine-induced CPP (Bilsky et al., 1992; Gerrits et al., 1995; Houdi et al., 1989; Rademacher & Steinpreis, 2002; Schroeder et al., 2007; Suzuki et al., 1992).

Cocaine place preference is also blocked in mice that receive an antisense oligodeoxynulceotide specific to the MOR (Hummel et al., 2006). Furthermore, high doses of methadone maintenance prevent the acquisition and expression of cocaine CPP in rats, as well as attenuate the incubation of cocaine-induced sensitization (Leri et al., 2006; 2012). It has also been demonstrated that the role of the MOR in cocaine-induced place preference is site specific, as the direct injection of

20 CTAP into the NAc and rostral VTA inhibit the development of cocaine CPP (Soderman &

Unterwald, 2007). Moreover, CTAP injection into the NAc, caudal VTA, and CPu, significantly reduces cocaine-induced hyperactivity (Soderman & Unterwald, 2007).

Surprisingly, results from studies using a MOR KO mouse model have not been as consistent as the aforementioned studies. In the MOR KO mouse, cocaine CPP has been found to be increased (Becker et al., 2002), decreased (Hall et al., 2004), and unaffected (Contarino et al.,

2002; Nguyen et al., 2012). On a similar note, MOR KO mice have been reported to have unchanged (Becker et al., 2002; Contarino et al., 2002; Hall et al., 2004; Lesscher et al., 2005) or decreased (Chefer et al., 2004; Yoo et al., 2003) cocaine-induced locomotor activity and locomotor sensitization. These discrepancies may put into question the role of the MOR in cocaine reinforcement and reward that is substantially supported by the pharmacological studies described previously. However, it is important to note that differences in the genetic background of the mouse strain, gender differences, and variations in experimental protocols (i.e. cocaine dose, number of conditioning sessions) may account for the inconsistencies between studies

(Yoo et al., 2012).

The MOR has been implicated in cocaine reinforcement via self-administration studies as well. Systemic administration of naloxone and naltrexone significantly attenuates cocaine self- administration in rats (Corrigall & Coen, 1991; Ramsey et al., 1999). Specifically, it appears that the MOR predominantly acts within the VTA to mediate cocaine self-administration, as infusions of CTOP and naltrexone directly into the VTA reduced this behavior (Corrigall et al.,

1999; Ramsey et al., 1999), and simultaneous infusions of funaltrexamine, a selective MOR antagonist, into the VTA and NAc decreased responding for cocaine self-administration (Ward et al., 2003). In agreement with these findings, injection of the MOR preferring agonist [D-Ala2, N-

21 MePhe4, Gly-ol]-enkephalin (DAMGO), into the VTA produced a leftward shift in the dose- response curve for cocaine self-administration (Corrigall et al., 1999). This suggests an increase in the reinforcing efficacy of cocaine and thus, a role of the MOR in drug reinforcement

(Corrigall et al., 1999). Furthermore, the same methadone treatment that blocked cocaine CPP

(Leri et al., 2006), also blocked operant responding to a cocaine conditioned stimulus in rats

(Leri et al., 2009). The MOR KO mouse model also supports the role of MOR in cocaine self- administration, as there is an observed decrease in responding relative to wild-type (WT) mice

(Mathon et al., 2005).

Despite the large body of evidence supporting the role of the MOR in cocaine-associated behaviours, and the regulation of MOR by cocaine and the DAergic system, the exact mechanism by which this occurs has not been fully elucidated. Several molecular players have been implicated (see above), including the gaseous compound NO.

3.0. The nitrergic system Inflammatory responses and blood vessel reactivity were the first established biological roles of NO (Bredt & Snyder, 1994). However, NO has since been found to be involved in a wide variety of physiological functions in the brain where it plays a role in processes such as synaptic plasticity and memory reconsolidation (Itzhak, 2008; Liddie et al., 2013). These processes have also been implicated in the development and persistence of addiction (Liddie et al., 2013). Thus, the role of NO in the formation of drug-associated memories and drug- conditioned responses is of significant interest.

NO is a gaseous radical that is formed via the oxidative deamination of L-arginine to L- citrulline by the enzyme NO synthase (NOS) (Kuriyama & Ohkuma, 1995). There are three major isoforms of the NOS enzyme. The neuronal (nNOS) and endothelial (eNOS) isoforms are

22 both calcium-dependent and constitutively expressed (Bredt & Snyder, 1994). In contrast, the inducible isoform (iNOS) is not constitutively expressed and is predominantly present in microglia and macrophages (Brenman & Bredt, 1997). Evidently, the primary source of NO in the brain arises from its production by nNOS. Three alternatively spliced transcripts of nNOS

have been identified: nNOSa (160kDa), nNOSb (136kDa), and nNOSg (125kDa) (Brenman &

Bredt, 1997). However, the nNOSa transcript variant accounts for about 95% of total nNOS catalytic activity in the brain (Huang et al., 1993).

The involvement of NO in various physiological processes in the brain is largely demonstrated with the use of NOS inhibitors. The majority of NOS inhibitors are non-selective and act as L-Nw-substituted arginine analogues (Bredt & Snyder, 1994). In addition to their lack of specificity for the nNOS isoform, these non-selective inhibitors have systemic adverse effects including increased blood pressure, decreased cardiac output, and decreased tissue perfusion, which can also influence neuron function (Wong & Lerner, 2015). In contrast, the compound 7- nitroindazole (7-NI) selectively inhibits nNOS via competitive binding to an isoform specific heme group located at the L-arginine binding site, and does not cause arterial vasoconstriction

(Moore et al., 1993).

3.1. Nitric oxide signalling in the brain NO is a key biological intercellular messenger that can activate signaling pathways in pre- and post-synaptic neurons, as well as nearby neurons (see Figure 2) (Vincent, 2010). NO- induced signaling in the brain is dependent on the activation of nNOS by calcium. The nNOS enzyme is linked to the NR2B subunit of the N-methyl-D-aspartate (NMDA) type glutamate receptor via the post synaptic density protein PSD95 (Brenman & Bredt, 1997). Activation of the ionotropic NMDA receptor results in increased calcium influx, and the subsequent binding of

23 calcium to calmodulin (Garthwaite & Boulton, 1995). The calcium-calmodulin complex dephosphorylates nNOS to activate the enzyme, thereby converting L-arginine to L-citrulline and increasing NO production (Lee et al., 2010). Diffusion of NO into the pre-synaptic neuron activates soluble guanylate cyclase (sGC), which increases cyclic guanosine monophosphate

(cGMP) production in order to facilitate glutamate release (Kiss & Vizi, 2001). This process is necessary for early-phase long-term potentiation (LTP) and the formation of short term memories (Kiss & Vizi, 2001).

In the post-synaptic neuron, NO also generates the second messenger cGMP via activation of sGC, in order to initiate two signaling cascades (Garthwaite et al., 1988). 1) cGMP activates adenylate cyclase (AC) to produce the second messenger cAMP. The increased levels of cAMP activate protein kinase A (PKA), which phosphorylates CREB. 2) cGMP directly stimulates protein kinase G (PKG) which phosphorylates ERK 1/2. This triggers the translocation of ERK1/2 to the nucleus, where it phosphorylates CREB (Impey et al., 1998).

Activation of CREB from both pathways stimulates its binding to the CREB response element

(CRE) and following co-activation by CREB-binding protein (CBP), results in altered gene transcription (Guan et al., 2002). These changes in gene transcription modulate a variety of mechanisms, such as late-phase LTP, which in addition to strengthening synapses and facilitating learning and memory, is thought to underlie the development of drug addiction (Liddie et al.,

2013).

24

Figure 2. Summary of NO signaling in pre- and post-synaptic neurons. NMDA receptor activation stimulates NO production via nNOS in the post-synaptic cell. NO can act at the site of synthesis or in the pre-synaptic cell, and activates sGC to generate the second messenger cGMP. In the pre-synaptic terminal, cGMP stimulates glutamate release, as well as activates PKG. PKG subsequently phosphorylates ERK1/2, which then translocates to the cell nucleus, where it activates CREB by phosphorylation. pCREB mediates gene transcription necessary for LTP and memory formation. The same signaling pathway is activated in the post-synaptic terminal. Additionally, in the post-synpatic neuron, cGMP stimulates AC to increase cAMP production. cAMP activates PKA, which then translocates to the cell nucleus and phosphorylates CREB. Figure adapted and modified from Liddie et al. (2013) Current Pharmaceutical Design, 19:7092- 7102.

3.2. The effect of cocaine on the nitrergic system Reports consistently indicate that cocaine administration upregulates the nitrergic system in areas of the brain associated with drug reinforcement and reward. For instance, mice that receive chronic cocaine treatments have 82% more nNOS positive neurons in the Hp, relative to control mice (Yoo et al., 2006). Similarly, repeated cocaine injections increase the expression of nNOS neurons in the CPu of mice by 96% (Balda et al., 2008). However, the same finding is not

25 observed in the NAc or in the brains of adolescent mice (Balda et al., 2008). Chronic cocaine administration also increases total brain nNOS activity by about 59% in rats; a result that persists into withdrawal (Vitcheva et al., 2015). Furthermore, it appears that this cocaine-induced increase in nNOS activity mediates withdrawal symptoms and oxidative stress throughout the brain, as these effects are blocked by pre-treatment with 7-NI (Vitcheva et al., 2015). In support of these findings, an increase in nNOS activity in the mouse cortex was observed following chronic cocaine injections and 48 hours into drug withdrawal (Bhargava & Kumar, 1997). Thus, it is clear that cocaine enhances both the expression and activity of the nNOS enzyme. As such, it is not surprising that cocaine has been associated with increased NO efflux in the brain as well.

Several studies have used microelectrodes in vivo to confirm this cocaine-mediated increase in NO production. In the rat PFC, acute systemic cocaine administration results in a time-dependent increase in NO efflux, and reaches maximal levels 45 minutes following drug treatment (Sammut & West, 2008). Pre-treatment with 7-NI almost completely blocks this cocaine-induced NO efflux, thus indicating that the NO production is predominantly derived from neuronal sources (Sammut & West, 2008). Conversely, an acute systemic cocaine injection does not enhance NO production in the CPu (Koh et al., 2008). However, an increase in NO efflux in the CPu is observed with chronic cocaine administration (Koh et al., 2008). This is supported by Lee et al. (2010), who reported that seven days of cocaine injections also results in a significant increase in NO efflux in the rat CPu. Additionally, this effect is prevented with the pharmacological inhibition of nNOS (Lee et al., 2010). Therefore, it is likely that cocaine’s modulation of the nitrergic system is brain region specific and dependent on the dosing schedule

(Koh et al., 2008; Lee et al., 2010; Sammut & West, 2008).

The exact molecular mechanism by which cocaine upregulates nNOS activity and NO

26 production is not known. However, evidence indicates that the mechanism likely involves the

DAergic and glutamatergic systems. Specifically, D1 receptor antagonists (Lee et al., 2010;

Morris et al., 1997; Sammut et al., 2006; Yang et al., 1999), D2 receptor agonists (Lee et al.,

2010; Morris et al., 1997; Sammut et al., 2007), and NMDA receptor antagonists (Lee et al.,

2010; Morris et al., 1997) significantly reduce the cocaine-induced NO efflux in the rat striatum and Hp. Furthermore, an electrophysiological study found that D1 receptor agonists robustly enhance the firing activity of nNOS interneurons in the rat striatum (Centonze et al., 2002).

Double-labeling immunocytochemistry also illustrated co-localization of nNOS interneurons and

D1/D5 receptors throughout the striatum (Rivera et al., 2002). Thus, it is hypothesized that cocaine indirectly activates nNOS via the amplification of the DAergic and glutamatergic systems.

Interestingly, nNOS KO mice express lower basal levels of tyrosine hydroxylase (TH) neurons in the VTA, relative to WT mice (Balda et al., 2009). TH is the rate-limiting enzyme in catecholamine biosynthesis. With repeated cocaine administration, there is a further reduction in the expression of TH neurons in the nNOS KO mice, while WT mice show a significant increase in TH expressing neurons (Balda et al., 2009). Overall, these results indicate a reciprocal relationship: that cocaine effects likely necessitate nNOS expression and that nNOS may contribute to the regulation of DA synthesis (Balda et al., 2009).

3.3. The role nitric oxide in cocaine-motivated behaviours Substantial focus has been placed on how this cocaine-induced NO efflux contributes to the expression of cocaine-mediated behaviours. The CPP paradigm has been especially vital in solidifying the major role of NO in the formation and reconsolidation of drug-associated memories. Inhibition of NOS activity has been reported to reduce or block the CPP of many

27 drugs of abuse, including morphine (Kivastik et al., 1996; Karami et al., 2002; Shen et al., 2012;

2014), ethanol (Itzhak et al., 2009), methamphetamine (Li et al., 2002), and nicotine (Martin &

Itzhak, 2000), in both mice and rats. As such, the same results follow for cocaine-induced CPP.

Both non-selective NOS inhibition (Kim & Park, 1995) and selective nNOS inhibition (Balda et al., 2006; Itzhak et al., 1998; 2008; Itzhak & Anderson, 2007) attenuate the development of cocaine CPP in mice. These findings are supported by studies using nNOS KO mice, which exhibit a resistance to cocaine CPP, as well as reinstatement by cocaine priming (Balda et al.,

2006; Itzhak et al., 1998; Itzhak & Anderson, 2007). Furthermore, cocaine-induced CPP is acquired by male nNOS KO mice during adolescence, however it is not maintained nor reinstated by cocaine priming in adulthood (Balda et al., 2006). Moreover, when male nNOS KO mice are administered molsidomine, an NO donor, immediately following conditioning, a short- lived expression of cocaine place preference is observed (Itzhak, 2008). Interestingly, resistance to cocaine CPP is not observed in female nNOS KO mice, and their behaviour is not significantly different from WT mice (Balda et al., 2006). This suggests that the neural plasticity involved in cocaine reinforcement may occur via an nNOS-independent mechanism in females.

The role of nNOS in CPP maintenance has also been examined. Itzhak & Anderson

(2007) conditioned WT mice with cocaine and administered 7-NI only prior to retrieval (i.e. testing). Although the mice express an immediate place preference, this CPP is completely abolished on subsequent testing eight and fifteen days later (Itzhak & Anderson, 2007). A follow-up study examined the effect of nNOS inhibition immediately after retrieval and found that this effectively prevents future cocaine priming injections from reinstating the place preference (Itzhak, 2008). Therefore, this evidence supports the role of nNOS in LTM formation of cocaine-associated cues and in memory reconsolidation. In line with these results,

28 administration of the NO analogue L-arginine, either systemically or directly into the NAc, but not in the VTA of rats, produces a significant place preference (Sahraei et al., 2004).

Additionally, pre-treatment with a non-selective NOS inhibitor completely abolished the L- arginine-induced CPP (Sahraei et al., 2004). As such, NO efflux in the NAc may be involved in mechanisms of reward and reinforcement.

NO production is also involved in cocaine self-administration. Pre-treatment with a non- selective NOS inhibitor significantly reduced responding for cocaine self-administration in a dose-dependent manner (Collins & Kantak, 2002; Orsini et al., 2002; Pudiak & Bozarth, 2002;

Pulvirenti et al., 1997), with the highest dose of the inhibitor decreasing self-administration responding by 50% (Collins & Kantak, 2002). Similar results were reported when a NOS inhibitor was administered one hour into a three hour self-administration session; a decrease in cocaine self-administration was observed, as well as an increase in the inter-response time between successive cocaine injections (Pudiak & Bozarth, 2002).

A substantial number of studies have focused on the effect of NOS inhibition on cocaine sensitization as well. Behavioural sensitization is the observed enhancement in locomotor activity and stereotypic behaviour that develops with repeated psychostimulant administration

(Ago et al., 2008). Non-selective NOS inhibition (Bhargava & Kumar, 1997; Haracz et al., 1997;

Pudiak & Bozarth, 2013) and selective nNOS inhibition (Haracz et al., 1997; Nasif et al., 2010) attenuated cocaine-induced locomotor sensitization, but did not block cocaine conditioned locomotor activity (Pudiak & Bozarth, 2013). Whereas, nNOS KO mice exhibited no behavioural sensitization or conditioned locomotion induced by cocaine (Itzhak et al., 1998).

Additionally, Nasif et al. (2010) found that 7-NI pre-treatments prevented the cocaine-induced increase in membrane excitability of PFC neurons in rats. Therefore, it is hypothesized that NO

29 is necessary for the dysregulation of PFC activity that occurs with chronic cocaine administration, which may then subsequently contribute to the development of behavioural sensitization (Nasif et al., 2010). However, the role of NO in the VTA has also been implicated.

Specifically, daily infusions of 7-NI into the VTA blocked the development of cocaine-induced locomotor sensitization (Byrnes et al., 2000). Conversely, nNOS inhibition in the VTA did not alter the locomotor activity induced by acute cocaine administration (Byrnes et al., 2000).

Other cocaine-associated behaviours have been linked to NO production as well, including cocaine kindling (i.e. increased sensitivity to the convulsive effects of cocaine) (Itzhak,

1996) and the discriminative stimulus effects of cocaine (Collins et al., 2001).

3.4. The link between the cocaine-induced nitric oxide efflux and the endogenous opioid system Only a couple of studies have investigated the connection between the EOS and NO production in the context of cocaine addiction. The first study found that chronic cocaine administration in WT mice produces an 82% increase in nNOS positive cells in the Hp, whereas

MOR KO mice only show a 54% increase in Hp nNOS expression (Yoo et al., 2006). Therefore, this observed attenuation may support a small role for the EOS in the regulation of the nitrergic system.

On the other hand, the second study suggests regulation of opioid receptor expression by

NO. Winick-Ng et al. (2012) pre-treated PC12 cells with 20mM of the non-selective NOS inhibitor, L-NAME, one hour prior to cocaine exposure. Two treatment models were used; cells were administered either a single continuous cocaine treatment (SCT) (500µM) or repeated intermittent treatments (RIT) (100µM) consisting of three daily 30 minute treatments with cocaine for 72 hours. Results indicated that NOS inhibition attenuated the increase in MOR

30 mRNA levels by RIT, as well as the increase in MOR protein expression by SCT and RIT

(Winick-Ng et al., 2012). This suggests that in vitro, NO may modulate MOR expression at the transcriptional, translational, and/or post-translational level (Winick-Ng et al., 2012). However, the exact mechanism by which this occurs, and whether these results can be replicated in vivo, has not been elucidated.

As previously discussed (see section 1.3 and 3.1), cocaine mediates NO efflux, which subsequently induces ERK1/2 and CREB activation to modulate gene transcription.

Additionally, stimulation of ERK1/2 and CREB in the NAc has been reported to alter the gene transcription of the receptors and ligands of the EOS (Duraffourd et al., 2014; Muschamp &

Carlezon, 2013). However, whether the NO-mediated activation of the ERK1/2/CREB pathway is connected to the cocaine-induced increase in MOR expression is unknown. Thus, the link between the nitrergic system and the MOR in cocaine addiction requires further investigation.

