NEWT LENS REGENERATION: ROLE OF OCT-4 IN NEWT REGENERATING

TISSUE AND PROTEOME ANALYSIS OF REGENERATION COMPETENT VS.

REGENERATION INCOMPETENT CELLS

Dissertation

Submitted to

The College of Arts and Sciences of the

UNIVERSITY OF DAYTON

In Partial Fulfillment of the Requirements for

The Degree

Doctor of Philosophy in Biology

By

Rital B. Bhavsar

UNIVERSITY OF DAYTON

Dayton, Ohio

May, 2014 NEWT LENS REGENERATION: ROLE OF OCT-4 IN NEWT REGENERATING

TISSUE AND PROTEOME ANALYSIS OF REGENERATION COMPETENT VS.

REGENERATION INCOMPETENT CELLS

Name: Bhavsar, Rital B

APPROVED BY:

______Dr. Panagiotis A. Tsonis, Ph.D. Faculty Advisor

______Dr. Amit Singh, Ph.D. Committee Member

______Dr. John Rowe, Ph.D. Committee Member! ! ! ______Dr. Madhuri Kango-Singh, Ph.D. Committee Member! !

______Dr. Katia Del Rio Tsonis, Ph.D. Committee Member! ! !

! ii!

ABSTRACT

NEWT LENS REGENERATION: ROLE OF OCT-4 IN NEWT REGENERATING

TISSUE AND PROTEOME ANALYSIS OF REGENERATION COMPETENT VS.

REGENERATION INCOMPETENT CELLS

Name: Bhavsar, Rital B. University of Dayton

Advisor: Dr. Panagiotis A. Tsonis, Ph.D.

Newts possess remarkable ability for regenerating various body organs and parts. Lens regeneration in newts is achieved by transdifferentiation of dorsal iris to lens cells. This ability of transdifferentiation is exhibited only from the dorsal iris and not by the ventral iris. In order to study the process of transdifferentiation during lens regeneration and the characteristics that allow lens regeneration only from the dorsal iris, we studied the role of reprogramming factor; oct-4 during newt lens regeneration and analyzed the proteome of dorsal iris cells vs. ventral iris cells respectively. During transdifferentiation, the dorsal iris has to change its cellular identity in order to achieve identity of lens cells. Such mechanisms are also observed during generation of iPS cells and previous studies have shown that these two processes share some similarities. It was observed that one of the crucial reprogramming factor oct-4 was absent in the regenerating tissues of newt. Thus,

! iii!

we hypothesize that absence of oct-4 during newt lens regeneration restricts the IPE cells to only a particular fate (lens cells). We over expressed oct-4 in the newt IPE cells and studied its effect on transdifferentiation potential of these cells. The results showed oct-4 inhibits the process of transdifferentiation in newt dorsal IPE cells by interfering with sox-2 and pax-6, factors important for synthesis of crystallin during lens formation. Thus, oct-4 absence during newt lens regeneration allows the dorsal iris to change its cellular identity to regenerate the lost lens. Further, we also examined the proteome of cultured regeneration competent dorsal IPE cells and regeneration incompetent ventral iris cells with a goal to identify any molecular marker specific to either dorsal or ventral IPE cells.

The proteome was studied using newt’s de novo assembled transcriptome as a reference library. The results did not reveal any specific markers for either of the cell population.

However, on comparison of in vitro proteome to in vivo proteome of 0, 4 and 8 day regenerating iris identified some factors related to gene regulation and retinoic acid synthesis with higher expression in the dorsal IPE cells compared to the ventral IPE cells.

! iv!

Dedicated to Krishna and My Family

! v!

ACKNOWLEDGEMENTS

I am thankful to my advisor Dr. Panagiotis Tsonis for providing me the opportunity to work with him and supporting my research by providing all the resources and guidance throughout the course of the study. My kind respects to his efforts and time for all the help extended towards completion of my doctorate.

I appreciate the valuable support, guidance and time from my advising committee. This includes Dr Amit Singh, Dr Katia Del-Rio Tsonis, Dr Madhuri kango-Singh and Dr John

Rowe. A special thanks to Dr Amit Singh for his kind hearted nature. I am also thankful to the department chairperson Dr Jayne Robinson for all the help she has extended during my graduate study.

My special thanks to Dr. Kenta Nakamura for training me in the technical expertise needed for conducting the research. I would also like to extend my thanks to my colleagues Maki, Rinako, Priyanka, Andrea, Kosta, Joelle and all the lab undergrads for providing any help needed in these years.

My sincere appreciation for the mass spectrometry experiment conducted by our collaborator Dr Mario Looso at Germany.

I am thankful to my friends Meghana, Sulabha, Shefali, Sushmita and Lavanya for their affection and friendship through these years.

! vi!

I would also like to acknowledge the organisms whose lives were sacrificed for the study.

Lastly, I would like to thank all my relatives and family friends for their affection.

! vii!

TABLE OF CONTENTS

Page number

ABSTRACT ...... iii

DEDICATION ...... v

ACKNOWLEDGEMENTS ...... vi

TABLE OF CONTENTS ...... viii

LIST OF FIGURES ...... xi

LIST OF TABLES ...... xiii

LIST OF ABBREVIATIONS ...... xiv

CHAPTER I. INTRODUCTION AND LITERATURE REVIEW ...... 1

Lens regeneration in newts ...... 1

Lens regeneration in other vertebrate model organisms ...... 5

Mechanism of regeneration in vertebrates ...... 5

Regeneration and iPS reprogramming ...... 9

Hypothesis ...... 10

Significance ...... 11

References ...... 12

! viii!

CHAPTER II. EXOGENOUS OCT-4 INHIBITS LENS TRANSDIFFERENTIATION

IN NEWTS BY REGULATING SOX-2, C-MYC AND PAX-6 ...... 16

Abstract ...... 16

Introduction ...... 17

Materials and methods ...... 18

Results ...... 27

Discussion ...... 30

References ...... 34

CHAPTER III. PROTEOME ANALYSIS OF IN VITRO CULTURED DORSAL IRIS

EPITHELIAL CELLS (IPE) AND VENTRAL IPE CELLS ...... 46

Abstract ...... 46

Introduction ...... 47

Materials and methods ...... 48

Results ...... 50

Discussion ...... 51

References ...... 53

CHAPTER IV. SUMMARY AND FUTURE STUDY ...... 59

Summary ...... 59

Future study and significance ...... 60

! ix!

APPENDIX

Proteins identified in Newt cultured IPE cells

A. Dorsal proteome ...... 61

B. Ventral proteome ...... 78

! x!

LIST OF FIGURES

CHAPTER II

Figure 1. Oct-4 transfection in newt 1 week cultured IPE cells ...... 36

Figure 2. Cell condition after nucleofection ...... 38

Figure 3. pCS2+ venus transfection in 2 week cultured IPE cells...... 38

Figure 4. Cultured IPE cells transfected with Caggs plasmid ...... 39

Figure 5. Immunocytochemistry of IPE cells expressing oct-4-EGFP ...... 39

Figure 6. Implantation of Caggs transfected aggregates in lentectomized newts. ....40

Figure 7. In vitro matrigel assay for Caggs EGFP transfected aggregate...... 41

Figure 8. Newt IPE cells treated with oct-4 protein...... 42

Figure 9. Immunohistochemistry for crystallin expression in aggregates placed on matrigel ...... 43

Figure 10. Oct-4 mRNA expression in human oct-4 protein treated vs. untreated newt IPE cells ...... 44

Figure 11. mRNA expression levels in human oct-4 protein treated vs. untreated

newt IPE cells ...... 44

Figure 12. Klf4 mRNA expression in human oct-4 protein treated vs. untreated

newt IPE cells ...... 45

! xi!

CHAPTER III

Figure 13. GO distribution for the significant terms shown in Table 1B ...... 56

Figure 14. Q-PCR validation for proteins listed in Table 1B ...... 56

Figure 15. Q-PCR validation for proteins listed in Table 5 ...... 58

! xii!

LIST OF TABLES

CHAPTER II

Table 1. Nucleofection reaction tubes ...... 21

Table 2. Newt IPE cell transfection using nucleofector ...... 37

Table 3. In vitro matrigel assay results for IPE cell aggregates...... 42

CHAPTER III

Table 4. Fisher’s Exact Test for Dorsal and Ventral Proteome ...... 54

Table 5. Proteins found in both in vitro IPE cells and various stages of in vivo regenerating iris ...... 57

! xiii!

LIST OF ABBREVIATIONS

IPE Iris pigmented epithelial

BMP Bone Morphogenetic protein

FGF Fibroblast Growth Factor

DNA Deoxyribonucleic Acid

TGF- β Transforming Growth Factor Beta

CMZ Ciliary Marginal Zone

CNS Central Nervous System iPS induced Pluripotent Stem

ES Embryonic stem

IACUC Institutional Animal Care and Use Committee

CMF Calcium Magnesium Free

EGFP Enhanced Green Fluorescent Protein

PCR Polymerase Chain Reaction

RT Room Temperature

SSC Saline-Sodium Citrate

TNB Tris-NaCl Blocking

PBS Phosphate Buffered Saline

PBST Phosphate Buffered Saline-0.2% Triton x-10

! xiv!

DI Deionized

DAPI 4',6-DiAmidino-2-PhenylIndole

Q-PCR Quantitative Polymerase Chain Reaction

ANOVA Analysis of Variance

Ct Cycle threshold

GO Gene Ontology

DMEM Dulbecco's Modified Eagle Medium

L15 Leibovitz 15

MS Mass Spectrometry

HPLC High Performance Liquid Chromatography

FDR False Discovery Rate

! xv!

CHAPTER I

INTRODUCTION AND LITERATURE REVIEW

Lens regeneration in newts

Vertebrate eye is a complex organ that renders visual perception of surroundings to an organism. It mainly consists of cornea, iris, lens and retina each having a specific function. Lens is a transparent spherical structure composed of outer epithelial layer and inner concentric rings of lens fibers basically composed of crystallins. Among vertebrates, organisms shown to regenerate their lens are newts, frogs, fish and axolotl

(Henry & Tsonis, 2010; Maki et al., 2012). However, only newts possess this ability throughout their adulthood.

The history of lens regeneration in newt dates back to year 1891 when Colucci first observed that these species could develop a new eye upon its partial removal. (Colucci,

1891). Later Wolff showed that newts are capable of regenerating a new lens (Wolff,

1895). Here, the regenerated lens developed from the edge of iris tissue of eye. Iris lies in front of lens and adjusts the amount of light entering into eye. It is composed of pigmented epithelial cells that usually determine the eye color. In these earlier studies it is shown that after lens removal, the corneal tissue is healed followed by thickening of the edge of iris and gradual increase in cell number that eventually forms a clear ball of

! 1!

cells, the regenerated lens. This phenomenon of forming a new lens is property of only the upper edge (Dorsal) of iris. These observations of lens regeneration in newt led to further research considering the two aspects; 1) the new lens came from iris, the tissue that differs with lens in respect to its embryonic origin 2) Only the dorsal iris was capable of lens regeneration even though the same tissue is also present in ventral part of eye.

Mechanism of lens regeneration

I. Transdifferentiation of iris to lens

Transdifferentiation is the process by which newt iris pigmented epithelial (IPE) cells change its identity to form lens. After lens removal, IPE cells re-enter cell cycle as observed by cell proliferation at day 4. These cells eventually dedifferentiate and lose their pigments at day 8 followed by formation of a lens vesicle. The cells of lens vesicle elongate and differentiate to form primary lens fiber cells. This phenomenon is observed on days 12-16 after lens removal. Continued synthesis of crystallin leads to a fully differentiated lens by day 25 (Eguchi, 1963). These morphological changes demonstrate dedifferentiation, proliferation and differentiation as the three basic steps by which the

IPE cells transdifferentiate to lens.

Studying the molecular events of this process has shown thrombin activation as the initial response by iris to lens removal. This kind of tissue injury response in turn activates growth factors such as FGF2 that directs IPE cells to re-enter cell cycle

(Godwin, Liem, & Brockes, 2010). Microarray analysis of early days (3-5) of regenerating iris show upregulation of factors related to cell cycle, DNA repair,

! 2!

hemostasis and tissue remodeling (Sousounis et al., 2013). These events are observed in the ventral iris as well. However, some factors display higher or early upregulation in the dorsal iris compared to ventral. Other factors that have been identified as players of cell proliferation are sox2, klf4 and pax-6. Sox2 and klf4 are stem cell maintenance factors that are upregulated in the iris at day 2 of lentectomy and inhibition of pax-6 affects proliferation of cell in regenerating iris (Madhavan et al., 2006; Maki et al., 2009;

Sousounis et al., 2013). Regulation of these various factors at early days of lens regeneration suggests their role in cell cycle re-entry of IPE cells.

Dedifferentiation of iris is more evident at day 8 of lentectomy. Morphologically, the cells at this stage lack pigment which is evident by lack of tyrosinase, an enzyme involved in pigment synthesis. Epigenetic regulators, cancer and apoptosis related genes, members of BMP and TGF- β and microRNAs are found to be present in the dedifferentiated iris (Maki et al., 2010; Nakamura et al., 2010). Molecular events related to this expression profile often regulate gene expression and cell growth. Such events suggest its role in the dedifferentiation events during lens regeneration. This behavior of dedifferentiated cells correlates to property of stems cells, which also maintains an undifferentiated state. Comparisons between these two processes found expression of factor nucleostemin, to be common in both the processes (Maki et al., 2007). Similar comparison with germ cells shows expression of an oocyte specific histone B4 in the regenerating IPE cells (Maki et al., 2010).

In the last step of transdifferentiation, dedifferentiated IPE cells differentiates to form lens cells. For a cell to differentiate into a particular cell type it needs to express

! 3!

transcription factors specific for such cell type. Here, the dedifferentiated IPE cells express factors such as pax-6 and prox-1 that are required for crystallin synthesis, a marker for lens (Del Rio-Tsonis, Tomarev, & Tsonis, 1999; Madhavan et al., 2006). The regenerated lens exhibits anterior-posterior polarity as normal lens with an outer lens epithelial layer and inner lens fibers expressing crystallin.

II. Regeneration of lens from dorsal iris

The ventral iris despite comprising of similar tissue as in dorsal does not regenerate lens.

However, it does so under in vitro conditions (Eguchi, Abe, & Watanabe, 1974). The instances where the ventral iris can be induced to form lens are treating it with carcinogens or inhibiting BMP signaling. Though no mechanism has been described for the former, in the later case BMP is shown to specify dorsal-ventral axis and could possibly explain lens induction from ventral iris. Ventral IPE’s were also able to trans differentiate when treated with six-3 and retinoic acid (Grogg et al., 2005). Recent transcriptome analysis revealed quantitative differences between dorsal and ventral iris rather than qualitative difference to be the underlying reason for dorsal to regenerate lens.

These quantitative differences show genes involved in cell cycle, gene regulation, cytoskeleton and immune response to be significantly up regulated in dorsal regenerating iris compared to ventral non-regenerating iris. Also, the study identified genes in both dorsal and ventral iris displaying time dependent regulation in the regenerating iris. These highly regulated genes are TBX5, FGF10 and UNC5B in the dorsal iris and VAX2,

NR2F5 and NTN1 in the ventral iris. Functional analysis of such genes would provide

! 4!

more information into regenerative ability of organisms such as newt (Sousounis et al.,

2013).

Lens regeneration in other vertebrate model organisms

Frogs, some species of fish and axolotl are among the other organisms that possess the ability of lens regeneration. Both in Xenopus and axolotl the ability of lens regeneration is restricted to earlier stages of life such as pre-metamorphosis and stage 44-52 (post- hatch) respectively. Although, only Xenopus spp. is well studied in this matter. In

Xenopus not all the species undergo lens regeneration and those that permit regeneration does so through corneal epithelium. Here, many signaling pathways such as FGF, TGF- beta and notch were implicated to be playing role in the regeneration. Micro-array analysis during xenopus lens regeneration revealed expression of factors of immune response, chromatin remodeling, cell cycle regulators etc. (Henry & Tsonis, 2010). In axolotl, the regenerated lens originated from iris (Maki et al., 2012). However, in axolotl both dorsal and ventral participated in lens regeneration unlike newts. Thus, much correlation has been found with respect to the cellular processes governing the process of lens regeneration in different organisms.

Mechanism of regeneration in vertebrates

The cellular source of newly regenerated tissue could be either the resident stem cell population or tissues that undergo dedifferentiation at the site of injury. Both these

! 5!

processes differ with respect to how they proceed towards attaining the identity of cell types that constitute the regenerated tissue.

Stem cell / progenitors – as source of regenerative tissue

Regenerative medicine has always been inclined towards understanding the role of stem cells because of its immense potential in treating various human diseases. Vertebrate muscle regeneration is one of the classic examples demonstrating the involvement of adult stem cells as the source of newly regenerated muscle. Adult stem cells are found in many organs including brain, intestine, bone marrow, skin, blood, heart and liver. These cells are in quiescent state until activated on need of tissue maintenance and / or repair upon injury. In organs such as brain, skin and blood these cells are in a constitutive state of producing new cells for need of tissue maintenance irrespective of tissue damage.

Their role as regenerative players is more distinct in few of the organs as discussed here.

During muscle regeneration, the satellite cells (myogenic stem cells) located at the basal lamina of muscle fiber participates in repair of the damaged muscle by undergoing proliferation and differentiation (Poss, 2010). In order to harness the potential of using such stem cells for therapeutic application it is important to understand properties of these cells and how they progress from quiescent to differentiated state. Such studies are extensively being conducted with the satellite cells and much progress is achieved with identifying the satellite stem cell population and signaling pathways involved during their lineage progression. The only satellite cells that actually display stem cell characteristics are cells expressing Pax7+/Myf5- phenotype (Kang & Krauss, 2010). After injury, Notch

! 6!

signaling initiates proliferation of these cells followed by their differentiation to myoblast under wnt activation (Buckingham & Montarras, 2008). The signaling pathways implicated here in the regeneration events are also involved in various functions of embryonic stem cells (Noggle, 2006; Tanaka, 2011)

Vertebrate central nervous system (CNS) is another example that recruits adult stem cells for regaining neuronal loss. Cerebellum, spinal cord and retina are the three distinct parts of the CNS that has been shown to undergo regeneration upon injury. Regeneration of these tissues is quite different from neurogenesis or axon regeneration. The latter is widely distributed among vertebrates but true CNS regenerative potential is limited to species of teleost fish and amphibians. All the three CNS tissues mentioned differ in their source of newly regenerated cells. In cerebellum, the new cells are the result of adult stem cells harbored in the proliferative zones (neurogenesis) and other areas that is normally quiescent but is activated upon injury. The cells undergo proliferation and eventually differentiate to granular neurons that comprise the cerebellum (Zupanc, 2009).

Similar mechanism of regeneration has also been identified in newts (Berg et al., 2010).

However, activation of these stem cells upon injury is yet to be understood and would be the next step in this field to be explored.

Retina, another CNS area recruits tissue resident stem cells (circumferential germinal zone/ ciliary marginal zone) or transdifferentiation (retinal pigment epithelial cells/

Muller glia cells) as a means to regenerate the lost retinal cells. Stem cell based retina regeneration is observed in fish and amphibians (Locker, Borday, & Perron, 2009). In embryonic chickens the same phenomenon is observed when induced with growth or

! 7!

immune system factors (Haynes et al., 2013; Spence et al., 2004). In these organisms, cells located at the CMZ (Ciliary Marginal Zone) are shown to undergo proliferation upon injury. As during neurogenesis, the cells eventually replace all the lost cell types in the retina (Moshiri, Close, & Reh, 2004).

Dedifferentiation - as source of regenerative tissue

In most of the regenerating tissues, cells at the site of injury contribute to regain the lost tissues by reverting back to their progenitor state. This mechanism of regeneration is termed dedifferentiation and is observed during vertebrate heart and fin regeneration. In recent years, this field of regeneration gained a quite momentum with the development of genetic tools such as cre recombinase system in zebra fish.

Jopling C et al was the first to study heart regeneration using Cre/lox system in zebra fish

(Jopling et al., 2010). This study clearly demonstrates that in the resected heart adult cardiomyocytes dedifferentiate and proliferate to form the newly regenerated heart. The adult cardiomyocytes initiates a program where they lose their sarcomeric structure evident by down regulation of sarcomeric structural genes and re-enters the cell cycle.

GATA-4, a transcription factor involved in heart development is also upregulated in these proliferating cells (Kikuchi et al., 2010). Thus, the cells lose its characteristic feature and activate molecular programs that facilitate them to return to its progenitor state.

