The Molecular Mechanisms of Testosterone Depletion During Skeletal Myogenesis Connor Geraghty Honors Thesis College of Arts
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
FLNC Missense Variants in Familial Noncompaction Cardiomyopathy
Cardiogenetics 2019; volume 9:8181 FLNC missense variants than 2 according to current echocardio- in familial noncompaction graphic criteria, or 2.3 on CMR.1,2 Correspondence: Jaap I. van Waning, Approximately 10% of patients diagnosed Department of Clinical Genetics, EE 2038, cardiomyopathy with NCCM have concurrent congenital Erasmus MC, POB 2040, 3000CA Rotterdam, heart defects (CHD).3,4 the Netherlands. Tel.: +3107038388 - Fax: +3107043072. Jaap I. van Waning,1 In 30-40% of cases diagnosed with E-mail: [email protected] Yvonne M. Hoedemaekers,2 NCCM a pathogenic variant can be identi- 2,3 4 Wouter P. te Rijdt, Arne I. Jpma, fied. Around 80% of these pathogenic vari- Acknowledgements: JVW was supported by a Daphne Heijsman,4 Kadir Caliskan,5 ants involve the same sarcomere genes, that grant from the Jaap Schouten Foundation. Elke S. Hoendermis,6 are the major causes for hypertrophic car- WPTR was supported by a Young Talent Program (CVON PREDICT) grant 2017T001 Tineke P. Willems,7 diomyopathy (HCM) and dilated cardiomy- - Dutch Heart Foundation. 8 opathy (DCM), in particular MYH7, Arthur van den Wijngaard, 5,6 3 MYBPC3 and TTN. Filamin C (FLNC) Albert Suurmeijer, Conflict of interest: the authors declare no plays a central role in muscle functioning Marjon A. van Slegtenhorst,1 potential conflict of interest. by maintaining the structural integrity of the Jan D.H. Jongbloed,2 muscle fibers. Pathogenic variants in FLNC Received for publication: 20 March 2019. Danielle F. Majoor-Krakauer,1 2 were found to be associated with a wide Revision received: 29 July 2019. Paul A. -
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
1 1 Alpha-Smooth Muscle Actin (ACTA2) Is Required for Metastatic Potential of Human 1 Lung Adenocarcinoma 2 3 Hye Won Lee*1,2,3
Author Manuscript Published OnlineFirst on August 30, 2013; DOI: 10.1158/1078-0432.CCR-13-1181 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. 1 1 Alpha-smooth muscle actin (ACTA2) is required for metastatic potential of human 2 lung adenocarcinoma 3 4 Hye Won Lee*1,2,3, Young Mi Park*3,4, Se Jeong Lee1,4,5, Hyun Jung Cho1,2, Duk-Hwan Kim6,7, 5 Jung-Il Lee2, Myung-Soo Kang3, Ho Jun Seol2, Young Mog Shim8, Do-Hyun Nam1,2,3, Hyeon 6 Ho Kim3,4, Kyeung Min Joo1,3,4,5 7 8 Authors’ Affiliations: 9 1Cancer Stem Cell Research Center, 2Department of Neurosurgery, 3Department of Health 10 Sciences and Technology, Samsung Advanced Institute for Health Sciences and 11 Technology (SAIHST), 4Samsung Biomedical Research Institute, 5Department of Anatomy 12 and Cell Biology, 6Department of Molecular Cell Biology, 7Center for Genome Research, 13 8Department of Thoracic Surgery, Samsung Medical Center, Sungkyunkwan University 14 School of Medicine, Seoul, Korea 15 16 *These authors contributed equally to this work. 17 18 Running title: ACTA2 confers metastatic potential on lung adenocarcinoma 19 Keywords: Non-small cell lung adenocarcinoma, alpha-smooth muscle actin, migration, 20 invasion, metastasis 1 Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2013 American Association for Cancer Research. Author Manuscript Published OnlineFirst on August 30, 2013; DOI: 10.1158/1078-0432.CCR-13-1181 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. 2 1 Financial support: This study was supported by a grant from the Korea Healthcare 2 Technology R&D Project, Ministry for Health & Welfare Affairs, Republic of Korea (A092255), 3 and the Basic Science Research Program, National Research Foundation of Korea by the 4 Ministry of Education, Science, and Technology (2011-009329 to H. -
Impairments in Contractility and Cytoskeletal Organisation Cause Nuclear Defects in Nemaline Myopathy