31 Rationale Cocaine is used by an estimated 18.2 million people worldwide and abuse of this drug incurs about $181 billion in annual societal costs in Canada alone (CCSA, 2015; Gorelick,

2017). Thus, cocaine addiction is a national public health problem for which there are no effective pharmacological treatments or vaccines. Furthermore, psychosocial treatments have limited efficacy, with cognitive-behavioural approaches being most common and leading to some level of reduced drug use (Farranato et al., 2013). However, overall a large percentage of cocaine addicts eventually relapse, even following long periods of drug abstinence (Koob et al.,

2004). This emphasizes the urgent need for new therapeutic strategies. Although significant advances in our understanding of the neurobiology of addiction have been made, there are several factors that complicate the development of successful treatments. For instance, the majority of cocaine addicts abuse other illicit drugs and/or have co-morbid psychiatric illnesses

(Gorelick, 2017). Additionally, drug addiction is influenced by a combination of genetic, epigenetic and environmental factors, and persistent drug-induced neurochemical alterations in the brain (Noble et al., 2015). Moreover, our knowledge of the cellular and molecular mechanisms responsible for these long-term neuroadaptations and their role in compulsive drug- seeking behaviour is somewhat limited.

One such neuroadaptation that has received attention as a potential target for pharmacotherapies is the cocaine-induced increase in MOR expression. Human brain imaging studies demonstrate increased MOR expression in brain reward regions positively correlates with drug craving, vulnerability to relapse, and poor treatment outcome (Ghitza et al., 2010; Gorelick et al., 2005; Zubieta et al., 1996). A substantial number of animal studies also implicate the

MOR in mediating cocaine reinforcement and reward (Bilsky et al., 1992; Gerrits et al., 1995;

Houdi et al., 1989; Hummel et al., 2004; Kim et al., 1997; Leri et al., 2006; 2009; Rademacher &

32 Steinpreis, 2002; Schroeder et al., 2007; Suzuki et al., 1992). Although the exact molecular mechanism by which cocaine modulates MOR expression is unknown, in vitro evidence suggests that NO is involved (Winick-Ng et al., 2012). It is well established that cocaine administration elicits NO efflux, and elevates nNOS activity and expression, in brain reward regions (Balda et al., 2008; Koh et al., 2008; Lee et al., 2010; Sammut & West, 2008). NO also appears to be critical in cocaine reinforcement and cue-associated learning (Balda et al., 2006; Kim & Park,

1995; Itzhak et al., 1998; 2008; Itzhak & Anderson, 2007).

As such, this study aimed to investigate whether nNOS modulates the cocaine-induced

MOR expression in vivo, specifically in the NAc, and plays a role in cocaine reward, as measured by CPP. As the cocaine-induced increase in MOR expression is associated with an individual’s vulnerability to relapse, elucidation of the molecular mechanism responsible for this neuroadaptation may help identify upstream targets for pharmacotherapies that effectively reduce drug cravings and risk of relapse.

The involvement of NO was assessed via pharmacological nNOS inhibition with 7-NI.

As previously mentioned, 7-NI does not produce systemic adverse effects and selectively inhibits the predominant NOS isoform in the brain, nNOS. Additionally, previous studies have shown that 7-NI is effective at inhibiting cocaine-induced NO production and blocking cocaine- associated behaviours in mice (Balda et al., 2006; 2008; Itzhak et al., 1998; 2008; Itzhak &

Anderson, 2007; Kalisch et al., 1996; Sammut & West, 2008). Therefore, 7-NI was selected as an appropriate inhibitor. It has also been accepted that different cocaine dosing schedules can have varying molecular effects on the brain (Nobel et al., 2015). For this reason, MOR and nNOS expression following both acute and sub-chronic cocaine dosing schedules were examined in this study. In this study, acute cocaine administration is defined as a single cocaine injection,

33 whereas sub-chronic cocaine dosing is defined as four cocaine treatments given 48 hours apart.

Furthermore, a rat model was used to complete this study as our laboratory has previously demonstrated a cocaine-induced increase in MOR mRNA in the rat NAc (Leri et al., 2006;

2009), as well as the effect of nNOS inhibition on the development of cocaine CPP in rats has never been investigated. However, as rats have a different distribution of NOS-containing neurons compared to mice (Ng et al., 1999), it is important to confirm that results from a mouse and rat model coincide.

Although multiple brain regions were extracted and biochemically examined, only results from the rat NAc will be discussed in the following sections. For results from the CPu, Hp, and

PFC, see the appendix: supplementary data.

34 Hypothesis Cocaine induces an increase in MOR expression via a NO-dependent mechanism and this neuroadaptation plays a role in the expression of cocaine-induced place preference.

Objectives 1. Assess the effect of an acute cocaine injection on MOR and nNOS expression in the NAc

2. Determine the effect of systemic nNOS inhibition on cocaine-induced place preference

3. Determine the impact of systemic nNOS inhibition on ‘subchronic’ cocaine-induced

expression of the MOR and nNOS in the NAc

35 Materials and Methods

Materials TRIzol Reagent, DNAse I, oligo dT, SuperScript II, primers, Platinum Taq, Power SYBR Green

Master Mix, the rabbit polyclonal MOR antibody, the goat anti-rabbit secondary antibody, and the goat anti-mouse secondary antibody were purchased from ThermoFisher Scientific (Ottawa,

ON). Cocaine HCl was from Dumex (Toronto, ON, Canada), and 7-nitroindazole and b- mercaptoethanol were from Sigma Aldrich (St. Louis, MO, USA). The rabbit b-actin polyclonal antibody was purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA), and the mouse monoclonal nNOS was obtained from Novus Biologicals Canada (Oakville, ON, Canada) or ThermoFisher Scientific (Ottawa, ON, Canada). The enhanced chemiluminescence (ECL) kit, and the Protein Assay Dye Reagent Concentrate and nitrocellulose membranes were obtained from Bio-Rad Laboratories (Mississauga, ON, Canada). All remaining molecular or electrophoresis chemicals were from Fisher Scientific (Ottawa, ON) or DiaMed Laboratories

(Mississauga, ON).

Subjects A total of 96 male Sprague-Dawley rats (Charles River, QC, Canada) were used as subjects.

Animals were singly housed and weighed 175-200 grams at the beginning of all experiments.

Upon arrival, the animals were given one week to acclimate to the Central Animal Facility. They were maintained on a twelve-hour reverse light/dark cycle (0700h lights off; 1900h lights on) with free access to water and food (Purina rat chow 18% protein) except during behavioral testing, which was always conducted during the dark cycle. All experiments were approved by the Animal Care Committee of the University of Guelph and were carried out in accordance with the recommendations of the Canadian Council on Animal Care.

36 Drugs Cocaine HCl (Dumex, Toronto, ON) was dissolved in 0.9% physiological saline and injected intraperitoneally (IP) at a volume of 1 mL/kg. A dose of 20 mg/kg of cocaine was selected as it produces a robust place preference in rats (Leri et al., 2006; Stitch et al., 2010). The

7-NI (Sigma Aldrich, St. Louis, USA) was made fresh before use, suspended in peanut oil

(Itzhak, 1996; Kalisch et al., 1996), and administered IP at a volume of 1mL/kg. The lowest dose of 7-NI (25 mg/kg) was chosen as it was found to block cocaine-induced place preference in mice (Itzhak et al., 1998). The highest dose of 7-NI (50 mg/kg) was selected because it was found to maximally inhibit nNOS activity in all rat brain regions (Kalisch et al., 1996).

Testing Apparatus

Activity Chambers/Conditioned Place Preference Six, custom made conditioning boxes (University of Guelph, Guelph, ON) were used in these experiments, as described previously (Stitch et al., 2010). The boxes were constructed of semitransparent Plexiglas and comprised of two large compartments (30 x 40 x 26 cm3). These compartments were separated by a removable dark grey polyvinyl chloride (PVC) insert with or without a small square opening (10 x 10 cm) at the back. The compartments were distinct in visual (marbled white and black pattern on the wall of one compartment and vertical white and black stripes on the wall of the other; objects external to the boxes included tables, cabinets, and computers) and tactile cues (one compartment contained a black ceramic floor tile), which remained constant throughout the experiment. The front of each compartment was covered in black wire mesh allowing for automatic video tracking (EthoVision v3, Noldus, The

Netherlands). When the inserts with the openings were used, a virtual transition zone was created with the software (approximately the size of a 400 gram rat); this ensured statistical

37 independence of measures taken in the two compartments. These measures included locomotor activity (cm) and time (s) spent active during preference testing.

Biochemical Assays

Quantitative Polymerase Chain Reaction (qPCR) analysis In experiment 1, rats were decapitated either 24 hours, 48 hours, or 72 hours, following cocaine administration. In experiment 2, rats were decapitated 72 hours after receiving the last drug administration. This time point was chosen based on the results from experiment 1 and

findings reported by Azaryan et al. (1998). All animals were exposed to CO2 for 30 seconds prior to decapitation. Immediately following decapitation, brains were placed ventral side up, in an ice-cold brain matrix, and the optic chiasm was identified as a landmark for bregma. Coronal slices were then made at +5.0, +3.0, and +1.0 mm anterior to bregma and -1.0 mm posterior to bregma. All coronal sections were immediately placed on an ice-cold glass petri dish and the

NAc, CPu, PFC, and Hp were extracted with a scalpel. All tissue was rapidly frozen on dry ice, and stored at -80°C until subsequent processing. The tissue was homogenized in the following volumes of TRIzol reagent (Invitrogen, Missisauga, ON): 1 mL for the PFC, 1.5 mL for the NAc and CPu, and 3 mL for the Hp. Samples were incubated at room temperature for 5 minutes and then centrifuged at 4°C and 17,530 g for 15 minutes. The supernatant was transferred to a 1.5 mL

Eppendorf tube and 200µL of chloroform/mL of TRIzol reagent used, was added. Next, the

Eppendorf tubes were vortex mixed for 15 to 30 seconds, incubated at room temperature for 2 to

3 minutes, and centrifuged at 4°C and 17,530 g for 15 minutes. Approximately 500µL of colourless aqueous phase was then transferred to a new 1.5 mL Eppendorf tube. The organic phenol-chloroform phase was stored at -20°C until protein was ready to be isolated (see below).

RNA precipitation was achieved with the addition of 500µL of 100% RNase-free

38 isopropanol/mL of TRIzol reagent used. Precipitation occurred overnight at -20°C. Samples were then centrifuged at 4°C and 17,530 g for 10 minutes. The supernatant was removed, followed by the washing and vortex mixing of the RNA pellet with 1 mL of 75% ethanol. The samples were once again centrifuged at 4°C and 6,854 g for 5 minutes, the supernatant was decanted, and the

RNA pellets were air-dried for 15 to 20 minutes. The dried pellets were re-suspended in 20 to

30µL of RNase-free water, incubated on ice for 10 minutes, and stored at -20°C until quantitation.

For RNA quantitation, the purity and concentration of each sample was determined by the absorbance at 230/260nm and 260/280nm using a spectrophotometer to calculate the dilution in µg RNA/mL (GeneQuant Pro). Only samples with a ratio of 1.7 to 2.0 for the 260/280 absorbance value were used. For the reverse transcription of RNA to complementary DNA

(cDNA), 2µg of RNA from each sample was mixed with RNase-free water to create a final volume of 8µL. To degrade any genomic DNA that may have been extracted with the RNA, 1µL of DNase 10X buffer (ThermoFisher Scientific) was added to each sample, followed by 1µL of

DNase Amp Grade I (ThermoFisher Scientific). Following a twelve minute incubation at room temperature, 1µL of 20mM ethylenediaminetetraacetic acid (EDTA) (ThermoFisher Scientific) was added and samples were incubated at 65°C for 10 minutes. Each sample then received 1µL of Oligo dT (ThermoFisher Scientific), the samples were mixed, and incubated at 70°C for 10 minutes, followed by 4°C for 4 minutes. To each sample, 7.5µL of superscript mix (4µL of 5X first strand buffer, 2µL of 0.1M dithiothreitol (DTT), and 1.5µL of 10mM dNTPs; ThermoFisher

Scientific) was added. After heating the samples to 43°C for 2 minutes, 1.5µL of superscript II

(ThermoFisher Scientific) was added to every sample, followed by incubation at 43°C for 75

39 minutes and 94°C for 4 minutes. Finally, each sample was brought to a final volume of 40µL by adding 19µL of RNase-free water, and the samples were frozen at -20°C.

To perform PCR and qPCR, the cDNA samples prepared from the reverse transcription

(RT) of the RNA samples were used. For PCR, 5µL of each RT product was combined with

45µL of PCR master mix (5µL of 15mM MgCl2, 1µL of 10mM dNTPs, 5µL of 5µM 5’ and 3’ primers, 5µL of 10X PCR buffer, 23.8µL of RNase-free water, and 0.2µL of Platinum Taq;

ThermoFisher Scientific). Contamination was assessed using a 5µL aliquot of RNase-free water as a PCR control. Hypoxanthine-guanine phosphoribosyltransferase (HPRT; located on the X chromosome) was used as a control housekeeping gene and was based on previous studies from our laboratory that have used rat tissue (Mitchnick et al., 2016). Primers (ThermoFisher

Scientific) for HPRT, MOR, and nNOS were designed with NCBI-Primer Blast to yield the forward and reverse primers: HPRT (132 base pairs; bp): F 5´-

TCCTCATGGACTGATTATGGACA-3´, R 5´-TAATCCAGCAGGTCAGCAAAGA-3 ´ as used in other studies from our lab (Mitchnick et al., 2015; Mitchnick et al., 2016), MOR (179 bp): F 5’-GCCCTCTACTCTATCGTGTGTGTA-3’,

R 5’-GTTCCCATCAGGTAGTTGACACTC-3’ as previously studied (Bannister et al., 2011), and nNOS (179 bp): F 5’- GACAACGTTCCTGTGGTCCT-3’,

R 5’-TCCAGTGTGCTCTTCAGGTG-3’ as previously studied (Mahairaki et al, 2009). The cycling conditions for all genes were as follows: 40 cycles of 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 45 seconds (Bio-Rad Thermocycler). The PCR products were then resolved on a 1.5% agarose gel (1.8g agarose, 2.5mL 50X tris acetic acid EDTA (TAE) buffer,

117.5mL water, and 4.8µL ethidium bromide). Loading dye was added to all samples and the

100bp DNA ladder prior to adding them to the wells of the gel. PCR products were separated at

40 90V for 1 hour (Bio-Rad Electrophoresis), and visualized using the Pharmacia Biotech

ImageMaster VDS.

Once all genes were qualitatively detected using PCR, qPCR was used to assess the quantitative changes in gene expression. To detect the HPRT gene, 1µL of RT product was added to 9µL of qPCR master mix (5µL Power SYBR Green; Life Technologies, 3µL RNase- free water, 0.5µL of 10µM forward and reverse primers). To detect the MOR and nNOS genes,

2µL of RT product was combined with 8µL of qPCR master mix (5µL Power SYBR Green; Life

Technologies, 2µL RNase-free water, 0.5µL of 10mM forward and reverse primers). Using a 96- well plate, samples were run using the Step One Plus Real-Time PCR System (Applied

Biosystems). The cycling conditions for qPCR were as follows: HPRT: 40 cycles of 95°C for 15 seconds, 60°C for 60 seconds; MOR: 40 cycles of 95°C for 15 seconds, 60°C for 60 seconds,

77°C for 15 seconds; nNOS: 40 cycles of 95°C for 15 seconds, 60°C for 60 seconds, 80.5°C for

15 seconds.

Immunoblot analysis Protein was isolated from the organic phenol-chloroform phase collected during RNA isolation (see above). The DNA was precipitated out of each sample by adding 0.3mL of 100% ethanol/mL of TRIzol initially used. The Eppendorf tubes were inverted for mixing, incubated at room temperature for 2 to 3 minutes, and centrifuged at 2,000 g for 5 minutes at 4°C.

Approximately 500µL of the phenol-ethanol supernatant was then transferred to a new 2mL

Eppendorf tube. To each sample, 1.5mL of 100% RNase-free isopropanol/mL of TRIzol used, was added. Next, samples were incubated at room temperature for 10 minutes, followed by centrifugation at 12,000 g for 10 minutes at 4°C and decantation of the supernatant. The protein

41 pellets were then washed three times with 2mL of wash solution (0.3M guanidine hydrochloride in 95% ethanol). In each wash, samples were incubated at room temperature for 20 minutes, centrifuged at 7,500 g for 5 minutes at 4°C, and the wash solution discarded. After the final wash, 2mL of 100% ethanol was added, and the samples were mixed and incubated at room temperature for 20 minutes, and centrifuged at 7,500 g for 5 minutes at 4°C. Following removal of the ethanol wash, the protein pellets were air-dried for 5 to 10 minutes, and then re-suspended in 200µL of a 1:1 solution of 1% sodium dodecyl sulfate (SDS) and 8M urea in Tris-HCl, pH

8.0. To solubilize the proteins pellets, 5 cycles of 15 seconds of sonication (Model 100

Ultrasonic Dismembrator, Thermo Fisher – 100 watts, ultrasonic frequency 22.5kHz) and 30 seconds of ice incubation was completed for all samples, as previously described by Simoes et al

(2013). Next, the samples were centrifuged at 3,200 g for 10 minutes at 4°C, to sediment any insoluble material. The supernatant containing the solubilized protein was transferred to a fresh

1.5mL Eppendorf tube and stored at -20°C until protein quantification.

Protein concentration was determined using the Bradford method (Bradford, 1976). This method involved the addition of Protein Dye Reagent Concentrate (Bio-Rad) to a diluted aliquot of each sample and its subsequent absorbance measurement at 595nm (EL311 Microplate

Autoreader, Biotek Instruments Inc., VT, USA). Bovine serum albumin (Roche) was used at a standard and the protein concentrations were calculated from interpolation of absorbance on a linear regression standard curve.

Protein extracts from the tissue lysates (40µg/sample) were separated using a 10% SDS polyacrylamide gel electrophoresis (SDS-PAGE). A two-thirds concentration of protein and water was combined with a one-third concentration of loading dye consisting of Laemmlli buffer

(final concentration: 6% SDS, 0.1875 M Tris-HCl pH 6.8, 30% glycerol and 0.015%

42 bromophenol blue) and 2-mercaptoethanol (0.075 mL Laemmlli buffer; Sigma). Samples were then heated at 99°C for 5 minutes, briefly centrifuged, and loaded onto the SDS-PAGE in a Dual

Vertical Slab Gel Electrophoresis system (Hoefer). Protein extracts were separated for 6 hours by electrophoresis at a current of 25mA/SDS-PAGE or overnight by electrophoresis at a current of

6mA/SDS-PAGE or until sufficient separation was visible. Following electrophoresis, the gels and nitrocellulose membranes (Bio-Rad) were equilibrated in transfer buffer (final concentration:

48mM Tris, 0.39 M glycine, 2% SDS, and 20% methanol) for 15 minutes, and the proteins then transferred onto the membranes using a semi-dry transfer apparatus (Bio-Rad) run at 20V for 90 minutes. The resulting membranes were cut at the 100kDa band and the 50kDa molecular weight markers indicated by the protein standard, and then blocked for 1.5 hours in 5% non-fat milk dissolved in tris-buffered saline (TBS) containing 0.1% Tween-20 (TBS-T). Following a quick rinse with TBS-T, the blocked membranes were incubated overnight at 4°C in primary antibodies specific for: b-actin (1:2000 rabbit polyclonal b-actin I-19 antibody in 5% milk in

TBS-T, Santa Cruz), MOR (1:1000 rabbit polyclonal MOR 44-308G antibody in 5% milk in

TBS-T, ThermoFisher Scientific), and nNOS (1:1000 mouse monoclonal nNOS MAB2416 antibody in 5% milk in TBS-T, Novus or 1:500 mouse monoclonal nNOS 3G6B10 antibody in

5% milk in TBS-T, ThermoFisher Scientific). Blots were then rinsed twice with TBS-T for 5 minutes, and incubated for 1 hour at room temperature in either: 1:2500 goat anti-rabbit or goat anti-mouse IgG-horseradish peroxidase (HRP)-conjugated secondary antibody (ThermoFisher

Scientific) in 5% non-fat milk in TBS-T. The blots were then rinsed four times in TBS-T (2 x 5 minutes, 2 x 10 minutes) and bands were visualized with the addition of equal volumes of enhanced chemiluminescence reagents (ECL1/2, Bio-Rad), followed by scanning using a

ChemiDoc MP imaging system (Bio-Rad).