Body parts like limb and fin regenerates by forming blastema at the site of injury. This blastema consists of group of homogenous appearing cells that eventually pattern itself into the lost body part. Cell tracking studies in axolotl and zebrafish found blastema to be

! 8!

a pool of lineage restricted dedifferentiated cells rather than multipotent cells (Kragl et al., 2009; Stewart & Stankunas, 2012).

Regeneration and iPS reprogramming

Generation of induced pluripotent stem cells by reprogramming of adult cells.

Stem cells are characterized as cells capable of giving rise to any of the different cell types found in an organism. Such cell types can be either isolated from an embryo or generated in vitro by reprogramming of terminally differentiated cells. The in vitro generated pluripotent stem cells are termed iPS (induced Pluripotent Stem) cells.

Generation of iPS cells was achieved by exogenous expression of transcription factors found in embryonic stem (ES) cells (Takahashi & Yamanaka, 2006). These iPS cells can be further directed to a specific cell type of interest. Thus, much research is currently in progress to understand the underlying mechanisms of cell fate so that it can be utilized to make a particular cell type. In iPS cell reprogramming a cell is taken back to a ground state where it resembles ES cell and from there is again directed to a new cell state. This ground state can be avoided and a cell can be directly converted to a specific cell with lineage reprogramming. A classic example of lineage reprogramming is in vivo conversion of exocrine pancreatic cells into β cells (Zhou et al, 2008). In these studies, transcription factors have shown to be major players for determining cell fates and are thus exogenously expressed to successfully induce lineage reprogramming in cell types

(Graf & Enver, 2009). Such direct lineage reprogramming appears to be more effective and promising approach for therapeutic applications.

! 9!

Mechanistic insight into similarities between reprogramming and regeneration

Observing the above mechanisms of dedifferentiation and transdifferentiation during regeneration posed questions related to if there was any common mechanism between it and reprogramming events during iPS generation. It is observed that both the processes need to change the current existing cellular state to either a progenitor state or direct conversion into another cellular type. With regard to this, a study in newt lens regeneration found that many of reprogramming factors sox2, c-myc and klf4 were regulated during lens and limb regeneration (Maki et al., 2009). Similar study in zebrafish found all the four reprogramming factors oct-4, sox2, c-myc and klf4 to be expressed in the regenerating tissue of fin (Christen et al, 2010). A different factor Sall4 has been identified as having a role in dedifferentiation and maintaining blastema cell population in xenopus limb regeneration (Neff, King, & Mescher, 2011).

Hypothesis

Based on previous studies, the aim of the current study was to further investigate into mechanism of regeneration of lens in newt by comparing it with iPS reprogramming studies. As mentioned above, newt iris cells expressed reprogramming factors sox2, c- myc and klf4 while undergoing lens regeneration but oct-4 was absent in these cells.

Since oct-4 has been a crucial factor in reprogramming studies, in the present study we examine the role of oct-4 during newt lens regeneration.

As discussed earlier, newts regenerate lens only from the dorsal iris. With the development of high throughput techniques in biology, we also studied proteome of the

! 10!

two distinct populations of newt iris: Dorsal iris and Ventral iris under in vitro conditions to find any underlying differences in their proteome.

The objectives of this dissertation were:

1) To study role of reprogramming factor oct-4 in newt lens regeneration (chapter II).

2) To analyze proteome of dorsal iris epithelial cells (IPE) and ventral IPE cells under in vitro conditions as these cells harbor differences in regeneration potential (chapter III).

Significance

Previous studies have already shown that regeneration and iPS cell reprogramming does share similarities. Studying how oct-4 contributes to the regeneration potential of newt iris cells would further provide insight into the extent these two processes are similar.

Regenerative medicine is exploring the use of stem cells in treating various human diseases and the knowledge gained from regeneration studies would be advantageous for such field.

Studying proteome of newt regenerating vs. non-regenerating tissue would provide insight into mechanistic details of lens regeneration. Such studies are important to understand the biology of regeneration.

! 11!

References

Berg, D. A., Kirkham, M., Beljajeva, A., Knapp, D., Habermann, B., Ryge, J., Tanaka, E. M. & Simon, A. (2010). Efficient regeneration by activation of neurogenesis in homeostatically quiescent regions of the adult vertebrate brain. Development, 137(24), 4127-4134.

Buckingham, M., & Montarras, D. (2008). Skeletal muscle stem cells. Curr Opin Genet Dev, 18(4), 330-336.

Christen, B., Robles, V., Raya, M., Paramonov, I., & Izpisua Belmonte, J. C. (2010). Regeneration and reprogramming compared. BMC Biol, 8, 5.

Colucci, V.L. (1891). Sulla rigenereazione parziale dell'occhio nei Tritoni-Istogenesi e sviluppo: Studio sperimentale. Mem R Acad Sci Ist Bologna., Ser 51, 593–629.

Del Rio-Tsonis, K., Tomarev, S. I., & Tsonis, P. A. (1999). Regulation of Prox 1 during lens regeneration. Investigative Ophthalmology & Visual Science, 40(9), 2039-2045.

Eguchi, G. (1963). Electron microscopic studies on lens regeneration. I. Mechanisms of depigmentation of the iris. Embryologia, 8, 45-62.

Eguchi, G., Abe, S. I., & Watanabe, K. (1974). Differentiation of lens-like structures from newt iris epithelial-cells in vitro. Proceedings of the National Academy of Sciences of the United States of America, 71(12), 5052-5056.

Godwin, J. W., Liem, K. F., Jr., & Brockes, J. P. (2010). Tissue factor expression in newt iris coincides with thrombin activation and lens regeneration. Mech Dev, 127(7-8), 321- 328.

Graf, T., & Enver, T. (2009). Forcing cells to change lineages. Nature, 462(7273), 587- 594.

Grogg, M. W., Call, M. K., Okamoto, M., Vergara, M. N., Del Rio-Tsonis, K., & Tsonis, P. A. (2005). BMP inhibition-driven regulation of six-3 underlies induction of newt lens regeneration. Nature, 438(7069), 858-862.

Haynes, T., Luz-Madrigal, A., Reis, E. S., Echeverri Ruiz, N. P., Grajales-Esquivel, E., Tzekou, A., Tsonis, P. A., Lambris, J. D. & Del Rio-Tsonis, K. (2013). Complement anaphylatoxin C3a is a potent inducer of embryonic chick retina regeneration. Nat Commun, 4, 2312.

! 12!

Henry, Jonathan J., & Tsonis, Panagiotis A. (2010). Molecular and cellular aspects of amphibian lens regeneration. Progress in Retinal and Eye Research, 29(6), 543-555. Jopling, C., Sleep, E., Raya, M., Marti, M., Raya, A., & Izpisua Belmonte, J. C. (2010). Zebrafish heart regeneration occurs by cardiomyocyte dedifferentiation and proliferation. Nature, 464(7288), 606-609.

Kang, J. S., & Krauss, R. S. (2010). Muscle stem cells in developmental and regenerative myogenesis. Curr Opin Clin Nutr Metab Care, 13(3), 243-248.

Kikuchi, K., Holdway, J. E., Werdich, A. A., Anderson, R. M., Fang, Y., Egnaczyk, G. F., Evans, T. Macrae, C. A. Stainier, D. Y. Poss, K. D. (2010). Primary contribution to zebrafish heart regeneration by gata4(+) cardiomyocytes. Nature, 464(7288), 601-605.

Kragl, M., Knapp, D., Nacu, E., Khattak, S., Maden, M., Epperlein, H. H., & Tanaka, E. M. (2009). Cells keep a memory of their tissue origin during axolotl limb regeneration. Nature, 460(7251), 60-65.

Locker, M., Borday, C., & Perron, M. (2009). Stemness or not stemness? Current status and perspectives of adult retinal stem cells. Curr Stem Cell Res Ther, 4(2), 118-130.

Madhavan, Mayur, Haynes, Tracy L., Frisch, Nicholas C., Call, Mindy K., Minich, Craig M., Tsonis, Panagiotis A., & Del Rio-Tsonis, Katia. (2006). The role of Pax-6 in lens regeneration. Proceedings of the National Academy of Sciences of the United States of America, 103(40), 14848-14853.

Maki, N., Suetsugu-Maki, R., Sano, S., Nakamura, K., Nishimura, O., Tarui, H., Tarui, H., Del Rio-Tsonis, K., Ohsumi, K., Agata, K. & Tsonis, P. A. (2010). Oocyte-type linker histone B4 is required for transdifferentiation of somatic cells in vivo. FASEB J, 24(9), 3462-3467.

Maki, N., Takechi, K., Sano, S., Tarui, H., Sasai, Y., & Agata, K. (2007). Rapid accumulation of nucleostemin in nucleolus during newt regeneration. Dev Dyn, 236(4), 941-950.

Maki, Nobuyasu, Martinson, John, Nishimura, Osamu, Tarui, Hiroshi, Meller, Jaroslaw, Tsonis, Panagiotis A., & Agata, Kiyokazu. (2010). Expression profiles during dedifferentiation in newt lens regeneration revealed by expressed sequence tags. Molecular Vision, 16(9), 72-78.

Maki, Nobuyasu, Suetsugu-Maki, Rinako, Tarui, Hiroshi, Agata, Kiyokazu, Del Rio- Tsonis, Katia, & Tsonis, Panagiotis A. (2009). Expression of Stem Cell Pluripotency Factors During Regeneration in Newts. Developmental Dynamics, 238(6), 1613-1616.

Moshiri, A., Close, J., & Reh, T. A. (2004). Retinal stem cells and regeneration. Int J Dev Biol, 48(8-9), 1003-1014.

! 13!

Nakamura, Kenta, Maki, Nobuyasu, Trinh, Albert, Trask, Heidi W., Gui, Jiang, Tomlinson, Craig R., & Tsonis, Panagiotis A. (2010). miRNAs in Newt Lens Regeneration: Specific Control of Proliferation and Evidence for miRNA Networking. Plos One, 5(8).

Neff, Anton W., King, Michael W., & Mescher, Anthony L. (2011). Dedifferentiation and the Role of Sall4 in Reprogramming and Patterning During Amphibian Limb Regeneration. Developmental Dynamics, 240(5), 979-989.

Noggle, S. A., Weiler, D., & Condie, B. G. (2006). Notch signaling is inactive but inducible in human embryonic stem cells. Stem Cells, 24(7), 1646-1653.

Poss, K. D. (2010). Advances in understanding tissue regenerative capacity and mechanisms in animals. Nat Rev Genet, 11(10), 710-722.

Sousounis, K., Michel, C. S., Bruckskotten, M., Maki, N., Borchardt, T., Braun, T., Looso, M. & Tsonis, P. A. (2013). A microarray analysis of gene expression patterns during early phases of newt lens regeneration. Mol Vis, 19, 135-145.

Sousounis, Konstantinos, Looso, Mario, Maki, Nobuyasu, Ivester, Clifford J., Braun, Thomas, & Tsonis, Panagiotis A. (2013). Transcriptome Analysis of Newt Lens Regeneration Reveals Distinct Gradients in Gene Expression Patterns. Plos One, 8(4).

Spence, J. R., Madhavan, M., Ewing, J. D., Jones, D. K., Lehman, B. M., & Del Rio- Tsonis, K. (2004). The hedgehog pathway is a modulator of retina regeneration. Development, 131(18), 4607-4621.

Stewart, S., & Stankunas, K. (2012). Limited dedifferentiation provides replacement tissue during zebrafish fin regeneration. Dev Biol, 365(2), 339-349.

Suetsugu-Maki, R., Maki, N., Nakamura, K., Sumanas, S., Zhu, J., Del Rio-Tsonis, K., & Tsonis, P. A. (2012). Lens regeneration in axolotl: new evidence of developmental plasticity. Bmc Biology, 10.

Takahashi, K., & Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell, 126(4), 663-676.

Tanaka, S. S., Kojima, Y., Yamaguchi, Y. L., Nishinakamura, R., & Tam, P. P. (2011). Impact of WNT signaling on tissue lineage differentiation in the early mouse embryo. Dev Growth Differ, 53(7), 843-856.

Wolff, G. (1895). Entwicklungsphysiologische Studien. I. die Regeneration der Urodelenlinse. Wilhelm Roux Arch Entwickl-Mech Org., 1, 380–390.

! 14!

Zhou, Q., Brown, J., Kanarek, A., Rajagopal, J., & Melton, D. A. (2008). In vivo reprogramming of adult pancreatic exocrine cells to beta-cells. Nature, 455(7213), 627- 632.

Zupanc, G. K. (2009). Towards brain repair: Insights from teleost fish. Semin Cell Dev Biol, 20(6), 683-690.

! 15!

CHAPTER II

EXOGENOUS OCT-4 INHIBITS LENS TRANSDIFFERENTIATION IN NEWTS

BY REGULATING SOX-2, C-MYC AND PAX-6

Abstract

From the cocktail of four factors that were able to induce pluripotent stem cells from differentiated cells, Oct-4, c-Myc, Sox-2 and Klf4, only Oct-4 was not expressed during regeneration in newts. To explore the possible action of this stemness factor we introduced exogenous Oct-4 to an established in vitro system for lens regeneration. We found that exogenous Oct-4 inhibits differentiation of iris pigment epithelial cells into lens cells and that possibly this action is mediated via regulation of Sox-2, c-Myc and

Pax-6. Thus, the presence of Oct-4 renders the iris cells to an undifferentiated state.

! 16!

Introduction

The ability to regenerate lost body parts in certain organisms is either due to resident stem cells or dedifferentiation of tissues at the site of injury. In newt, the regenerated lens is derived from pigmented epithelial cells of dorsal iris by the process of transdifferentiation (Sanchez Alvarado & Tsonis, 2006). Thus, iris pigmented epithelial cells (IPE) change their lineage to form cells of the regenerated lens. Similar event of changing lineage occurs during in vitro reprogramming of terminally differentiated cells.

In mammalian reprogramming, differentiated cells are forced to change their lineage or revert back to undifferentiated state by exogenous expression of tissue specific transcription factors or stem cell maintenance factors (Zhou & Melton, 2008). Studies have found similarities between these two processes as observed in regeneration animal models such as newt, zebra fish and frogs (Christen et al, 2010; Maki et al., 2009; Neff,

King, & Mescher, 2011).

In newts, regulated expression of stem cell factors; Sox2, c-myc and Klf4 is observed during both lens and limb regeneration (Maki et al., 2009). The same set of genes is also expressed during zebra fish fin regeneration (Christen et al., 2010). In addition, oct-4 is expressed and required during zebra fish fin regeneration unlike regeneration in newts.

Oct-4 has been a crucial pluripotency factor in reprogramming of various cell types to pluripotent cells (Sterneckert, Hoing, & Scholer, 2012). Regenerating tissue exhibits restricted potential by changing its fate to only those cell types that are lost during injury.

The absence of oct-4 during regeneration of lens and limbs in newts poses the obvious question of what would be the role of exogenous oct-4 during regeneration?

! 17!

Understanding mechanisms that are involved in stem cell reprogramming and underlying principles of in vivo regeneration will provide insights into common events occurring during cell fate changes. Here, we describe our findings for the consequences of oct-4 expression in cells involved in newt lens regeneration to understand the restricted transdifferentiation potential of newt IPE cells.

Materials and methods

Animals

Newts (Notophthalmus viridescens) were purchased from Charles Sullivan Co.,

Tennessee. Animal care measures were followed as described in IACUC; Protocol ID:

011-02.

Newt IPE cell culture

For each culture, 7 newts were anesthetized in 0.1% ethyl 3-aminobenzoate-methane sulfonic acid prepared in PBS. Eyeballs were collected from the anesthetized newt and placed in calcium magnesium free (CMF) hanks solution. Removed eyes were sterilized in Lugol's-Ethanol for 3 seconds followed by washing in CMF hanks. Eyes were transferred to CMF hanks and dissected to collect dorsal and ventral IPE cells (Bhavsar,

Nakamura, & Tsonis, 2011). Dorsal and ventral IPE cells in L15 medium were separately plated on collagen I coated plates. Cells were incubated at 27°C for a week. Medium was changed every alternative day since day 8 of culture.

! 18!

Plasmid preparation

To design plasmid carrying oct-4 gene, mouse oct-4 cDNA was inserted into pSC2+ venus by removing venus. Venus is an enhanced yellow fluorescent protein. This plasmid synthesized oct-4 protein when transfected into cells. In order to visualize oct-4 protein in the transfected cells, oct-4 cDNA was fused to sequence of EGFP (enhanced green fluorescent protein) into Caggs plasmid. This plasmid synthesized a fused oct-4

EGFP protein in the transfected cells. Oct-4 protein was visualized by presence of EGFP in the cells.

Sequencing of gene inserts in plasmids/ PCR products

Nucleotide sequence of interest was sequenced by first amplifying the sequence using

PCR. The sequence was further purified using qiagen gel extraction protocol. The nucleotide fragment was prepared for sequencing reaction using big dye 3.1v terminator sequencing kit. The PCR cycles used were: 1) 96°C for 10 seconds 2) 95°C for 10 seconds; 55°C for 5 seconds; 60°C for 4 minutes (30x). The above DNA solution was mixed with 2.5 volumes of 95% ethanol and 1/10 volume of 3M sodium acetate.

Incubated for 10 minutes at room temperature (RT). Centrifuged at 10,000 g for 10 minutes. The supernatant was removed and 60 µl 70% ethanol was added. Centrifuged at

10,000 g for 5 minutes and dried for 10 minutes. Samples were analyzed using ABI

Capillary Electrophoresis Genetic Analyzer 3130.

! 19!

Transfection of plasmid in Newt cultured IPE cells

Various transfection methods were attempted to attain an efficiency of 70-80%. For all the methods cells were manually counted for transfection efficiency. These methods are mentioned below:

A) Transfection using lipofectamine reagent and plus reagent: i) Under sterile conditions, two 1.5 ml tubes consisting of following reaction were prepared: tube A [pSC2+ venus (1 µg)+ plus reagent 16 µl+ serum free L 15 medium 23

µl] and tube B [lipofectamine 16 µl + serum free L15 medium 180 µl]. Each tube was incubated for 15 minutes. Tubes A and B were mixed and incubated for 15 minutes. The medium of 1 week cultured newt IPE cells was replaced with 800 µl of serum free L15 and above content of tubes were added to the plate. Cells were incubated at 27°C for 3 hours. Afterwards, medium was changed to fresh L15 medium. The plates were placed in incubator for 4 days for expression of exogenous gene. ii) Under sterile conditions, two 1.5 ml tubes consisting following reaction were prepared: tube A [pSC2+ venus (4 µg)+ plus reagent 16 µl+ serum free L 15 medium 100

µl] and tube B [lipofectamine 16 µl + serum free L15 medium 100 µl]. Each tube was incubated for 15 minutes. Tubes A and B were mixed and incubated for 15 minutes. The medium of 1 week cultured newt IPE cells was replaced with 800 µl of serum free L15 and above content of tubes were added to the plate. Cells were incubated at 27°C for 3 hours. Afterwards, medium was changed to fresh L15 medium. The plates were placed in incubator for 4 days for expression of exogenous gene.

! 20!

B) Nucleofection

Newt dorsal and ventral IPE cells were subjected to nucleofection reaction for transfection using pSC2+ venus (1 µg/ µl). Nucleofection solution was prepared as: 1]

81.2 µl supplement + 27.3 µl milli-q water 2] 368 µl nucleofection solution + 123 µl milli-q water. Contents of 1 and 2 were mixed and kept at 4°C until use. Four tubes were prepared as shown in Table 1. The cells were placed in cuvette and selected nucleofector program was executed. After which, 500 µl of L15 medium was added to the cuvette and cells were plated on collagen coated plate. Cells were incubated at 27°C. After 7 days, cells were checked for transfection efficiency. This protocol was implemented for cells isolated from newts and trypsinized prior to transfection.

Table 1. Nucleofection reaction tubes

1 2 3 4 Experimental Control Control Control 100 µl Mixture 100 µl Mixture 100 µl Mixture A - A A Nucleofection Nucleofection - - program program 2 µl 2 µl pSC2+ - Nucleofection - venus program

Immunocytochemistry for IPE cells transfected with Caggs oct-4 EGFP and stained for oct-4 detection

Newt IPE cells cultured in vitro for 16 days were transfected with caggs oct-4 EGFP plasmid as mentioned in section Ai of transfection methodology. The cells were fixed with methanol: acetic acid (3:1) for 10 minutes. Washed with methanol 3 times for 3 minutes each. Plates were dried completely by inverting them. Washed with 2x SSC two

! 21!

times for 10 minutes. Incubated for 1 hour in 0.5% saponin/0.5% triton x-100 in 2x SSC.

