DOCSLIB.ORG

Adipose Liver Muscle Brain

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Adipose Liver 30 8 25 6 20 LOD 15 LOD 4 10 2 5 0 0 1 2 3 4 5 6 7 8 9 10111213141516171819X 1 2 3 4 5 6 7 8 9 10111213141516171819X Chromosome Chromosome Muscle Brain 60 30 50 40 20 LOD LOD 30 20 10 10 0 0 1 2 3 4 5 6 7 8 9 10111213141516171819X 1 2 3 4 5 6 7 8 9 10111213141516171819X Chromosome Chromosome Supplementary Figure 1. Bicc1 eQTL plots in adipose, liver, muscle and brain tissue from the BXH F2 cross. Bicc1+/+ Males A B C Bicc1+/jcpk Males 50 50 120 0 0 4 4 100 jcpk / + 80 30 30 Bicc1 60 0 0 Weight (g) 2 2 Adiposity (%) 40 Percent of 0 0 1 1 20 0 0 0 P K Cl Ca Na BUN Albumin Supplementary Figure 2. Body weight (A), adiposity (B) and markers of kidney function (C) in 28 week-old Bicc1+/jcpk and Bicc1+/+ male mice. Data presented are means + standard errors. None of the measurements in Bicc1+/jcpk differ statistically from Bicc1+/+ mice. Supplementary Figure 3. Bicc1 expression levels across 96 different mouse tissues and cell-types. Micoarray data are from N=2/tisssue cell-type. Data for three different microarray probe sets are presented. Images were downloaded from www.biogps.org. Supplementary Figure 4. Pkd2 expression levels across 96 different mouse tissues and cell-types. Micoarray data are from N=2/tisssue cell-type.Data for three different microarray probe sets are presented. Images were downloaded from www.biogps.org. Empty PKD2 Vector PKD2 Pkd2_1 siRNA Pkd2_1 SC siRNA PKD2 ACTIN ACTIN 100 250 80 200 60 150 40 100 PKD2/ACTIN PKD2/ACTIN 20 50 0 0 Pkd2 SC siRNA Pkd2_1 siRNA Emphty Vector Supplementary Figure 5. Quantification of Pkd2 protein levels. PKD2 levels are reduced by ~20% by the Pkd2_1 siRNA and increased by ~260% by overexpressing Pkd2. Blot in the top left shows PKD2 and ACTIN levels in osteoblats 48 hours after transfection with Pkd2_1 or scrambled control (SC). Sample were run on the same gel but not in contigious lanes. Barchart in bottom left provides quantification of PKD2 from two seperate blots. Top right blot demonstrates an increase in PKD2 levels upon Pkd2 overexpression in osteoblasts. Bottom right provides quantification of band densities (N=3). Supplementary Figure 6. VISTA genome comparison plot for human BICC1. Shown is the ~15 Kbp region surrounding rs10740740 which is associated >50% Base genome: Human Feb. 2009 Chromosome: chr10 60,372,850-60,392,050 BICC1 100% Calc. Window: 100 bp Cons. Width: 100 bp Cons. Identity: 70% 50% 100% Calc. Window: 100 bp Cons. Width: 100 bp Cons. Identity: 70% 50% 60,372.88k 60,373.38k 60,373.88k 60,374.38k 60,374.88k 60,375.38k 60,375.88k 60,376.38k 60,376.88k 60,377.38k Annotations: BICC1 Gene UTR Exon CNS Repeats: 100% LINE RNA LTR DNA SINE Other 50% SNPs: SNP 100% Contigs: Contig Overlap 50% 60,377.68k 60,378.18k 60,378.68k 60,379.18k 60,379.68k 60,380.18k 60,380.68k 60,381.18k 60,381.68k 60,382.18k 1. Mouse Jul. 2007 (SLAGAN) 2. Mouse Jul. 2007 (SLAGAN) page 1 of 2 Base genome: Human Feb. 2009 Chromosome: chr10 60,372,850-60,392,050 BICC1 100% Calc. Window: 100 bp Location of rs10740740 Cons. Width: 100 bp Cons. Identity: 70% 50% 100% Calc. Window: 100 bp Cons. Width: 100 bp Cons. Identity: 70% 50% 60,382.48k 