43 Procedures

Experiment 1: Cocaine-induced locomotor activity Animals were handled for a minimum of six days before the beginning of the experiment.

Rats were injected with 0 or 20 mg/kg of cocaine and immediately placed in activity chambers, as previously described (Leri et al., 2009; Minhas & Leri, 2014). Horizontal and vertical activities were recorded for 2 hours.

Experiment 2: Effect of nNOS inhibition on the development of cocaine CPP Animals were handled for a minimum of six days before the beginning of the experiment.

As rats generally express a bias for one compartment over the other during the pre-conditioning sessions, a biased CPP procedure was used. By assigning the non-preferred side as the drug- paired compartment, any initial preferences that may affect the conditioning procedure would be eliminated. Rats were first habituated to the conditioning boxes for 20 minutes. The compartment that the rat spent less time in by at least one second, was selected as the cocaine- paired compartment. This criterion for selecting the less preferred compartment strengthens the support that the animal showed a preference for one compartment over the other due to the rewarding properties of the drug rather than a natural preference for a particular chamber.

The following day, rats were injected with either 0 (peanut oil vehicle), 25, or 50 mg/kg of 7-NI and placed in a novel cage for 30 minutes, allowing for maximal nNOS inhibition by 7-

NI following systemic administration (Kalisch et al., 1996). Rats were then injected with either 0

(saline vehicle) or 20 mg/kg of cocaine and immediately confined to the least preferred compartment for 30 minutes. This occurred four times in total (i.e. 4 vehicle and 4 cocaine- pairings, over 8 days). Thus, overall this experiment included 6 groups (n=8/group): pre- treatment with 0 mg/kg of 7-NI conditioned with 0 or 20 mg/kg of cocaine, pre-treatment with

44 25 mg/kg of 7-NI conditioned with 0 or 20 mg/kg of cocaine, and pre-treatment with 50 mg/kg of 7-NI conditioned with 0 or 20 mg/kg of cocaine. The day after the last conditioning session, the place preference of the rats was tested for 20 minutes. The time difference spent in the cocaine-paired compartment from habituation to test was used as an index of place preference.

Data and Statistical Analyses For place preference, time spent in the drug-paired (cocaine) compartment on habituation and test sessions in different groups was compared using a two-factor Analysis of Variance

(ANOVA). Locomotor activity was also analyzed by two-factor ANOVA. In case of significant main effects or interactions, individual mean differences were identified by multiple comparisons using the Bonferroni method (a=0.05). The details of non-significant statistics are not reported.

For qPCR analysis, relative mRNA levels were determined using the delta-delta Ct

method of analysis. A threshold cycle (CT) was determined for each data point. A ratio was then determined for each sample using the following formula:

Ratio = 2[CT(HPRT) – CT(GENE)]

where CT(GENE) was the gene of interest and CT(HPRT) was the CT value for HPRT. Each data point was then expressed relative to the control sample.

For immunoblotting analysis, each band was analyzed densitometrically. To account for variability between blots, all bands were expressed as a percentage of the total amount of protein on the entire blot. MOR and nNOS protein levels were normalized to b-actin levels within the same sample. Protein and mRNA analysis of MOR and nNOS levels were analyzed independently by one-factor ANOVA. In case of significant main effects, individual mean differences were determined by multiple comparisons using a Dunnett’s test (a=0.05).

All data analyses were performed using GraphPad Prism 7.0 (GraphPad Software Inc.)

45 and are presented as the mean ± standard error of the mean (SEM).

Results

Experiment 1: The effect of acute cocaine administration on locomotion, and MOR and nNOS mRNA and protein expression in the NAc To assess the time-course of acute cocaine effects, locomotor activity was measured within two hours of a single dose of 20 mg/kg cocaine, and MOR and nNOS mRNA and protein levels were quantified 24, 48, and 72 hours post-injection.

Cocaine-induced locomotor activity In a 2 hour test, the two-factor ANOVA identified significant main effects of treatment group [F (1, 22) = 20.62, p = 0.0002] and time post-injection [F (11, 242) = 29.66, p < 0.0001].

Multiple comparisons indicated significantly increased locomotor activity in the cocaine treated animals, relative to vehicle treated animals, between 10 and 40 minutes, 60 and 90 minutes, and at 110 minutes post-injection (p<0.05) (Figure 3).

Qualitative detection and quantification of MOR and nNOS mRNA The mRNA expression of HPRT, MOR, and nNOS were confirmed in the rat NAc tissue

(Figure 4). Based on their qualitative presence, quantitative changes in mRNA expression were further characterized using qPCR.

Figure 5 represents the time-dependent quantitative changes in (A) MOR and (B) nNOS mRNA expression in the rat NAc following a single cocaine injection (20 mg/kg), as determined by qPCR. In regards to MOR mRNA expression, the ANOVA revealed a significant effect of treatment [F (3, 20) = 4.214, p = 0.0183] and multiple comparisons indicated a significant 3.4-

46 fold and 3.2-fold increase in steady-state MOR mRNA levels in the NAc at 24 and 48 hours post-injection, respectively, relative to levels detected in the NAc of vehicle treated animals

(p<0.05). There was also an observed 2.6-fold increase in MOR mRNA at 72 hours post- injection, however this was not quite statistically significant.

The ANOVA for nNOS mRNA expression indicated a significant effect of treatment [F

(3, 20) = 3.844, p = 0.0253] and multiple comparisons identified a significant 2.7-fold increase

24 hours post-injection (p<0.05), and a 2.4-fold increase that approached significance (p=0.0529)

48 hours post-injection, in the NAc of cocaine treated rats relative to vehicle treated animals.

Expression levels returned to control levels by 72 hours post-treatment.

MOR and nNOS protein expression The time course of altered MOR and nNOS protein expression in the rat NAc following an acute cocaine treatment (20 mg/kg) was examined with immunoblotting followed by densitometric analysis. Representative western blots depicting the changes in (A) MOR and (B) nNOS protein expression in NAc extracts are shown in Figure 6. The ANOVA revealed a significant effect of treatment [F(3, 20) = 4.635, p = 0.0128] on MOR protein expression.

Multiple comparisons indicated a significant 1.8-fold increase at 72 hours post-cocaine treatment

(p<0.05), and a trend toward an increase (1.6-fold) in MOR protein levels at 48 hours post- injection (p=0.0789) (Figure 6C). There also appeared to be a correlation between MOR protein expression and time following treatment (R2= 0.89), suggesting MOR protein levels continue to increase over time following a single cocaine injection.

During immunoblotting, it was observed that the nNOS protein could not be detected in six of the protein samples, despite being able to detect other proteins of interest, an even b-actin distribution, and running the samples multiple times. Thus, these samples could not be quantified

47 and were excluded from the analysis. As a result, comparisons of NAc nNOS levels could only be made with n=4 for all groups in this experiment. The ANOVA indicated a significant effect of treatment [F (3, 12) = 13.39, p = 0.0004] on nNOS protein expression, and multiple comparisons identified a significant 4.5-fold increase in NAc nNOS protein levels 48 hours post-cocaine injection (p<0.01), with levels returning to control values by 72 hours post-treatment (Figure

6D). Interestingly, nNOS protein levels in the NAc were consistently below control levels, 24 hours following cocaine treatment, however this finding was not statistically significant.

Experiment 2: The role of nNOS in cocaine-induced locomotion, CPP, and MOR and nNOS mRNA and protein expression in the NAc As acute cocaine increased the expression of MOR and nNOS mRNA and protein in the

NAc of rats, and NOS inhibition attenuates the cocaine-mediated increase in MOR expression in vitro (Winick-Ng et al., 2012), the effect of nNOS inhibition on cocaine reward and cocaine- induced gene expression was investigated in vivo.

The effect of nNOS inhibition on cocaine-induced locomotor activity Figure 7 depicts the locomotor activity of rats during each 30 minute drug pairing (i.e. drug-conditioning session). The two-factor ANOVA identified a significant main effect of treatment [F (5, 42) = 30.79, p<0.0001] only. Multiple comparisons revealed that animals treated with cocaine alone exhibited significantly increased locomotor activity, relative to vehicle treated animals (p<0.0001) (Figure 7A). Pre-treatment with either 25 (p=0.0038) or 50 mg/kg (p<

0.0001) 7-NI alone produced a significant dose-dependent decrease in locomotor activity, relative to vehicle treated animals (Figure 7B). A similar trend was observed in the cocaine treated animals, with the pre-treatments of 25 (p=0.0022) and 50 mg/kg (p<0.0001) 7-NI resulting in a dose-dependent decrease in locomotion, relative to cocaine treated animals pre-

48 treated with 0 mg/kg 7-NI (Figure 7C).

The effect of nNOS inhibition on the development of cocaine CPP Figure 8 represents time spent in the cocaine-paired compartment during the habituation and test sessions in vehicle treated and cocaine treated rats pre-treated with 0 mg/kg, 25 mg/kg, or 50 mg/kg 7-NI. The ANOVA identified a significant interaction between treatment group and test [F (5, 42) = 4.136, p = 0.0038], as well as significant main effects of treatment group [F (5,

42) = 6.673, p = 0.0001] and test [F (1, 42) = 14.86, p = 0.0004]. Multiple comparisons further revealed a significant increase in the time spent in the cocaine-paired compartment from habituation to test only in the cocaine treated animals pre-treated with 0 mg/kg 7-NI (p< 0.01).

However, no statistically significant difference was detected in the cocaine treated rats that were pre-treated with either 25 mg/kg or 50 mg/kg 7-NI. Thus, both doses of 7-NI attenuated the development of the cocaine-induced CPP.

Cocaine-induced MOR and nNOS mRNA expression Figure 9 represents the quantitative changes in (A) MOR and (B) nNOS mRNA expression in the NAc 72 hours following the completion of the cocaine CPP, as determined using qPCR. The ANOVA identified a significant effect of treatment [F (5, 37) = 4.908, p =

0.0015] on MOR mRNA expression. Multiple comparisons then revealed a significant 2.5-fold increase in MOR mRNA levels in cocaine treated rats that received no 7-NI (p<0.01). No statistically significant change in MOR mRNA levels were detected in cocaine treated rats that were pre-treated with 25 mg/kg and 50 mg/kg 7-NI.

In regards to nNOS mRNA expression, the ANOVA indicated a significant effect of treatment [F (5, 38) = 5.67, p = 0.0005]. Multiple comparisons further revealed that nNOS mRNA levels were significantly elevated 2.2-fold (p<0.001), 1.9-fold (p<0.05), and 2.5-fold

49 (p<0.001) in cocaine treated rats pre-treated with 0 mg/kg, 25 mg/kg, and 50 mg/kg 7-NI, respectively. A significant 2.1-fold increase in nNOS mRNA expression was also noted in vehicle treated animals pre-treated with 25 mg/kg (p<0.01) and 50 mg/kg 7-NI (p<0.01).

Cocaine-induced MOR and nNOS protein expression Figure 10 depicts the changes in MOR and nNOS total protein expression in the NAc 72 hours following the completion of the cocaine CPP, as assessed via immunoblotting and densitometric analysis. Representative immunoblots depicting MOR and nNOS protein levels relative to b-actin in samples obtained from the NAc of rats from each treatment group are shown in Figure 10A and 10B, respectively. Densitometric analysis followed by ANOVA identified a significant effect of treatment [F (5, 39) = 3.434, p = 0.0115] on MOR protein expression and multiple comparisons revealed a significant 0.6-fold reduction in MOR protein levels in cocaine treated rats pre-treated with 50 mg/kg 7-NI (p<0.05) (Figure 10C). The

ANOVA indicated a significant effect of treatment [F (5, 39) = 4.328, p = 0.0031] on nNOS protein expression, as well. Multiple comparisons further revealed a significant 0.4-fold (p<0.05) and 0.3-fold (p<0.01) decrease in nNOS protein levels in the vehicle treated animals pre-treated with 25 mg/kg and 50 mg/kg 7-NI, respectively. Furthermore, multiple comparisons revealed a significant 0.2-fold (p<0.05) and 0.4-fold (p<0.05) reduction in nNOS protein expression in cocaine treated rats pre-treated with 0 mg/kg and 25 mg/kg 7-NI, respectively (Figure 10D).

50 Figure Legends

Figure 3. Mean (SEM) total distance moved (cm) during a 2-hour post-treatment test of locomotor behaviour in vehicle (n=6) and 20 mg/kg cocaine (n=18) treated rats. The * indicates a significant difference between the vehicle and cocaine treated groups.

Figure 4. Representative ethidium bromide-stained gel demonstrating qualitative identification of (A) HPRT, (B) MOR, and (C) nNOS mRNA expression in RNA extracted from the NAc tissue using PCR. Amplification of each transcript is illustrated in samples obtained from vehicle treated and cocaine treated rats 24, 48, and 72 hours after treatment. The product size of each amplification product was confirmed by comparison with a 100 base pair DNA ladder (not shown).

Figure 5. Quantitative analysis of (A) MOR and (B) nNOS mRNA levels relative to HPRT expression in the NAc of rats sacrificed 24 (n=6), 48 (n=6), and 72 (n=6) hours following an acute cocaine injection (20 mg/kg). All expression levels are relative to vehicle treated (n=6) animals and are expressed as the mean ± SEM. The * indicates a significant difference compared to control.

Figure 6. Representative immunoblots depicting (A) MOR and (B) nNOS protein expression in the NAc extracts obtained from control rats and those sacrificed at 24, 48, or 72 hours after a single cocaine treatment (20 mg/kg). The top panel in each image demonstrates the presence of the protein of interest (indicated on the right) and the bottom panel shows b-actin levels obtained from the same blot. Densitometric analysis of the protein expression ratios of total (C) MOR

(n=6/group) and (D) nNOS (n=4/group) to b-actin for each experimental group relative to vehicle treated animals is presented as the mean ± SEM. The * indicates a significant difference compared to control.

51 Figure 7. Mean (SEM) total distance moved (cm) across each of the four 30 minute drug-paired conditioning sessions. Graphs compare (A) vehicle treated (n=8) and cocaine treated (n=8) animals that were not pre-treated with 7-NI (B) vehicle treated animals that were pre-treated with

0 mg/kg (n=8), 25 mg/kg (n=8), and 50 mg/kg (n=8) 7-NI and (C) cocaine treated animals that were pre-treated with 0 mg/kg (n=8), 25 mg/kg (n=8), and 50 mg/kg (n=8) 7-NI. The * indicates a significant difference from the vehicle treated animals pre-treated with 0 mg/kg 7-NI and the # indicates a significant difference from the cocaine treated animals pre-treated with 0 mg/kg 7-NI.

Figure 8. Mean (SEM) time spent in the cocaine-paired compartment during the habituation and test sessions in vehicle treated and cocaine treated rats pre-treated with 0 mg/kg, 25 mg/kg, or 50 mg/kg 7-NI (n=8/group). The * indicates a significant difference compared to the 0 mg/kg 7-

NI/vehicle treated group.

Figure 9. Mean (SEM) relative expression of (A) MOR and (B) nNOS mRNA in the NAc of rats

72 hours following the completion of the cocaine CPP (n=8/group). All expression levels are relative to those obtained from vehicle treated animals that did not receive 7-NI. The * indicates a significant difference compared to the 0 mg/kg 7-NI/vehicle treated group.

Figure 10. Representative immunoblots depicting (A) MOR and (B) nNOS protein expression in samples obtained from the NAc of rats 72 hours following the completion of the cocaine CPP.

The top panel displays the protein of interest (indicated on the right) and the bottom panel shows b-actin levels from the same samples. Treatment group is labeled above the images and protein size is indicated on the left. The graphs display the mean (SEM) protein expression ratios of total

(C) MOR (n=8/group) and (D) nNOS (n=8/group) to b-actin for each experimental group relative to vehicle treated rats that did not receive 7-NI. The * indicates a significant difference compared to the 0 mg/kg 7-NI/vehicle treated group.

52 Figures Figure 3

53 FigureFigure 4 4

Vh 24H 48H 72H Vh 24H 48H 72H Vh 24H 48H 72H

54 Figure 5 A

5 4 * * 3

2

1

0 Relative MOR mRNA Expression

Vehicle 24 hours 48 hours 72 hours Time of sacrifice following cocaine administration

B

4

3 *

2

1

0 Relative nNOS mRNA Expression

Vehicle 24 hours 48 hours 72 hours Time of sacrifice following cocaine administration

55 Figure 6 C

2.5

2.0 *

1.5

1.0

0.5

0.0 Relative MOR Protein Expression

Vehicle 24 hours 48 hours 72 hours Time of sacrifice following cocaine administration

C D

2.5 6 * 2.0 * 4 1.5

1.0 2 0.5

0.0 0 Relative MOR Protein Expression Relative nNOS Protein Expression

Vehicle Vehicle 24 hours 48 hours 72 hours 24 hours 48 hours 72 hours Time of sacrifice following Time of sacrifice following cocaine administration cocaine administration

56

FigureFigure 7 7

A * 10000

0mg/kg 7-NI/Vehicle Treated 0mg/kg 7- NI/Cocaine Treated 5000

During Conditioning (cm)

Mean (SEM) Distance Moved 0

Pairing 1 Pairing 2 Pairing 3 Pairing 4

Pairing Number

B

10000

0mg/kg 7-NI/Vehicle Treated 25mg/kg 7-NI/Vehicle Treated 5000 50mg/kg 7-NI/ Vehicle Treated

0 *

Pairing 1 Pairing 2 Pairing 3 Pairing 4 Pairing Number C 10000

0mg/kg 7-NI/Cocaine Treated 25mg/kg 7-NI/Cocaine Treated 50mg/kg 7-NI/Cocaine Treated 5000 #

0

Pairing 1 Pairing 2 Pairing 3 Pairing 4 Pairing Number

57 Figure 8

58 Figure 9

59 Figure 10

60 Discussion

Summary of results Previously our laboratory demonstrated using a PC12 cell model that cocaine modulates

MOR mRNA and protein expression in vitro via an NO-dependent mechanism and that this mechanism is dependent on the drug administration schedule (Winick-Ng et al., 2012). However, whether the same mechanisms occur in neurons and the role of NO in regulating the cocaine- induced increase in MOR expression in vivo were unknown. As such, the current study aimed to: determine the effect of (1) acute cocaine administration and (2) ‘subchronic’ cocaine administration on MOR and nNOS expression, and to assess the role of NO in (3) cocaine conditioned reward and (4) cocaine-mediated expression of MOR and nNOS in the NAc.