Washed with 2X SSC three times for 10 minutes each. Washed with TN buffer for 10 minutes. Incubated in TNB (blocking buffer) for 15 minutes. Oct-4 protein was stained using rabbit oct-4 antibody (abcam, 1:200 dilution) at 4°C overnight. Secondary antibody was anti-rabbit Cy3. Images were taken using fluorescence microscope.

IPE cells’ aggregation

To the plates containing iris cells 75 µl/ml of dispase solution was added to the medium and swirled gently. Cells were incubated at 27°C for overnight. Next day, cells were gently pipetted and collected into an eppendorf tube. The tubes were centrifuged for 2 minutes at 1000 rpm at RT. Cells were washed with L15 medium and centrifuged again.

This step was repeated. Collected cells were distributed into different tubes to get two dorsal and two ventral aggregates from each culture. The tubes were centrifuged again and provided with 200 µl of L15 medium. For the cells to aggregate they were incubated at 27°C for 48 hours. Only tubes that showed aggregate formation were used for study.

Newt lentectomy

For lens removal, newts were first anesthetized in 0.1% ethyl 3-aminobenzoate-methane sulfonic acid prepared in PBS. A horizontal slit was made in the cornea of eye using a fine scalpel. Forceps were introduced into eye through the corneal slit and the lens was carefully removed without any bleeding.

! 22!

Implantation of IPE cell aggregates into lentectomized newts

After lens removal, aggregate was held in a pipette tip along with L15 medium and placed on the eye. Corneal slit was widened using forceps and aggregate was placed inside the eye slightly at ventral side of iris. The slit was closed and newt was placed in a newt container with wet paper. Lentectomized newt was kept under proper care until a month before the eyes were collected for examination.

Paraffin embedding of newt eyes for tissue sectioning

Eyes were removed from anaesthetized newts. A small cut was made on ventral part of eye to identify dorsal-ventral axis in the tissue. The eyes were fixed in 4% paraformaldehyde (PFA) at 4°C overnight. Next day washed in PBS at 4°C for 30 minutes. The tissue was further processed as follows: 0.85% saline at 4°C for 30 minutes; saline/ethanol (1:1) at RT for 15 minutes; 70% ethanol at RT 15 minutes twice; 85% ethanol at RT 30 minutes; 95% ethanol 30 minutes; 100% ethanol 30 minutes twice;

100% xylene for 30 minutes twice; xylene/paraffin (1:1) at 60°c for 45 minutes, 100% paraffin at 60°C for 1 hour thrice. The eyes were then embedded in embedding molds.

The eyes were sectioned at 15µm thickness using a microtome.

Immunohistochemistry of newt eye tissue sections/ newt IPE cell aggregates

The tissue was deparaffinized using xylene for 10 minutes twice. Followed by hydration using series of ethanol concentration: 100%, 95%, 90%, 80%, 70%, 50%, 30% and DI

(deionized) water for 1 minute each. Next, washed with PBS (phosphate buffered saline),

! 23!

PBST (phosphate buffered saline-0.2% triton x-100), and PBS for 15 minutes each. The tissue was blocked using 10% goat serum in PBST. Primary antibody for crystallin detection was mouse anti αA crystallin. Secondary antibody was goat anti-mouse Alex flour 488. Nuclei were stained using DAPI. After each antibody treatment, cells were washed with PBS, PBST and PBS series as mentioned above.

Oct-4 protein treatment in cultured newt IPE cells

Recombinant human oct-4 11-R protein was purchased from LD Biopharma (HTF-0006).

Total 4 cycles of oct-4 protein treatment (8ug/ml of L15 medium) were given to each well of cultured dorsal and ventral IPE cells: cycle 1-day 9, cycle 2-day 11, cycle 3-day

13 and cycle 4-day 15. Cells were treated with protein over night and changed to fresh medium on next morning. A lag period of 36 hours was kept between each cycle period.

Immunocytochemistry of IPE cells treated with oct-4 protein

Cultured newt IPE cells were treated with oct-4 protein (2 ug/ l ml) for 7 hours.

Following treatment, the medium was removed and cells were washed with PBS before fixation with 4% PFA. Next, washed with PBS (phosphate buffered saline), PBST

(phosphate buffered saline-0.2% triton x-100), and PBS for 15 minutes each. Cells were blocked with 10% goat serum and incubated with oct-4 antibody (stemgent) at 4°C overnight. Goat anti-Rabbit Alex flour 488 and DAPI were used to detect oct-4 and nuclei respectively. After each antibody treatment, cells were washed with PBS, PBST and PBS series as mentioned above.

! 24!

In vitro matrigel assay for newt IPE cell aggregates

To prepare cell aggregates, on day 17 cells were treated with dispase as mentioned earlier. Next day, cells were dislodged by pipetting and collected in a micro centrifuge tube. The cells were washed with L15 twice. In the final step, 200ul of L15 media was added to the cell pellet and centrifuged for 2 minutes at 1000 rpm. The tubes were incubated at 27°C for 48 hours for cell aggregation. From each well, 2 aggregates were prepared. For in vitro matrigel assay, 100 µl of matrigel was placed in a form of drop on tissue culture treated plates. The plates were incubated at 37°C for 30 minutes to solidify the matrigel. The aggregate was held in a pipette tip along with some L15 medium and placed inside the upper edge of matrigel. Each matrigel-aggregate arrangement was provided with 2 ml of L15 medium. The plates were incubated at 27°C and medium was changed every 2 days. The aggregates were checked for transdifferentiation every day starting day 2 until 2 weeks.

Paraffin embedding and sectioning of IPE cell aggregates from matrigel assay

The aggregates were processed for embedding as mentioned earlier. 10 µm sections were prepared using a microtome.

Quantitative PCR (Q-PCR) for gene expression analysis

RNA was isolated from both dorsal and ventral oct-4 protein treated cells using Trizol

(ambion) and concentrated using RNA concentrator kit from zymo research as per directions in the respective manuals. For control samples, untreated cells were used for

! 25!

RNA isolation. cDNA was synthesized using first strand synthesis kit from GE health care as per directions. Q-PCR was performed with iQSYBR green supermix (biorad). The primers used were: oct4-F: TGCAATCGTCGACAGAAGGG; oct4-R:

AGCATGGTTGGCAAGGCATA; sox2-F: GCGCAGGGATACATGAACGG; sox2-R:

AGTGCGAAGATGACGAGGTG; c-myc-F: CAACCGGAAGTGCACAAGTC; c-myc-

R: GCCACCTCTGGTATCTGGTC; klf4-F: CGGACGGCTACCCATAACTG; klf4-R:

AGTGATAGGGCTTCTCGCCT; pax6-F: GAATGTACGACAAGCTGCGG; pax6-R:

GGAGTTGGTGTTCTCGCCTC; RPL27-F: ATTTATGAAACCCGGGAAGG; RPL27-

R: CCAGGGCATGACTGTAAGGT. The samples were run in triplicates and Ct values were calculated using standard curve of respective gene. Specificity of Q-PCR reaction was checked by melt curve analysis.

Statistical analysis for q-PCR results

Oct-4 and klf4 expression were analyzed using independent t test. Levene’s test was used for determining variance of the groups tested. For a levene value less than 0.05, samples were assumed to be of in equal variance and respective P value was considered for rejecting the null hypothesis. Sox2, c-myc and pax-6 expression were analyzed using univariate ANOVA test. P value of less than 0.05 supported that the groups compared were significantly different.

! 26!

Results

Transfection of pSC2+ oct-4 in cultured newt IPE cells

Cultured IPE cells were transfected as described in section A-i. 15% of cells were positive for transgene expression (Figure 1).

Transfection efficiency in newt IPE cells by different methods

Nucleofection, a cell electroporation technique was used to transfect newt IPE cells.

Nucleofector is designed to execute programs that has different electric pulse settings for electroporating cells. For newt cells, optimization kit and basic cell epithelial kits were used for transfection. The highest efficiency obtained was 25% (Table 2). When primary

IPE cells were used for the best selected programs from the above kits 20% of cells were positive for transgene expression. However, nucleofected cells showed poor attachment to collagen which affected its as compared to the untransfected cells (figure 2 ). pSC2+ plasmid possess a strong enhancer/promoter (simian CMV IE94). Using a different promoter (CMV) however did not increase transfection efficiency.

When newt IPE cells were cultured for 15 days and transfected with pSC2+ using method described in section A ii, an efficiency of 33% was obtained (figure 3).

Transfection of Caggs EGFP and Caggs oct-4 EGFP plasmid in cultured newt IPE cells

Caggs EGFP plasmid carries gene for EGFP which when transfected into newt IPE cells showed expression of enhanced green fluorescent protein (figure 4A). Caggs oct-4 EGFP

! 27!

plasmid carries gene for oct-4-EGFP which is a fusion protein of oct-4 and EGFP. Here, oct-4 is visualized by expression of EGFP that is tagged to the protein. Cells transfected with caggs oct-4-EGFP showed nuclear localisation of transcription factor oct-4 (figure

4B). The cells were also immunostained with oct-4 antibody as shown in figure 5. The cells showed colocalisation of oct-4-EGFP with oct-4 antibody.

Implantation of Caggs transfected aggregates into lentectomized newts

Aggregates of IPE cells transfected with EGFP/oct-4 –EGFP were analysed for GFP expression after implanation into lentectomized newts. The newt implanted with dorsal oct-4 –EGFP aggregate showed two lens. A lens regenerated from the host newt and another from the implanted aggregate (Figure 6A). GFP expression was not observed in the implanted aggregate. Implantation of ventral GFP aggregate into lentectomized newt showed only one lens that regenerated from the host newt. The transplant from ventral

IPE aggregate did not show GFP expression (Figure 6B).

In vitro matrigel assay for Caggs EGFP transfected newt IPE aggregates

Newt IPE cells were transfected with caggs EGFP plasmid. The expression of EGFP is shown in figure 7A. Aggregates of these cells were placed on matrigel for 2 weeks to observe transdifferentiation. For both dorsal and ventral aggregate, expression of EGFP was observed only in few cells as visible in the aggregate (Figure 7B and C) and was stable for a period of 10 days.

! 28! Newt cultured IPE cells treated with human oct-4 protein

Oct-4 protein treated IPE cells showed colocalisation of nuclei and flourescent signal from oct-4 antibody as shown in figure 8.

In vitro matrigel assay for IPE cells treated with human oct-4 protein

Transdifferentiation potential of IPE cells treated with oct-4 protein was analysed by placing these aggregates on matrigel. The aggregates were daily observed for transdifferentiation. For dorsal treated cells, only 10% of aggregates displayed transdifferentiation by presence of a transparent lentoid. As compared to this, control aggregates showed higher transdifferentiation potential of 81% (Table 3).

Immunohistochemistry of transparent lentoid showed expression of crystallin (figure 9 a- c). Whereas, crystallin expression was not observed for aggregates that failed to transdifferentiate (figure 9 d-i).

Gene expression analysis for IPE cells treated with human oct-4 protein

Figure 10 shows expression levels of oct-4 in control and oct-4 protein treated IPE cells. oct-4 expression was not detected in the control cells. The treated cells showed oct-4 expression without any significant difference between dorsal and ventral cells. Statistical analysis was performed using independent t test.

Univariate ANOVA analysis showed significant difference for c-myc, sox2 and pax-6 expression in oct-4 treated cells (figure 11). This difference was significant for both dorsal and ventral cells for sox2 and pax-6 whereas only dorsal group was significantly

! 29! different for c-myc expresssion (t-test results). Also, independent t test showed significant difference in dorsal vs ventral control for sox2 and pax-6 expression levels.

Figure 12 shows expression levels of klf4 in control and oct-4 protein treated IPE cells. klf4 was camparatively low to other genes with high inconsistency in expression despite several repititions. However, no significant difference was observed between control and oct-4 treated cells. Statistical analysis was performed using independent t test.

Discussion

To study role of exogenous oct-4 in newt regenerating IPE cells, oct-4 gene was transfected into IPE cells. However, only 15% of transfected cells were positive for oct-4 gene. Various methods including nucleofection utilised for increasing efficiency of transfection in IPE cells. The highest efficiency was achieved with 2 week cultured IPE cells using lipofectamine (Grogg et al., 2005).

Using the above method, oct-4-EGFP fusion gene (Caggs oct-4 EGFP plasmid) was transfected into IPE cells. The advantage of using this fusion protein made oct-4 positive cells easily traceable. These oct-4 expressing cells were examined for its role in newt regeneration using an established in vitro system. In this in vitro system, aggregates of cultured dorsal IPE cells form lens when implanted to lentectomized newts. The aggregates of cultured ventral IPE cells do not possess this ability. Thus, recapitulating the in vivo events. In this system, implanted newts have to be kept for 25 days in order to

! 30!

visualize the new lens formation from the aggregate (Bhavsar et al., 2011). Implantation of dorsal and ventral IPE cell aggregates carrying caggs EGFP plasmid did not show

EGFP expression in the regenerated lens and ventral implant respectively. This result made it difficult to trace the fate of transfected cells. Thus, a recently developed in vitro matrigel assay was employed to study role of exogenous oct-4 (Hoffmann, Nakamura, &

Tsonis, 2013). In here, IPE aggregates were placed inside a drop of growth factor reduced matrigel to observe their transdifferentiation to lens cells. The advantage of this approach is that the live aggregates are tracked on daily basis to check their transdifferentiation and takes shorter time span of 2 weeks for lentoid formation.

A control plasmid caggs EGFP was used to analyse the feasibility of using in vitro matrigel assay for gene studies. The results showed; i) very few cells positive for transfected gene making it difficult to study their contribution to transdifferentiation ii)

EGFP expression diminished as the days of matrigel treatment increased. Thus with these results we planned on using oct-4 protein in place of oct-4 gene to overcome the above mentioned limitation in the study.

To exogenously express oct-4 in the cultured newt IPE cells, cells were treated with a recombinant human oct-4 protein as described in previous studies. Within 7 hours of treatment oct-4 protein was translocated into the nucleus. As the protein is transferred through cytoplasm its presence is also evident in cytoplasm.

! 31! The oct-4 treated cells when aggregated and placed on matrigel displayed reduced potential of transdifferentiation. Thus, oct-4 presence inhibited transdifferentiation of these aggregates. Only 10% of aggregates were able to form lentoid as compared to 81% by control aggregates.

Further, we examined expression of other stem cell pluripotency factors. In dorsal control

IPE cells, oct-4 and Klf4 are not expressed whereas Sox2 and c-myc are expressed. This is relatively consistent with the in vivo expression data (Maki et al., 2009). In the dorsal oct-4 treated cells, oct-4 expression was observed along with genes Sox2 and c-myc.

However, Sox2 was significantly downregulated as compared to the control cells. Sox2 has been identified as an important factor in pluripotency maintenance. During reprogramming or ES cell maintenance, oct-4 and Sox2 co-occupy many developmentally regulated genes to suppress differentiation (Rizzino, 2013). Contrary to this, our study showed that oct-4 has a negative effect on Sox2 expression. This could be possible because of cell type specific role of Sox2 during lineage establishment. Sox2 maintains tissue homeostasis in various organs where it marks adult stem cell population

(Driessens & Blanpain, 2011). In eye, Sox2 has been an interacting partner with pax-6 for crystallin synthesis (Kondoh, Uchikawa, & Kamachi, 2004). Pax-6 is an eye specific transcription factor whose expression is required for lens regeneration (Madhavan et al.,

2006). During transdifferentiation, Sox2 partners with pax-6 for lens regeneration. But in presence of oct-4, Sox2 becomes inaccessible to pax-6 (Lodato et al., 2013). This is

! 32! further supported by significant downregulation of pax-6 expression in oct-4 treated newt

IPE cells. Thus, oct-4, Sox2 and pax-6 form a transcription regulatory network in newt

IPE cells to determine its transdifferentiation fate. Oct-4 was also shown to affect c-myc expression in dorsal IPE cells (figure 3D). c-myc being a growth regulator (Dang, 1999) and its down regulation in dorsal IPE cells further supports the inhibitory effect of oct-4 on transdifferentiation.

In summary, we found that oct-4 affects the transdifferentiation process of newt IPE cells during lens regeneration by employing its interacting partner Sox2 and interfering with the role of transcription factor Pax-6 which is crucial for lens formation.

! 33! References

Bhavsar, R. B., Nakamura, K., & Tsonis, P. A. (2011). A system for culturing iris pigment epithelial cells to study lens regeneration in newt. J Vis Exp(52).

Christen, Bea, Robles, Vanesa, Raya, Marina, Paramonov, Ida, & Izpisua Belmonte, Juan Carlos. (2010). Regeneration and reprogramming compared. Bmc Biology, 8.

Dang, C. V. (1999). c-Myc target genes involved in cell growth, apoptosis, and metabolism. Mol Cell Biol, 19(1), 1-11.

Driessens, G., & Blanpain, C. (2011). Long live sox2: sox2 lasts a lifetime. Cell Stem Cell, 9(4), 283-284.

Grogg, M. W., Call, M. K., Okamoto, M., Vergara, M. N., Del Rio-Tsonis, K., & Tsonis, P. A. (2005). BMP inhibition-driven regulation of six-3 underlies induction of newt lens regeneration. Nature, 438(7069), 858-862.

Hoffmann, A., Nakamura, K., & Tsonis, P. A. (2013). Intrinsic Lens Forming Potential of Mouse Lens Epithelial versus Newt Iris Pigment Epithelial Cells in Three-Dimensional Culture. Tissue Eng Part C Methods.

Kondoh, H., Uchikawa, M., & Kamachi, Y. (2004). Interplay of Pax6 and SOX2 in lens development as a paradigm of genetic switch mechanisms for cell differentiation. Int J Dev Biol, 48(8-9), 819-827.

Lodato, M. A., Ng, C. W., Wamstad, J. A., Cheng, A. W., Thai, K. K., Fraenkel, E., Jaenisch, R. & Boyer, L. A. (2013). SOX2 co-occupies distal enhancer elements with distinct POU factors in ESCs and NPCs to specify cell state. PLoS Genet, 9(2), e1003288.

Madhavan, Mayur, Haynes, Tracy L., Frisch, Nicholas C., Call, Mindy K., Minich, Craig M., Tsonis, Panagiotis A., & Del Rio-Tsonis, Katia. (2006). The role of Pax-6 in lens regeneration. Proceedings of the National Academy of Sciences of the United States of America, 103(40), 14848-14853.

Maki, Nobuyasu, Suetsugu-Maki, Rinako, Tarui, Hiroshi, Agata, Kiyokazu, Del Rio- Tsonis, Katia, & Tsonis, Panagiotis A. (2009). Expression of Stem Cell Pluripotency Factors During Regeneration in Newts. Developmental Dynamics, 238(6), 1613-1616.

! 34! Neff, Anton W., King, Michael W., & Mescher, Anthony L. (2011). Dedifferentiation and the Role of Sall4 in Reprogramming and Patterning During Amphibian Limb Regeneration. Developmental Dynamics, 240(5), 979-989. Rizzino, A. (2013). Concise review: The Sox2-Oct4 connection: critical players in a much larger interdependent network integrated at multiple levels. Stem Cells, 31(6), 1033-1039.

Sanchez Alvarado, A., & Tsonis, P. A. (2006). Bridging the regeneration gap: genetic insights from diverse animal models. Nat Rev Genet, 7(11), 873-884.

Sterneckert, J., Hoing, S., & Scholer, H. R. (2012). Concise review: Oct4 and more: the reprogramming expressway. Stem Cells, 30(1), 15-21.

Zhou, Qiao, & Melton, Douglas A. (2008). Extreme Makeover: Converting One Cell into Another. Cell Stem Cell, 3(4), 382-388.

! 35!

Figure 1. Oct-4 transfection in newt 1 week cultured IPE cells. A) Cells transfected with oct-4 gene and stained with oct-4 antibody (green). Colocalisation of oct-4 and dapi is observed in few transfected cells (white circle). Nuclei are stained by dapi (blue). B) Control cells stained for oct-4 showed no signal.

A. Oct-4 transfected

BF/ !

!

B. Untransfected (control)

BF/

! 36!