60,382.98k 60,383.48k 60,383.98k 60,384.48k 60,384.98k 60,385.48k 60,385.98k 60,386.48k 60,386.98k Annotations: BICC1 Gene UTR Exon CNS Repeats: 100% LINE RNA LTR DNA SINE Other 50% SNPs: SNP 100% Contigs: Contig Overlap 50% 60,387.28k 60,387.78k 60,388.28k 60,388.78k 60,389.28k 60,389.78k 60,390.28k 60,390.78k 60,391.28k 60,391.78k 1. Mouse Jul. 2007 (SLAGAN) 2. Mouse Jul. 2007 (SLAGAN) page 2 of 2 Supplementary Table 1. M6 genes. ProbesetID TargetId Gene Description Chr Mb GeneId Module ME6 ILM102850603 scl24190.1_328-S Nfib nuclear factor I/B 4 81.936287 18028 6 0.903329275 ILM2260440 scl0226154.4_125-S Lzts2 leucine zipper, putative tumor suppressor 2 19 45.101336 226154 6 0.896270055 ILM3440373 scl31155.10_11-S Mfge8 milk fat globule-EGF factor 8 protein 7 86.278779 17304 6 0.890811618 ILM3170605 scl054324.3_167-S Arhgef5 Rho guanine nucleotide exchange factor (GEF) 5 6 43.2391 54324 6 0.890623985 ILM4670390 scl27505.17_595-S Pkd2 polycystic kidney disease 2 5 104.934692 18764 6 0.88414764 ILM4920184 scl016779.32_71-S Lamb2 laminin, beta 2 9 108.392456 16779 6 0.882162484 ILM2190333 scl00101476.1_284-S Plekha1 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 7 138.056746 101476 6 0.880910004 ILM5720450 scl0056490.1_199-S Zbtb20 zinc finger and BTB domain containing 20 (hippocampus expression signature) 16 43.619062 56490 6 0.877503114 ILM4730025 scl16146.28_80-S Lamc1 laminin, gamma 1 1 155.066119 226519 6 0.875219135 ILM4150609 scl32699.8.1_168-S Rras Harvey rat sarcoma oncogene, subgroup R 7 52.276834 20130 6 0.871688809 ILM1340736 scl52829.1_29-S B3gnt6 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase) 19 5.041059 272411 6 0.871439639 ILM6940139 scl42950.10.1_98-S 1700019E19Rik RIKEN cDNA 1700019E19 gene 12 87.503225 76411 6 0.870468312 ILM102340605 ri|5330439J01|PX00054P19|AK077362|1511-S Sobp sine oculis-binding protein homolog (Drosophila) 10 42.722966 109205 6 0.869071715 ILM1570040 scl47452.3.1_39-S Hoxc9 homeo box C9 15 102.814804 15427 6 0.866767521 ILM101190039 scl072190.1_208-S 2510009E07Rik RIKEN cDNA 2510009E07 gene 16 21.649254 72190 6 0.865834215 ILM2510687 scl0015530.1_184-S Hspg2 perlecan (heparan sulfate proteoglycan 2) 4 137.126406 15530 6 0.865028439 ILM4780068 scl00269549.2_19-S Nfib nuclear factor I/B 4 81.937262 18028 6 0.863694579 ILM2260082 scl22869.17.1_4-S Mtmr11 myotubularin related protein 11 3 95.975134 194126 6 0.862988557 ILM3850468 GI_47564089-S BC054438 cDNA sequence BC054438 17 24.785426 407831 6 0.860384914 ILM5910735 scl056149.9_314-S Grasp GRP1 (general receptor for phosphoinositides 1)-associated scaffold protein 15 101.063103 56149 6 0.859725245 ILM103850093 ri|4832408C21|PX00313I10|AK029270|3164-S Tshz2 teashirt zinc finger family member 2 2 169.598584 228911 6 0.858523219 ILM103450497 scl0269878.14_318-S Megf8 multiple EGF-like-domains 8 7 26.150862 269878 6 0.85817318 ILM6270528 scl33150.17.997_2-S Itgb1 integrin beta 1 (fibronectin receptor beta) 8 131.619177 16412 6 0.855744008 ILM1660546 scl36349.9.1_1-S Acvr2b activin receptor IIB 9 119.342486 11481 6 0.854106412 ILM5670577 scl54747.23_352-S Dlg3 discs, large homolog 3 (synapse-associated protein 102 kD) X 98.013613 53310 6 0.853082292 ILM102120129 scl5468.1.1_137-S 