In experiment #1, the NAc of rats was extracted either 24, 48, or 72 hours following a single cocaine injection (20 mg/kg), and alterations in MOR and nNOS expression were determined using qPCR and immunoblotting for mRNA and protein quantification, respectively.

The experiment yielded the findings that acute cocaine administration increases both MOR and nNOS transcript levels within the first 24 hours of administration, and that acute cocaine gradually increases MOR protein expression over 72 hours, whereas the increase in nNOS protein levels is more transient; peaking by 48 hours and returning to baseline by 72 hours.

In experiment #2, rats underwent cocaine CPP (biased design, 4 drug and 4 vehicle pairings) in which vehicle treated and cocaine treated animals were pre-treated with either 0, 25, or 50 mg/kg of 7-NI. The results indicated that cocaine alone produced a robust place preference, however this effect was attenuated with the pre-treatment of 7-NI in a dose-independent manner.

The effect of nNOS inhibition on cocaine-mediated MOR and nNOS expression was subsequently investigated, and the NAc of the rats was extracted 72 hours after the final 7-

61 NI/cocaine treatment. The mRNA and protein levels were once again assessed via qPCR and immunoblotting, respectively. Findings suggested that ‘subchronic’ cocaine administration enhances MOR mRNA levels, and that this effect is attenuated with nNOS inhibition.

Conversely, MOR protein expression in the NAc remained unchanged following ‘subchronic’ cocaine treatment. In addition, cocaine and 7-NI alone or in combination increased nNOS expression at the transcriptional level and suppressed nNOS expression at the translational level.

Taken together, these results indicate that acute and ‘subchronic’ cocaine administration differentially modulate MOR and nNOS expression at the transcriptional and translational level.

Furthermore, it appears that nNOS plays a role in both cocaine conditioned reward and cocaine- induced MOR mRNA expression, however other molecular players are likely involved as well.

Acute cocaine administration modulates MOR and nNOS expression As a stimulant, it is not surprising that cocaine administration enhances movement and energy levels in humans (CSSA, 2015; Ritz et al., 1990). This finding is consistent with countless previous studies that reported increased activity in rodents administered cocaine (Allen et al., 2013; Gulley et al., 2003; Horger et al., 1999; Leri et al., 2003; 2004; 2012; Placenza et al.,

2008; Thomeson & Caine, 2011). Hence, locomotor activity was measured in the present study as a means of confirming that the rats properly responded to the cocaine treatment. As expected, cocaine treated animals exhibited significantly greater locomotor activity across a two-hour period, relative to the vehicle treated animals. These results provided confidence for moving forward with the molecular assessments of gene expression.

Prior to proceeding with the quantification of MOR and nNOS transcripts, the qualitative confirmation that the genes of interest, along with the housekeeping gene HPRT, were present in the rat NAc was carried out. As evidenced by the detection of the correct sized PCR

62 amplification products and the absence of contamination in blank samples, all genes were present. This result was in line with previous studies that have also detected the HPRT (Chen et al., 2011; Zelek-Molik et al., 2010), MOR (Azaryan et al., 1998; Leri et al., 2006; 2009), and nNOS (Bradley et al., 2005; Lau et al., 2003; Padovan-Neto et al., 2011) genes in the rat NAc tissue. Once the genes were detected and primer efficiencies determined, the quantitative analysis of these genes could be performed. The optimal blocking conditions, primary antibody concentration, and transfer conditions were also established for the detection and analysis of the proteins of interest with immunoblotting.

The main objective of experiment #1 was to elucidate the time-course of acute cocaine- induced alterations in MOR expression in the NAc, as this had never been previously investigated. This study revealed that a single cocaine injection enhances MOR expression at the mRNA level within the first 24 hours, which likely results in the subsequent increase in MOR protein levels that manifests by 72 hours. Although these findings are consistent with the numerous reports of a cocaine-induced increase in MOR mRNA and protein expression

(Azaryan et al., 1996a; 1998; Bailey et al., 2005; 2007; Ghitza et al., 2010; Gorelick et al., 2005;

Hammer, 1989; Leri et al., 2006; 2009; Unterwald et al., 1992; 1994; Winick-Ng et al., 2012;

Zubieta et al., 1996), these results are novel in demonstrating time-dependent changes in MOR expression following a single high dose of cocaine. Similarly, Azaryan et al. (1998) also reported a time-dependent increase in MOR mRNA and protein levels with cocaine, however significant differences are noteworthy. For instance, MOR mRNA was found to be maximally increased by

72 hours of cocaine administration (Azaryan et al., 1998), as opposed to the 24-hour time-point observed in this study. This discrepancy is likely a result of differences in the duration of drug exposure, drug dose, and route of administration (i.e. chronic continuous, 50 mg/kg/day,

63 subcutaneous via osmotic minipump, respectively). Importantly, a subcutaneous chronic continuous treatment regimen is not representative of the higher levels of cocaine that would more rapidly reach the central nervous system with each dose during the binge-like pattern of administration that is often observed in human cocaine users (Gawin & Kleber, 1986), thus limiting the translatability of their results. However, the report that MOR protein binding is maximally enhanced by 72 hours of cocaine administration (Azaryan et al., 1998) is in line with our finding that total MOR protein expression was elevated at 72 hours. This may suggest that the cocaine-induced alterations in MOR protein levels occur independently of the administration paradigm. However, as protein binding is not equivalent to total protein levels, it is not known if the increased binding observed by Azaryan and colleagues (1998) is the result of higher receptor levels, or whether the increase in MOR levels identified in the present study reflect an increase in receptor activation. Further studies would be required to confirm this.

Conversely, Soderman & Unterwald (2009) previously reported a significant decrease in

MOR protein binding in rats following an acute high dose cocaine treatment (20 mg/kg).

However, changes in receptor binding were only investigated within the first 10 minutes post- injection (Soderman & Unterwald, 2009). Thus, the shorter time-course likely accounts for the discrepancy in results.

Moreover, this is the first in vivo study to investigate the changes in total MOR protein expression following an acute cocaine injection, using immunoblotting. Previously, our laboratory examined this effect in vitro and determined that either SCT with 500µM or RIT with

100µM cocaine in PC12 cells induced an increase in total MOR protein levels (Winick-Ng et al.,

2012). Furthermore, it was reported that the RIT in PC12 cells elevated MOR mRNA expression as well (Winick-Ng et al., 2012); another consistent finding with the present study. Interestingly,

64 this cocaine-induced increase in MOR expression was prevented by NOS inhibition, thereby linking NO production to this mechanism in vitro (Winick-Ng et al., 2012). Whether this mechanism also occurs in vivo was therefore assessed and the link between cocaine, NO, and

MOR was further substantiated by the investigation of changes in nNOS expression following acute cocaine treatment.

This investigation determined there was a transient upregulation of nNOS expression in the rat NAc following a single cocaine injection. Specifically, levels of the nNOS transcript were increased within 24 hours, which likely induced the increase in nNOS protein levels observed at

48 hours. Additionally, both nNOS mRNA and protein levels returned to baseline by 72 hours.

These findings are novel in demonstrating enhanced nNOS expression mediated by acute cocaine and support previous reports of a cocaine-induced increase in NO efflux in brain reward regions

(Koh et al., 2008; Lee et al., 2010; Sammut & West, 2008). Thus, it is possible that the increase in NO production previously reported is mediated by cocaine’s ability to transiently upregulate the expression of nNOS. Furthermore, these results compliment previous studies that used immunohistochemistry to detect an increase in nNOS positive neurons following chronic cocaine administration (Balda et al., 2008; Loftis & Janowsky, 2000; Yoo et al., 2006). It is important to note that Balda et al. (2008) reported no changes in nNOS expression in the NAc of rats, however this discrepancy is likely a result of the different dosing regimens (i.e. acute v. chronic).

Moreover, according to Laine et al. (1998), the half-life of the nNOS protein in rat brain homogenates is 12 to 30 minutes, depending on the isoform, and this rapid degradation occurs via a calpain-dependent mechanism. Calpain is a ubiquitous calcium-dependent protease that selectively cleaves a large variety of substrates (Laine et al., 1998). As such, it is likely that this mechanism quickly degrades nNOS in vivo as well (Laine et al., 1998). This is supported by the

65 immunoblotting results which illustrated drastic cocaine-induced changes in total nNOS expression within the 24 hour periods assessed in the present study. Thus, it would follow that nNOS is a protein with a rapid turnover rate in vivo, thereby allowing expression levels to be regulated across short periods of time.

Overall, the findings from experiment #1 validated that acute cocaine alters both MOR and nNOS expression, supporting the hypothesis that a connection in vivo is possible. Therefore, these results provided the rationale for the subsequent experiment, in which nNOS activity was inhibited in order to elucidate the role of NO in cocaine-induced MOR expression and cocaine conditioned reward.

Inhibition of nNOS attenuates cocaine CPP The present study assessed the effects of the selective nNOS inhibitor, 7-NI, on cocaine

CPP. To confirm cocaine’s actions, the locomotor activity during each conditioning session was assessed for all treatment groups. As expected, treatment with cocaine alone significantly increased locomotor activity relative to the vehicle treatment (see above). Furthermore, compared to the vehicle only treatment, administration of 7-NI alone resulted in a significant decrease in locomotor activity. Pre-treatment with 7-NI also reduced the locomotor activity of rats treated with cocaine, relative to rats treated with cocaine alone. The effect of 7-NI inducing a dose-dependent decrease in locomotor activity in vehicle treated rats (Akar et al., 2007;

Czernecka et al., 2015; Kalisch et al., 1996; Marren, 1998; Richter et al., 2000; Yildiz et al.,

2000) and cocaine treated rats (Byrnes et al., 2000) is consistent with previous studies. Although, the exact mechanism by which nNOS inhibition induces motor impairments is unknown, it is hypothesized that blocking NO production subsequently reduces DA biogenesis/neurotransmission in the substantia nigra, thereby impairing motor movement

66 (Czernecka et al., 2015). This is based on previous reports of NO-mediated DA release in the dorsal striatum (Iravani et al., 1998; West & Galloway, 1997a; 1997b). However, this hypothesis is arguable, as 7-NI has also been reported to improve motor deficits in a Parkinson’s disease rat model (Di Matteo et al., 2009). Interestingly, this depression of locomotion is not observed when mice are treated with 7-NI (Celik et al., 1999; Itzhak, 1997; Manzanedo et al., 2004; Noda et al.,

1995; Pokk & Vali, 2002), which may point to species-dependent differences in drug effects.

Results from the CPP testing indicated that a place preference did not develop in the vehicle treated rats pre-treated with 0, 25, or 50 mg/kg 7-NI, which is consistent with previous reports (Itzhak et al., 1998; Itzhak & Martin, 2000; Li et al., 2002; Martin & Itzhak, 2000).

Conversely, the cocaine treated animals pre-treated with 0 mg/kg 7-NI developed a significant robust place preference, which illustrates the reinforcing properties of cocaine and is consistent with past findings (Leri et al., 2006; Mueller & Stewart, 2000; Nygard et al., 2017; Schroeder et al., 2007; Stitch et al., 2010). The findings also indicated that this cocaine CPP was attenuated in rats pre-treated with 25 and 50 mg/kg 7-NI. Although these animals often spent more time in the drug-paired compartment, the results were not found to be significantly different relative to the animals that received the vehicle alone or cocaine alone. Overall, these findings are consistent with previous studies, in which both non-selective NOS inhibition (Kim & Park, 1995) and selective nNOS inhibition (Balda et al., 2006; Itzhak et al., 1998; 2008; Itzhak & Anderson,

2007) were reported to abolish cocaine CPP in mice. However, since the place preference is reported to be completely abolished in mice, but was only found to be attenuated in rats, this discrepancy may once again suggest a species-dependent difference.

One potential influential factor is the variation in the nitrergic system between rats and mice. According to Ng et al. (1999), rats generally have a greater number of nNOS positive

67 neurons than mice. Furthermore, the level of NO plasma metabolites in rats is 10 to 20 times higher compared to humans and mice (Radermacher & Haouzi, 2013). Thus, if the nitrergic system is different between species, it follows that the pharmacodynamics of 7-NI may vary between species as well. This is supported by the fact that 7-NI impairs the locomotion of rats, but not mice, as previously described. Moreover, past reports have demonstrated that 7-NI produces a different level of nNOS inhibition in rats and mice. Specifically, Demas et al. (1997) found that 50 mg/kg 7-NI inhibited more than 90% of nNOS activity in the mouse brain.

Comparatively, in the rat brain, 50 mg/kg 7-NI achieves maximal inhibition and only blocks about 50 to 60% of total nNOS activity (Kalisch et al., 1996; MacKenzie et al., 1994). This suggests that 7-NI may be a more effective inhibitor in mice than rats, and that the observed attenuation of cocaine CPP in rats is the result of incomplete nNOS inhibition in the brain.

However, it is important to note that a greater level of nNOS inhibition in mice may also suggest a lack of isoform specificity by 7-NI in this species.

The efficacy of 7-NI in rats may also be inconsistent, as it was reported that cocaine- induced NO efflux is only completely blocked by the nNOS inhibitor in about 50% of rats, whereas in the other 50%, it is only attenuated (Sammut & West, 2008). This implies that there is inter-rat variability in the effectiveness of nNOS inhibition, and supports the observation that not all cocaine treated rats pre-treated with 7-NI developed a strong preference for the drug-paired compartment in this study. Additionally, repeated administration of 30 mg/kg 7-NI in rats has been reported to enhance iNOS protein expression in the brain, which may subsequently compensate for the NO production previously lost by nNOS inhibition (Luo et al., 2007).

Collectively, this evidence suggests that pharmacological nNOS inhibition in rats should be supported by genetic inhibition, which may be achieved using methods such as small interfering

68 RNA (siRNA) or short hairpin RNA (shRNA) gene knock down, to further elucidate the role of

NO in cocaine CPP in rats.

It is also possible that an attenuation in cocaine reward was observed in rats pre-treated with 7-NI, rather than abolishment as previous studies have reported, because the dose of cocaine was too high. Such an effect is observed with methylphenidate-induced hyperlocomotion, in that

7-NI completely blocks the sensitization induced by a low dose of methylphenidate, but not with a higher dose (Itzhak & Martin, 2002). The authors of this study suggested that the degree of stimulation of the DA system may alter the pharmacological function of 7-NI (Itzhak & Martin,

2002). If this hypothesis is correct, a place preference induced by a lower dose of cocaine (10-15 mg/kg) may have been more suitable.

Lastly, it may be that NO modulates cocaine-motivated behaviours differentially and that

CPP may not fully elucidate this mechanism in rats. This could be due to the fact that CPP is an all-or-nothing response (Bardo & Bevins, 2000) and is not sensitive to dose-dependent effects

(Wise, 1989). Other models, such as self-administration, can provide a more graded response and is indicative of dose-dependent effects (Bardo & Bevins, 2000). In addition, previous studies have linked NO to the mechanisms responsible for cocaine self-administration (Collins &

Kantak, 2002; Orsini et al., 2002; Pudiak & Bozarth, 2002; Pulvirenti et al., 1996), and this model may have been a suitable behavioural measure as well.

‘Subchronic’ cocaine administration and nNOS inhibition modulate MOR and nNOS expression Rats were sacrificed 72 hours following the final 7-NI/cocaine treatment received during

CPP. This was based on (1) results from experiment #1 that illustrated a significant acute cocaine-induced increase in MOR protein levels by 72 hours and (2) a previous study that reported maximal increase in MOR mRNA expression at 72 hours with chronic continuous

69 cocaine exposure (Azaryan et al., 1998). As expected, this study revealed a significant increase in MOR mRNA levels in the NAc of rats treated with cocaine alone. This finding is consistent with a previous study from our laboratory that reported elevated MOR mRNA levels in the rat

NAc ten days after the completion of cocaine CPP (Leri et al., 2006). Moreover, this cocaine- induced increase in MOR mRNA was attenuated with the pre-treatment of 25 or 50 mg/kg 7-NI, thus suggesting a role for NO in this mechanism.

These results are somewhat consistent with the previous report that non-selective NOS inhibition abolishes the cocaine-induced increase in MOR mRNA in vitro (Winick-Ng et al.,

2012). The fact that an attenuation was observed in vivo, compared to the abolishment reported in vitro may be explained by differences between the two models. The in vitro model is made up of a homogenous population of cells that respond to cocaine and express the MOR and all three

NOS isoforms, however they are not neurons and do not possess the same interactions that occur under physiological conditions (Murphy & Murphy, 1991). As a result, it is not uncommon for cultured cells to respond differently from whole animal models (Murphy & Murphy, 1991).

Furthermore, Winick-Ng et al. (2012) used PC12 cells that were not differentiated into a neuron- like phenotype, were treated with a different and non-selective NOS inhibitor, and followed a slightly different drug treatment regimen (i.e. RIT over 72 hours); all of which may contribute to the observed discrepancies between the studies.

Although acute cocaine treatment increased MOR protein levels and nNOS inhibition attenuated the ‘subchronic’ cocaine-mediated increase in MOR mRNA levels, this experiment provided less conclusive findings on the effect of cocaine and nNOS inhibition on MOR protein expression. No significant changes in MOR protein levels were observed in any of the treatment groups, with the exception of the cocaine treated animals pre-treated with 50 mg/kg 7-NI, in

70 which a significant decrease in MOR protein expression relative to vehicle only treated rats was observed. This finding was not consistent with previous studies that reported increased MOR protein binding, activity, and density in the NAc following cocaine administration in rats

(Azaryan et al., 1998; Bailey et al., 2007; Hammer, 1989; Unterwald et al., 1992; 1994).

However, it is important to note that immunoblotting is only a measure of total protein levels, and does not indicate changes in protein activity or localization. As such, although no changes in total protein levels were detected, it is possible that cocaine and/or 7-NI could alter the activity, binding affinity, and/or membrane expression of the MOR in the NAc. Thus, sub-cellular fractionation, receptor binding, and/or immunohistochemistry techniques would be required to investigate such changes.

Additionally, our findings are not consistent with those reported by Winick-Ng et al.

(2012), who detected a cocaine-induced increase in total MOR protein expression using immunoblotting, as well as an abolishment of this effect with NOS inhibition (Winick-Ng et al.,

2012). However, as previously mentioned, this inconsistency may be the result of inherent differences between the in vitro and in vivo models.

Notably, this is the first study to investigate the changes in MOR mRNA and protein expression in the same samples following cocaine CPP. All previous studies have used a different drug treatment protocol, which could impact the observed changes in gene and protein expression (Nobel et al., 2015). It is also possible that the cocaine-induced increase in MOR mRNA levels observed in the present study did lead to increased protein translation, but that this protein was subsequently translocated to a different connecting brain region. According to Le

Merrer et al. (2009), this is not uncommon for the ligands and receptors of the EOS, as the proteins are often transported to different projection areas where they are localized pre-

71 synaptically.

As acute cocaine was found to alter nNOS expression in experiment #1, the effect of 7-NI on this mechanism following CPP was also examined. Interestingly, both cocaine and 7-NI alone and in combination significantly increased nNOS mRNA expression in the rat NAc, with no observed additive or dose-dependent effects. The finding that cocaine alone enhanced nNOS mRNA levels is consistent with experiment #1 and may be linked to cocaine’s propensity to induce NO-dependent oxidative stress in the brain (Vitcheva et al., 2015). Furthermore, this was the first study to investigate the effects of 7-NI alone or in combination with cocaine, on nNOS mRNA levels. Thus, in order to further interpret the results, the investigation of the effects of acute 7-NI with and without cocaine would be beneficial and is considered a future direction.