Table 2. Newt IPE cell transfection using nucleofector. A) Programs from optimization kit showing transfection efficiency and cell viability. B) Programs from basic cell epithelial kit showing transfection efficiency and cell viability. C) Programs with good efficiency from table A and B were repeated to check transfection efficiency. Cell viability was examined by trypan blue staining.

A. Cell line optimization kit result

Solution L Cell Solution V Cell Nucleofection (Transfection viability (Transfection viability program efficiency %) % efficiency %) % A-020 5.6 83.3 11.2 93 T-020 4.3 82.7 14.7 61.8 T-030 24.4 97.5 5.4 95.9 X-001 6 96 6.8 97.7 X-005 17.8 92.8 8.6 91.3 L-029 10.6 100 10.9 92.2 D-023 25 92.5 13.5 97.3 Without 0 86.3 0 95.8 program T-020 0 87 0 93.2 without DNA

B. Basic epithelial cell kit result

Nucleofection Transfection Cell viability (%) program efficiency (%) S-005 0 92 T-013 0 100 T-020 0 95.5 T-023 2.3 95.2 U-017 19.5 93.4 Without program 0 87.2

C. Programs with high efficiency from Table A and B

Nucleofection Transfection program efficiency (%) U-017 20% T-030 12.3% D-023 17%

! 37!

Figure 2. Cell condition after nucleofection. A and B) the nucleofected cells after 1 week in culture shows less attachment as compared to cells not treated for nucleofection (C). Cells positive for transfected gene ‘venus’ is shown in green.

A B C

Figure 3. pCS2+ venus transfection in 2 week cultured IPE cells. A) Transfected cells showing venus expression. B) Control.

A. Venus transfected

BF Venus BF/ Venus

B. Untransfected (Control)

BF Venus BF/ Venus

! 38!

Figure 4. Cultured IPE cells transfected with Caggs plasmid. A) Caggs EGFP transfected cells showing EGFP protein (green). B) Caggs oct-4 EGFP transfected cells showing oct- 4-EGFP protein in nucleus (green)

A. B. BF/EGFP BF/oct-4- EGFP

Figure 5. Immunocytochemistry of IPE cells expressing oct-4-EGFP. A) IPE cells transfected with Caggs oct-4-EGFP shows oct-4 expression (green, arrow). These oct-4- EGFP expressing cells are positive for oct-4 protein when stained with oct-4 antibody (red, arrow). B) Cells not transfected with Caggs oct-4 EGFP plasmid were used as control. Some background for secondary antibody is observed in these cells (red, arrow).

A. Cells transfected with Caggs oct-4-EGFP

BF oct-4 !oct-4

B. Control cells (untransfected)

BF

! 39!

Figure 6. Implantation of Caggs transfected aggregates in lentectomized newts. A) Dorsal IPE oct-4 aggregate transdifferentiated to lens (arrow) showing crystallin expression. Lens regenerated from host newt (inset). B) Ventral GFP aggregate (arrow). Only the host lens here show crystalline expression. No GFP expression was observed in the implanted aggregates.

A. Dorsal Caggs oct-4 EGFP transfected

BF Crystallin

B. Ventral Caggs EGFP transfected

BF Crystallin

! 40!

Figure 7. In vitro matrigel assay for Caggs EGFP transfected aggregate. A) Transfected newt IPE cells showing EGFP expression. B) Aggregate of Dorsal transfected cells. EGFP expression (green) in the aggregate is observed until day 10 on matrigel. C) Aggregate of Ventral transfected cells. EGFP expression (green) in the aggregate is observed until day 10 on matrigel.

A BF/EGFP

Day 4 Day 10 Day 18

BF/EGFP BF/EGFP BF/EGFP B. Dorsalaggregate B.

Day 4 Day 10 Day 18 BF/EGFP BF/EGFP BF/EGFP

C. Ventral aggregate Ventral C.

! 41!

Figure 8. Newt IPE cells treated with oct-4 protein. A) Oct-4 protein after 7 hours of treatment. Few cells show oct-4 protein transfer to nucleus (circles). B) Control for primary antibody.

Oct-4/Dapi Oct-4/Dapi !

! !

!

Table 3. In vitro matrigel assay results for IPE cell aggregates. The aggregates were placed on matrigel and observed for transdifferentiation for a period of 14 days.

Aggregate showing transdifferentiation on IPE cell Aggregate Treatment matrigel Percent Dorsal oct 4 protein 1 in 10 10% Ventral oct 4 protein 0 in 14 0% Dorsal Control 22 in 27 81% Ventral Control 0 in 22 0%

! 42!

Figure 9. Immunohistochemistry for crystallin expression in aggregates placed on matrigel. Control dorsal aggregate showing transdifferentiated structure (arrow)(a) and crystalline expression(c). Dorsal oct-4 treated aggregate with no crystallin expression (d, f). Ventral oct-4 treated aggregate with no crystallin expression (g, i). Control aggregate image was captured using confocal microscope. Oct-4 treated aggregates were sectioned into 10 um sections for staining.

aggregate Control Dorsal a BF b Dapi c Crystallin

aggregate oct Dorsal d e f

- 4 aggregate Ventraloct g h i

- 4

! 43!

Figure 10. Oct-4 mRNA expression in human oct-4 protein treated vs. untreated newt IPE cells. Oct-4 expression was observed only in the treated cells. P value was obtained by performing independent t test for dorsal vs. ventral oct-4 treated groups. No significant different was observed between these groups.

4 Control P!>!0.05 Oct-4 3.5 Treated 3 2.5 2 1.5 1

Relative expression level level expression Relative 0.5 0 Dorsal Ventral

Figure 11. mRNA expression levels in human oct-4 protein treated vs. untreated newt IPE cells. a) Sox2 expression levels b) Pax6 expression levels and c) Cmyc expression levels. P values were obtained by univariate ANOVA analysis of dorsal/ventral groups as both control and oct-4 treated.

a b Sox-2 Pax-6 4 P < 0.05 5

3 4 P < 0.05 3 2 2 1 1

Relative expression level level expression Relative 0 Relative expression level level expression Relative 0 DORSAL VENTRAL DORSAL VENTRAL

c c-Myc 4 P < 0.05 3 Dorsal

2

1

Relative expression level level expression Relative 0 DORSAL VENTRAL

! 44!

Figure 12. Klf4 mRNA expression in human oct-4 protein treated vs. untreated newt IPE cells. Klf4 showed high variation for its expression levels. P value was obtained by performing both anova and independent t test for ventral control vs. oct-4 treated groups. No significant different was observed between these groups.

klf4 0.0005 P > 0.05 CONTROL 0.0004 TREATED 0.0003

0.0002

0.0001

0 mRNA expression level level expression mRNA DORSAL VENTRAL -0.0001

-0.0002

! 45!

CHAPTER III

PROTEOME ANALYSIS OF IN VITRO CULTURED DORSAL IRIS

EPITHELIAL CELLS (IPE) AND VENTRAL IPE CELLS

Abstract

Newt regenerates its lost lens by the process of transdifferentiation of dorsal iris. The same tissue is also present at the ventral part of the eye. However, only the dorsal iris is competent to regenerate the lens. This phenomenon of regeneration by these two populations of cells is also maintained under in vitro condition. We analyzed the cultured dorsal and ventral IPE cells at the proteome level to understand their underlying differences. The results did not reveal any significant trend at GO (gene ontology) level in the dorsal cells that would possibly explain its regeneration competence. However, the in vitro cells exhibits characteristics that correlates to the in vivo regenerating stage.

! 46!

Introduction

Lens regeneration in newts is achieved by transdifferentiation of dorsal IPE cells to lens cells. The ability of dorsal iris to regenerate lens and lack of such ability by ventral iris required the study of these cell populations in order to understand the process of regeneration. Gene expression and protein microarrays for regenerating dorsal and ventral iris did not reveal any distinct differences in the expression pattern of these cells

(Makarev et al., 2007; Roddy et al., 2008). Moreover, due to unavailability of newt genome these previous studies had to use reference libraries from newt blastema or species other than newt. Such studies though provide needed information has certain limitations. Recently, large repertoires of information have been made available for newts with a de novo assembly of its transcriptome from various developmental and regeneration related stages (Looso et al., 2013). This gives the opportunity to study gene expression patterns using newts’ own reference library.

Newt has both in vivo and in vitro system to exhibit its lens regeneration potential from dorsal IPE cells. The dorsal and ventral cells maintain their respective regeneration related role even under in vitro conditions. Moreover, the in vitro system provides advantages for performing gene manipulation studies to further understand the mechanism of lens regeneration (Bhavsar, Nakamura, & Tsonis, 2011). Here, we present our results for proteome analysis of in vitro cultured dorsal and ventral IPE cells with a goal to explore any underlying differences in these cell populations.

! 47!

Materials and methods

Animals

Newts (Notophthalmus viridescens) were purchased from Charles Sullivan Co.,

Tennessee. Animal care measures were followed as described in IACUC; Protocol ID:

011-02.

Newt IPE cell culture

For each culture, 7 newts were anesthetized in 0.1% ethyl 3-aminobenzoate-methane sulfonic acid prepared in PBS. Eyeballs were collected from the anesthetized newt and placed in calcium magnesium free (CMF) Hanks solution. Removed eyes were sterilized in Lugol's-Ethanol for 3 seconds followed by washing in CMF hanks. Eyes were transferred to CMF hanks and dissected to collect dorsal and ventral IPE cells (Bhavsar et al., 2011). Dorsal and ventral IPE cells in DMEM medium were separately plated on collagen I coated plates. Cells were incubated at 27°C with 2% CO2. Medium was changed every alternative day till day 21. On day 21, 75 µl of dispase was added to the cells and cells were collected next morning. The cell pellet was washed thrice with CMF hanks and frozen with liquid nitrogen.

Protein Isolation and Mass Spectrometry (MS)

The cultured cells were analyzed for label free quantification using MS. Isolated proteins from dorsal and ventral cells were ran on a gel to separate the protein mixture. The

! 48!

proteins were in-gel digested using trypsin. For each band on the gel, MS spectra were generated using HPLC (high performance liquid chromatography). Selected peptides from each of these MS spectra were further fragmented to obtain MS/MS spectra.

MS/MS spectra were compared to the theoretical MS/MS spectra generated from newt transcriptome using bioinformatics tools. Proteins were identified based on the presence of its transcript in newt transcriptome.

Fisher’s exact test for dorsal and ventral proteome

The peptides were quantified based on their intensity obtained during MS analysis.

Proteins with more than 2 fold expression compared to ventral were grouped as dorsal proteome and vice-versa for ventral. Any differences in GO (gene ontology) terms between these two groups were analyzed using the fisher’s exact test in the Blast2go program.

Proteome validation at transcript level using q-PCR

RNA was isolated from in vitro cultured IPE cells (21 days) using Trizol (ambion) and concentrated using RNA concentrator kit from zymo research as per directions in the respective manuals. For control samples, untreated cells were used for RNA isolation. cDNA was synthesized using first strand synthesis kit from GE health care as per directions. Q-PCR was performed with iQSYBR green supermix (biorad). The primers used are listed in Table. The samples were run in triplicates and Ct values were calculated

! 49! using standard curve of respective gene. Specificity of Q-PCR reaction was checked by melt curve analysis.

Statistical analysis for q-PCR results

Gene expression was analyzed using independent t test. Levene’s test was used for determining variance of the groups tested. For a levene value less than 0.05, samples were assumed to be of in-equal variance and respective P value was considered for rejecting the null hypothesis. P value of less than 0.05 supported that the groups compared were significantly different.

Results

The in vitro proteome consisted of total 2269 identified proteins each having a uniprot

ID. Proteins with more than 2 fold expression either in dorsal or ventral IPE cells is listed in the appendix. It is also observed that many proteins were identified either in dorsal or ventral only. Fisher’s exact test for dorsal and ventral proteome showed enrichment of

GO terms in the ventral proteome (Table 4A). These enriched GO terms are mainly related to cytoskeleton category of cell function (figure 13). Genes for these enriched terms are listed in table 4B. The dorsal proteome did not show any enriched GO terms.

For proteins that displayed enriched GO terms, its expression was analyzed at mRNA level by QPCR technique. QPCR results for genes Desmin, Tropomyosin 1 and Lim binding domain 3 are shown in figure 14. Among these genes, only desmin was significantly higher in the ventral cells at both mRNA and protein level (figure 14 A).

! 50! The in vitro proteome was further compared to the proteome of 0, 4 and 8 day in vivo regenerating iris. Proteins with similar expression pattern with respect to dorsal-ventral axis under both in vitro and in vivo conditions are shown in table 5. Few of these proteins belong to cell cycle, DNA replication and splicing functions of the cell. Genes Retinal dehydrogenase 1 (ALDH1A), Structural maintenance of chromosomes protein 2 (SMC2) and DNA replication licensing factor MCM4 also showed significant difference between dorsal and ventral cells when analyzed using QPCR (figure 15).

Discussion

Comparing the dorsal proteome to ventral proteome did not reveal any significant trend in the proteins that had higher quantification in the dorsal IPE cells. However, on analysis of GO terms for these two datasets (dorsal and ventral) the ventral showed enrichment for various gene ontology terms. These proteins with enriched GO terms are involved with the cytoskeleton component of the cell (figure 1A). Similar upregulation of cytoskeletal related genes was observed for in vivo regenerating iris (K. Sousounis et al., 2013).

Although in vivo both dorsal and ventral iris showed such regulation. These cytoskeletal related changes are important for cell cycle reentry of dorsal iris undergoing regeneration and is also exhibited by the ventral iris. The results of in vitro proteome thus contradicted the earlier findings (K. Sousounis et al., 2013). So we further validated the proteome at mRNA level. Q-PCR validation for such proteins however showed no difference in their expression between dorsal and ventral cells thus supporting the

! 51! findings of previous studies (figure 2). The only protein that showed consistent pattern for its expression both at transcript and protein level was Desmin (figure 2). Desmin also displayed higher regulation in the in vivo ventral iris (data not shown). Thus, in vitro proteome could not detect any specific dorsal or ventral candidates at both protein and transcript level.

Comparison with the in vivo proteome data found proteins with similar pattern of expression. Few of these proteins involved in retinoic acid synthesis and DNA replication were also validated at mRNA level (figure 15). Such cellular processes have been involved in the regeneration of lens from dorsal iris (Konstantinos Sousounis et al., 2013;

Tsonis, Trombley, Rowland, Chandraratna, & del Rio-Tsonis, 2000). Moreover, these proteins are also upregulated in the dorsal iris during early stages of regeneration (data not published). Its presence in the in vitro proteome signifies that the cells in the in vitro stage resemble the behavior of the in vivo regenerating iris to a certain extent.

!

! 52!

References

Bhavsar, R. B., Nakamura, K., & Tsonis, P. A. (2011). A system for culturing iris pigment epithelial cells to study lens regeneration in newt. J Vis Exp(52).

Looso, M., Preussner, J., Sousounis, K., Bruckskotten, M., Michel, C. S., Lignelli, E., Reinhardt, R., Hoffner, S., Kruger, M., Tsonis, P. A., Borchardt, T., Braun, T. (2013). A de novo assembly of the newt transcriptome combined with proteomic validation identifies new protein families expressed during tissue regeneration. Genome Biol, 14(2), R16.

Makarev, E., Call, M. K., Grogg, M. W., Atkinson, D. L., Milash, B., Odelberg, S. J., & Tsonis, P. A. (2007). Gene expression signatures in the newt irises during lens regeneration. FEBS Lett, 581(9), 1865-1870.

Roddy, M., Fox, T. P., McFadden, J. P., Nakamura, K., Del Rio-Tsonis, K., & Tsonis, P. A. (2008). A comparative proteomic analysis during urodele lens regeneration. Biochem Biophys Res Commun, 377(1), 275-279.

Sousounis, K., Michel, C. S., Bruckskotten, M., Maki, N., Borchardt, T., Braun, T., Looso, M., & Tsonis, P. A. (2013). A microarray analysis of gene expression patterns during early phases of newt lens regeneration. Mol Vis, 19, 135-145.

Sousounis, Konstantinos, Looso, Mario, Maki, Nobuyasu, Ivester, Clifford J., Braun, Thomas, & Tsonis, Panagiotis A. (2013). Transcriptome Analysis of Newt Lens Regeneration Reveals Distinct Gradients in Gene Expression Patterns. Plos One, 8(4).

Tsonis, P. A., Trombley, M. T., Rowland, T., Chandraratna, R. A., & del Rio-Tsonis, K. (2000). Role of retinoic acid in lens regeneration. Dev Dyn, 219(4), 588-593.

! 53!

Table 4. Fisher’s Exact Test for Dorsal and Ventral Proteome.

A. GO terms significantly enriched in the ventral proteome.

GO-ID Term FDR GO:0043292 contractile fiber 2.87E-06 GO:0030016 myofibril 1.09E-05 GO:0044449 contractile fiber part 3.41E-04 GO:0030017 sarcomere 5.60E-04 GO:0005882 intermediate filament 0.025766922 striated muscle GO:0006941 contraction 0.025766922

B. Genes for enriched GO terms in ventral proteome

Gene Gene name symbol ACTA1 Actin, alpha 1, skeletal muscle ACTB Actin, cytoplasmic 1 ACTC1 Actin, alpha cardiac muscle 1 AK1 Adenylate kinase ARF1 ADP-ribosylation factor 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 CALD1 Caldesmon CLIP1 CAP-Gly domain-containing linker protein 1 CNN3 Calponin-3 CRYAB Alpha-crystallin B chain (Fragment) CSRP3 Cysteine and glycine-rich protein 3 CTNNB1 Catenin beta-1 DES Desmin EIF6 Eukaryotic translation initiation factor 6 FKBP1B Peptidyl-prolyl cis-trans isomerase FKBP1B FLNB Filamin-B FXR1 Fragile X mental retardation syndrome- related protein 1 KRT17 Keratin, type I cytoskeletal 17 KRT18 Keratin, type I cytoskeletal 18 KRT19 Keratin, type I cytoskeletal 19 KRT8 Keratin, type II cytoskeletal 8 LDB3 LIM domain-binding protein 3

! 54! LMAN1 Protein ERGIC-53 LMNA Lamin A/C LMNA Prelamin-A/C LMNB1 Lamin-B1 MYH3 Myosin-3 MYH7 Myosin-7 MYL1 Myosin light chain 1/3, skeletal muscle isoform MYL12B Myosin regulatory light chain 12B MYL2 Myosin regulatory light chain 2, ventricular/cardiac muscle isoform MYL3 Myosin light chain 3 MYL4 Myosin light chain 4 MYL9 Myosin regulatory light polypeptide 9 NES Nestin PALLD Palladin PDLIM5 PDZ and LIM domain protein 5 PDLIM7 PDZ and LIM domain protein 7 PLEC Plectin PPP1R12A Protein phosphatase 1 regulatory subunit 12A SRI Sorcin SVIL Supervillin SYNPO2 Synaptopodin-2 TNNC1 Troponin C, slow skeletal and cardiac muscles TNNC2 Troponin C, skeletal muscle TNNT1 Troponin T, slow skeletal muscle TPM1 Tropomyosin alpha-1 chain TPM3 Tropomyosin 3 TWF1 Twinfilin-1 VIM Vimentin

! 55!

Figure 13. GO distribution for the significant terms shown in Table 1B.

cellular_component Level 2

synapse (4)

cell (50) organelle (50)

membrane- cell junction (8) enclosed lumen (9) membrane (19) macromolecula r complex (37)

Figure 14. Q-PCR validation for proteins listed in Table 1B.

A 7 Desmin 6 P < 0.01 5 4 3 2 1

Relative mRNA expression expression mRNA Relative 0 Dorsal Ventral

B C

2 TPM1 2 LBD3

1.5 1.5

1 1

0.5 0.5

Relative mRNA expression expression mRNA Relative 0 expression mRNA Relative 0 Dorsal Ventral Dorsal ventral

!!!!!!!!!!!!!!!!!!!!!

!!!!!

! 56!

Table 5. Proteins found in both in vitro IPE cells and various stages of in vivo regenerating iris.