2900009C16Rik RIKEN cDNA 2900009C16 gene 10 42.722325 78400 6 0.852240847 ILM3140632 scl0320398.3_8-S Lrig3 leucine-rich repeats and immunoglobulin-like domains 3 10 125.451997 320398 6 0.852212397 ILM102340008 scl47449.2_635-S Hoxc8 homeo box C8 15 102.824421 15426 6 0.85090067 ILM3140368 scl49330.22.4_270-S Chrd chordin 16 20.742354 12667 6 0.848514294 ILM106450452 scl0240024.1_128-S Mllt4 myeloid/lymphoid or mixed lineage-leukemia translocation to 4 homolog (Drosophila) 17 14.042536 17356 6 0.847829769 ILM3520438 scl0232237.7_170-S Fgd5 FYVE, RhoGEF and PH domain containing 5 6 92.025797 232237 6 0.846776889 ILM2470735 scl46265.10.1_16-S Nfatc4 nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4 14 56.452674 73181 6 0.841155941 ILM4230577 scl36257.10_16-S Yap1 yes-associated protein 1 9 7.932283 22601 6 0.840021636 ILM3800372 scl26735.47.1_66-S Ift172 intraflagellar transport 172 homolog (Chlamydomonas) 5 31.555655 67661 6 0.839742217 ILM4150113 scl37767.8_640-S Syde1 synapse defective 1, Rho GTPase, homolog 1 (C. elegans) 10 78.047346 71709 6 0.839353584 ILM1740575 scl35102.50_84-S Col4a1 procollagen, type IV, alpha 1 8 11.19879 12826 6 0.838760355 ILM6020095 scl0018590.2_128-S Pdgfa platelet derived growth factor, alpha 5 139.453135 18590 6 0.838416154 ILM4010239 scl018858.5_31-S Pmp22 peripheral myelin protein 11 62.972694 18858 6 0.837554388 ILM730136 scl32180.18_394-S Parva parvin, alpha 7 119.735062 57342 6 0.836166634 ILM1780301 scl31603.36.1_19-S Ltbp4 latent transforming growth factor beta binding protein 4 7 28.090439 108075 6 0.835554779 ILM2350619 scl34083.48_466-S Col4a2 procollagen, type IV, alpha 2 8 11.44916 12827 6 0.833537699 ILM2120280 scl37679.21_483-S Appl2 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2 10 83.06288 216190 6 0.832062188 ILM3850133 scl47450.4_93-S Hoxc6 homeo box C6 15 102.842229 15425 6 0.831880629 ILM103140541 ri|9530073A13|PX00114K21|AK035591|3548-S 9530073A13Rik RIKEN 9530073A13Rik 4 58.5338 6 0.828164891 ILM103840048 scl072844.1_278-S Kctd17 potassium channel tetramerisation domain containing 17 15 78.26961 72844 6 0.82783152 ILM6940593 scl39881.7_182-S Tnfaip1 tumor necrosis factor, alpha-induced protein 1 (endothelial) 11 78.336463 21927 6 0.826121987 ILM110717 scl30961.29_228-S Inppl1 inositol polyphosphate phosphatase-like 1 7 108.971251 16332 6 0.825627285 ILM102680592 ri|9830147J19|PX00118J13|AK036665|3837-S Smad1 MAD homolog 1 (Drosophila) 8 81.871514 17125 6 0.825285898 ILM100110338 ri|C230060D01|PX00176G21|AK048773|3746-S Kcnma1 potassium large conductance calcium-activated channel, subfamily M, alpha member 1 14 24.242905 16531 6 0.824793611 ILM2480427 scl017260.8_51-S Mef2c myocyte enhancer factor 2C 13 83.802727 17260 6 0.823783795 ILM100360300 scl39327.21_224-S Caskin2 cask-interacting protein 2 11 115.660594 140721 6 0.821286181 ILM460053 scl35355.5_339-S Dag1 dystroglycan 1 9 108.108334 13138 6 0.820987366 ILM106510204 scl073159.1_61-S Dchs1 dachsous 1 (Drosophila) 7 112.901774 233651 6 0.820951159 ILM940075 scl00269593.1_72-S Luzp1 leucine zipper protein 1 4 136.104921 269593 6
Recommended publications
  • The Connections of Wnt Pathway Components with Cell Cycle and Centrosome: Side Effects Or a Hidden Logic?