Conversely, both cocaine and 7-NI alone, as well as cocaine in combination with 25 mg/kg 7-NI, resulted in a significant decrease in nNOS protein expression. The finding that cocaine alone reduces nNOS protein levels is not consistent with previous reports. Past studies have indicated that chronic cocaine administration generally increases nNOS expression in multiple brain regions, including the NAc, as determined by immunohistochemistry (Balda et al.,

2008; Loftis & Janowsky, 2000; Yoo et al., 2006). As well, no change in the density of nNOS- positive neurons in the rat NAc following chronic cocaine treatment has also been reported

(Balda et al., 2008). Moreover, these results do not match the cocaine-induced increase in nNOS protein expression illustrated in experiment #1. However, it is important to note that this elevation in nNOS protein mediated by acute cocaine was transient, with levels changing drastically within 24 hours periods, as previously discussed. As such, it may be that the time of sacrifice in this study was not optimal for the detection of increased nNOS protein levels. This is supported by the fact that all previous studies measured nNOS-positive neuron density levels 24

72 hours after the final cocaine injection (Balda et al., 2008; Loftis & Janowsky, 2000; Yoo et al.,

2006).

However, what is consistent with previous literature is the finding that 7-NI alone decreases nNOS protein expression. This has been reported in vitro in PC12 cells, as detected by immunoblotting (Cheng et al., 2014), as well as in vivo in the rat NAc, as detect by immunohistochemistry (Tian et al., 2008). When the nNOS mRNA and protein results are taken together, it may suggest that the mRNA levels were elevated in response to the 7-NI mediated decreased in protein expression, in order to return nNOS levels to baseline.

73 Summary and Significance Based on the findings of experiment #1 and #2, a few general conclusions can be made.

First, a single high dose of cocaine enhances the expression of both MOR and nNOS at the transcriptional and translational level. Moreover, the acute cocaine-mediated change in MOR expression is more persistent, whereas cocaine alters nNOS expression in a more transient fashion. Second, NO produced by nNOS plays a role in cocaine CPP and the cocaine-induced increase in MOR mRNA expression in rats, however there are likely other key molecular players involved as well. Third, acute and ‘subchronic’ cocaine administration differentially regulate

MOR expression. Specifically, acute cocaine treatment alters NAc MOR expression at the mRNA and protein level, whereas ‘subchronic’ cocaine administration only increases MOR in the NAc at the transcriptional level.

Overall, these results support the hypothesis that NO modulates the cocaine-induced increase in MOR levels which regulates the development of the cocaine-mediated place preference, but suggests that while NO is necessary, it is not the only regulator of the cocaine- induced increase in MOR expression and cocaine conditioned reward. However, the proposed mechanism may warrant further investigation due to some limitations present in this study.

Limitations One clear limitation in the present study is the translatability of cocaine CPP to human cocaine use. Although CPP is a well established and accepted model to measure drug reinforcement in animals, it does not completely mimic the pattern of drug use seen in humans, as well as the transition from drug use to addiction (Koob & Volkow, 2010). In line with this, it has been reported that the mesolimbic DA system is differentially activated depending on whether cocaine is passively or actively administered (Bardo & Bevins, 2000; Stefanksi et al.,

74 2007). Thus, the passive administration used in CPP may limit the extent to which results can be translated to active human cocaine use. Another limitation is the use of a pharmacological inhibitor. Although 7-NI selectively and effectively blocks nNOS, it does not inhibit 100% of the enzyme in the rat brain (Kalisch et al., 1996; MacKenzie et al., 1994). Additionally, the level of inhibition varies between rats and brain region (Kalisch et al., 1996; Sammut & West, 2008), and it is not uncommon for pharmacological agents to have off-target effects (Jackson & Linsley,

2010). As such, this may somewhat limit the elucidation of the role of NO in these cocaine- mediated mechanisms. Lastly, recovery of proteins from Trizol is not the most effective method of protein isolation, as it does not permit consistent or complete solubilisation of proteins

(Simoes et al., 2013). This may have limited the detection of high molecular weight proteins in all samples, such as nNOS (Simoes et al., 2013). However, it was necessary for the simultaneous recovery of RNA and protein from the same tissue sample, which increased the amount of information that could be obtained from each rat and reduced the number of animals required in the study. This method of isolation also increased the ability to correlate the mRNA and protein data.

Future directions Results from the current study validated that different drug administration regimens can have varying effects on transcription and translation; a fact that has been well established in the literature (Nobel et al., 2015). Thus, it may be that the role NO plays in cocaine-mediated gene expression depends on the dosing schedule. As such, the most logical extension of experiment #1 is to determine the effect of pharmacological nNOS inhibition on MOR and nNOS expression following acute cocaine administration. Moreover, although it is a selective and effective drug in vivo, the efficiency of 7-NI has been shown to differ between rats and brain regions (Kalisch et

75 al., 1996; Sammut & West, 2008). Therefore, the selective silencing of the nNOS gene may be a more reliable method to ensure NO production by nNOS is more efficiently blocked within the brain. Specifically, a future study may complete experiment #2 again following the injection of nNOS selective siRNA or shRNA into the NAc for temporary gene knockdown and investigating the effects on cocaine CPP and cocaine-induced MOR expression.

Furthermore, it has been reported that the mechanisms that mediate self-administration and drug-induced CPP may differ (Bardo et al., 1999), and that this may be associated to the differences that passive and active drug administration have on the activation of the mesolimbic

DA system (Bardo & Bevins, 2000; Stefanski et al., 2007). As such, whether cocaine modulates

MOR expression via NO-dependent mechanisms in order to mediate cocaine self-administration may also warrant future investigation.

If the results from these proposed studies provide additional support for the in vivo link between NO and the cocaine-mediated increase in MOR expression, a potential extension of the experiments would be to examine the exact molecular mechanisms by which this occurs.

Specifically, ERK1/2 and CREB may be targets for investigation due to their direct link to NO

(Garthwaite et al., 1988; Guan et al., 2002; Impey et al., 1998; Liddie et al., 2013; Lu et al.,

2005), as well as their reported involvement in altering the gene expression of the EOS ligands and receptors in the NAc (Duraffourd et al., 2014; Muschamp & Carlezon, 2013). This may be accomplished by first confirming the activation of CREB and ERK1/2 by the cocaine-mediated

NO efflux, followed by subsequent examination of the effect of CREB and ERK1/2 inhibition or knock down on cocaine-induced MOR expression. Histone acetylation and c-fos activation were also identified as potential mechanisms regulating the cocaine-mediated increase in MOR levels in vitro (Winick-Ng et al., 2012). Knock-down or pharmacological inhibition of individual

76 histone acetyltransferases or c-fos could be used to determine their role in the regulation of cocaine CPP, as well as MOR and nNOS expression.

Conclusions Overall, the findings from the current study support the hypothesis in that NO plays a role in both cocaine conditioned reward and cocaine-induced MOR expression. However, it is unlikely to be the only molecular player involved. Furthermore, the results of this study suggest that the role of NO in cocaine-mediated effects is dependent on the species and the drug administration paradigm, and that additional experiments are required to confirm these findings.

Collectively, this work begins to elucidate one potential molecular mechanism involved in the cocaine-induced increase in MOR expression, as well as provides insight into the complexity of the neuro-adaptations that occur with drugs of abuse. Further understanding of this molecular mechanism with continued research may identify key targets necessary for cocaine reward and reinforcement.

77 References Ago, Y., Nakamura, S., Baba, A., & Matsuda, T. (2008). Neuropsychotoxicity of abused drugs: effects of serotonin receptor ligands on methamphetamine- and cocaine-induced behavioral sensitization in mice. Journal of Pharmacological Sciences, 106(1), 15–21.

Aharonovich, E., Hasin, D.S., Brooks, A.C., Liu, X., Bisaga, A., & Nunes, E.V. (2006). Cognitive deficits predict low treatment retention in cocaine dependent patients. Drug Alcohol Depend, 81, 313–322

Akar, F. Y., Ulak, G., Tanyeri, P., Erden, F., Utkan, T., & Gacar, N. (2007). 7-Nitroindazole , a neuronal nitric oxide synthase inhibitor , impairs passive-avoidance and elevated plus- maze memory performance in rats. Pharmacology Biochemistry and Behavior, 87, 434– 443.

Akil, H., Meng, F., Devine, D.P., & Watson, S.J. (1997). Molecular and neuroanatomical properties of the endogenous opioid systems: implications for the treatment of opiate addiction. Semin. Neurosci. 9, 70–83.

Allen, C. P., Zhou, Y., & Leri, F. (2013). Effect of food restriction on cocaine locomotor sensitization in Sprague-Dawley rats: Role of kappa opioid receptors. Psychopharmacology, 226(3), 571–578.

Ambrose, L.M., Unterwald, E.M., & Van Bockstaele, E.J. (2004). Ultrastructural evidence for co-localization of dopamine D2 and micro-opioid receptors in the rat dorsolateral striatum. Anat Rec A Discov Mol Cell Evol Biol 279, 583–591.

Azaryan, A. V., Clock, B. J., & Cox, B. M. (1996a). Mu opioid receptor mRNA in nucleus accumbens is elevated following dopamine receptor activation. Neurochem Res, 21(11), 1411–1415.

Azaryan, A. V, Clock, B. J., Rosenberger, J. G., & Cox, B. M. (1998). Transient upregulation of mu opioid receptor mRNA levels in nucleus accumbens during chronic cocaine administration. Can. J. Physiol. Pharmacol., 283, 1–6.

Azaryan, A. V, Coughlin, L. J., Búzás, B., Clock, B. J., & Cox, B. M. (1996b). Effect of chronic cocaine treatment on mu- and delta-opioid receptor mRNA levels in dopaminergically innervated brain regions. Journal of Neurochemistry, 66(2), 443–448.

Bailey, A., Yoo, J. H., Racz, I., Zimmer, A., & Kitchen, I. (2007). Preprodynorphin mediates locomotion and D2 dopamine and µ-opioid receptor changes induced by chronic “binge” cocaine administration. Journal of Neurochemistry, 102(6), 1817–1830.

Bailey, A., Yuferov, V., Bendor, J., Schlussman, S. D., Zhou, Y., Ho, A., & Kreek, M. J. (2005). Immediate withdrawal from chronic “binge” cocaine administration increases µ-opioid receptor mRNA levels in rat frontal cortex. Molecular Brain Research, 137(1–2), 258– 262.

78

Balda, M. A., Anderson, K. L., & Itzhak, Y. (2006). Adolescent and adult responsiveness to the incentive value of cocaine reward in mice: Role of neuronal nitric oxide synthase (nNOS) gene. Neuropharmacology, 51(2), 341–349.

Balda, M. A., Anderson, K. L., & Itzhak, Y. (2008). Differential role of the nNOS gene in the development of behavioral sensitization to cocaine in adolescent and adult B6;129S mice. Psychopharmacology, 200(4), 509–519.

Balda, M. A., Anderson, K. L., & Itzhak, Y. (2009). The neuronal nitric oxide synthase (nNOS) gene contributes to the regulation of tyrosine hy- droxylase (TH) by cocaine. Neurosci Lett 457, 120.

Bannister, K., Sikandar, S., Bauer, C., Dolphin, A., Porreca, F., & Dickenson, A. (2011). Pregabalin suppresses spinal neuronal hyperexcitability and visceral hypersensitivity in the absence of peripheral pathophysiology, 115(1), 144–152.

Bardo, M. T., & Bevins, R. A. (2000). Conditioned place preference: What does it add to our preclinical understanding of drug reward? Psychopharmacology, 153(1), 31–43.

Barr, A.M., & Phillips, A.G. (1999). Withdrawal following repeated exposure to d-amphetamine decreases responding for a sucrose solution as measured by a progressive ratio schedule of reinforcement. Psychopharmacology, 141, 99–106.

Becker, A., Grecksch, G., Kraus, J., Loh, H.H., Schroeder, H., & Hollt, V. (2002). Rewarding effects of ethanol and cocaine in m opioid receptor-deficient mice. Naunyn Schmiedebergs Arch Pharmacol 365, 296–302.

Bergman, J., Madras, B.K., Johnson, S.E., Spealman, R.D. (1989). Effects of cocaine and related drugs in nonhuman primates. III. Self-adminis- tration by squirrel monkeys. J. Pharmacol. Exp. Ther., 251, 150–155.

Bergman, J.J., Kamien, J.J., & Spealman, R.R. (1990). Antagonism of cocaine self- administration by selective dopamine D(1) and D(2) antagonists. Behav. Pharmacol., 1, 355–363.

Bhargava, H.N., & Kumar, S. (1997) Sensitization to the locomotor stimulant activity of cocaine is associated with increases in nitric oxide synthase activity in brain regions and spinal cord of mice. Pharmacology 55, 292–298

Bilsky, E.J., Montegut, M.J., Delong, C.L., & Reid, L.D. (1992). Opioidergic modulation of cocaine conditioned place preferences. Life Sci. 50, L85–L90.

Bjork, J.M., Momenan, R., & Hommer, D.W. (2009). Delay discounting correlates with proportional lateral frontal cortex volumes. Biol Psychiatry, 65, 710–713.

79 Bolla, K.I., Eldreth, D.A., London, E.D., Kiehl, K.A., Mouratidis, M., & Contoreggi, C. (2003). Orbitofrontal cortex dysfunction in abstinent cocaine abusers performing a decision- making task. Neuroimage, 19, 1085–1094

Boutrel, B. (2008). A neuropeptide-centric view of psychostimulant addiction. Br. J. Pharmacol. 154, 343–357.

Bradberry, C.W., Barrett-Larimore, R.L., Jatlow, P., & Rubino, S.R. (2000). Impact of self- administered cocaine and cocaine cues on extracellular dopamine in mesolimbic and sensorimotor striatum in rhesus monkeys. J. Neurosci., 20, 3874–3883.

Bradford, M. M. (1976). A Rapid and Sensitive Method for the Quantitation Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding. Analytical Biochemistry, 254, 248–254.

Bradley, K. C., Boulware, M. B., Jiang, H., Doerge, R. W., Meisel, R. L., & Mermelstein, P. G. (2005). Changes in gene expression within the nucleus accumbens and striatum following sexual experience. Genes, Brain and Behavior, 4(1), 31–44.

Bredt, D.S., & Snyder, S.H. (1994). Nitric oxide: a physiologic messenger molecule. Annu Rev Biochem. 63, 175-95.

Breiter, H.C., Gollub, R.L., Weisskoff, R.M., Kennedy, D.N., Makris, N., Berke, J.D., Goodman, J.M., Kantor, H.L., Gastfriend, D.R., Riorden, J.P., Mathew, R.T., Rosen, B.R., & Hyman, S.E. (1997). Acute effects of cocaine on human brain activity and emotion. Neuron., 19, 591–611.

Brenman, J. E., & Bredt, D. S. (1997). Synaptic signaling by nitric oxide. Current Opinion in Neurobiology, 7, 374–378.

Briand, L.A., Gross, J.P., & Robinson, T.E. (2008). Impaired object recognition following prolonged withdrawal from extended-access cocaine self-administration. Neuroscience, 155, 1–6.

Britton, D.R., Curzon, P., Mackenzie, R.G., Kebabian, J.W., Williams, J.E., & Kerkman, D. (1991). Evidence for involvement of both D1 and D2 receptors in maintaining cocaine self-administration. Pharmacol. Biochem. Behav,. 39, 911–915.

Byrnes, J. J., Pantke, M. M., Onton, J. A., & Hammer, R. P. (2000). Inhibition of nitric oxide synthase in the ventral tegmental area attenuates cocaine sensitization in rats. Progress in Neuro-Psychopharmacology and Biological Psychiatry, 24(2), 261–273.

Caine, S.B., Humby, T., Robbins, T.W., & Everitt, B.J. (2001). Behavioral effects of psychomotor stimulants in rats with dorsal or ventral subiculum lesions: locomotion, cocaine self-administration, and prepulse inhibition of startle. Behav Neurosci, 115, 880– 894.

80

Caine, S.B., Thomsen, M., Gabriel, K.I., Berkowitz, J.S., Gold, L.H., & Koob, G.F.(2007). Lack of self-administration of cocaine in dopamine D1 receptor knock-out mice. J Neurosci, 27, 13140–13150

Canadian Centre on Substance Abuse (2015). Canadian Drug Summary: Cocaine. Ottawa, Ont.

Canales, J.J. (2007). Adult neurogenesis and the memories of drug addiction. Eur Arch Psychiatry Clin Neurosci, 257, 261–270.

Carlezon Jr.., W.A., Devine, D.P., & Wise, R.A. (1995). Habit-forming actions of nomifensine in nucleus accumbens. Psychopharmacology, 122, 194– 197.

Celik, T., Zagli, U., Kayir, H., & Uzbay, I. T. (1999). Nitric oxide synthase inhibition blocks amphetamine-induced locomotor activity in mice. Drug and Alcohol Dependence, 56, 109–113.

Centonze, D., Bracci, E., Pisani, A., Gubellini, P., Bernardi, G., & Calabresi, P. (2002). Activation of dopamine D1-like receptors excites LTS interneurons of the striatum. Eur J Neurosci 15, 2049–2052.

Chartoff, E., Sawyer, A., Rachlin, A., Potter, D., Pliakas, A., & Carlezon, W.A. (2012). Blockade of kappa opioid receptors attenuates the development of depressive-like behaviors induced by cocaine withdrawal in rats. Neuropharmacology 62, 167–176.

Chefer, V.I., Kieffer, B.L., & Shippenberg, T.S. (2004). Contrasting effects of mu opioid receptor and delta opioid receptor deletion upon the behavioral and neurochemical effects of cocaine. Neuroscience 127, 497–503.

Chen, H., Liu, Z., Gong, S., Wu, X., Taylor, W. L., & Williams, R. W. (2011). Genome-wide gene expression profiling of nucleus accumbens neurons projecting to ventral pallidum using both microarray and transcriptome sequencing. Frontiers in Neuroscience, 5(98), 1–11.

Chen, Y., Mestek, A., Liu, J., Hurley, J.A., & Yu, L. (1993). Molecular cloning and functional expression of a mu-opioid receptor from rat brain. Mol. Pharmacol. 44, 8–12.

Chen, R., Tilley, M.R., Wei, H., Zhou, F., Zhou, F.M., & Ching, S. (2006). Abolished cocaine reward in mice with a cocaine-insensitive dopamine transporter. Proc Natl Acad Sci USA, 103, 9333–9338.

Cheng, X., Luo, H., Hou, Z., Huang, Y. A. N., Sun, J., & Zhou, L. (2014). Neuronal nitric oxide synthase , as a downstream signaling molecule of c-jun , regulates the survival of differentiated PC12 cells, (74), 1881–1886.

Collins, S. L., Edwards, M. A., & Kantak, K. M. (2001). Effects of nitric oxide synthase

81 inhibitors on the discriminative stimulus effects of cocaine in rats, 261–273.

Collins, S. L., & Kantak, K. M. (2002). Neuronal nitric oxide synthase inhibition decreases cocaine self-administration behavior in rats. Psychopharmacology, 159(4), 361–369.