Gene name Uniprot ID 14 kDa phosphohistidine phosphatase Q9NRX4 Probable ATP-dependent RNA helicase DDX46 Q7L014 Probable ATP-dependent RNA helicase DDX23 Q9BUQ8 Chromodomain-helicase-DNA-binding protein 4 F5GWX5 DNA replication licensing factor MCM4 P33991 Retinal dehydrogenase 1 P00352 Ran GTPase-activating protein 1 P46060 Acylamino-acid-releasing enzyme P13798 Testin B7Z6L5 Cyclin-dependent kinase 1 P06493 Versican core protein P13611 Structural maintenance of chromosomes protein 2 O95347 Spectrin beta chain, non-erythrocytic 1 Q01082 Pseudouridylate synthase 7 homolog Q96PZ0 Prolyl 4-hydroxylase subunit alpha-1 P13674 Glutathione S-transferase omega-1 P78417 S-adenosylmethionine synthase isoform type-2 P31153 Eukaryotic translation elongation factor 1 epsilon-1 O43324 Proliferating cell nuclear antigen P12004 Isoleucine--tRNA ligase, cytoplasmic J3KR24 Poly [ADP-ribose] polymerase 1 P09874 Plectin Q15149 Galectin-1 P09382 E3 ubiquitin-protein ligase UBR4 Q5T4S7 Desmin P17661

! 57!

Figure 15. Q-PCR validation for proteins listed in Table 5.

A P < 0.05 (A,B,C) 2 ALDH1A

1.5

1

expression expression 0.5 Relative mRNA mRNA Relative

0 DORSAL VENTRAL

B C

2 MCM4 2! SMC2

1.5 1.5!

1 1! expression expression expression expression 0.5! Relative mRNA mRNA Relative Relative mRNA mRNA Relative 0.5

0 0! DORSAL VENTRAL DORSAL VENTRAL

! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !

! 58!

CHAPTER IV

SUMMARY AND FUTURE STUDY

Summary

Regeneration of lost tissues or organs involves mechanism that either recruits tissue resident stem cells or cells at the site of injury to regain the lost tissues. It is observed that different organism employ different ways to regenerate their lost body parts. Newt regenerates its lost lens by transdifferentiation of dorsal iris, a tissue located at the site of tissue injury. This process have been extensively studied in past. The cells of dorsal iris is shown to re enter the cell cycle on injury and eventually it lose its cellular characteristics for e.g., pigments and gradually attains the identity of lens cells. Signaling pathways such as FGF, molecular factors; Pax-6, retinoic acid, epigenetic factors; histones, stem cell factors have been well studied for this process and have shown its implication the mechanism of regeneration. However, in newts only the dorsal iris is competent to regenerate lens and not the ventral iris even though it is the same tissue. Understanding the differences between dorsal and ventral would possibly explain how the dorsal iris exhibits such property. High through studies such as microarrays, Expression sequence tags (ESTs), transcriptome and proteomes revealed no qualitative differences but quantitative differences between the dorsal and ventral iris to be the possible answer to the regeneration ability of the dorsal iris.

! 59!

Regeneration of ventral iris is possible by dorsalizing the ventral iris by inhibition of

BMP pathway or overexpression of eye transcription factor six-3 and retinoic acid.

Future study and significance

The ability of regenerating lost body parts have been widely distributed across the animal kingdom. Moreover, not all the regeneration competent species possess such ability for all of its organs. For e.g, lens regeneration in xenopus is only restricted to pre metamorphic stage and axolotl that can regenerate its limbs fail to regenerate a lost lens where as a newt can regenerate organs such as lens, limbs, heart and brain through out its adulthood. It would be important to conduct comparative studies between species in order to gain more insight into why a particular organism possess such regeneration ability and how can the knowledge be useful for the advancement of regenerative medicine.

! 60!

APPENDIX Proteins identified in Newt cultured IPE cells. The proteins shown here have more than two fold expression in Dorsal (A) or Ventral (B). #Div/0! Means protein intensity was detected only in dorsal/ventral.

A. Dorsal Proteome

Gene Dorsal/Ventral Dorsal/Ventr Protein IDs Uniprot ID Protein IDs Uniprot ID Gene Symbol Symbol ratio al ratio transcript9410 O43390 HNRNPR 2.01 transcript9254 Q02218 OGDH 2.08 transcript5824 Q02818 NUCB1 2.01 transcript15831 P57105 SYNJ2BP 2.08 transcript10320 Q07020 RPL18 2.02 transcript43767 Q9UKX2 MYH2 2.08 transcript16436 Q9UIJ7 AK3 2.02 transcript12487 Q08945 SSRP1 2.08 transcript25310 Q9Y2Q5 LAMTOR2 2.02 transcript13049 O00560 SDCBP 2.09 transcript15035 P47897 QARS 2.02 transcript87474 J3KNT0 FSCN1 2.09 transcript4538 P16144 ITGB4 2.02 transcript14376 Q9NSD9 FARSB 2.09

transcript4519 Q9GZT3 SLIRP 2.03 transcript14157 P22626 HNRNPA2B1 2.09 transcript24858 Q8N5C6 SRBD1 2.03 transcript9460 P13674 P4HA1 2.11 transcript17515 P05165 PCCA 2.03 transcript75154 P49419 ALDH7A1 2.12 transcript14953 B4DT77 ANXA7 2.03 transcript12225 O14972 DSCR3 2.12 transcript10467 Q9NZB2 FAM120A 2.04 transcript13044 P61158 ACTR3 2.12 transcript19190 P22033 MUT 2.04 transcript9596 O14949 UQCRQ 2.13 transcript7173 G3V4C1 HNRNPC 2.04 transcript7957 B4DTC3 HNRNPD 2.14 transcript85443 Q9Y487 ATP6V0A2 2.05 transcript9500 P31749 AKT1 2.14

! 61! transcript93548 Q9HBK9 AS3MT 2.05 transcript10617 P55786 NPEPPS 2.15 transcript16272 Q04760 GLO1 2.05 transcript16416 B4DIT7 TGM2 2.15 transcript40639 F8W8B5 AACS 2.05 transcript9271 Q9UBF2 COPG2 2.15 transcript9103 P22392 NME2 2.05 transcript369 P62899 RPL31 2.15 transcript81759 P61289 PSME3 2.06 transcript5282 G5E9B6 PRMT1 2.16 transcript21500 P17858 PFKL 2.06 transcript11036 H0YL69 PSMA4 2.16 transcript19630 P48556 PSMD8 2.06 transcript22181 P23434 GCSH 2.18 transcript5230 Q9HAV0 GNB4 2.06 transcript17573 Q8WVM8 SCFD1 2.18 transcript26080 P35749 MYH11 2.06 transcript8307 P63173 RPL38 2.18 transcript10584 P52209 PGD 2.08 transcript108524 Q06520 SULT2A1 2.18 transcript14517 P26639 TARS 2.18 transcript15294 Q13838 DDX39B 2.30 transcript11207 P62244 RPS15A 2.19 transcript8347 P34896 SHMT1 2.31 transcript18580 O15269 SPTLC1 2.19 transcript16499 Q96PZ0 PUS7 2.33 transcript46877 P23786 CPT2 2.19 transcript26133 Q92973 TNPO1 2.34 transcript12428 P62191 PSMC1 2.20 transcript18150 J9JIH9 RHOT1 2.34 transcript13576 B7Z452 ACSL1 2.20 transcript7425 Q01082 SPTBN1 2.34 transcript36828 Q16658 FSCN1 2.20 transcript16995 Q7L523 RRAGA 2.34 transcript6805 P18206 VCL 2.20 transcript18233 B4DH70 FBXW11 2.34 transcript63879 Q9Y6M1 IGF2BP2 2.21 transcript77975 P60903 S100A10 2.34 transcript16529 P60891 PRPS1 2.21 transcript15173 Q9UMS0 NFU1 2.35 transcript6371 Q12905 ILF2 2.21 transcript20440 O95394 PGM3 2.36 transcript9178 P25398 RPS12 2.21 transcript11926 P45974 USP5 2.37 transcript90257 Q15629 TRAM1 2.21 transcript11056 P50991 CCT4 2.37 transcript7981 P55011 SLC12A2 2.21 transcript9911 P62333 PSMC6 2.38 transcript18414 O95563 MPC2 2.21 transcript18246 P15559 NQO1 2.38 transcript12953 Q13200 PSMD2 2.23 transcript81033 C9JXB8 RPL24 2.39 transcript10026 P63027 VAMP2 2.24 transcript13625 O15372 EIF3H 2.40 transcript19924 P09467 FBP1 2.24 transcript20218 Q8NC56 LEMD2 2.40 transcript43109 Q8NFW8 CMAS 2.24 transcript9732 P02649 APOE 2.40 transcript11263 P39019 RPS19 2.25 transcript11318 O75390 CS 2.42

! 62! transcript13087 P34897 SHMT2 2.27 transcript17079 Q8NCW5 APOA1BP 2.43 transcript5295 P62851 RPS25 2.27 transcript5252 P46940 IQGAP1 2.43 transcript12272 E5RHW4 ERLIN2 2.29 transcript15623 P16152 CBR1 2.44 transcript19352 Q9UHG3 PCYOX1 2.29 transcript11925 Q6IN85 SMEK1 2.44 transcript9526 Q9UKD2 MRTO4 2.29 transcript6643 P11142 HSPA8 2.45 transcript68933 G3V1D1 FTH1 2.30 transcript14 Q8IUE6 HIST2H2AB 2.45 transcript65739 Q8NFU3 TSTD1 2.30 transcript5318 P00387 CYB5R3 2.45 transcript97789 Q5SZU1 PHGDH 2.30 transcript7611 P08865 RPSA 2.46 transcript27515 O95347 SMC2 2.46 transcript7627 P14618 PKM 2.57 transcript11412 O43143 DHX15 2.46 transcript16509 O60493 SNX3 2.58 transcript36547 Q9BZX2 UCK2 2.47 transcript22868 Q9BPX5 ARPC5L 2.58 transcript84552 P15309 ACPP 2.47 transcript7324 Q9Y2X3 NOP58 2.59 transcript12578 P00505 GOT2 2.47 transcript11017 P29692 EEF1D 2.59 transcript7208 Q15404 RSU1 2.47 transcript10687 P55084 HADHB 2.60 transcript5604 P35580 MYH10 2.47 transcript10744 O60234 GMFG 2.61 transcript25980 Q8N1F7 NUP93 2.47 transcript9762 P56192 MARS 2.61 transcript10915 P09960 LTA4H 2.48 transcript7059 Q9NWH9 SLTM 2.62 transcript8077 Q9H0D6 XRN2 2.48 transcript9899 B0QY89 EIF3EIP 2.62 transcript14965 O95831 AIFM1 2.48 transcript26250 Q02790 FKBP4 2.65 transcript12157 Q8N5M9 JAGN1 2.48 transcript12323 P61960 UFM1 2.66 transcript22184 Q9UKF6 CPSF3 2.49 transcript84278 P49588 AARS 2.67 transcript13965 Q13098 GPS1 2.49 transcript9479 P42704 LRPPRC 2.67 transcript12922 P12081 HARS 2.49 transcript12859 P49591 SARS 2.68 transcript13109 O15144 ARPC2 2.51 transcript11388 Q9Y5S2 CDC42BPB 2.72 transcript31517 Q8TED0 UTP15 2.51 transcript13830 Q9NYU2 UGGT1 2.72 transcript19881 P51659 HSD17B4 2.51 transcript8076 Q7L576 CYFIP1 2.73 transcript30352 Q8IXL7 MSRB3 2.52 transcript7851 P27144 AK4 2.73 transcript26316 P63220 RPS21 2.53 transcript31719 P48507 GCLM 2.73 transcript9061 J3QSS4 FNBP1L 2.54 transcript10537 G5E9Q6 PFN2 2.75 transcript8983 Q9Y2A7 NCKAP1 2.54 transcript82142 P07814 EPRS 2.76

! 63! transcript43386 Q99497 PARK7 2.54 transcript14769 P53778 MAPK12 2.76 transcript85232 Q9P2K5 MYEF2 2.54 transcript7210 P18124 RPL7 2.76 transcript34053 Q9Y696 CLIC4 2.54 transcript7598 P07384 CAPN1 2.77 transcript24188 Q14690 PDCD11 2.54 transcript16643 P49247 RPIA 2.77 transcript15088 Q86WT6 TRIM69 2.56 transcript11836 O75629 CREG1 2.77 transcript3101 Q13748 TUBA3C 2.56 transcript13207 P36957 DLST 2.80 transcript85340 O75688 PPM1B 2.80 transcript13737 Q96KP4 CNDP2 3.00 transcript16292 Q92696 RABGGTA 2.82 transcript18310 Q9HBL8 NMRAL1 3.01 transcript12101 P62495 ETF1 2.82 transcript9459 P30041 PRDX6 3.01 transcript25114 J3KMX9 EIF2B1 2.82 transcript12400 Q99832 CCT7 3.02 transcript18901 Q9UHX1 PUF60 2.82 transcript15383 O00148 DDX39A 3.02 transcript9424 P07900 HSP90AA1 2.82 transcript15193 P35659 DEK 3.04 transcript9049 P50395 GDI2 2.83 transcript7449 P26196 DDX6 3.05 transcript13244 Q9Y5X3 SNX5 2.84 transcript81750 Q99615 DNAJC7 3.05 transcript9848 P24666 ACP1 2.87 transcript12440 P23921 RRM1 3.05 transcript84813 P40222 TXLNA 2.87 transcript3982 Q92542 NCSTN 3.08 transcript50261 G3V277 WARS 2.87 transcript21726 Q9HC38 GLOD4 3.08 transcript80201 F5H667 ASPH 2.88 transcript19902 Q9Y512 SAMM50 3.08 transcript70115 P62888 RPL30 2.88 transcript29516 Q96RS6 NUDCD1 3.09 transcript8142 P22314 UBA1 2.89 transcript82856 Q15075 EEA1 3.09 transcript16083 Q0VDF9 HSPA14 2.89 transcript17857 P50583 NUDT2 3.09 transcript7684 Q6DD88 ATL3 2.90 transcript10826 P63098 PPP3R1 3.10 transcript6695 P62910 RPL32 2.90 transcript62081 E9PBX3 ALDH1L1 3.12 transcript14293 P55884 EIF3B 2.92 transcript81742 Q8TD30 GPT2 3.13 transcript19333 A2RRF3 EPS15L1 2.93 transcript10335 P40429 RPL13A 3.14 transcript7497 D6RHZ5 SEC31A 2.93 transcript10774 P62266 RPS23 3.14 transcript20814 Q86VS8 HOOK3 2.95 transcript7316 P19022 CDH2 3.15 transcript78113 P46778 RPL21 2.96 transcript21010 P63172 DYNLT1 3.15 transcript5674 P15121 AKR1B1 2.96 transcript11636 P01009 SERPINA1 3.16 transcript15652 Q9UJS0 SLC25A13 2.96 transcript13408 Q8WUM4 PDCD6IP 3.16

! 64! transcript24940 Q13951 CBFB 2.96 transcript9888 Q15435 PPP1R7 3.17 transcript17699 P12235 SLC25A4 2.97 transcript14454 Q5JTV8 TOR1AIP1 3.19 transcript15430 Q9BXD5 NPL 2.98 transcript82795 Q9NYL9 TMOD3 3.19 transcript5 P36578 RPL4 2.98 transcript20561 Q9BS26 ERP44 3.19 transcript22611 O00469 PLOD2 3.19 transcript7042 Q96S97 MYADM 3.32 transcript7667 P62993 GRB2 3.19 transcript85394 Q7L1Q6 BZW1 3.32 transcript7388 P17980 PSMC3 3.20 transcript48052 E9PB90 HK2 3.34 transcript13279 P18031 PTPN1 3.22 transcript7869 P04899 GNAI2 3.35 transcript17889 P30153 PPP2R1A 3.22 transcript20788 O96019 ACTL6A 3.36 transcript13248 O76003 GLRX3 3.22 transcript82467 O14979 HNRPDL 3.36 transcript3021 Q9BUF5 TUBB6 3.22 transcript18101 P38919 EIF4A3 3.36 transcript16350 H0UI37 TSTD3 3.23 transcript48164 P16278 GLB1 3.38 transcript22610 O60568 PLOD3 3.24 transcript28543 Q5T4F7 SFRP5 3.38 transcript85945 P61221 ABCE1 3.24 transcript79086 Q96PU8 QKI 3.39 transcript8616 P35241 RDX 3.25 transcript11967 Q9Y4W6 AFG3L2 3.40 transcript13359 Q99460 PSMD1 3.26 transcript101005 E9PDM8 SEC24D 3.40 transcript14370 Q08209 PPP3CA 3.27 transcript86005 Q9UNM6 PSMD13 3.40 transcript2517 P00751 CFB 3.27 transcript16942 P49773 HINT1 3.42 transcript14918 Q9Y295 DRG1 3.28 transcript9411 Q9HB71 CACYBP 3.42 transcript11297 Q9BZZ5 API5 3.28 transcript22099 P05413 FABP3 3.43 transcript5686 Q14204 DYNC1H1 3.29 transcript86701 Q13011 ECH1 3.44 transcript20417 O43765 SGTA 3.29 transcript12315 P48506 GCLC 3.45 transcript68311 Q9BRR6 ADPGK 3.30 transcript20126 P13861 PRKAR2A 3.45 transcript18586 O75439 PMPCB 3.30 transcript9785 Q9UBV2 SEL1L 3.47 transcript6054 P07339 CTSD 3.31 transcript16336 O14907 TAX1BP3 3.51 transcript29574 Q9Y5K5 UCHL5 3.31 transcript13952 Q96QK1 VPS35 3.57 transcript81194 P61956 SUMO2 3.31 transcript13103 Q49A26 GLYR1 3.58 transcript8874 P33992 MCM5 3.31 transcript16687 P22234 PAICS 3.62 transcript4840 P53634 CTSC 3.31 transcript18798 Q13617 CUL2 3.63 transcript57235 I3L1F5 HMOX2 3.31 transcript108469 O15460 P4HA2 3.63

! 65! transcript22122 Q9H0V9 LMAN2L 3.32 transcript6849 Q9UN36 NDRG2 3.64 transcript84097 O00423 EML1 3.32 transcript68922 P08708 RPS17 3.67 transcript6958 P11217 PYGM 3.67 transcript6491 O75844 ZMPSTE24 3.92 transcript17265 P22061 PCMT1 3.68 transcript17237 H0Y4A6 VARS 3.93 transcript17451 P49840 GSK3A 3.69 transcript4166 P29373 CRABP2 3.95 transcript9822 J3KNX9 MYO18A 3.70 transcript82151 P55209 NAP1L1 3.96 transcript12238 Q16531 DDB1 3.71 transcript13665 Q9ULA0 DNPEP 3.99 transcript8719 O15212 PFDN6 3.71 transcript13487 P31939 ATIC 3.99 transcript12930 P50454 SERPINH1 3.71 transcript13501 O14737 PDCD5 4.01 transcript18513 P02794 FTH1 3.72 transcript11008 P15880 RPS2 4.08 transcript5715 P41222 PTGDS 3.74 transcript27146 P60228 EIF3E 4.09 transcript12739 P31350 RRM2 3.76 transcript10778 P49327 FASN 4.11 transcript89280 B3KSH1 EIF3F 3.78 transcript22701 Q8N6N7 ACBD7 4.11 transcript9204 O43776 NARS 3.79 transcript14415 P30837 ALDH1B1 4.14 transcript11426 P15374 UCHL3 3.79 transcript19862 Q13153 PAK1 4.15 transcript20563 P40123 CAP2 3.79 transcript31903 Q6UWP2 DHRS11 4.15 transcript17632 F5H6E2 MYO1C 3.81 transcript13543 P62318 SNRPD3 4.17 transcript11962 O75891 ALDH1L1 3.82 transcript7699 O00487 PSMD14 4.20 transcript6073 P11387 TOP1 3.82 transcript7629 Q15631 TSN 4.22 transcript43445 P30038 ALDH4A1 3.83 transcript11497 Q86VP6 CAND1 4.23 transcript15128 P20042 EIF2S2 3.83 transcript11167 P35754 GLRX 4.23 transcript15948 P61970 NUTF2 3.83 transcript80139 Q13418 ILK 4.24 transcript10175 C9JZR2 CTNND1 3.84 transcript7800 P55060 CSE1L 4.25 transcript9350 P31949 S100A11 3.85 transcript7402 J3KQU9 AP1G1 4.26 transcript18166 Q9NXA8 SIRT5 3.85 transcript14881 P41227 NAA10 4.26 transcript17258 P38435 GGCX 3.85 transcript16232 Q99627 COPS8 4.32 transcript28933 O95336 PGLS 3.86 transcript44158 Q8NBX0 SCCPDH 4.33 transcript21429 Q12907 LMAN2 3.88 transcript16373 Q96RQ3 MCCC1 4.34 transcript16290 O76094 SRP72 3.90 transcript20670 Q13177 PAK2 4.37 transcript5519 O75369 FLNB 3.90 transcript22828 Q9NX62 IMPAD1 4.41