    The Connections of Wnt Pathway Components with Cell Cycle and Centrosome: Side Effects Or a Hidden Logic?

    Critical Reviews in Biochemistry and Molecular Biology ISSN: 1040-9238 (Print) 1549-7798 (Online) Journal homepage: http://www.tandfonline.com/loi/ibmg20 The connections of Wnt pathway components with cell cycle and centrosome: side effects or a hidden logic? Vítězslav Bryja , Igor Červenka & Lukáš Čajánek To cite this article: Vítězslav Bryja , Igor Červenka & Lukáš Čajánek (2017): The connections of Wnt pathway components with cell cycle and centrosome: side effects or a hidden logic?, Critical Reviews in Biochemistry and Molecular Biology, DOI: 10.1080/10409238.2017.1350135 To link to this article: http://dx.doi.org/10.1080/10409238.2017.1350135 Published online: 25 Jul 2017. Submit your article to this journal Article views: 72 View related articles View Crossmark data Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=ibmg20 Download by: [Masarykova Univerzita v Brne], [Lukas Cajanek] Date: 08 August 2017, At: 01:58 CRITICAL REVIEWS IN BIOCHEMISTRY AND MOLECULAR BIOLOGY, 2017 https://doi.org/10.1080/10409238.2017.1350135 REVIEW ARTICLE The connections of Wnt pathway components with cell cycle and centrosome: side effects or a hidden logic? Vıtezslav Bryjaa , Igor Cervenka b and Lukas Caj anekc aDepartment of Experimental Biology, Faculty of Science, Masaryk University, Brno, Czech Republic; bMolecular and Cellular Exercise Physiology, Department of Physiology and Pharmacology, Karolinska Institutet, Stockholm, Sweden; cDepartment of Histology and Embryology, Faculty of Medicine, Masaryk University, Brno, Czech Republic ABSTRACT ARTICLE HISTORY Wnt signaling cascade has developed together with multicellularity to orchestrate the develop- Received 10 April 2017 ment and homeostasis of complex structures.
  • Next Generation Sequencing Panels for Disorders of Sex Development

    Next Generation Sequencing Panels for Disorders of Sex Development

    Next Generation Sequencing Panels for Disorders of Sex Development Disorders of Sex Development – Overview Disorders of sex development (DSDs) occur when sex development does not follow the course of typical male or female patterning. Types of DSDs include congenital development of ambiguous genitalia, disjunction between the internal and external sex anatomy, incomplete development of the sex anatomy, and abnormalities of the development of gonads (such as ovotestes or streak ovaries) (1). Sex chromosome anomalies including Turner syndrome and Klinefelter syndrome as well as sex chromosome mosaicism are also considered to be DSDs. DSDs can be caused by a wide range of genetic abnormalities (2). Determining the etiology of a patient’s DSD can assist in deciding gender assignment, provide recurrence risk information for future pregnancies, and can identify potential health problems such as adrenal crisis or gonadoblastoma (1, 3). Sex chromosome aneuploidy and copy number variation are common genetic causes of DSDs. For this reason, chromosome analysis and/or microarray analysis typically should be the first genetic analysis in the case of a patient with ambiguous genitalia or other suspected disorder of sex development. Identifying whether a patient has a 46,XY or 46,XX karyotype can also be helpful in determining appropriate additional genetic testing. Abnormal/Ambiguous Genitalia Panel Our Abnormal/Ambiguous Genitalia Panel includes mutation analysis of 72 genes associated with both syndromic and non-syndromic DSDs. This comprehensive panel evaluates a broad range of genetic causes of ambiguous or abnormal genitalia, including conditions in which abnormal genitalia are the primary physical finding as well as syndromic conditions that involve abnormal genitalia in addition to other congenital anomalies.
  • Membrane Tension Buffering by Caveolae: a Role in Cancer?