Contarino, A., Picetti, R., Matthes, H.W., Koob, G.F., Kieffer, B.L., & Gold, L.H. (2002). Lack of reward and locomotor stimulation induced by heroin in m-opioid receptor-deficient mice. Eur J Pharmacol 446, 103–109.

Corrigall, W.A., & Coen, K.M. (1991). Opiate antagonists reduce cocaine but not nicotine self- administration. Psychopharmacology 104, 167–170.

Corrigall, W.A., Coen, K.M., Adamson, K.L., & Chow, B.L. (1999). The mu opioid agonist DAMGO alters the intravenous self-administration of cocaine in rats: mecha- nisms in the ventral tegmental area. Psychopharmacology 141, 428–435.

Czarnecka, A., Konieczny, J., & Lenda, T. (2015). The preferential nNOS inhibitor 7- nitroindazole and the non-selective one N G -nitro- L -arginine methyl ester administered alone or jointly with L -DOPA differentially affect motor behavior and monoamine metabolism in sham-operated and 6-OHDA- lesioned, 1625, 218–237.

Czoty, P.W., Justice Jr.., J.B., & Howell, L.L. (2000). Cocaine-induced changes in extracellular dopamine determined by microdialysis in awake squirrel monkeys. Psychopharmacology (Berl), 148, 299–306.

Dackis, C. A., & O’Brien, C. P. (2001). Cocaine dependence : a disease of the brain's reward centers. Journal of Substance Abuse Treatment, 21, 111–117.

Daunais, J.B., & McGinty, J.F. (1995). Cocaine binges differentially alter striatal preprodynorphin and zif/268 mRNAs. Brain Res Mol Brain Res 29, 201–210.

Delfs, J.M., Kong, H., Mestek, A., Chen, Y., Yu, L., Reisine, T., & Chesselet, M.F. (1994). Expression of mu opioid receptor mRNA in rat brain: an in situ hybridization study at the single cell level. J. Comp. Neurol. 345, 46–68.

Demas, G. E., Eliasson, M. J., Dawson, T. M., Dawson, V. L., Kriegsfeld, L. J., Nelson, R. J., & Snyder, S. H. (1997). Inhibition of neuronal nitric oxide synthase increases aggressive behavior in mice. Molecular Medicine (Cambridge, Mass.), 3(9), 610–616.

Di Ciano, P., Coury, A., Depoortere, R.Y., Egilmez, Y., Lane, J.D., Emmett-Oglesby, M.W., Lepiane, F.G., Phillips, A.G., & Blaha, C.D. (1995). Comparison of changes in extracellular dopamine concentrations in the nucleus accumbens during intravenous self- administration of cocaine or d-amphetamine. Behav. Pharmacol,. 6, 311–322.

Di Matteo, V., Pierucci, M., Benigno, A., Crescimanno, G., Esposito, E., & Di Giovanni, G. (2009). Involvement of nitric oxide in nigrostriatal dopaminergic system degeneration: A

82 neurochemical study. Annals of the New York Academy of Sciences, 1155, 309–315.

Duraffourd, C., Kumala, E., Anselmi, L., Brecha, N. C., & Sternini, C. (2014). Opioid-induced mitogen-activated protein kinase signaling in rat enteric neurons following chronic morphine treatment. PLoS ONE, 9(10)

Edwards, S., Graham, D.L., Bachtell, R.K., & Self, D.W. (2007). Region-specific tolerance to cocaine-regulated cAMP-dependent protein phosphorylation following chronic self- administration. Eur J Neurosci, 25, 2201–2213.

Evans, C.J., Keith Jr., D.E., Morrison, H., Magendzo, K., & Edwards, R.H. (1992). Cloning of a delta opioid receptor by functional expression. Science 258, 1952–1955.

Everitt, B.J., Belin, D., Economidou, D., Pelloux, Y., Dalley, J.W., & Robbins, T.W. (2008). Neural mechanisms underlying the vulnerability to develop compulsive drug-seeking habits and addiction. Phil Trans Royal Soc London B Biol Sci, 363, 3125–3135.

Everitt, B.J., & Wolf, M.E. (2002). Psychomotor stimulant addiction: a neural systems perspective. J Neurosci, 22, 3312–3320

Farronato, N.S., Dursteler-Macfarland, K.M., Weisbeck, G.A., & Petitjean, S.A. (2013). A systematic review comparing cognitive- behavioral therapy and contingency management for cocaine dependence. Journal of Addictive Diseases, 32(3), 274–287.

Fibiger, H.C. (1978). Drugs and reinforcement mechanisms: a critical review of the catecholamine theory. Annu. Rev. Pharmacol. Toxicol., 18, 37– 56.

Fowler, J.S., Volkow, N.D., Logan, J., Alexoff, D., Telang, F., & Wang, G.J. (2008). Fast uptake and long-lasting binding of methamphetamine in the human brain: comparison with cocaine. Neuroimage, 43, 756–763.

Frankel, P.S., Alburges, M.E., Bush, L., Hanson, G.R., & Kish, S.J. (2008). Striatal and ventral pallidum dynorphin concentrations are markedly increased in human chronic cocaine users. Neuropharmacology 55, 41–46.

Garavan, H., Pankiewicz, J., Bloom, A., Cho, J.K., Sperry, L., Ross, T.J., Salmeron, B.J., Risinger, R., Kelley, D., & Stein, E.A. (2000). Cue-induced cocaine craving: neuroanatomical specificity for drug users and drug stimuli. Am. J. Psychiatry, 157, 1789–1798

Garthwaite, J., & Boulton, C.L. (1995). Nitric oxide signaling in the central nervous system. Annu Rev Physiol. 57, 707-36.

Garthwaite, J., Charles, S.L., & Chess-Williams, R. (1988). Endothelium-derived relaxing factor release on activation of NMDA receptors suggests role as intercellular messenger in the brain. Nature 336, 385-8.

83

Gawin, F. (1991). Cocaine addiction: psychology and neurophysiology. Science 251, 1580–1586.

Gawin, F.H., & Kleber, H.D. (1986). Abstinence symptomatology and psychiatric diagnosis in cocaine abusers: clinical observations. Arch Gen Psychiatry, 43, 107–13.

George, O., Mandyam, C.D., Wee, S., & Koob, G.F. (2008). Extended access to cocaine self- administration produces long-lasting prefrontal cortex-dependent working memory impairments. Neuropsychopharmacology, 33 2474–2482.

Gerrits, M.A., Patkina, N., Zvartau, E.E., & van Ree, J.M. (1995). Opioid blockade attenuates acquisition and expression of cocaine-induced place preference conditioning in rats. Psychopharmacology 119, 92–98.

Ghitza, U. E., Preston, K. L., Epstein, D. H., Kuwabara, H., Endres, C. J., Bencherif, B., … Gorelick, D. A. (2010). Brain mu-opioid receptor binding predicts treatment outcome in cocaine-abusing outpatients. Biological Psychiatry, 68(8), 697–703.

Glick, S.D., Maisonneuve, I.M., Raucci, J., & Archer, S. (1995). Kappa opioid inhibition of morphine and cocaine self-administration in rats. Brain Res 681, 147–152.

Goeders, N.E., Smith, J.E. (1983). Cortical dopaminergic involvement in cocaine reinforcement. Science, 221, 773–775.

Gorelick, D. A., Kim, Y. K., Bencherif, B., Boyd, S. J., Nelson, R., Copersino, M., … Frost, J. J. (2005). Imaging brain mu-opioid receptors in abstinent cocaine users: Time course and relation to cocaine craving. Biological Psychiatry, 57(12), 1573–1582.

Grace, A.A. (2000). The tonic/phasic model of dopamine system regulation and its implications for understanding alcohol and psychostimulant craving. Addiction, 95, S119–S128.

Grant, B. F., Dawson, D. A., Stinson, F. S., Chou, S. P., Dufour, M. C., & Pickering, R. P. (2004). The 12-month prevalence and trends in DSM-IV alcohol abuse and dependence : United States , 1991 – 1992 and 2001 – 2002, 74, 223–234.

Grech, D.M., Spealman, R.D., & Bergman, J. (1996). Self-administration of D1 receptor agonists by squirrel monkeys. Psychopharmacology (Berl,) 125, 97–104.

Guan, Z., Giustetto, M., & Lomvardas, S. (2002). Integration of long-term- memory-related synaptic plasticity involves bidirectional regulation of gene expression and chromatin structure. Cell 111, 483.

Gulley, J. M., Hoover, B. R., Larson, G. A., & Zahniser, N. R. (2003). Individual Differences in Cocaine-induced Locomotor Activity in Rats: Behavioral Characteristics, Cocaine Pharmacokinetics, and the Dopamine Transporter. Neuropsychopharmacology, 28, 2089– 2101.

84

Hall, F.S., Goeb, M., Li, X.F., Sora, I., & Uhl, G.R. (2004). Mu-opioid receptor knockout mice display reduced cocaine conditioned place preference but enhanced sensitization of cocaine-induced locomotion. Brain Res Mol Brain Res 121, 123–130.

Hammer, R.P. (1989) Cocaine alters opiate receptor binding in critical brain reward regions. Synapse 3(1), 55–60

Haracz, J.L., MacDonall, J.S., & Sircar, R. (1997). Effects of nitric oxide syn- thase inhibitors on cocaine sensitization. Brain Res 746, 183–189.

Heimer, L., Alheid, G.F., de Olmos, J.S., Groenewegen, H.J., Haber, S.N., Harlan, R.E., & Zahm, D.S. (1997). The accumbens: beyond the core-shell dichotomy. J. Neuropsychiatry Clin. Neurosci. 9, 354–381.

Heinrichs, S.C., & Koob, G.F. (2004). Corticotropin-releasing factor in brain: A role in activation, arousal, and affect regulation. Journal of Pharmacology and Experimental Therapeutics, 311, 427–440.

Heinz, A., Siessmeier, T., Wrase, J., Hermann, D., Klein, S., & Grusser, S.M. (2004). Correlation between dopamine D2 receptors in the ventral striatum and central processing of alcohol cues and craving. Am J Psychiatry, 161, 1783–1789

Hemby, S.E., Co, C., Koves, T.R., Smith, J.E., & Dworkin, S.I. (1997). Differences in extracellular dopamine concentrations in the nucleus accumbens during response- dependent and response-independent cocaine administration in the rat. Psychopharmacology (Berl), 133, 7–16.

Horger, B. A., Iyasere, C. A., Berhow, M. T., Messer, C. J., Nestler, E. J., & Taylor, J. R. (1999). Enhancement of locomotor activity and conditioned reward to cocaine by brain-derived neurotrophic factor. The Journal of Neuroscience : The Official Journal of the Society for Neuroscience, 19(10), 4110–4122.

Houdi, A.A., Bardo, M.T., & Van Loon, G.R. (1989). Opioid mediation of cocaine-induced hyperactivity and reinforcement. Brain Res. 497, 195–198.

Howell, L.L., & Byrd, L.D. (1991). Characterization of the effects of cocaine and GBR 12909, a dopamine uptake inhibitor, on behavior in the squirrel monkey. J. Pharmacol. Exp. Ther. 258, 178–185.

Huang, P.L., Dawson, T.M., Bredt, D.S., Snyder, S.H., & Fishman, M.C. (1993). Targeted disruption of the neuronai nitric oxide synthase gene. Cell, 75, 273-l.

Hummel, M., Schroeder, J., Liu-Chen, L.Y., Cowan, A., & Unterwald, E.M. (2006). An antisense oligodeoxynucleotide to the mu opioid receptor attenuates cocaine- induced behavioral sensitization and reward in mice. Neuroscience 142, 481–491.

85

Hurd, Y.L., Brown ,E.E., Finlay. J.M., Fibiger, H.C., & Gerfen, C.R. (1992). Cocaine self- administration differentially alters mRNA expression of striatal peptides. Brain Res Mol Brain Res 13, 165–170.

Hurd, Y.L., & Herkenham, M. (1993). Molecular alterations in the neostriatum of human cocaine addicts. Synapse 13, 357–369.

Hurd, Y.L., Weiss, F., Koob, G.F., Koob, N.E., Ungerstedt, U. (1989). Cocaine reinforcement and extracellular dopamine overflow in rat nucleus accumbens: an in vivo microdialysis study. Brain Res., 498, 199–203.

Hyman, S.E., Malenka, R.C., & Nestler, E.J. (2006). Neural mechanisms of addiction: the role of reward-related learning and memory. Annu Rev Neurosci, 29, 565–598.

Ikemoto, S., Glazier, B.S., Murphy, J.M., & McBride, W.J. (1997). Role of dopamine D1 and D2 receptors in the nucleus accumbens in mediating reward. J. Neurosci., 17, 8580–8587.

Impey, S., Obrietan, K., & Wong, S. (1998). Cross talk between ERK and PKA is required for Ca2+ stimulation of CREB-dependent tran- scription and ERK nuclear translocation. Neuron 21, 869-83.

Iravani, M. M., Millar, J., & Kruk, Z. L. (1998). Differential Release of Dopamine by Nitric Oxide in Subregions of Rat Caudate Putamen Slices. Journal of Neurochemistry, 71, 1969–1977.

Ito, R., Dalley, J.W., Robbins, T.W., & Everitt, B.J. (2002). Dopamine release in the dorsal striatum during cocaine-seeking behavior under the control of a drug-associated cue. J Neurosci, 22, 6247–6253.

Itzhak, Y. (1996). Attenuation of cocaine kindling by 7-nitroindazole, an inhibitor of brain nitric oxide synthase. Neuropharmacology, 35(8), 1065–1073.

Itzhak, Y. (2008). Role of the NMDA receptor and nitric oxide in memory reconsolidation of cocaine-induced conditioned place preference in mice. Annals of the New York Academy of Sciences, 1139, 350–357.

Itzhak, Y., Ali, S. F., Martin, J. L., Black, M. D., & Huang, P. L. (1998). Resistance of neuronal nitric oxide synthase-deficient mice to cocaine- induced locomotor sensitization. Psychopharmacology, 140(3), 378–386.

Itzhak, Y., & Anderson, K. L. (2007). Memory reconsolidation of cocaine-associated context requires nitric oxide signaling. Synapse (New York, N.Y.), 61(9), 790–794.

Itzhak, Y., & Martin, J. L. (2000). Blockade of alcohol-induced locomotor sensitization and conditioned place preference in DBA mice by 7-nitroindazole. Brain Research, 858, 402–

86 407.

Itzhak, Y., & Martin, J. L. (2002). Effect of the neuronal nitric oxide synthase inhibitor 7- nitroindazole on methylphenidate-induced hyperlocomotion in mice, 13(1), 81–86.

Itzhak, Y., Martin, J. L., Black, M. D., & Huang, P. L. (1998). The role of neuronal nitric oxide synthase in cocaine-induced conditioned place preference. NeuroReport: An International Journal for the Rapid Communication of Research in Neuroscience, 9, 2485–2488.

Jackson, A.L., & Linsley, P.S. (2010) Recognizing and avoiding siRNA off-target effects for target identification and therapeutic application. Nat Rev Drug Discov, 9, 57–67.

Kalisch, B. E., Connop, B. P., Jhamandas, K., Beninger, R. J., & Boegman, R. J. (1996). Differential action of 7-nitro indazole on rat brain nitric oxide synthase. Neuroscience Letters, 219(2), 75–78.

Karami, M., Zarrindast, M., & Sepehri, H. (2002). Role of nitric oxide in the rat hippocampal CA1 area on morphine-induced conditioned place preference. European Journal of, 449, 113–119.

Kieffer, B.L., Befort, K., Gaveriaux-Ruff, C., & Hirth, C.G. (1992). The delta-opioid receptor: isolation of a cDNA by expression cloning and pharmacological characterization. Proc. Natl. Acad. Sci. U.S.A. 89, 12048–12052.

Kilts, C.D., Schweitzer, J.B., Quinn, C.K., Gross, R.E., Faber, T.L., & Muhammad, F. (2001). Neural activity related to drug craving in cocaine addiction. Arch Gen Psychiatry, 58, 334–341.

Kim, H. S., & Park, W. K. (1995). Nitric oxide mediation of cocaine-induced dopaminergic behaviors: ambulation-accelerating activity, reverse tolerance and conditioned place preference in mice. J Pharmacol Exp Ther, 275(2), 551–557.

Kim, H.S., Park, W.K., Jang, C.G., Oh, K.W., Kong, J.Y., Oh, S., Rheu, H.M., Cho, D.H., & Kang, S.Y. (1997). Blockade by naloxone of cocaine-induced hyperactivity, reverse tolerance and conditioned place preference in mice. Behav. Brain Res. 85, 37–46.

Kiss, J.P., & Vizi, E.S. (2001). Nitric oxide: a novel link between synaptic and nonsynaptic transmission. Trends Neurosci. 24, 211-5.

Kivastik, T., Rutkauskaite, J., & Zharkovsky, A. (1996). Nitric oxide synthesis inhibition attenuates morphine-induced place preference. Pharmacol. Biochem. Behav. 53, 1013– 1015

Koh, W. C., Rahman, M. A., Choe, E. S., Lee, D. K., & Shim, Y. B. (2008). A cytochrome c modified-conducting polymer microelectrode for monitoring in vivo changes in nitric

87 oxide. Biosensors and Bioelectronics, 23(9), 1374–1381.

Koob, G. F. (2004). Allostatic view of motivation: implications for psychopathology. In: Bevins RA, Bardo MT (eds). Motivational Factors in the Etiology of Drug Abuse (series title: Nebraska Symposium on Motivation, vol 50). University of Nebraska Press: Lincoln, NE. pp 1–18.

Koob, G.F. (2008). A role for brain stress systems in addiction. Neuron, 59, 11–34.

Koob, G.F. (2009). Neurobiological substrates for the dark side of compulsivity in addiction. Neuropharmacology, 56, 18–31.

Koob, G. F., Ahmed, S. H., Boutrel, B., Chen, S. A., Kenny, P. J., Markou, A., … Sanna, P. P. (2004). Neurobiological mechanisms in the transition from drug use to drug dependence, 27, 739–749.

Koob, G.F., & Kreek, M.J. (2007). Stress, dysregulation of drug reward pathways, and the transition to drug dependence. Am J Psychiatry, 164, 1149–1159.

Koob, G.F., Le, H.T., & Creese, I. (1987). The D1 dopamine receptor antagonist SCH 23390 increases cocaine self-administration in the rat. Neurosci. Lett., 79, 315–320.

Koob, G. F., & Le Moal, M. (1997). Drug Abuse : Hedonic Homeostatic Dysregulation, Science, 278.

Koob, G. F., & Le Moal, M. (2001). Drug Addiction, Dysregulation of Reward, and Allostasis. Neuropsychopharmacology, 24(2).

Koob, G. F., & Le Moal, M. (2005). Plasticity of reward neurocircuitry and the ‘dark side’ of drug addiction. Nat Neurosci, 8, 1442–1444.

Koob, G. F., & Volkow, N. D. (2009). Neurocircuitry of Addiction. Neuropsychopharmacology, 35(1), 217–238.

Kreek, M. J., Levran, O., Reed, B., Schlussman, S. D., Zhou, Y., & Butelman, E. R. (2012). Science in medicine Opiate addiction and cocaine addiction : underlying molecular neurobiology and genetics, 122(10).

Kuriyama, K., & Ohkuma, S. (1995). Role of nitric oxide in central synaptic transmission: Effects on neurotransmitter release. Jpn J Pharmacol 69, 1–8.