! 66! transcript3796 Q07954 LRP1 4.45 transcript5388 P62136 PPP1CA 4.91 transcript6782 P53621 COPA 4.46 transcript18677 P06493 CDK1 4.91 transcript10551 Q9H444 CHMP4B 4.48 transcript14596 P13804 ETFA 4.94 transcript18536 O43759 SYNGR1 4.48 transcript5991 P39023 RPL3 4.97 transcript11196 Q86U42 PABPN1 4.49 transcript15136 O60264 SMARCA5 5.00 transcript6327 F8WEZ8 GRIK2 4.50 transcript17408 P48739 PITPNB 5.06 transcript6151 Q00013 MPP1 4.54 transcript18550 O60701 UGDH 5.07 transcript27953 P62699 YPEL5 4.60 transcript6577 Q7L9L4 MOB1B 5.07 transcript10974 Q8NEU8 APPL2 4.60 transcript7540 P05386 RPLP1 5.09 transcript10832 E7ES33 SEPT7 4.62 transcript9134 O15294 OGT 5.09 transcript15555 O00231 PSMD11 4.62 transcript13037 Q6YN16 HSDL2 5.10 transcript82033 Q9BUL8 PDCD10 4.64 transcript8036 Q92769 HDAC2 5.11 transcript26197 Q9NWU2 GID8 4.67 transcript7557 Q13045 FLII 5.13 transcript8528 Q02878 RPL6 4.67 transcript3027 Q13509 TUBB3 5.14 transcript32653 Q9UNN5 FAF1 4.68 transcript14812 P30419 NMT1 5.20 transcript8067 P07602 PSAP 4.69 transcript23150 H7BXX3 SNX18 5.20 transcript22329 Q9GZL7 WDR12 4.72 transcript5357 P07996 THBS1 5.25 transcript13852 Q6QHF9 PAOX 4.74 transcript21652 P08236 GUSB 5.33 transcript6751 O60841 EIF5B 4.76 transcript10897 E7EU13 ARAP1 5.33 transcript8909 O00410 IPO5 4.76 transcript9502 O75312 ZNF259 5.34 transcript11969 P50914 RPL14 4.77 transcript81490 O14617 AP3D1 5.35 transcript16218 Q13561 DCTN2 4.78 transcript10723 Q16543 CDC37 5.36 transcript15357 P11310 ACADM 4.78 transcript20843 P15927 RPA2 5.41 transcript81810 D6R938 CAMK2D 4.80 transcript96495 O00625 PIR 5.46 transcript10566 P53618 COPB1 4.80 transcript9270 B5MBZ0 EML4 5.47 transcript11141 Q15459 SF3A1 4.83 transcript13233 P13798 APEH 5.48 transcript81613 E9PEZ1 CUL9 4.89 transcript10378 Q14974 KPNB1 5.48 transcript6467 Q9BXJ9 NAA15 4.90 transcript15698 P04062 GBA 5.49 transcript32447 G3XAP3 ABCB8 5.54 transcript12301 Q01581 HMGCS1 6.13 transcript44862 Q9BY49 PECR 5.60 transcript10227 P22694 PRKACB 6.14

! 67! transcript26232 P07954 FH 5.61 transcript5451 P52565 ARHGDIA 6.23 transcript83374 Q15833 STXBP2 5.67 transcript20483 Q71U36 TUBA1A 6.29 transcript21872 Q16555 DPYSL2 5.68 transcript20870 P30084 ECHS1 6.37 transcript13837 P14735 IDE 5.68 transcript9046 Q15746 MYLK 6.39 transcript13884 P62277 RPS13 5.69 transcript7702 Q92905 COPS5 6.40 transcript78667 P09668 CTSH 5.69 transcript14053 Q9Y263 PLAA 6.41 transcript84777 O95793 STAU1 5.70 transcript13246 P46976 GYG1 6.42 transcript7717 Q9UI12 ATP6V1H 5.76 transcript21995 P16219 ACADS 6.44 transcript9330 Q15942 ZYX 5.78 transcript12672 O60506 SYNCRIP 6.49 transcript15038 O15270 SPTLC2 5.79 transcript6696 P29992 GNA11 6.50 transcript10580 P52907 CAPZA1 5.79 transcript6616 P47813 EIF1AX 6.52 transcript13469 Q13907 IDI1 5.80 transcript8251 P61160 ACTR2 6.55 transcript14514 Q13867 BLMH 5.82 transcript9624 P46926 GNPDA1 6.56 transcript9567 P17174 GOT1 5.85 transcript17404 Q8IZ83 ALDH16A1 6.59 transcript15462 Q8NBK3 SUMF1 5.86 transcript9980 Q15029 EFTUD2 6.62 transcript8144 Q9P2R7 SUCLA2 5.87 transcript17481 Q9BWD1 ACAT2 6.64 transcript22161 Q13564 NAE1 5.89 transcript25573 P61163 ACTR1A 6.68 transcript7412 O75494 SRSF10 5.93 transcript12991 Q15019 SEPT2 6.75 transcript10815 O94826 TOMM70A 5.94 transcript7019 Q53FA7 TP53I3 6.78 transcript19293 P49458 SRP9 5.94 transcript13689 Q9NZ01 TECR 6.81 transcript22169 J3KQT7 IMPA1 6.01 transcript9508 Q14683 SMC1A 6.82 transcript25985 O75477 ERLIN1 6.04 transcript13395 O60749 SNX2 6.89 transcript15732 Q92575 UBXN4 6.06 transcript10638 P04181 OAT 6.90 transcript12605 Q9Y5P4 COL4A3BP 6.09 transcript19053 P39748 FEN1 6.90 transcript6945 Q9BXS5 AP1M1 6.11 transcript9436 Q14677 CLINT1 6.91 transcript17382 Q8WXX5 DNAJC9 6.11 transcript25345 Q9Y371 SH3GLB1 6.91 transcript84258 Q32P28 LEPRE1 6.91 transcript19852 Q16836 HADH 8.20 transcript15936 P46060 RANGAP1 6.97 transcript12401 O43681 ASNA1 8.26 transcript16322 P11182 DBT 6.98 transcript80888 Q9NVH6 TMLHE 8.27 transcript9273 E7EWC2 IQGAP2 7.01 transcript12257 A4D0Z6 IMPDH1 8.27

! 68! transcript46640 B4DME9 KLC4 7.03 transcript6840 Q9UN86 G3BP2 8.30 transcript34462 E9PCI9 FDPS 7.03 transcript8554 F5H425 EIF3J 8.41 transcript18119 J3KR54 IVD 7.07 transcript7314 O75533 SF3B1 8.46 transcript20883 Q07960 ARHGAP1 7.10 transcript51001 B4E1F3 SELENBP1 8.46 transcript18304 P04424 ASL 7.22 transcript19563 Q9H845 ACAD9 8.51 transcript33377 A8MUW5 FAM98B 7.27 transcript14328 Q8TCT9 HM13 8.52 transcript81405 P26358 DNMT1 7.28 transcript92086 F5H5A9 SUGT1 8.54 transcript12775 F6U211 RPS10 7.29 transcript17076 P36551 CPOX 8.55 transcript11507 Q15393 SF3B3 7.41 transcript20444 J3KQ32 OLA1 8.56 transcript20404 Q9NP77 SSU72 7.43 transcript8726 Q9P289 MST4 8.59 transcript8791 B7WPF4 USP24 7.49 transcript27621 Q9NVP2 ASF1B 8.59 transcript8506 Q9H299 SH3BGRL3 7.55 transcript12039 Q12996 CSTF3 8.62 transcript8096 P62841 RPS15 7.66 transcript89219 Q13107 USP4 8.79 transcript20246 Q13268 DHRS2 7.69 transcript32891 O43294 TGFB1I1 8.84 transcript21473 Q9H0R6 QRSL1 7.71 transcript12512 P55263 ADK 8.84 transcript90246 Q9NTZ6 RBM12 7.79 transcript19033 Q8N8S7 ENAH 8.99 transcript82636 O14980 XPO1 7.80 transcript14367 Q9BRQ8 AIFM2 9.17 transcript83948 Q86TI2 DPP9 7.80 transcript13510 P10619 CTSA 9.32 transcript9453 Q92597 NDRG1 7.86 transcript12745 Q12874 SF3A3 9.35 transcript9059 P46108 CRK 7.95 transcript13195 P30740 SERPINB1 9.39 transcript6698 P50148 GNAQ 7.98 transcript90585 Q13155 AIMP2 9.47 transcript5391 Q96RL7 VPS13A 8.01 transcript10772 F5HFY4 NAP1L4b 9.69 transcript15355 P51665 PSMD7 8.10 transcript10497 Q5T624 NASP 9.77 transcript5529 P35237 SERPINB6 8.14 transcript16074 Q9GZS3 WDR61 9.83 transcript26716 Q9H7D7 WDR26 9.90 transcript13697 Q9BT78 COPS4 16.50 transcript88134 Q9BT09 CNPY3 9.99 transcript11733 Q9BUP0 EFHD1 16.59 transcript11200 P24752 ACAT1 10.02 transcript24718 Q9NUZ1 ACOXL 16.63 transcript83172 P21399 ACO1 10.34 transcript20780 O14744 PRMT5 17.65 transcript18650 O75436 VPS26A 10.44 transcript114 P62736 ACTA2 17.94 transcript79798 P26368 U2AF2 10.48 transcript39154 P58107 EPPK1 18.58

! 69! transcript20456 P11908 PRPS2 10.52 transcript11479 Q96IU4 ABHD14B 19.07 transcript16081 Q9NZL4 HSPBP1 10.58 transcript13441 Q15067 ACOX1 19.24 transcript12360 P78347 GTF2I 10.64 transcript85627 Q8IUD2 ERC1 19.42 transcript16119 Q8WW22 DNAJA4 10.96 transcript24668 Q8TD16 BICD2 19.42 transcript21579 P11172 UMPS 11.03 transcript94100 P61006 RAB8A 19.47 transcript10794 Q969X5 ERGIC1 11.17 transcript13979 O75027 ABCB7 19.49 transcript7438 P62854 RPS26 11.52 transcript85250 B7Z815 USP7 19.69 transcript7762 Q969G3 SMARCE1 11.69 transcript19863 P22059 OSBP 19.74 transcript13586 Q9UNH7 SNX6 11.74 transcript23159 Q9UBM7 DHCR7 19.91 transcript80408 Q13263 TRIM28 11.97 transcript11005 P23919 DTYMK 20.93 transcript9080 Q9P287 BCCIP 12.37 transcript10149 Q8WU90 ZC3H15 21.69 transcript11981 Q5T1M5 FKBP15 12.50 transcript28077 P37198 NUP62 21.76 transcript16032 P27361 MAPK3 12.51 transcript16414 Q9HCN8 SDF2L1 21.90 transcript25456 P00492 HPRT1 13.00 transcript8360 O15031 PLXNB2 22.08 transcript12326 P27695 APEX1 13.19 transcript10728 P21695 GPD1 22.53 transcript15970 Q99986 VRK1 13.34 transcript15921 P11766 ADH5 22.54 transcript11765 O95372 LYPLA2 13.42 transcript21545 Q9Y385 UBE2J1 22.89 transcript46394 O43172 PRPF4 13.43 transcript9241 O43847 NRD1 23.51 transcript12067 O14579 COPE 14.32 transcript9720 P11388 TOP2A 23.68 transcript4838 Q9NVD7 PARVA 14.56 transcript8765 O95373 IPO7 23.79 transcript8817 P25205 MCM3 15.81 transcript7793 B0QZ18 CPNE1 23.88 transcript10015 Q9Y376 CAB39 16.49 transcript12600 Q7L2H7 EIF3M 24.13 transcript16303 H3BNX3 24.52 transcript13733 Q92890 UFD1L 66.57

transcript29674 Q16204 CCDC6 24.67 transcript9563 P55010 EIF5 67.41 transcript6120 Q9Y657 SPIN1 24.80 transcript18876 Q15427 SF3B4 73.49 transcript6273 O14773 TPP1 25.54 transcript19991 H0YNW5 DUT 83.47 transcript86652 Q9H9S4 CAB39L 26.04 transcript44991 Q6NZI2 PTRF 98.99 transcript6110 P46781 RPS9 26.51 transcript14445 Q9UBE0 SAE1 116.23 transcript11524 O00170 AIP 26.51 transcript100512 Q9BY44 EIF2A #DIV/0! transcript18014 Q9NRZ7 AGPAT3 26.70 transcript100644 Q9NY12 GAR1 #DIV/0!

! 70! transcript15950 Q9Y570 PPME1 26.72 transcript10080 O75886 STAM2 #DIV/0! transcript119678 Q3ZAQ7 VMA21 27.25 transcript10106 Q9NVP1 DDX18 #DIV/0! transcript11680 Q7LBC6 KDM3B 28.06 transcript10119 O60271 SPAG9 #DIV/0! transcript23049 P35244 RPA3 29.24 transcript10140 Q6PIY7 PAPD4 #DIV/0! transcript10083 P46777 RPL5 30.42 transcript10177 Q9BYG3 MKI67IP #DIV/0! transcript87826 P00352 ALDH1A1 30.84 transcript102639 H0Y746 MMS19 #DIV/0! transcript35462 P16455 MGMT 30.90 transcript103702 Q8TCT8 SPPL2A #DIV/0! transcript9797 O00203 AP3B1 31.46 transcript10547 Q9Y3E7 CHMP3 #DIV/0! transcript13459 P49915 GMPS 31.83 transcript10559 P61201 COPS2 #DIV/0! transcript15433 O00233 PSMD9 31.93 transcript10598 Q9UMX0 UBQLN1 #DIV/0! transcript7968 P33991 MCM4 34.95 transcript10693 B8ZZD4 TAX1BP1 #DIV/0! transcript20696 P14550 AKR1A1 36.23 transcript10797 O00139 KIF2A #DIV/0! transcript9744 Q96CW1 AP2M1 37.16 transcript10827 J3KQA6 CYTH2 #DIV/0! transcript26314 Q16563 SYPL1 38.71 transcript108422 P21589 NT5E #DIV/0! transcript7364 P06737 PYGL 39.14 transcript10850 Q9UI26 IPO11 #DIV/0! transcript22614 Q8TBF2 FAM213B 39.35 transcript108962 Q9BT73 PSMG3 #DIV/0! transcript17620 P21283 ATP6V1C1 44.06 transcript10919 P35354 PTGS2 #DIV/0! transcript12443 Q8N806 UBR7 45.17 transcript10928 Q9BS40 LXN #DIV/0! transcript11612 Q9H3P7 ACBD3 64.27 transcript10989 Q86UV5 USP48 #DIV/0! transcript14369 Q9Y2W1 THRAP3 64.36 transcript11057 G3V3B0 ACIN1 #DIV/0! transcript11074 Q9Y5X1 SNX9 #DIV/0! transcript13398 Q9UNL2 SSR3 #DIV/0! transcript11118 Q14653 IRF3 #DIV/0! transcript13524 O75940 SMNDC1 #DIV/0! transcript11134 O00541 PES1 #DIV/0! transcript13577 P42224 STAT1 #DIV/0! transcript11146 P33993 MCM7 #DIV/0! transcript13632 O95456 PSMG1 #DIV/0! transcript11201 P01116 KRAS #DIV/0! transcript13701 Q9NR46 SH3GLB2 #DIV/0! transcript11266 O75351 VPS4B #DIV/0! transcript13893 P41240 CSK #DIV/0! transcript11519 G3V1X3 CHURC1 #DIV/0! transcript13900 P62745 RHOB #DIV/0! transcript11597 Q9HAV7 GRPEL1 #DIV/0! transcript13922 Q96DZ1 ERLEC1 #DIV/0! transcript11683 Q9BZF1 OSBPL8 #DIV/0! transcript14048 D6RB78 PDLIM5 #DIV/0! transcript11841 Q96EE3 SEH1L #DIV/0! transcript14085 P23443 RPS6KB1 #DIV/0!

! 71! transcript11888 Q9H446 RWDD1 #DIV/0! transcript14090 Q9NT62 ATG3 #DIV/0! transcript11977 O95983 MBD3 #DIV/0! transcript14140 Q9H0Z9 RBM38 #DIV/0! transcript12000 P42285 SKIV2L2 #DIV/0! transcript14148 Q00653 NFKB2 #DIV/0! MPHOSPH1 transcript12004 C9JX83 #DIV/0! transcript14317 O95166 GABARAP #DIV/0! 0 transcript12036 P07942 LAMB1 #DIV/0! transcript14458 Q9HD33 MRPL47 #DIV/0! transcript12054 Q5VTR2 RNF20 #DIV/0! transcript14519 Q9BVI4 NOC4L #DIV/0! transcript12055 Q9BXK5 BCL2L13 #DIV/0! transcript14658 Q96T88 UHRF1 #DIV/0! transcript12090 D6RHI9 RNASET2 #DIV/0! transcript14843 P49585 PCYT1A #DIV/0! transcript12354 P20290 BTF3 #DIV/0! transcript14870 P15289 ARSA #DIV/0! transcript12431 Q9GZQ8 MAP1LC3B #DIV/0! transcript14874 H0YJ97 TRIP11 #DIV/0! transcript12538 Q8NI60 ADCK3 #DIV/0! transcript15049 Q9H4L7 SMARCAD1 #DIV/0! transcript12575 O14730 RIOK3 #DIV/0! transcript15103 F8WE53 AASS #DIV/0! transcript12632 Q9NX18 SDHAF2 #DIV/0! transcript15211 P28482 MAPK1 #DIV/0! transcript12634 Q01459 CTBS #DIV/0! transcript15241 P48723 HSPA13 #DIV/0! transcript12740 Q8IXJ6 SIRT2 #DIV/0! transcript15335 P33527 ABCC1 #DIV/0! transcript12757 Q9Y2Y6 TMEM98 #DIV/0! transcript15458 Q9NU22 MDN1 #DIV/0! transcript12840 O60502 MGEA5 #DIV/0! transcript15633 Q15052 ARHGEF6 #DIV/0! transcript12936 H0Y7L2 DOCK7 #DIV/0! transcript15722 Q96SB4 SRPK1 #DIV/0! transcript15802 Q9UHY1 NRBP1 #DIV/0! transcript17734 Q9NZL9 MAT2B #DIV/0! transcript15908 A0PJE2 DHRS12 #DIV/0! transcript17846 O60232 SSSCA1 #DIV/0! transcript16036 Q99459 CDC5L #DIV/0! transcript17918 Q8WV28 BLNK #DIV/0! transcript16189 P53582 METAP1 #DIV/0! transcript17997 Q6P9B6 KIAA1609 #DIV/0! transcript16311 Q9Y3C1 NOP16 #DIV/0! transcript18006 Q5TCZ1 SH3PXD2A #DIV/0! transcript16323 O14776 TCERG1 #DIV/0! transcript18146 Q96LJ7 DHRS1 #DIV/0! transcript16330 O43395 PRPF3 #DIV/0! transcript18170 Q9Y5K6 CD2AP #DIV/0! transcript16409 H0YBB9 PROSC #DIV/0! transcript18213 H0Y8S9 MTRR #DIV/0! transcript16435 F8WJN3 CPSF6 #DIV/0! transcript18214 Q9C005 DPY30 #DIV/0! transcript16522 A6NI12 NUPL1 #DIV/0! transcript18240 Q8N7H5 PAF1 #DIV/0! transcript16533 P49792 RANBP2 #DIV/0! transcript18402 P49137 MAPKAPK2 #DIV/0!