    Membrane Tension Buffering by Caveolae: a Role in Cancer?

    Cancer and Metastasis Reviews (2020) 39:505–517 https://doi.org/10.1007/s10555-020-09899-2 Membrane tension buffering by caveolae: a role in cancer? Vibha Singh1 & Christophe Lamaze1 Published online: 30 May 2020 # Springer Science+Business Media, LLC, part of Springer Nature 2020 Abstract Caveolae are bulb-like invaginations made up of two essential structural proteins, caveolin-1 and cavins, which are abundantly present at the plasma membrane of vertebrate cells. Since their discovery more than 60 years ago, the function of caveolae has been mired in controversy. The last decade has seen the characterization of new caveolae components and regulators together with the discovery of additional cellular functions that have shed new light on these enigmatic structures. Early on, caveolae and/ or caveolin-1 have been involved in the regulation of several parameters associated with cancer progression such as cell migration, metastasis, angiogenesis, or cell growth. These studies have revealed that caveolin-1 and more recently cavin-1 have a dual role with either a negative or a positive effect on most of these parameters. The recent discovery that caveolae can act as mechanosensors has sparked an array of new studies that have addressed the mechanobiology of caveolae in various cellular functions. This review summarizes the current knowledge on caveolae and their role in cancer development through their activity in membrane tension buffering. We propose that the role of caveolae in cancer has to be revisited through their response to the mechanical forces encountered by cancer cells during tumor mass development. Keywords Caveolae . Cancer . Mechanosensing . Mechanotransdcution . Membrane tension .
  • An Overview of the Role of Hdacs in Cancer Immunotherapy

    An Overview of the Role of Hdacs in Cancer Immunotherapy

    International Journal of Molecular Sciences Review Immunoepigenetics Combination Therapies: An Overview of the Role of HDACs in Cancer Immunotherapy Debarati Banik, Sara Moufarrij and Alejandro Villagra * Department of Biochemistry and Molecular Medicine, School of Medicine and Health Sciences, The George Washington University, 800 22nd St NW, Suite 8880, Washington, DC 20052, USA; [email protected] (D.B.); [email protected] (S.M.) * Correspondence: [email protected]; Tel.: +(202)-994-9547 Received: 22 March 2019; Accepted: 28 April 2019; Published: 7 May 2019 Abstract: Long-standing efforts to identify the multifaceted roles of histone deacetylase inhibitors (HDACis) have positioned these agents as promising drug candidates in combatting cancer, autoimmune, neurodegenerative, and infectious diseases. The same has also encouraged the evaluation of multiple HDACi candidates in preclinical studies in cancer and other diseases as well as the FDA-approval towards clinical use for specific agents. In this review, we have discussed how the efficacy of immunotherapy can be leveraged by combining it with HDACis. We have also included a brief overview of the classification of HDACis as well as their various roles in physiological and pathophysiological scenarios to target key cellular processes promoting the initiation, establishment, and progression of cancer. Given the critical role of the tumor microenvironment (TME) towards the outcome of anticancer therapies, we have also discussed the effect of HDACis on different components of the TME. We then have gradually progressed into examples of specific pan-HDACis, class I HDACi, and selective HDACis that either have been incorporated into clinical trials or show promising preclinical effects for future consideration.
  • Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model

    Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model

    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
  • Conformational Disruption of Pi3kδ Regulation by Immunodeficiency Mutations in PIK3CD and PIK3R1

    Conformational Disruption of Pi3kδ Regulation by Immunodeficiency Mutations in PIK3CD and PIK3R1