Laine, R., & Ortiz de Montellano, P. R. (1998). Neuronal Nitric Oxide Synthase Isoforms alpha and mu Are Closely Related Calpain-Sensitive Proteins. Molecular Pharmacology, 54, 305–312.

Lange, R. A., & Hillis, L. D. (2001). Cardiovascular complications of cocaine use. N Engl J

88 Med, 345(5), 351-8.

Lau, Y., Petroske, E., Meredith, G. E., & Wang, J. Q. (2003). Elevated neuronal nitric oxide synthase expression in chronic haloperidol-treated rats. Neuropharmacology, 45, 986– 994.

Law, P.Y., Wong, Y.H., & Loh, H.H. (2000). Molecular mechanisms and regulation of opioid receptor signaling. Annu. Rev. Pharmacol. Toxicol. 40, 389–430.

Le Merrer, J., Becker, J. A. J., Befort, K., & Kieffer, B. L. (2009). Reward processing by the opioid system in the brain. Physiological Reviews, 89(4), 1379–412.

Lee, D. K., Ahn, S. M., Shim, Y.-B., Koh, W. C. A., Shim, I., & Choe, E. S. (2011). Interactions of Dopamine D1 and N-methyl-D-Aspartate Receptors are Required for Acute Cocaine- Evoked Nitric Oxide Efflux in the Dorsal Striatum. Experimental Neurobiology, 20(2), 116–22.

Lee, D. K., Koh, W. C. A., Shim, Y. B., Shim, I., & Choe, E. S. (2010). Repeated cocaine administration increases nitric oxide efflux in the rat dorsal striatum. Psychopharmacology, 208(2), 245–256.

Leri, F., Flores, J., Rajabi, H., & Stewart, J. (2003). Effects of Cocaine in Rats Exposed to Heroin. Neuropsychopharmacology, 2102–2116.

Leri, F., Tremblay, A., Sorge, R. E., & Stewart, J. (2004). Methadone Maintenance Reduces Heroin- and Cocaine-Induced Relapse without Affecting Stress-Induced Relapse in a Rodent Model of Poly-Drug Use. Neuropsychopharmacology, 29(7), 1312–1320.

Leri, F., Zhou, Y., Carmichael, B., Cummins, E., & Kreek, M. J. (2012). Treatment-like steady- state methadone in rats interferes with incubation of cocaine sensitization and associated alterations in gene expression. European Neuropsychopharmacology, 100(2), 130–134.

Leri, F., Zhou, Y., & Goddard, B. (2009). Steady-State Methadone Blocks Cocaine Seeking and Cocaine- Induced Gene Expression Alterations in the Rat Brain, Eur Neuropsychopharmacol., 44(3), 735–745.

Leri, F., Zhou, Y., Goddard, B., Cummins, E., & Kreek, M. J. (2006). Effects of high-dose methadone maintenance on cocaine place conditioning, cocaine self-administration, and mu-opioid receptor mRNA expression in the rat brain. Neuropsychopharmacology : Official Publication of the American College of Neuropsychopharmacology, 31(7), 1462– 74.

Lesscher, H.M., Hordijk, M., Bondar, N.P., Alekseyenko, O.V., Burbach, J.P., & van Ree, J.M. et al. (2005). Mu-opioid receptors are not involved in acute cocaine-induced locomotor activity nor in development of cocaine-induced behavioral sensitization in mice. Neuropsychopharmacology 30, 278–285.

89

Li, S., Yin, L., Shi, J., Lin, Z., & Zheng, J. (2002). The effect of 7-nitroindazole on the acquisition and expression of D-methamphetamine-induced place preference in rats, 435, 217–223.

Li, Y.Q., Li, F.Q., Wang, X.Y., Wu, P., Zhao, M., & Xu, C.M.. (2008). Central amygdala extracellular signal-regulated kinase signaling pathway is critical to incubation of opiate craving. J Neurosci, 28, 13248–13257.

Liddie, S., Balda, M., & Itzhak, Y. (2013). Nitric Oxide (NO) Signaling as a Potential Therapeutic Modality Against Psychostimulants. Current Pharmaceutical Design, 19(40), 7092–7102.

Loftis, J. M., & Janowsky, A. (2000). Regulation of NMDA receptor subunits and nitric oxide synthase expression during cocaine withdrawal. Journal of Neurochemistry, 75(5), 2040– 2050.

Lord, J.A., Waterfield, A.A., Hughes, J., & Kosterlitz, H.W. (1977). Endogenous opioid peptides: multiple agonists and receptors. Nature 267, 495–499.

Love, T., Stohler, C., & Zubieta, J. K. (2009). Predict Impulsiveness Traits in Humans. Arch Gen Psychiatry, 66(10), 1124–1134.

Lu, L., Koya, E., Zhai, H., Hope, B.T., & Shaham, Y. (2006). Role of ERK in cocaine addiction. Trends Neurosci, 29, 695–703.

Luo, C. X., Zhu, X. J., Zhou, Q. G., Wang, B., Wang, W., & Cai, H. H. (2007). Reduced neuronal nitric oxide synthase is involved in ischemia-induced hippocampal neurogenesis by up-regulating inducible nitric oxide synthase expression, 1872–1882.

MacKenzie, G.M., Rose, S., Bland-Ward, P.A., Moore, P.K., Jenner, P., Marsden, C.D. (1994). Time course of inhibition of brain nitric oxide synthase by 7-nitro indazole. Neuroreport 5, 1993–1996.

Mahairaki, V., Xu, L., Farah, M. H., Hatfield, G., Kizana, E., & Koliatsos, V. E. (2009). Targeted knock-down of neuronal NOS expression in basal forebrain with RNA interference, 179(2), 292–299.

Mansour, A., Fox, C.A., Akil, H., Watson, S.J. (1995). Opioid-receptor mRNA expression in the rat CNS: anatomical and functional implications. Trends Neurosci. 18, 22–29.

Mansour, A., Fox, C.A., Burke, S., Meng, F., Thompson, R.C., Akil, H., & Watson, S.J. (1994). Mu, delta, and kappa opioid receptor mRNA expression in the rat CNS: an in situ hybridization study. J. Comp. Neurol. 350, 412–438.

Mansour, A., Khachaturian, H., Lewis, M.E., Akil, H., & Watson, S.J. (1987) Autoradiographic

90 differentiation of mu, delta, and kappa opioid receptors in the rat forebrain and midbrain. JNeurosci 7, 2445–2464

Mansour, A., Thompson, R.C., Akil, H., & Watson, S.J. (1993). Delta opioid receptor mRNA distribution in the brain: comparison to delta receptor binding and proenkephalin mRNA. J. Chem. Neuroanat. 6, 351–362.

Manzanedo, C., Aguilar, M. A., Rodríguez-Arias, M., Navarro, M., & Miñarro, J. (2004). 7- Nitroindazole blocks conditioned place preference but not hyperactivity induced by morphine. Behavioural Brain Research, 150(1–2), 73–82.

Maren, S. (1998). Effects of 7-nitroindazole, a neuronal nitric oxide synthase (nNOS) inhibitor, on locomotor activity and contextual fear conditioning in rats. Brain Research, 804(1), 155–158.

Marhe, R., Luijten, M., & Franken, I. H. (2013). The clinical relevance of neurocognitive measures in addiction. Front Psychiatry, 4, 185.

Martin, W.R., Eades, C.G., Thompson, J.A., Huppler, R.E., & Gilbert, P.E. (1976). The effects of morphine- and nalorphine-like drugs in the nondependent and morphine- dependent chronic spinal dog. J. Pharmacol. Exp. Ther. 197, 517–532.

Martin, J. L., & Itzhak, Y. (2000). 7-Nitroindazole blocks nicotine-induced conditioned place preference but not LiCl-induced conditioned place aversion. NeuroReport: An International Journal for the Rapid Communication of Research in Neuroscience, 11, 947–949.

Martinez, D., Broft, A., Foltin, R.W., Slifstein, M., Hwang, D.R., & Huang, Y. (2004). Cocaine dependence and d2 receptor availability in the functional subdivisions of the striatum: relationship with cocaine-seeking behavior. Neuropsychopharmacology, 29, 1190–1202.

Martinez, D., Gil, R., Slifstein, M., Hwang, D.R., Huang, Y., & Perez, A. (2005). Alcohol dependence is associated with blunted dopamine transmission in the ventral striatum. Biol Psychiatry, 58, 779–786.

Mathieu-Kia, A.M., & Besson, M.J. (1998). Repeated administration of cocaine, nicotine and ethanol: effects on preprodynorphin, preprotachykinin A and preproenkephalin mRNA expression in the dorsal and the ventral striatum of the rat. Brain Res Mol Brain Res 54, 141–151.

Mathon, D.S., Lesscher, H.M., Gerrits, M.A., Kamal, A., Pintar, J.E., Schuller, A.G., Spruijt, B.M., Burbach, J.P., Smidt, M.P., van Ree, J.M., & Ramakers, G.M. (2005). Increased gabaergic input to ventral tegmental area dopaminergic neurons asso- ciated with decreased cocaine reinforcement in mu-opioid receptor knockout mice. Neuroscience 130, 359–367.

91 Mcewen, B. S. (2000). Allostasis and Allostatic Load : Implications for Neuropsychopharmacology. Neuropsychopharmacology, 22(2).

McKinzie, D.L., Rodd-Henricks, Z.A., Dagon, C.T., Murphy, J.M., & McBride, W.J. (1999). Cocaine is self-administered into the shell region of the nucleus accumbens in Wistar rats. Ann. N. Y. Acad. Sci., 877, 788–791.

McLaughlin, D.P., Marton-Popovici, M., & Chavkin, C. (2003). k opioid receptor antagonism and prodynorphin gene disruption block stress-induced behavioral responses. J Neurosci 23, 5674–5683.

Melis, M., Spiga, S., & Diana, M. (2005). The dopamine hypothesis of drug addiction: hypodopaminergic state. Int Rev Neurobiol, 63, 101–154.

Menkens, K., Bilsky, E.J., Wild, K.D., Portoghese, P.S., Reid, L.D., & Porreca, F. (1992). Cocaine place preference is blocked by the delta-opioid receptor antagonist, naltrindole. Eur. J. Pharmacol. 219, 345–346.

Meng, F., Xie, G.X., Thompson, R.C., Mansour, A., Goldstein, A., Watson, S.J., & Akil, H. (1993). Cloning and pharmacological characterization of a rat kappa opioid receptor. Proc. Natl. Acad. Sci. U.S.A. 90, 9954–9958.

Minhas, M., & Leri, F. (2014) The effect of heroin dependence on resumption of heroin self- administration in rats. Drug Alcohol Depend 138, 24-31.

Mitchnick, K. A., Creighton, S. D., & Winters, B. D. (2016). Dissociable roles for histone acetyltransferases p300 and PCAF in hippocampus and perirhinal cortex-mediated object memory. Genes, Brain and Behavior, 15, 542–557.

Mitchnick, K. A., Creighton, S., Hara, M. O., Kalisch, B. E., & Winters, B. D. (2015). Differential contributions of de novo and maintenance DNA methyltransferases to object memory processing in the rat hippocampus and perirhinal cortex – a double dissociation. European Journal of Neuroscience, 41, 773–786.

Moore, P.K., Wallace, P., Gaffen, Z., Hart, S.L. & Babbedge, R.C. (1993). Characterization of the novel nitric oxide synthase inhibitor 7-nitro indazole and related indazoles: antinociceptive and cardiovascular effects. Br. J. Pharmacol., 110, 219-224.

Morris, B.J., Simpson, C.S., Mundell, S., Maceachern, K., Johnston, H.M., & Nolan, A.M. (1997). Dynamic changes in NADPH-diaphorase stain- ing reflect activity of nitric oxide synthase: Evidence for a dopami- nergic regulation of striatal nitric oxide release. Neuropharmacology 36, 1589–1599.

Mueller, D., & Stewart, J. (2000). Cocaine-induced conditioned place preference: Reinstatement by priming injections of cocaine after extinction. Behavioural Brain Research, 115(1), 39–47.

92

Murphy, H. C., & Murphy, C. (1991). The Use of Whole Animals Versus Isolated Organs or Cell Culture in Research.

Muschamp, J. W., & Carlezon, W. A. (2013). Roles of nucleus accumbens CREB and dynorphin in dysregulation of motivation. Cold Spring Harbor Perspectives in Medicine, 3(2), 1–16.

Nasif, F. J., Hu, X.-T., Ramirez, O. a, & Perez, M. F. (2010). Inhibition of neuronal nitric oxide synthase prevents alterations in medial prefrontal cortex excitability induced by repeated cocaine administration. Psychopharmacology, 218(2), 323–30.

Nestler, E. J.(2005). The Neurobiology of Cocaine Addiction. Science and Practice Perspectives, 4–10.

Ng, Y. K., Xue, Y. D., & Wong, P. T. (1999). Different distributions of nitric oxide synthase- containing neurons in the mouse and rat hypothalamus. Nitric Oxide : Biology and Chemistry / Official Journal of the Nitric Oxide Society, 3(5), 383–392.

Nguyen, A.T., Marquez, P., Hamid, A., Kieffer, B., Friedman, T.C., & Lutfy, K. (2012). The rewarding action of acute cocaine is reduced in beta-endorphin deficient but not in mu opioid receptor knockout mice. Eur J Pharmacol 686, 50–54.

Noble, F., Lenoir, M., Marie, N., Curtis, M., & Takeda, K. (2015). The opioid receptors as targets for drug abuse medication. British Journal of Pharmacology, 14(172), 3964– 3979.

Noda, Y., Yamada, K., Furukawa, H., & Nabeshima, T. (1995). Involvement of nitric oxide in phencyclidine-induced hyperlocomotion in mice. European Journal of Pharmacology, 286, 291–297.

Nygard, S. K., Klambatsen, A., Balouch, B., Quinones-Jenab, V., & Jenab, S. (2017). NMDAR dependent intracellular responses associated with cocaine conditioned place preference behavior. Behavioural Brain Research SreeTestContent1, 317, 218–225.

Olds, J., & Milner, P. (1954). Positive reinforcement produced by electrical stimulation of septal area and other regions of rat brain. J Comp Physiol Psychol, 47, 419–427.

Olive, M.F., Koenig, H.N., Nannini, M.A., & Hodge, C.W. (2001). Stimulation of endor- phin neurotransmission in the nucleus accumbens by ethanol, cocaine, and amphetamine. J. Neurosci. 21, RC184.

Orsini, C., Izzo, E., Koob, G. F., & Pulvirenti, L. (2002). Blockade of nitric oxide synthesis reduces responding for cocaine self-administration during extinction and reinstatement. Brain Research, 925(2), 133–140.

Pert, C.B., & Snyder, S.H. (1973). Opiate receptor: Demonstration in nervous tissue. Science,

93 179, 1011–1014.

Pettit, H.O., & Justice Jr., J.B. (1989). Dopamine in the nucleus accumbens during cocaine self- administration as studied by in vivo microdialysis. Pharmacol. Biochem. Behav., 34, 899–904.

Phillips, G.D., Robbins, T.W., & Everitt, B.J. (1994). Bilateral intra- accumbens self- administration of d-amphetamine: antagonism with intra-accumbens SCH-23390 and sulpiride. Psychopharmacology (Berl), 114, 477–485.

Pierce, R. C., & Kumaresan, V. (2006). The mesolimbic dopamine system : The final common pathway for the reinforcing effect of drugs of abuse? Neuroscience and Biobehavioral Reviews, 30, 215–238.

Placenza, F. M., Rajabi, H., & Stewart, J. (2008). Effects of chronic buprenorphine treatment on levels of nucleus accumbens glutamate and on the expression of cocaine-induced behavioral sensitization in rats. Psychopharmacology, 200(3), 347–355.

Pokk, P., & Väli, M. (2002). Effects of Nitric Oxide Synthase Inhibitors 7-NI , L-NAME , and L-NOARG in Staircase Test. Archives of Medical Research, 33, 265–268.

Pudiak, C. M., & Bozarth, M. A. (2002). The effect of nitric oxide synthesis inhibition on intravenous cocaine self-administration. Progress in Neuro-Psychopharmacology & Biological Psychiatry, 26(1), 189–196.

Pudiak, C. M., & Bozarth, M. A. (2013). Effect of post-trial L-NAME administration on cocaine sensitization. The International Journal of Neuroscience, 123(9), 663–669.

Pulvirenti, L., Balducci, C., & Koob, G. F. (1997). Dextromethorphan reduces intravenous cocaine self-administration in the rat. European Journal of Pharmacology, 321(3), 279– 283.

Rademacher, D.J., & Steinpreis, R.E. (2002). Effects of the selective mu(1)-opioid recep- tor antagonist, naloxonazine, on cocaine-induced conditioned place preference and locomotor behavior in rats. Neurosci. Lett. 332, 159–162.

Radermacher, P., & Haouzi, P. (2013). A mouse is not a rat is not a man: species-specific metabolic responses to sepsis - a nail in the coffin of murine models for critical care research? Intensive Care Medicine Experimental, 1(1), 7.

Ramsey, N.F., Gerrits, M.A., & van Ree, J.M. (1999). Naltrexone affects cocaine self- administration in naive rats through the ventral tegmental area rather than dopaminergic target regions. Eur. Neuropsychopharmacol. 9, 93–99.

Reid, L.D., Glick, S.D., Menkens, K.A., French, E.D., Bilsky, E.J., & Porreca, F. (1995). Cocaine self-administration and naltrindole, a delta-selective opioid antagonist.

94 Neuroreport 6, 1409–1412.

Richter, A., Loschmann, P., & Loscher, W. (2000). Antidystonic efficacy of nitric oxide synthase inhibitors in a rodent model of primary paroxysmal dystonia. British Journal of Pharmacology, 131, 921–926.

Richter, R.M. & Weiss, F. (1999). In vivo CRF release in rat amygdala is increased during cocaine withdrawal in self-administering rats. Synapse, 32, 254–61.

Ritz, M. C., Cone, E. J., & Kuhar, M. J. (1990). Cocaine inhibition of ligand binding at dopamine, norepinephrine and serotonin transporters: A structure-activity study. Life Sciences, 46(9), 635–645.

Ritz, M.C., Lamb, R.J., Goldberg, S.R., & Kuhar, M.J. (1987). Cocaine receptors on dopamine transporters are related to self-administration of cocaine. Science, 237, 1219–1223.

Rivera, A., Alberti, I., Martin, A.B., Narvaez, J.A., & Moratalla, R. (2002). Molecular phenotype of rat striatal neurons expressing the dopamine D5 receptor subtype. Eur J Neurosci 16, 2049–2058.

Rodd-Henricks, Z.A., McKinzie, D.L., Li, T.K., Murphy, J.M., & McBride, W.J. (2002). Cocaine is self-administered into the shell but not the core of the nucleus accumbens of Wistar rats. J. Pharmacol. Exp. Ther., 303, 1216–1226.

Rogers, T.J., Steele, A.D., Howard, O.M., & Oppenheim, J.J. (2000). Bidirectional heterologous desensitization of opioid and chemokine receptors. Ann N Y Acad Sci 917, 19–28.

Roth-Deri, I., Zangen, A., Aleli, M., Goelman, R.G., Pelled, G., Nakash, R., Gispan-Herman, I., Green, T., Shaham, Y., & Yadid, G. (2003). Effect of experimenter- delivered and self- administered cocaine on extracellular beta-endorphin levels in the nucleus accumbens. J. Neurochem. 84, 930–938.