! 72! transcript16616 C9JJE2 SF1 #DIV/0! transcript18433 C9JP52 TBC1D5 #DIV/0! transcript16653 Q9ULC4 MCTS1 #DIV/0! transcript18448 Q53GS9 USP39 #DIV/0! transcript16691 Q13630 TSTA3 #DIV/0! transcript18459 Q9NRX4 PHPT1 #DIV/0! transcript16705 Q96D46 NMD3 #DIV/0! transcript18559 O94776 MTA2 #DIV/0! transcript16730 O75569 PRKRA #DIV/0! transcript18604 O60551 NMT2 #DIV/0! transcript16738 Q9Y2R9 MRPS7 #DIV/0! transcript18746 O60256 PRPSAP2 #DIV/0! transcript16763 Q9H2W6 MRPL46 #DIV/0! transcript18968 Q9Y314 NOSIP #DIV/0! transcript16824 Q13362 PPP2R5C #DIV/0! transcript18995 Q13188 STK3 #DIV/0! transcript16913 O75506 HSBP1 #DIV/0! transcript19007 Q9NX20 MRPL16 #DIV/0! transcript17096 Q14914 PTGR1 #DIV/0! transcript19110 P28039 AOAH #DIV/0! transcript17109 Q9NZN4 EHD2 #DIV/0! transcript19171 Q9H9B1 EHMT1 #DIV/0! transcript17248 Q9UMY1 NOL7 #DIV/0! transcript19222 Q9P299 COPZ2 #DIV/0! transcript17428 P55039 DRG2 #DIV/0! transcript19226 O15160 POLR1C #DIV/0! transcript17473 Q8IWT6 LRRC8A #DIV/0! transcript19381 O95352 ATG7 #DIV/0! transcript17628 O00194 RAB27B #DIV/0! transcript19857 F5H8F9 SEPHS2 #DIV/0! transcript17676 P32321 DCTD #DIV/0! transcript19936 Q9Y333 LSM2 #DIV/0! transcript17704 Q7Z4G1 COMMD6 #DIV/0! transcript20012 Q96I25 RBM17 #DIV/0! transcript20044 P22415 USF1 #DIV/0! transcript22979 O75935 DCTN3 #DIV/0! transcript20107 Q9H204 MED28 #DIV/0! transcript23776 P78318 IGBP1 #DIV/0! transcript20144 Q9NVS9 PNPO #DIV/0! transcript24145 P50748 KNTC1 #DIV/0! transcript20152 Q15555 MAPRE2 #DIV/0! transcript25015 Q9P2R3 ANKFY1 #DIV/0! transcript20308 Q9NX40 OCIAD1 #DIV/0! transcript25340 Q9UNH6 SNX7 #DIV/0! transcript20448 Q9ULW0 TPX2 #DIV/0! transcript25404 O14497 ARID1A #DIV/0! transcript20507 O00399 DCTN6 #DIV/0! transcript25440 Q6GMV3 PTRHD1 #DIV/0! transcript20748 Q9ULC3 RAB23 #DIV/0! transcript25464 Q7L014 DDX46 #DIV/0! transcript20764 Q96GX9 APIP #DIV/0! transcript25479 H7C4R4 AKR1CL1 #DIV/0! transcript21038 Q9Y399 MRPS2 #DIV/0! transcript25519 Q9BQA1 WDR77 #DIV/0! transcript21077 O75937 DNAJC8 #DIV/0! transcript25639 Q9BV57 ADI1 #DIV/0! transcript21081 Q8TBA6 GOLGA5 #DIV/0! transcript25670 P78406 RAE1 #DIV/0! transcript21110 Q99417 MYCBP #DIV/0! transcript25725 Q86XP3 DDX42 #DIV/0!

! 73! transcript21133 O00186 STXBP3 #DIV/0! transcript25885 Q9Y3Z3 SAMHD1 #DIV/0! transcript21168 Q96EF0 MTMR8 #DIV/0! transcript25887 Q9H2U2 PPA2 #DIV/0! CHURC1- transcript21174 P19784 CSNK2A2 #DIV/0! transcript25955 B4E1A0 #DIV/0! FNTB transcript21667 Q92882 OSTF1 #DIV/0! transcript25970 Q8WYK3 TS #DIV/0! transcript21729 Q92747 ARPC1A #DIV/0! transcript25997 Q9UNF0 PACSIN2 #DIV/0! transcript22072 Q96FX7 TRMT61A #DIV/0! transcript26004 Q8WTS6 SETD7 #DIV/0! transcript22172 Q9NQG5 RPRD1B #DIV/0! transcript26065 Q9H1Y0 ATG5 #DIV/0! transcript22212 Q9UJY5 GGA1 #DIV/0! transcript26155 Q96PM5 RCHY1 #DIV/0! transcript22427 A8MXV4 NUDT19 #DIV/0! transcript26161 F5H5I6 GRSF1 #DIV/0! transcript22549 Q96AT9 RPE #DIV/0! transcript26244 Q8WXD5 GEMIN6 #DIV/0! transcript22586 G3V1R4 NSUN2 #DIV/0! transcript26252 B4DE16 CTNNBL1 #DIV/0! transcript22601 Q9UHA4 LAMTOR3 #DIV/0! transcript26590 P49903 SEPHS1 #DIV/0! transcript22630 Q8NFF5 FLAD1 #DIV/0! transcript27330 E7EVQ6 SQLE #DIV/0! transcript22709 Q59G71 TNS1 #DIV/0! transcript28098 Q9NRV9 HEBP1 #DIV/0! transcript22867 C9J470 NCAPH #DIV/0! transcript28287 P35249 RFC4 #DIV/0! transcript28624 Q99747 NAPG #DIV/0! transcript37871 J3KNP2 TBL3 #DIV/0! transcript28722 J3KQJ1 SUMF2 #DIV/0! transcript3833 B1AKP7 TARDBP #DIV/0! transcript28743 O75792 RNASEH2A #DIV/0! transcript3868 Q12841 FSTL1 #DIV/0! transcript28850 Q15814 TBCC #DIV/0! transcript3984 Q92922 SMARCC1 #DIV/0! transcript29111 Q01415 GALK2 #DIV/0! transcript39926 I3L0V3 TBCD #DIV/0! transcript29333 Q9NUQ2 AGPAT5 #DIV/0! transcript4002 Q9UNA3 A4GNT #DIV/0! transcript29512 Q9Y5V0 ZNF706 #DIV/0! transcript42707 Q5SXQ3 GLT25D2 #DIV/0! transcript29735 P49916 LIG3 #DIV/0! transcript42772 Q9Y617 PSAT1 #DIV/0! transcript29740 Q8WUH6 C12orf23 #DIV/0! transcript42794 H0Y7W6 FNBP1 #DIV/0! transcript30177 Q8TF74 WIPF2 #DIV/0! transcript42811 O95273 CCNDBP1 #DIV/0! transcript30265 Q8TDB6 DTX3L #DIV/0! transcript42892 Q86VI3 IQGAP3 #DIV/0! transcript30546 O00762 UBE2C #DIV/0! transcript4316 Q5T073 LIPA #DIV/0! transcript30908 Q9Y4X1 UGT2A1 #DIV/0! transcript43553 Q9Y3E5 PTRH2 #DIV/0! transcript31362 Q96IV0 NGLY1 #DIV/0! transcript43606 Q7Z478 DHX29 #DIV/0!

! 74! transcript3172 P17900 GM2A #DIV/0! transcript43773 Q15738 NSDHL #DIV/0! transcript32483 O75832 PSMD10 #DIV/0! transcript44658 Q08257 CRYZ #DIV/0! transcript32654 Q7Z2E3 APTX #DIV/0! transcript45035 Q9UIL1 SCOC #DIV/0! transcript33123 Q96JC1 VPS39 #DIV/0! transcript45706 C9JKA9 KIF15 #DIV/0! transcript33580 Q96D71 REPS1 #DIV/0! transcript45709 P30566 ADSL #DIV/0! transcript33870 Q9NZ43 USE1 #DIV/0! transcript4651 Q7Z6Z7 HUWE1 #DIV/0! transcript34233 J3KRY8 ASPSCR1 #DIV/0! transcript46548 Q9BRF8 CPPED1 #DIV/0! transcript34342 H0Y5N9 COL12A1 #DIV/0! transcript46575 Q2TAA2 IAH1 #DIV/0! transcript34474 P32929 CTH #DIV/0! transcript5000 Q5VYX0 RNLS #DIV/0! transcript34581 Q5QPP1 GALE #DIV/0! transcript50753 P18754 RCC1 #DIV/0! transcript34995 Q96PE7 MCEE #DIV/0! transcript5272 P49756 RBM25 #DIV/0! transcript3504 Q96A49 SYAP1 #DIV/0! transcript53 Q71DI3 HIST2H3A #DIV/0! transcript36459 F8W1I9 ACAD10 #DIV/0! transcript5333 Q8WWX9 SELM #DIV/0! transcript3688 A8MYN5 ADH1B #DIV/0! transcript54264 B4DJ85 GLMN #DIV/0! transcript5542 P11802 CDK4 #DIV/0! transcript7313 Q9NQ29 LUC7L #DIV/0! transcript55677 P22681 CBL #DIV/0! transcript7457 Q15059 BRD3 #DIV/0! transcript57229 H7C5H0 POGLUT1 #DIV/0! transcript7460 Q14008 CKAP5 #DIV/0! transcript60516 P61764 STXBP1 #DIV/0! transcript75410 P38571 LIPA #DIV/0! transcript61215 P30622 CLIP1 #DIV/0! transcript7676 Q7Z4S6 KIF21A #DIV/0! transcript61480 Q9BUQ8 DDX23 #DIV/0! transcript7707 E9PAL9 NT5DC2 #DIV/0! transcript62906 Q9H4L4 SENP3 #DIV/0! transcript77451 Q96QC0 PPP1R10 #DIV/0! transcript6337 Q6P1J9 CDC73 #DIV/0! transcript77472 Q01658 DR1 #DIV/0! transcript6351 Q96TA2 YME1L1 #DIV/0! transcript7842 Q9Y3A5 SBDS #DIV/0! transcript6393 Q9H4A6 GOLPH3 #DIV/0! transcript7846 Q96P70 IPO9 #DIV/0! transcript6405 P01040 CSTA #DIV/0! transcript79518 Q9NR09 BIRC6 #DIV/0! transcript6407 Q14498 RBM39 #DIV/0! transcript79723 P39880 CUX1 #DIV/0! transcript64130 H3BMZ9 MPI #DIV/0! transcript80002 P30050 RPL12 #DIV/0! transcript65102 Q14376 GALE #DIV/0! transcript80129 H7C2G8 SON #DIV/0! transcript6517 D3DQV9 EIF4G2 #DIV/0! transcript80205 P06753 TPM3 #DIV/0! transcript65578 Q969G6 RFK #DIV/0! transcript8022 O00338 SULT1C2 #DIV/0!

! 75! transcript65776 Q14181 POLA2 #DIV/0! transcript8081 H0Y6I0 GOLGA4 #DIV/0! transcript6625 P13591 NCAM1 #DIV/0! transcript80936 B4DUC5 CSE1L #DIV/0! transcript66708 Q9UMX1 SUFU #DIV/0! transcript8137 P27449 ATP6V0C #DIV/0! transcript6747 P51531 SMARCA2 #DIV/0! transcript81511 O60832 DKC1 #DIV/0! transcript6793 Q14789 GOLGB1 #DIV/0! transcript8163 Q9Y2V2 CARHSP1 #DIV/0! transcript68175 Q9H6Y2 WDR55 #DIV/0! transcript82001 Q9Y534 CSDC2 #DIV/0! transcript68206 Q9H9B4 SFXN1 #DIV/0! transcript82589 Q13136 PPFIA1 #DIV/0! transcript70049 C9JFL5 ACTG2 #DIV/0! transcript8351 Q96DH6 MSI2 #DIV/0! transcript7105 Q9H492 MAP1LC3A #DIV/0! transcript8427 Q5VYK3 ECM29 #DIV/0! transcript7117 Q92538 GBF1 #DIV/0! transcript84648 O75934 BCAS2 #DIV/0! transcript7193 F5GZ78 PXN #DIV/0! transcript8522 O95810 SDPR #DIV/0! transcript72757 O00267 SUPT5H #DIV/0! transcript85746 O43795 MYO1B #DIV/0! transcript86085 Q9NZZ3 CHMP5 #DIV/0! transcript9819 P56545 CTBP2 #DIV/0! transcript8623 Q86W92 PPFIBP1 #DIV/0! transcript9821 E7EPN9 PRRC2C #DIV/0! transcript86808 O75947 ATP5H #DIV/0! transcript98647 Q9UHR5 SAP30BP #DIV/0! transcript8705 P68036 UBE2L3 #DIV/0! transcript9875 Q96B97 SH3KBP1 #DIV/0! transcript8752 Q9Y4F1 FARP1 #DIV/0! transcript9890 Q92888 ARHGEF1 #DIV/0! transcript87611 H7BYK4 PDLIM7 #DIV/0! transcript99594 Q9Y4Y9 LSM5 #DIV/0! transcript87641 Q9NZ32 ACTR10 #DIV/0! transcript17624 P20908 COL5A1 #DIV/0! transcript87749 O60573 EIF4E2 #DIV/0! transcript19159 O95782 AP2A1 #DIV/0! transcript87905 Q68EM7 ARHGAP17 #DIV/0! transcript19965 No hit #DIV/0!

transcript8801 Q99541 PLIN2 #DIV/0! transcript20714 P46939 UTRN #DIV/0! transcript88391 Q13526 PIN1 #DIV/0! transcript20740 A0AVT1 UBA6 #DIV/0! transcript88467 Q86X55 CARM1 #DIV/0! transcript28948 P50416 CPT1A #DIV/0! transcript8890 Q9Y6I3 EPN1 #DIV/0! transcript29838 O60437 PPL #DIV/0! transcript88925 F5H1F6 VPS37B #DIV/0! transcript7726 Q15293 RCN1 #DIV/0! transcript89200 Q9NTJ3 SMC4 #DIV/0! transcript9545 E7EP00 SEC24C #DIV/0! transcript8921 J3QR07 YTHDC1 #DIV/0! transcript9612 F5GWX5 CHD4 #DIV/0! transcript8967 Q8IWA4 MFN1 #DIV/0! transcript9675 P51812 RPS6KA3 #DIV/0! transcript9050 Q7KZ85 SUPT6H #DIV/0! transcript97913 O75608 LYPLA1 #DIV/0!

! 76! transcript9079 G3V5R9 KLC1 #DIV/0! transcript9494 Q9UIG0 BAZ1B #DIV/0! transcript91017 O43252 PAPSS1 #DIV/0! transcript95043 C9JWN0 ZNF638 #DIV/0! transcript91288 Q8WUM0 NUP133 #DIV/0!

transcript9492 Q6P2Q9 PRPF8 #DIV/0!

! 77!

B. Ventral Proteome

Gene Ventral/Dorsal Gene Ventral/Dorsal Protein IDs Uniprot ID Protein IDs Uniprot ID Symbol ratio Symbol ratio transcript76159 E9PCY7 HNRNPH1 2.00 transcript13320 Q7LBR1 CHMP1B 2.16 transcript15529 O75340 PDCD6 2.01 transcript10838 A8MX94 GSTP1 2.17 transcript21019 P25788 PSMA3 2.02 transcript42111 O94760 DDAH1 2.17 transcript2 P03915 MT-ND5 2.03 transcript88370 P07741 APRT 2.17 transcript9823 P14927 UQCRB 2.03 transcript4352 O43670 ZNF207 2.19 transcript7282 P62750 RPL23A 2.03 transcript8074 P04406 GAPDH 2.19 transcript75762 P48509 CD151 2.05 transcript91990 Q9NZ45 CISD1 2.19 transcript20161 Q9Y230 RUVBL2 2.06 transcript9725 P06748 NPM1 2.20 transcript19308 O14548 COX7A2L 2.06 transcript75517 P56537 EIF6 2.20 transcript10016 P49721 PSMB2 2.07 transcript5051 P50402 EMD 2.21 transcript15428 P63010 AP2B1 2.07 transcript21796 Q9BRK5 SDF4 2.23 transcript15978 O43772 SLC25A20 2.08 transcript52793 P47804 RGR 2.23 transcript15095 Q3KQV9 UAP1L1 2.08 ! transcript11443 P45880 VDAC2 2.23 transcript17679 A8K7Q2 HSPA8 2.08 transcript6482 P62241 RPS8 2.24 transcript29760 Q9UP95 SLC12A4 2.09 transcript86846 J3KPM8 COX6B1 2.24 transcript12134 Q93088 BHMT 2.11 transcript3633 O95470 SGPL1 2.25 transcript6275 P62917 RPL8 2.12 transcript14027 P17050 NAGA 2.26 transcript78741 Q92896 GLG1 2.12 transcript17278 P28845 HSD11B1 2.27 transcript7336 Q5VU58 TPM3 2.12 transcript23013 Q92520 FAM3C 2.27 transcript7057 P13667 PDIA4 2.14 transcript12327 O95292 VAPB 2.27 transcript13966 O60664 PLIN3 2.14 transcript94638 P30049 ATP5D 2.28 transcript26287 P62308 SNRPG 2.14 transcript42810 P54652 HSPA2 2.28 transcript87371 P63151 PPP2R2A 2.15 transcript21255 P29558 RBMS1 2.28 transcript21540 Q9H7Z7 PTGES2 2.15 transcript6680 Q86UP2 KTN1 2.28 transcript34299 Q8NI22 MCFD2 2.16 transcript43234 P11055 MYH3 2.28

! 78! transcript6280 Q96AE4 FUBP1 2.29 transcript61210 Q9NUI1 DECR2 2.54 transcript20628 Q9UM22 EPDR1 2.29 transcript9247 P06576 ATP5B 2.55 transcript84265 P63000 RAC1 2.30 transcript7287 P61026 RAB10 2.56 transcript59088 F8W6E4 GPD2 2.30 transcript24721 O60313 OPA1 2.56 transcript25788 Q9HCC0 MCCC2 2.30 transcript18236 Q969S3 ZNF622 2.57 transcript18356 Q96NR8 RDH12 2.32 transcript5763 Q96JJ7 TMX3 2.57 transcript12887 Q14696 MESDC2 2.32 transcript4786 P02545 LMNA 2.57 transcript84007 P41567 EIF1 2.34 transcript7067 Q9UJU6 DBNL 2.57 transcript27529 P62306 SNRPF 2.36 transcript11144 Q8IXB1 DNAJC10 2.58 transcript19539 P08574 CYC1 2.36 transcript6701 P84085 ARF5 2.58 transcript11199 Q7L5D6 GET4 2.37 transcript29920 P55854 SUMO3 2.59 transcript76097 O14672 ADAM10 2.37 transcript80576 P08962 CD63 2.61 transcript25568 P40126 DCT 2.38 transcript6186 P62158 CALM1 2.62 transcript82923 Q86VM6 MBNL1 2.39 transcript25261 O15127 SCAMP2 2.66 transcript11477 P17931 LGALS3 2.40 transcript67053 O75880 SCO1 2.66 transcript84781 Q15185 PTGES3 2.40 transcript15444 Q15005 SPCS2 2.66 transcript12002 Q9UBI6 GNG12 2.40 transcript21954 Q8WVT3 TRAPPC12 2.67 transcript3023 P07437 TUBB 2.40 transcript3882 P23246 SFPQ 2.70 transcript68951 P0C0S8 HIST1H2AG 2.42 transcript846 O75400 PRPF40A 2.72 transcript7233 P21291 CSRP1 2.44 transcript10397 F5H698 LARS 2.72 transcript6515 O14745 SLC9A3R1 2.46 transcript76198 Q6UYC3 LMNA 2.72 transcript9430 Q9NTJ5 SACM1L 2.48 transcript10006 P35610 SOAT1 2.73 transcript21249 Q9BWJ5 SF3B5 2.48 transcript9522 P32969 RPL9 2.73 transcript381 P05023 ATP1A1 2.49 transcript15742 O14950 MYL12B 2.73 transcript15700 P10768 ESD 2.50 transcript9754 Q13242 SRSF9 2.73 transcript46584 H7BYY1 TPM1 2.51 transcript4728 Q5W0H4 TPT1 2.75 transcript78931 P62995 TRA2B 2.53 transcript7574 P60953 CDC42 2.76 transcript9215 P07203 GPX1 2.53 transcript7255 O43374 RASA4 2.77 transcript22112 O00151 PDLIM1 2.78 transcript15844 Q56VL3 OCIAD2 3.16 transcript6838 P26583 HMGB2 2.79 transcript19604 P49257 LMAN1 3.26