    Conformational disruption of PI3Kδ regulation by immunodeficiency mutations in PIK3CD and PIK3R1 Gillian L. Dornana, Braden D. Siempelkampa, Meredith L. Jenkinsa, Oscar Vadasb, Carrie L. Lucasc, and John E. Burkea,1 aDepartment of Biochemistry and Microbiology, University of Victoria, Victoria, BC, Canada V8W 2Y2; bDepartment of Pharmaceutical Chemistry, University of Geneva, CH-1211 Geneva 4, Switzerland; and cDepartment of Immunobiology, Yale University, New Haven, CT 06511 Edited by Lewis C. Cantley, Weill Cornell Medical College, New York, NY, and approved January 12, 2017 (received for review November 2, 2016) Activated PI3K Delta Syndrome (APDS) is a primary immunodefi- domain, and a bilobal kinase domain. All p85 regulatory subunits ciency disease caused by activating mutations in either the contain two SH2 domains (nSH2 and cSH2) linked by a coiled-coil leukocyte-restricted p110δ catalytic (PIK3CD) subunit or the ubiq- region referred to as the inter-SH2 domain (iSH2). The class IA uitously expressed p85α regulatory (PIK3R1) subunit of class IA p110 catalytic subunits are differentially inhibited by p85, with phosphoinositide 3-kinases (PI3Ks). There are two classes of APDS: p110α containing inhibitory contacts between the nSH2 domain of α APDS1 that arises from p110δ mutations that are analogous to p85 and the C2, helical, and kinase domains of p110 , as well as α oncogenic mutations found in the broadly expressed p110α sub- between the iSH2 domain of p85 and the C2 domain of p110 (10). Both p110β and p110δ contain an additional regulatory unit and APDS2 that occurs from a splice mutation resulting in – p85α with a central deletion (Δ434–475).
  • Table 2. Significant

    Table 2. Significant

    Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.
  • Eradication of ENO1-Deleted Glioblastoma Through Collateral Lethality

    Eradication of ENO1-Deleted Glioblastoma Through Collateral Lethality

    bioRxiv preprint doi: https://doi.org/10.1101/331538; this version posted May 25, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Eradication of ENO1-deleted Glioblastoma through Collateral Lethality Yu-Hsi Lin1, Nikunj Satani1,2, Naima Hammoudi1, Jeffrey J. Ackroyd1, Sunada Khadka1, Victoria C. Yan1, Dimitra K. Georgiou1, Yuting Sun3, Rafal Zielinski4, Theresa Tran1, Susana Castro Pando1, Xiaobo Wang1, David Maxwell5, Zhenghong Peng6, Federica Pisaneschi1, Pijus Mandal7, Paul G. Leonard8, Quanyu Xu,9 Qi Wu9, Yongying Jiang9, Barbara Czako10, Zhijun Kang10, John M. Asara11, Waldemar Priebe4, William Bornmann12, Joseph R. Marszalek3, Ronald A. DePinho13 and Florian L. Muller#1 1) Department of Cancer Systems Imaging, The University of Texas MD Anderson Cancer Center, Houston, TX 77054 2) Institute of Stroke and Cerebrovascular Disease, The University of Texas Health Science Center at Houston, TX 77030 3) Center for Co-Clinical Trials, The University of Texas MD Anderson Cancer Center, Houston, TX 77054 4) Department of Experimental Therapeutics, The University of Texas MD Anderson Cancer Center, Houston, TX 77054 5) Institutional Analytics & Informatics, The University of Texas MD Anderson Cancer Center, Houston, TX 77030 6) Cardtronics, Inc., Houston, TX 77042 7) Department of Genomic Medicine, The University of Texas MD Anderson Cancer Center, Houston, TX 77054 bioRxiv preprint doi: https://doi.org/10.1101/331538; this version posted May 25, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
  • EHD2 Is a Mechanotransducer Connecting Caveolae Dynamics with Gene Transcription