Sahraeia, H., Noorbakhshniad, M., Asgaria, A., Haeri-Rohanid, A., Khoshbatena, A., Poorheidaria, G., Sepehrid, H., Ghoshoonia, H., & Zarrindast, M. (2004). Involvement of nucleus accumbens in L-arginine-induced conditioned place preference in rats. Behav Pharmacology, 15, 473–480.

Sammut, S., Dec, A., Mitchell, D., Linardakis, J., Ortiguela, M., & West, A.R. (2006). Phasic dopaminergic transmission increases NO efflux in the rat dorsal striatum via a neuronal NOS and a dopamine D(1/5) receptor-dependent mechanism. Neuropsychopharmacology 31, 493–505.

Sammut, S., & West, A. R. (2008). Acute cocaine administration increases NO efflux in the rat prefrontal cortex via a neuronal NOS-dependent mechanism. Synapse, 62(9), 710–713.

Schenk, S., Partridge, B., & Shippenberg, T.S. (1999). U69593, a kappa-opioid agonist,

95 decreases cocaine self-administration and decreases cocaine-produced drug-seeking. Psychopharmacology 144, 339–346.

Schlussman, S.D., Zhou, Y., Bailey, A., Ho, A., & Kreek, M.J. (2005). Steady-dose and escalating-dose ‘binge’ administration of cocaine alter expression of behavioral stereotypy and striatal preprodynorphin mRNA levels in rats. Brain Res Bull 67, 169– 175.

Schroeder, J. A., Niculescu, M., & Unterwald, E. M. (2003). Cocaine alters Mu but not delta or kappa opioid receptor-stimulated in situ [35S]GTPS binding in rat brain. Synapse, 47(1), 26–32.

Self, D.W., Stein, L. (1992). The D1 agonists SKF 82958 and SKF 77434 are self-administered by rats. Brain Res., 582, 349–352.

Self, D.W., Belluzzi, J.D., Kossuth, S., & Stein, L. (1996). Self-administration of the D1 agonist SKF 82958 is mediated by D1, not D2, receptors. Psychopharmacology (Berl), 123, 303– 306.

Shaham, Y., Shalev, U., Lu, L., de Wit, H., & Stewart, J. (2003). The reinstatement model of drug relapse: history, methodology and major findings. Psychopharmacology, 168, 3–20.

Shaw-Lutchman, T.Z., Barrot, M.,Wallace, T., Gilden, L., Zachariou, V., & Impey, S. (2002). Regional and cellular mapping of cAMP response element-mediated transcription during naltrexone-precipitated morphine withdrawal. JNeurosci, 22, 3663–3672.

Shen, F., Li, Y. J., Shou, X. J., & Cui, C. L. (2012). Role of the NO/sGC/PKG signaling pathway of hippocampal CA1 in morphine-induced reward memory. Neurobiology of Learning and Memory, 98(2), 130–138.

Shen, F., Wang, N., Qi, C., Li, Y.-J., & Cui, C.-L. (2014). The NO/sGC/PKG Signaling Pathway in the NAc Shell Is Necessary for the Acquisition of Morphine-Induced Place Preference. Behav Neurosci, 128(4), 446–459

Shippenberg, T.S., Zapata, A., & Chefer, V.I. (2007). Dynorphin and the pathophysiology of drug addiction. Pharmacol Ther 116, 306–321.

Simões, A. E. S., Pereira, D. M., Amaral, J. D., Nunes, A. F., Gomes, S. E., & Rodrigues, P. M. (2013). Efficient recovery of proteins from multiple source samples after trizol or trizol LS RNA extraction and long-term storage. BMC Genomics, 14(181).

Simon, E.J., Hiller, J.M., & Edelman, I. (1973). Stereospecific binding of the potent narcotic analgesic [3H]etorphine to rat brain homogenate. Proceedings of the National Academy of Sciences USA, 70, 1947– 1949

Sinnott, R.S., Mach, R.H., Nader, M.A. (1999). Dopamine D2/D3 receptors modulate cocaine’s

96 reinforcing and discriminative stimulus effects in rhesus monkeys. Drug Alcohol Depend., 54, 97–110.

Sivam, S.P. (1989). Cocaine selectively increases striatonigral dynorphin levels by a dopaminergic mechanism. J Pharmacol Exp Ther 250, 818–824.

Smiley, P.L., Johnson, M., Bush, L., Gibb, J.W., & Hanson, G.R. (1990). Effects of cocaine on extrapyramidal and limbic dynorphin systems. J Pharmacol Exp Ther 253, 938–943.

Soderman, A. R., & Unterwald, E. M. (2009). Cocaine-induced mu opioid receptor occupancy within the striatum is mediated by dopamine D2 receptors. Brain Research, 1296, 63–71.

Solinas, M., Chauvet, C., Thiriet, N., El Rawas, R., & Jaber, M. (2008). Reversal of cocaine addiction by environmental enrichment. Proc Natl Acad Sci U S A, 105(44), 17145– 17150.

Stefanski, R., Ziólkowska, B., Kusmider, M., Wyszogrodzka, E., Kolomanska, P., Dziedzicka- wasylewska, M., … Kostowski, W. (2007). Active versus passive cocaine administration : Differences in the neuroadaptive changes in the brain dopaminergic system. Brain Research, 57, 1–10.

Steiner, H., & Gerfen, C.R. (1993). Cocaine-induced c-fos messenger RNA is inversely related to dynorphin expression in striatum. J Neurosci 13, 5066–5081.

Sticht, M., Mitsubata, J., Tucci, M., & Leri, F. (2010). Neurobiology of Learning and Memory Reacquisition of heroin and cocaine place preference involves a memory consolidation process sensitive to systemic and intra-ventral tegmental area naloxone. Neurobiology of Learning and Memory, 93(2), 248–260.

Suzuki, T., Mori, T., Tsuji, M., Misawa, M., & Nagase, H. (1994). The role of delta-opioid receptor subtypes in cocaine- and methamphetamine-induced place prefer- ences. Life Sci. 55, L339–L344.

Suzuki, T., Shiozaki, Y., Masukawa, Y., Misawa, M., & Nagase, H. (1992). The role of mu- and kappa-opioid receptors in cocaine-induced conditioned place preference. Jpn J Pharmacol 58, 435–442.

Svensson, P., & Hurd, Y.L. (1998). Specific reductions of striatal prodynorphin and D1 dopamine receptor messenger RNAs during cocaine abstinence. Brain Res Mol Brain Res 56, 162–168.

Terenius, L. (1973). Stereospecific interaction between narcotic analgesics and a synaptic plasma membrane fraction of rat cerebral cortex. Acta Pharmacoligica Toxicoligica, 32, 317– 320.

Thompson, R.C., Mansour, A., Akil, H., & Watson, S.J. (1993). Cloning and pharmacolog- ical

97 characterization of a rat mu opioid receptor. Neuron 11, 903–913.

Thomsen, M., & Caine, S. B. (2011). Psychomotor stimulant effects of cocaine in rats and 15 mouse strains. Experimental and clinical psychopharmacology, 19.

Tian, Y., Lee, K., You, I., Lee, S., & Jang, C. (2008). 7-Nitroindazole , Nitric Oxide Synthase Inhibitor Attenuates Physical Dependence on Butorphanol in Rat. Synapse, 589, 582– 589.

Trigo, J. M., Martin-García, E., Berrendero, F., Robledo, P., & Maldonado, R. (2010). The endogenous opioid system: A common substrate in drug addiction. Drug and Alcohol Dependence, 108(3), 183–194.

Turchan, J., Maj, M., Przewlocka, B., & Przewlocki, R. (2002). Effect of cocaine and amphetamine on biosynthesis of proenkephalin and prodynorphin in some regions of the rat limbic system. Pol J Pharmacol 54, 367–372.

Tzschentke, T.M. (1998). Measuring reward with the conditioned place preference paradigm: a comprehensive review of drug effects, recent progress and new issues. Prog Neurobiol, 56, 613–672.

Unterwald, E. M., Horne-King, J., & Kreek, M. J. (1992). Chronic cocaine alters brain mu opioid receptors. Brain Research, 584(1–2), 314–318.

Unterwald, E.M., Kreek, M.J., & Cuntapay, M. (2001). The frequency of cocaine administration impacts cocaine-induced receptor alter- ations. Brain Res 900, 103–109.

Unterwald, E.M., Rubenfeld, J.M., & Kreek, M.J. (1994). Repeated cocaine administra- tion upregulates kappa and mu, but not delta, opioid receptors. Neuroreport 5, 1613–1616.

Uzbay, I. T., Erden, B. F., Tapanyigit, E. E., & Kayaalp, S. O. (1997). Nitric oxide synthase inhibition attenuates signs of ethanol withdrawal in rats. Life Sciences, 61(22), 2197– 2209.

Vescovi, P.P., Coiro, V., Volpi, R., & Passeri, M. (1992). Diurnal variations in plasma ACTH, cortisol and beta-endorphin levels in cocaine addicts. Horm Res 37, 221–224.

Vincent, S. R. (2010). Progress in Neurobiology Nitric oxide neurons and neurotransmission, 90, 246–255.

Vitcheva, V., Simeonova, R., Kondeva-Burdina, M., & Mitcheva, M. (2015). Selective Nitric Oxide Synthase Inhibitor 7-Nitroindazole Protects against Cocaine-Induced Oxidative Stress in Rat Brain. Oxidative Medicine and Cellular Longevity, 2015.

Volkow, N.D., Fowler. J.S., Wang, G.J., & Swanson, J.M. (2004). Dopamine in drug abuse and addiction: results from imaging studies and treatment implications. Mol Psychiatry, 9,

98 557–569

Volkow, N.D. & Li, T.K. (2004). Drug addiction: The neurobiology of behavior gone awry. Nature Reviews Neuroscience, 5, 963–970.

Volkow, N.D., & Swanson, J.M. (2003). Variables that affect the clinical use and abuse of methylphenidate in the treatment of ADHD. Am J Psychiatry, 160, 1909–1918.

Volkow, N.D., Wang, G.J., Fischman, M.W., Foltin, R.W., Fowler, J.S., Abumrad, N.N., Vitkun, S., Logan, J., Gatley, S.J., Pappas, N., Hitzemann, R., Shea, C.E. (1997). Relationship between subjective effects of cocaine and dopamine transporter occupancy. Nature, 386, 827–830.

Volkow, N.D., Wang, G.J., Fowler, J.S., Franceschi, D., Thanos, P.K., & Wong, C. (2000). Cocaine abusers show a blunted response to alcohol intoxication in limbic brain regions. Life Sci, 66, PL161–PL167.

Volkow, N.D., Wang, G.J., Telang, F., Fowler, J.S., Logan, J., & Childress, A.R. (2006). Cocaine cues and dopamine in dorsal striatum: mechanismof craving in cocaine addiction. J Neurosci, 26, 6583–6588.

Volkow, N.D., Wang, G.J., Telang, F., Fowler, J.S., Logan, J., & Childress, A.R. (2008). Dopamine increases in striatum do not elicit craving in cocaine abusers unless they are coupled with cocaine cues. Neuroimage, 39, 1266–1273.

Ward, S.J., & Roberts, D.C. (2007). Microinjection of the delta-opioid receptor selective antagonist naltrindole 5′-isothiocyanate site specifically affects cocaine self- administration in rats responding under a progressive ratio schedule of reinforcement. Behav. Brain Res. 182, 140–144.

Ward, S.J., Martin, T.J., & Roberts, D.C. (2003). Beta-funaltrexamine affects cocaine self- administration in rats responding on a progressive ratio schedule of rein- forcement. Pharmacol. Biochem. Behav. 75, 301–307.

Weed, M.R., & Woolverton, W.L. (1995). The reinforcing effects of dopamine D1 receptor agonists in rhesus monkeys. J. Pharmacol. Exp. Ther., 275, 1367–1374.

West, A. R., & Galloway, M. P. (1997a). Endogenous Nitric Oxide Facilitates Striatal Dopamine and Glutamate Efflux in viva : Role of Ionotropic Glutamate Receptor-Dependent Mechanisms. Neuropharmacology, 36, 1571–1581.

West, A. R., & Galloway, M. P. (1997b). Inhibition of glutamate reuptake potentiates endogenous nitric oxide-facilitated dopamine efflux in the rat striatum : an in vivo microdialysis study. Neuroscience Letters, 230, 21–24.

Wexler, B.E., Gottschalk, C.H., Fulbright, R.K., Prohovnik, I., Lacadie, C.M., & Rounsaville,

99 B.J. (2001). Functional magnetic resonance imaging of cocaine craving. Am J Psychiatry, 158, 86–95.

Whitelaw, R.B., Markou, A., Robbins, T.W., & Everitt, B.J. (1996). Excitotoxic lesions of the basolateral amygdala impair the acquisition of cocaine-seeking behaviour under a second-order schedule of reinforcement. Psychopharmacology, 127, 213–224.

Winick-Ng, W., Leri, F., & Kalisch, B. E. (2012). Nitric oxide and histone deacetylases modulate cocaine-induced mu-opioid receptor levels in PC12 cells. BMC Pharmacology & Toxicology, 13(1), 11.

Wise, R.A. (1978). Catecholamine theories of reward: a critical review. Brain Res.,152, 215– 247.

Wise, R.A. (1989). The brain and reward. In: Leibman JM, Cooper SJ (eds), The neuropharmacological basis of reward. Clarendon Press, Oxford, pp 377–424.

Wise, R.A., Murray, A., & Bozarth, M.A. (1990). Bromocriptine self- administration and bromocriptine-reinstatement of cocaine-trained and heroin-trained lever pressing in rats. Psychopharmacology, 100, 355–360.

Wolf, M.E. (2002). Addiction: making the connection between behavioral changes and neuronal plasticity in specific pathways. Mol Intervent, 2, 146–157.

Wong, V., & Lerner, E. (2015). Nitric oxide inhibition strategies. Future Science OA, 1.

Woolverton, W.L. (1987). Evaluation of the role of norepinephrine in the reinforcing effects of psychomotor stimulants in rhesus monkeys. Pharmacol. Biochem. Behav., 26, 835–839.

Woolverton, W.L., Goldberg, L.I., & Ginos, J.Z. (1984). Intravenous self- administration of dopamine receptor agonists by rhesus monkeys. J. Pharmacol. Exp. Ther,. 230, 678–683.

Woolverton, W.L., Hecht, G.S., Agoston, G.E., Katz, J.L., & Newman, A. H. (2001). Further studies of the reinforcing effects of benztropine analogs in rhesus monkeys. Psychopharmacology (Berl), 154, 375– 382.

Xu, M., Hu, X.T., Cooper, D.C., Moratalla, R., Graybiel, A.M., White, F.J., Tonegawa, S. (1994). Elimination of cocaine-induced hyperactivity and dopamine-mediated neurophysiological effects in dopamine D1 receptor mutant mice. Cell, 79, 945–955.

Yang, S.N. (1999). Presynaptic involvement of nitric oxide in dopamine D1/D5 receptor-induced sustained enhancement of synaptic cur- rents mediated by ionotropic glutamate receptors in the rat hippocampus. Neurosci Lett 270, 87–90.

100 Yasuda, K., Raynor, K., Kong, H., Breder, C.D., Takeda, J., Reisine, T., & Bell, G.I. (1993). Cloning and functional comparison of kappa and delta opioid receptors from mouse brain. Proc. Natl. Acad. Sci. U.S.A. 90, 6736–6740.

Yildiz, F., Ulak, G., Erden, B. F., & Gacar, N. (2000). Anxiolytic-Like Effects of 7- Nitroindazole in the Rat Plus-Maze Test. Pharmacology Biochemistry and Behavior, 65(2), 199–202.

Yoo, J., Cho, J., Lee, S., Lee, S., Loh, H. H., Ho, I. K., & Jang, C. (2006). Differential effects of morphine- and cocaine-induced nNOS immunoreactivity in the dentate gyrus of hippocampus of mice lacking mu -opioid receptors, 395, 98–102.

Yoo, J. H., Kitchen, I., & Bailey, A. (2012). The endogenous opioid system in cocaine addiction: What lessons have opioid peptide and receptor knockout mice taught us? British Journal of Pharmacology, 166(7), 1993–2014.

Yoo, J.H., Yang, E.M., Lee, S.Y., Loh, H.H., Ho, I.K., & Jang, C.G. (2003). Differential effects of morphine and cocaine on locomotor activity and sensitization in mu-opioid receptor knockout mice. Neurosci Lett 344, 37–40.

Zelek-Molik, A., Taracha, E., Nawrat, D., Bielawski, A., Lehner, M., Płaźnik, A., & Nalepa, I. (2010). Effects of morphine and methadone treatment on mRNA expression of Gα(i) subunits in rat brains. Pharmacological Reports, 62, 1197–203.

Zimmer, A., Valjent, E., Konig, M., Zimmer, A.M., Robledo, P., & Hahn, H. (2001). Absence of delta-9-tetrahydrocannabinol dysphoric effects in dynorphin-deficient mice. J Neurosci 21, 9499–9505.

Zubieta, J. K., Gorelick, D. A., Stauffer, R., Ravert, H. T., Dannals, R. F., & Frost, J. J. (1996). Increased mu opioid receptor binding detected by PET in cocaine-dependent men is associated with cocaine craving. Nat.Med., 2(11), 1225–1229.

101 Appendix: Supplementary Data

Gene Primer Sequence Product Efficiency R2 Slope Size (bp) F TCCTCATGGACTGATTATGGACA 132 104.68% 0.99 -3.2147 HPRT R TAATCCAGCAGGTCAGCAAAGA

F GCCCTCTACTCTATCGTGTGTGTA 179 102.55% 0.99 - MOR 3.2623 R GTTCCCATCAGGTAGTTGACACTC

F GACAACGTTCCTGTGGTCCT 179 103.28% 0.99 - nNOS 3.2458 R TCCAGTGTGCTCTTCAGGTG

102

Supplementary Figure 1. Relative MOR and nNOS mRNA and protein expression in the rat CPu 72 hours following the completion of cocaine CPP. For both (A) MOR and (B) nNOS relative mRNA expression, the ANOVA revealed no significant main effect of treatment. The same was true for (C) MOR and (D) nNOS relative protein expression. Data is expressed as mean ± SEM (n=8/group).

103

Supplementary Figure 2. Relative mRNA and protein expression of MOR and nNOS in the rat PFC 72 hours after completing cocaine CPP. The ANOVA indicated that there was no significant main effect of treatment on both (A) MOR and (B) nNOS relative mRNA expression. The same results were found for (C) MOR and (D) nNOS relative protein expression. Data is expressed as mean ± SEM (n=8/group).

104

Supplementary Figure 3. Relative expression of (A) MOR and (B) nNOS mRNA, as well as (C) MOR protein in the rat Hp 72 hours following cocaine CPP. All expression levels are relative to those obtained from vehicle treated animals that did not receive 7-NI and were analyzed using a one-factor ANOVA followed by a Dunnett post-hoc test. The * indicates p < 0.05 and the ** indicates p < 0.01, relative to vehicle only treated animals. The # indicates a significant difference from the cocaine only treated animals. It is important to note that the nNOS protein was not detectable in the rat Hp tissue via immunoblotting. Data is expressed as mean ± SEM (n=8/group).

105