! 79! transcript56511 Q5T8M7 ACTA1 2.83 transcript14778 O00115 DNASE2 3.26 transcript25770 Q8IUH3 RBM45 2.85 transcript8425 B8ZZL6 CAPG 3.28 transcript18372 F8VU51 YLPM1 2.85 transcript6717 P08727 KRT19 3.29 transcript6289 P07858 CTSB 2.85 transcript20255 P49207 RPL34 3.30 transcript36074 O60739 EIF1B 2.86 transcript4946 P17643 TYRP1 3.33 transcript9007 Q9Y3B3 TMED7 2.87 transcript10005 P48047 ATP5O 3.34 transcript9045 Q9UGP8 SEC63 2.87 transcript10004 Q9BR76 CORO1B 3.36 transcript20019 P32121 ARRB2 2.87 transcript7207 P16615 ATP2A2 3.36 transcript7817 B7Z7N0 ECHDC2 2.89 transcript22714 P05976 MYL1 3.39 transcript5390 P62140 PPP1CB 2.90 transcript9622 O15498 YKT6 3.39 transcript88338 Q03135 CAV1 2.94 transcript9252 P43034 PAFAH1B1 3.42 transcript18085 P24539 ATP5F1 2.95 transcript9860 O43678 NDUFA2 3.43 transcript13083 Q13442 PDAP1 2.98 transcript78060 Q9NYL4 FKBP11 3.43 transcript11433 F5H774 RTN3 2.98 transcript21333 P61019 RAB2A 3.48 transcript82532 P48729 CSNK1A1 3.01 transcript15578 Q16647 PTGIS 3.49 transcript7430 P07711 CTSL1 3.01 transcript20924 P68032 ACTC1 3.51 transcript11623 Q9HCD5 NCOA5 3.06 transcript43974 H9KV75 ACTN1 3.56 transcript8810 Q15121 PEA15 3.08 transcript9110 Q9NR31 SAR1A 3.57 transcript11939 Q9BY43 CHMP4A 3.09 transcript5890 Q15233 NONO 3.58 transcript18327 P62857 RPS28 3.11 transcript8531 O00264 PGRMC1 3.64 transcript25291 Q9H3N1 TMX1 3.11 transcript7156 Q9BW60 ELOVL1 3.68 transcript13542 Q8WXF1 PSPC1 3.11 transcript12062 P28330 ACADL 3.69 transcript54111 Q9HCE1 MOV10 3.12 transcript16999 Q9UIQ6 LNPEP 3.72 transcript12913 P25705 ATP5A1 3.14 transcript32218 Q9HCU5 PREB 3.72 transcript19290 Q9H2J4 PDCL3 3.14 transcript83826 Q01518 CAP1 3.73 transcript17023 Q92804 TAF15 3.16 transcript10775 P04040 CAT 3.74 transcript17118 P51149 RAB7A 3.78 transcript90349 F5H0X8 PDLIM5 4.34 transcript14152 P33947 KDELR2 3.78 transcript12224 P12883 MYH7 4.36 transcript11067 Q9NZ08 ERAP1 3.79 transcript10370 G3V2B8 MTHFD1 4.55 transcript92752 F8WA83 PDIA6 3.81 transcript21940 Q16778 HIST2H2BE 4.55

! 80! transcript9257 O60637 TSPAN3 3.83 transcript9723 Q15041 ARL6IP1 4.61 transcript13374 P05783 KRT18 3.84 transcript11163 P58546 MTPN 4.63 transcript5314 P52272 HNRNPM 3.85 transcript358 P16401 HIST1H1B 4.64 transcript101114 O15260 SURF4 3.86 transcript10115 Q14847 LASP1 4.75 transcript12717 P61081 UBE2M 3.86 transcript20128 Q15819 UBE2V2 4.84 transcript13993 P68104 EEF1A1 3.87 transcript7064 P24844 MYL9 4.87 transcript13165 P29350 PTPN6 3.88 transcript9141 Q06830 PRDX1 4.89 transcript20544 P30042 C21orf33 3.89 transcript14682 P61313 RPL15 5.05 transcript8588 Q9NVJ2 ARL8B 3.93 transcript17851 Q9Y5L4 TIMM13 5.13 transcript23185 E7EWR4 CSTF2 4.00 transcript18282 Q13596 SNX1 5.14 transcript15760 Q9H8Y8 GORASP2 4.04 transcript16906 P48681 NES 5.25 transcript4892 Q5BKZ1 ZNF326 4.06 transcript69805 P63261 ACTG1 5.29 transcript12293 P35222 CTNNB1 4.10 transcript18407 P84098 RPL19 5.34 transcript63850 H3BN54 MYLPF 4.10 transcript14737 Q86V81 ALYREF 5.35 transcript12451 P09525 ANXA4 4.13 transcript7505 P08670 VIM 5.36 transcript7422 F5H1Z9 CALD1 4.17 transcript8782 J3KQN4 RPL36A 5.37 transcript13762 P61009 SPCS3 4.17 transcript10366 P06732 CKM 5.39 transcript23940 P20700 LMNB1 4.18 transcript11826 P43307 SSR1 5.41 transcript3025 P68371 TUBB4B 4.19 transcript81665 O96008 TOMM40 5.45 transcript17964 Q9GZZ1 NAA50 4.20 transcript7284 F8VXB4 KRT8 5.46 transcript10197 Q9NX63 CHCHD3 4.21 transcript90392 P15586 GNS 5.55 transcript40110 H7BXI1 ESYT2 4.27 transcript29645 B3KY17 ATP2A1 5.57 transcript12550 Q9NRW7 VPS45 4.27 transcript36120 P10916 MYL2 5.68 transcript85891 Q9BZE4 GTPBP4 4.28 transcript12912 P84077 ARF1 5.73 transcript13136 Q15417 CNN3 5.76 transcript19307 Q9BQA9 C17orf62 11.47 transcript10837 P09211 GSTP1 5.91 transcript14168 P09493 TPM1 12.19 transcript7882 G5EA30 CELF1 5.93 transcript7182 P84103 SRSF3 12.59 transcript11489 P67809 YBX1 5.95 transcript4942 Q15149 PLEC 13.02 transcript22744 Q9Y266 NUDC 6.01 transcript82838 P62280 RPS11 13.31 transcript80263 Q15056 EIF4H 6.07 transcript18139 P28074 PSMB5 14.20

! 81! transcript15400 Q9H8H3 METTL7A 6.18 transcript6040 P29966 MARCKS 14.76 transcript82659 J3QL05 SRSF2 6.20 transcript10913 O15355 PPM1G 14.97 transcript13914 A8K5V8 SLTM 6.31 transcript8570 Q8WX93 PALLD 15.80 transcript21 Q8NC51 SERBP1 6.42 transcript8202 Q9UKY7 CDV3 15.82 transcript10546 Q9HB40 SCPEP1 6.47 transcript8267 P49755 TMED10 16.42 transcript8305 P62913 RPL11 6.62 transcript758 P60709 ACTB 16.81 transcript16525 H7BXD5 GCA 6.66 transcript4573 E7ENY8 COL3A1 17.33 transcript18015 P46459 NSF 6.71 transcript15366 P46782 RPS5 17.44 transcript79621 P61586 RHOA 6.95 transcript13482 P04632 CAPNS1 18.17 transcript81889 O43399 TPD52L2 7.21 transcript10528 Q6FI81 CIAPIN1 20.17 transcript12549 P61106 RAB14 7.25 transcript11758 P15311 EZR 20.54 transcript8780 O15217 GSTA4 7.25 transcript8399 P55327 TPD52 22.84 transcript26299 Q8IVL5 LEPREL1 7.58 transcript32077 Q04695 KRT17 25.69 transcript11150 O75396 SEC22B 7.82 transcript5697 Q96I24 FUBP3 28.77 transcript8395 P59998 ARPC4 8.03 transcript12689 Q9NR12 PDLIM7 30.20 transcript8734 P23284 PPIB 8.66 transcript44190 P49674 CSNK1E 30.64 transcript16573 Q9Y2D5 AKAP2 9.05 transcript8429 Q14240 EIF4A2 31.22 transcript15362 O75319 DUSP11 9.35 transcript40891 P55212 CASP6 33.50 transcript227 P16402 HIST1H1D 9.87 transcript9946 Q15363 TMED2 33.75 transcript83835 Q96PK6 RBM14 10.16 transcript10012 P04179 SOD2 35.10 transcript18728 Q9UJW0 DCTN4 10.21 transcript9947 P20340 RAB6A 36.19 transcript23932 Q5T9B7 AK1 10.22 transcript16254 P61224 RAP1B 36.76 transcript14184 A8MTH6 SRI 38.15 transcript12381 P18846 ATF1 #DIV/0! transcript15411 P47985 UQCRFS1 43.20 transcript12469 Q9NR50 EIF2B3 #DIV/0! transcript18 P45452 MMP13 55.98 transcript12627 Q8N5K1 CISD2 #DIV/0! transcript4487 P15924 DSP 59.81 transcript12696 O14974 PPP1R12A #DIV/0! transcript7029 P61254 RPL26 153.77 transcript12706 P54922 ADPRH #DIV/0! transcript10062 P50461 CSRP3 #DIV/0! transcript12707 H0YEX5 SF3B2 #DIV/0! transcript10122 Q12792 TWF1 #DIV/0! transcript13160 G3XAN8 TIMM8B #DIV/0! transcript10184 Q9BZK7 TBL1XR1 #DIV/0! transcript13205 P42785 PRCP #DIV/0!

! 82! transcript103015 Q9ULD9 ZNF608 #DIV/0! transcript13316 Q6ZVM7 TOM1L2 #DIV/0! transcript10323 Q9NYP7 ELOVL5 #DIV/0! transcript13418 O95861 BPNT1 #DIV/0! transcript103286 Q8N335 GPD1L #DIV/0! transcript13423 Q9H4G0 EPB41L1 #DIV/0! transcript103573 E9PR44 CRYAB #DIV/0! transcript13536 Q9BW91 NUDT9 #DIV/0! transcript104166 G3V1S9 ACSL6 #DIV/0! transcript13539 P51114 FXR1 #DIV/0! transcript10440 Q8WUM9 SLC20A1 #DIV/0! transcript13682 Q9GZT6 CCDC90B #DIV/0! transcript10593 Q9NY27 PPP4R2 #DIV/0! transcript13730 O75251 NDUFS7 #DIV/0! transcript10689 Q13823 GNL2 #DIV/0! transcript13764 O60684 KPNA6 #DIV/0! transcript10861 Q8WVX9 FAR1 #DIV/0! transcript13802 Q96C01 FAM136A #DIV/0! transcript11015 H7C456 MAP4 #DIV/0! transcript13988 O60784 TOM1 #DIV/0! transcript11042 Q02750 MAP2K1 #DIV/0! transcript14036 O76031 CLPX #DIV/0! transcript11366 Q5EBL4 RILPL1 #DIV/0! transcript14457 P82979 SARNP #DIV/0! transcript11562 P40855 PEX19 #DIV/0! transcript14673 F2Z394 LDB3 #DIV/0! transcript11746 F5GX05 EPB41L3 #DIV/0! transcript14753 Q9Y3D8 TAF9 #DIV/0! transcript11835 Q9P0K7 RAI14 #DIV/0! transcript14931 O95400 CD2BP2 #DIV/0! transcript119172 Q8NBJ5 GLT25D1 #DIV/0! transcript15268 Q9H0G5 NSRP1 #DIV/0! transcript12216 Q5VUA4 ZNF318 #DIV/0! transcript15348 Q5JVS0 HABP4 #DIV/0! transcript12258 P43235 CTSK #DIV/0! transcript15485 P35611 ADD1 #DIV/0! transcript12304 Q86SQ0 PHLDB2 #DIV/0! transcript15553 Q99426 TBCB #DIV/0! transcript12333 P52815 MRPL12 #DIV/0! transcript15645 P82909 MRPS36 #DIV/0! transcript15808 Q9Y3B8 REXO2 #DIV/0! transcript19926 Q8TBX8 PIP4K2C #DIV/0! transcript15935 B7Z3I9 ALAD #DIV/0! transcript20535 O43684 BUB3 #DIV/0! transcript15987 P25685 DNAJB1 #DIV/0! transcript20983 Q9BXI3 NT5C1A #DIV/0! transcript16098 Q00169 PITPNA #DIV/0! transcript21265 Q9BZL1 UBL5 #DIV/0! transcript16283 Q4G0F5 VPS26B #DIV/0! transcript21286 Q8NFH3 NUP43 #DIV/0! transcript16366 Q9H2G2 SLK #DIV/0! transcript21446 O43768 ENSA #DIV/0! transcript16575 Q8IWS0 PHF6 #DIV/0! transcript21449 O75600 GCAT #DIV/0! transcript16811 O43583 DENR #DIV/0! transcript21759 P51911 CNN1 #DIV/0! transcript17130 Q9NVZ3 NECAP2 #DIV/0! transcript21920 Q96FW1 OTUB1 #DIV/0! transcript17145 Q08379 GOLGA2 #DIV/0! transcript23033 O14964 HGS #DIV/0!

! 83! transcript17155 Q9NRR5 UBQLN4 #DIV/0! transcript23070 H7BZ59 SCAMP4 #DIV/0! transcript17214 Q14012 CAMK1 #DIV/0! transcript24147 Q9BV38 WDR18 #DIV/0! transcript17490 Q9Y6A5 TACC3 #DIV/0! transcript24299 E7EWE1 UBA5 #DIV/0! transcript17606 O14929 HAT1 #DIV/0! transcript24524 Q15428 SF3A2 #DIV/0! transcript17711 Q8WW12 PCNP #DIV/0! transcript24525 B7Z3I5 EVL #DIV/0! transcript17913 P50479 PDLIM4 #DIV/0! transcript24653 P17661 DES #DIV/0! transcript18028 Q14566 MCM6 #DIV/0! transcript24945 Q9NS91 RAD18 #DIV/0! transcript18208 Q9NP79 VTA1 #DIV/0! transcript25111 Q63ZY4 ATXN2L #DIV/0! transcript18235 P12829 MYL4 #DIV/0! transcript25370 Q6T310 RASL11A #DIV/0! transcript18254 Q16718 NDUFA5 #DIV/0! transcript25429 Q96CS3 FAF2 #DIV/0! transcript18529 P35250 RFC2 #DIV/0! transcript25513 Q9UI08 EVL #DIV/0! transcript18575 Q9UNS2 COPS3 #DIV/0! transcript25694 O60613 SEP15 #DIV/0! transcript18744 Q9UKX7 NUP50 #DIV/0! transcript25914 P12236 SLC25A6 #DIV/0! transcript18769 B4E135 LIG1 #DIV/0! transcript27435 P19388 POLR2E #DIV/0! transcript18934 P08397 HMBS #DIV/0! transcript27670 Q9BV40 VAMP8 #DIV/0! transcript18989 E9PC74 EIF2B5 #DIV/0! transcript27991 F5H5E4 BCAT1 #DIV/0! transcript19560 P51397 DAP #DIV/0! transcript28005 Q5TDH0 DDI2 #DIV/0! transcript19697 P41236 PPP1R2 #DIV/0! transcript28031 Q9BXM0 PRX #DIV/0! transcript28255 P09234 SNRPC #DIV/0! transcript51029 E7EMH5 PDXDC1 #DIV/0! transcript28738 P49069 CAMLG #DIV/0! transcript5232 Q9UBR2 CTSZ #DIV/0! transcript28861 Q6UW63 KDELC1 #DIV/0! transcript56276 O43251 RBFOX2 #DIV/0! transcript28879 Q9NR28 DIABLO #DIV/0! transcript5753 G8JLK4 TACC1 #DIV/0! transcript28905 P52292 KPNA2 #DIV/0! transcript5913 B1AMS2 SEPT6 #DIV/0! transcript29558 O94925 GLS #DIV/0! transcript6021 P52943 CRIP2 #DIV/0! transcript29844 O75781 PALM #DIV/0! transcript6071 Q02952 AKAP12 #DIV/0! transcript30102 P20933 AGA #DIV/0! transcript63351 B3KSY4 CORO7 #DIV/0! transcript32790 F5H1H4 TNNT1 #DIV/0! transcript65157 Q6P2E9 EDC4 #DIV/0! transcript34447 E9PJT3 SF3B2 #DIV/0! transcript67022 Q9BTL3 FAM103A1 #DIV/0! transcript34733 Q9P0L0 VAPA #DIV/0! transcript67971 E7EP11 HSPA1A #DIV/0! transcript35238 Q9Y6N7 ROBO1 #DIV/0! transcript6893 P50238 CRIP1 #DIV/0!

! 84! transcript35498 Q9NZI8 IGF2BP1 #DIV/0! transcript7006 O43491 EPB41L2 #DIV/0! transcript38731 O95453 PARN #DIV/0! transcript7100 P16035 TIMP2 #DIV/0! transcript4175 J3KTA4 DDX5 #DIV/0! transcript7423 P07585 DCN #DIV/0! transcript42635 E9PQP6 FNTA #DIV/0! transcript74636 Q13148 TARDBP #DIV/0! transcript43015 Q9Y697 NFS1 #DIV/0! transcript75320 Q8WUP2 FBLIM1 #DIV/0! transcript43157 P02585 TNNC2 #DIV/0! transcript7551 Q14978 NOLC1 #DIV/0! transcript43358 F6TH84 BAG6 #DIV/0! transcript7593 Q9Y6F1 PARP3 #DIV/0! transcript44271 Q8IX04 UEVLD #DIV/0! transcript77352 E7EN95 FLNB #DIV/0! transcript45095 Q5W1B0 CREM #DIV/0! transcript77965 Q15773 MLF2 #DIV/0! transcript45591 Q9UMS6 SYNPO2 #DIV/0! transcript7830 Q9Y3Y2 CHTOP #DIV/0! transcript4575 P02452 COL1A1 #DIV/0! transcript78406 P23634 ATP2B4 #DIV/0! transcript46355 Q9UBY9 HSPB7 #DIV/0! transcript80279 O95721 SNAP29 #DIV/0! transcript46603 E9PDM3 SLC6A6 #DIV/0! transcript8057 Q99447 PCYT2 #DIV/0! transcript46639 Q9Y4K4 MAP4K5 #DIV/0! transcript8085 P63165 SUMO1 #DIV/0! transcript46842 C9JYJ6 FILIP1L #DIV/0! transcript80903 Q14157 UBAP2L #DIV/0! transcript48887 P55809 OXCT1 #DIV/0! transcript81303 O75897 SULT1C4 #DIV/0! transcript8194 Q27J81 INF2 #DIV/0! transcript9985 P63316 TNNC1 #DIV/0! transcript82127 F8VZ45 RPL6 #DIV/0! transcript11038 P98082 DAB2 #DIV/0! transcript8256 P47914 RPL29 #DIV/0! transcript13391 Q5JSZ5 PRRC2B #DIV/0! transcript82570 Q5VZF2 MBNL2 #DIV/0! transcript14256 Q96FQ6 S100A16 #DIV/0! transcript82835 P08590 MYL3 #DIV/0! transcript15859 P49790 NUP153 #DIV/0! transcript82869 Q8N6T3 ARFGAP1 #DIV/0! transcript16605 Q5JRX3 PITRM1 #DIV/0! transcript83020 Q9H0E2 TOLLIP #DIV/0! transcript29274 E9PF10 NUP155 #DIV/0! transcript84612 P61011 SRP54 #DIV/0! transcript37829 O00499 BIN1 #DIV/0! transcript85085 Q9UL40 ZNF346 #DIV/0! transcript4211 Q12904 AIMP1 #DIV/0! transcript8512 J3KP58 CLIP1 #DIV/0! transcript5702 O43852 CALU #DIV/0! transcript85292 P62891 RPL39 #DIV/0! transcript6191 O95425 SVIL #DIV/0! transcript85597 I3L4N6 SLC12A4 #DIV/0! transcript7806 Q14247 CTTN #DIV/0! transcript8573 P68106 FKBP1B #DIV/0! transcript8016 Q14152 EIF3A #DIV/0! transcript8652 Q24JQ7 ATXN2 #DIV/0! transcript80656 G5E9Q2 CSDE1 #DIV/0!

! 85! transcript8686 Q86YP4 GATAD2A #DIV/0! transcript93890! P09661! SNRPA1! #DIV/0!! transcript88524 Q14694 USP10 #DIV/0! transcript9575! Q13137! CALCOCO2! #DIV/0!! transcript8905 P46379 BAG6 #DIV/0! transcript95880! Q92522! H1FX! #DIV/0!! transcript90352 F5H7Y0 PDLIM5 #DIV/0! transcript9667! O60884! DNAJA2! #DIV/0!! transcript9101 Q8ND56 LSM14A #DIV/0! transcript9683! Q9UMY4! SNX12! #DIV/0!! transcript9169 Q5FVE4 ACSBG2 #DIV/0! transcript9748! P10644! PRKAR1A! #DIV/0!! transcript93707 Q96IZ0 PAWR #DIV/0! transcript9851! P54578! USP14! #DIV/0!! !

! 86!