    EHD2 Is a Mechanotransducer Connecting Caveolae Dynamics with Gene Transcription

    EHD2 is a mechanotransducer connecting caveolae dynamics with gene transcription Satish Kailasam Mani, Cesar Valades-Cruz, Stéphanie Torrino, Wei-Wei Shen, Cedric Blouin, Satish Kailasam Mani, Christine Viaris de Lesegno, Pierre Bost, Alexandre Grassart, Darius Köster, et al. To cite this version: Satish Kailasam Mani, Cesar Valades-Cruz, Stéphanie Torrino, Wei-Wei Shen, Cedric Blouin, et al.. EHD2 is a mechanotransducer connecting caveolae dynamics with gene transcription. Journal of Cell Biology, Rockefeller University Press, 2018, 217 (12), pp.4092-4105. 10.1083/jcb.201801122. inserm- 02426440 HAL Id: inserm-02426440 https://www.hal.inserm.fr/inserm-02426440 Submitted on 2 Jan 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution - NonCommercial - ShareAlike| 4.0 International License REPORT EHD2 is a mechanotransducer connecting caveolae dynamics with gene transcription Stéphanie Torrino1,2,3*, Wei‑Wei Shen1,2,3*, Cédric M. Blouin1,2,3, Satish Kailasam Mani1,2,3, Christine Viaris de Lesegno1,2,3, Pierre Bost4,5, Alexandre Grassart6, Darius Köster7, Cesar Augusto Valades‑Cruz2,3,8, Valérie Chambon2,3,8, Ludger Johannes2,3,8, Paolo Pierobon9, Vassili Soumelis4, Catherine Coirault10, Stéphane Vassilopoulos10, and Christophe Lamaze1,2,3 Caveolae are small invaginated pits that function as dynamic mechanosensors to buffer tension variations at the plasma membrane.
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • DYNC1I1 (NM 001135556) Human Tagged ORF Clone Product Data

    DYNC1I1 (NM 001135556) Human Tagged ORF Clone Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC226881 DYNC1I1 (NM_001135556) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: DYNC1I1 (NM_001135556) Human Tagged ORF Clone Tag: Myc-DDK Symbol: DYNC1I1 Synonyms: DNCI1; DNCIC1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 DYNC1I1 (NM_001135556) Human Tagged ORF Clone – RC226881 ORF Nucleotide >RC226881 representing NM_001135556 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCTGACAAAAGTGACTTAAAAGCTGAGCTAGAGCGCAAAAAGCAGCGCTTAGCACAGATAAGAGAAG AGAAGAAACGGAAGGAAGAGGAGAGGAAAAAGAAAGAGGCTGATATGCAGCAGAAGAAAGAACCCGTTCA GGACGACTCTGATCTGGATCGCAAACGACGAGAGACAGAGGCTTTGCTGCAAAGCATTGGTATCTCACCG GAGCCGCCTCTAGTCCCAACCCCTATGTCTCCCTCCTCGAAATCAGTGAGCACTCCCAGTGAAGCTGGAA GCCAAGACTCAGGCGATCTGGGGCCATTAACAAGGACCCTGCAGTGGGACACAGACCCCTCAGTGCTCCA GCTGCAGTCAGACTCAGAACTTGGAAGAAGACTGCATAAACTGGGCGTGTCAAAGGTCACCCAAGTGGAT TTCCTGCCAAGGGAAGTAGTGTCCTACTCAAAGGAGACCCAGACTCCTCTTGCCACGCATCAGTCTGAAG AGGATGAGGAAGATGAGGAAATGGTGGAATCTAAAGTTGGCCAGGACTCAGAACTGGAAAATCAGGACAA AAAACAGGAAGTGAAGGAAGCCCCTCCAAGAGAGTTGACAGAGGAAGAAAAACAGCAGATCATTCATTCA
  • The Concise Guide to Pharmacology 2019/20

    The Concise Guide to Pharmacology 2019/20

    Edinburgh Research Explorer THE CONCISE GUIDE TO PHARMACOLOGY 2019/20 Citation for published version: Cgtp Collaborators 2019, 'THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: Transporters', British Journal of Pharmacology, vol. 176 Suppl 1, pp. S397-S493. https://doi.org/10.1111/bph.14753 Digital Object Identifier (DOI): 10.1111/bph.14753 Link: Link to publication record in Edinburgh Research Explorer Document Version: Publisher's PDF, also known as Version of record Published In: British Journal of Pharmacology General rights Copyright for the publications made accessible via the Edinburgh Research Explorer is retained by the author(s) and / or other copyright owners and it is a condition of accessing these publications that users recognise and abide by the legal requirements associated with these rights. Take down policy The University of Edinburgh has made every reasonable effort to ensure that Edinburgh Research Explorer content complies with UK legislation. If you believe that the public display of this file breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 28. Sep. 2021 S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2019/20: Transporters. British Journal of Pharmacology (2019) 176, S397–S493 THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: Transporters Stephen PH Alexander1 , Eamonn Kelly2, Alistair Mathie3 ,JohnAPeters4 , Emma L Veale3 , Jane F Armstrong5 , Elena Faccenda5 ,SimonDHarding5 ,AdamJPawson5 , Joanna L