bioRxiv preprint doi: https://doi.org/10.1101/518522; this version posted January 28, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Impairments in contractility and cytoskeletal organisation cause nuclear defects in nemaline myopathy Jacob A Ross1, Yotam Levy1, Michela Ripolone2, Justin S Kolb3, Mark Turmaine4, Mark Holt5, Maurizio Moggio2, Chiara Fiorillo6, Johan Lindqvist3, Nicolas Figeac5, Peter S Zammit5, Heinz Jungbluth5,7,8, John Vissing9, Nanna Witting9, Henk Granzier3, Edmar Zanoteli10, Edna C Hardeman11, Carina Wallgren- Pettersson12, Julien Ochala1,5. 1. Centre for Human & Applied Physiological Sciences, School of Basic & Medical Biosciences, Faculty of Life Sciences & Medicine, Guy’s Campus, King’s College London, SE1 1UL, UK 2. Neuromuscular and Rare Diseases Unit, Department of Neuroscience, Fondazione IRCCS Ca' Granda, Ospedale Maggiore Policlinico, Milan 20122, Italy 3. Department of Cellular and Molecular Medicine, University of Arizona, Tucson, Arizona, 85721, USA 4. Division of Biosciences, University College London, Gower Street, London WC1E 6BT, UK 5. Randall Centre for Cell and Molecular Biophysics, School of Basic & Medical Biosciences, Faculty of Life Sciences & Medicine, Guy’s Campus, King’s College London, SE1 1UL, UK 6. Molecular Medicine, IRCCS Fondazione Stella Maris, Pisa and Department of Neuroscience, Rehabilitation, Ophthalmology, Genetics, Maternal and Child Health, University of Genova, Genoa, Italy 7. Department of Paediatric Neurology, Neuromuscular Service, Evelina's Children Hospital, Guy's and St Thomas' Hospital National Health Service Foundation Trust, London, SE1 9RT, UK 8. Department of Basic and Clinical Neuroscience, Institute of Psychiatry, Psychology & Neuroscience, King's College, London, SE1 1UL, UK 9. -
Identification of the Binding Partners for Hspb2 and Cryab Reveals
Brigham Young University BYU ScholarsArchive Theses and Dissertations 2013-12-12 Identification of the Binding arP tners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non- Redundant Roles for Small Heat Shock Proteins Kelsey Murphey Langston Brigham Young University - Provo Follow this and additional works at: https://scholarsarchive.byu.edu/etd Part of the Microbiology Commons BYU ScholarsArchive Citation Langston, Kelsey Murphey, "Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins" (2013). Theses and Dissertations. 3822. https://scholarsarchive.byu.edu/etd/3822 This Thesis is brought to you for free and open access by BYU ScholarsArchive. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of BYU ScholarsArchive. For more information, please contact [email protected], [email protected]. Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston A thesis submitted to the faculty of Brigham Young University in partial fulfillment of the requirements for the degree of Master of Science Julianne H. Grose, Chair William R. McCleary Brian Poole Department of Microbiology and Molecular Biology Brigham Young University December 2013 Copyright © 2013 Kelsey Langston All Rights Reserved ABSTRACT Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactors and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston Department of Microbiology and Molecular Biology, BYU Master of Science Small Heat Shock Proteins (sHSP) are molecular chaperones that play protective roles in cell survival and have been shown to possess chaperone activity. -
Genetic Mutations and Mechanisms in Dilated Cardiomyopathy
Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, … , Jessica R. Golbus, Megan J. Puckelwartz J Clin Invest. 2013;123(1):19-26. https://doi.org/10.1172/JCI62862. Review Series Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of congestive heart failure. In hypertrophic cardiomyopathy (HCM), cardiac output is limited by the thickened myocardium through impaired filling and outflow. Mutations in the genes encoding the thick filament components myosin heavy chain and myosin binding protein C (MYH7 and MYBPC3) together explain 75% of inherited HCMs, leading to the observation that HCM is a disease of the sarcomere. Many mutations are “private” or rare variants, often unique to families. In contrast, dilated cardiomyopathy (DCM) is far more genetically heterogeneous, with mutations in genes encoding cytoskeletal, nucleoskeletal, mitochondrial, and calcium-handling proteins. DCM is characterized by enlarged ventricular dimensions and impaired systolic and diastolic function. Private mutations account for most DCMs, with few hotspots or recurring mutations. More than 50 single genes are linked to inherited DCM, including many genes that also link to HCM. Relatively few clinical clues guide the diagnosis of inherited DCM, but emerging evidence supports the use of genetic testing to identify those patients at risk for faster disease progression, congestive heart failure, and arrhythmia. Find the latest version: https://jci.me/62862/pdf Review series Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, Jessica R. Golbus, and Megan J. Puckelwartz Department of Human Genetics, University of Chicago, Chicago, Illinois, USA. Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of conges- tive heart failure. -
Defining Functional Interactions During Biogenesis of Epithelial Junctions
ARTICLE Received 11 Dec 2015 | Accepted 13 Oct 2016 | Published 6 Dec 2016 | Updated 5 Jan 2017 DOI: 10.1038/ncomms13542 OPEN Defining functional interactions during biogenesis of epithelial junctions J.C. Erasmus1,*, S. Bruche1,*,w, L. Pizarro1,2,*, N. Maimari1,3,*, T. Poggioli1,w, C. Tomlinson4,J.Lees5, I. Zalivina1,w, A. Wheeler1,w, A. Alberts6, A. Russo2 & V.M.M. Braga1 In spite of extensive recent progress, a comprehensive understanding of how actin cytoskeleton remodelling supports stable junctions remains to be established. Here we design a platform that integrates actin functions with optimized phenotypic clustering and identify new cytoskeletal proteins, their functional hierarchy and pathways that modulate E-cadherin adhesion. Depletion of EEF1A, an actin bundling protein, increases E-cadherin levels at junctions without a corresponding reinforcement of cell–cell contacts. This unexpected result reflects a more dynamic and mobile junctional actin in EEF1A-depleted cells. A partner for EEF1A in cadherin contact maintenance is the formin DIAPH2, which interacts with EEF1A. In contrast, depletion of either the endocytic regulator TRIP10 or the Rho GTPase activator VAV2 reduces E-cadherin levels at junctions. TRIP10 binds to and requires VAV2 function for its junctional localization. Overall, we present new conceptual insights on junction stabilization, which integrate known and novel pathways with impact for epithelial morphogenesis, homeostasis and diseases. 1 National Heart and Lung Institute, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK. 2 Computing Department, Imperial College London, London SW7 2AZ, UK. 3 Bioengineering Department, Faculty of Engineering, Imperial College London, London SW7 2AZ, UK. 4 Department of Surgery & Cancer, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Communication Pathways in Human Nonmuscle Myosin-2C 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Authors: 25 Krishna Chinthalapudia,B,C,1, Sarah M
1 Mechanistic Insights into the Active Site and Allosteric 2 Communication Pathways in Human Nonmuscle Myosin-2C 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Authors: 25 Krishna Chinthalapudia,b,c,1, Sarah M. Heisslera,d,1, Matthias Prellera,e, James R. Sellersd,2, and 26 Dietmar J. Mansteina,b,2 27 28 Author Affiliations 29 aInstitute for Biophysical Chemistry, OE4350 Hannover Medical School, 30625 Hannover, 30 Germany. 31 bDivision for Structural Biochemistry, OE8830, Hannover Medical School, 30625 Hannover, 32 Germany. 33 cCell Adhesion Laboratory, Department of Integrative Structural and Computational Biology, The 34 Scripps Research Institute, Jupiter, Florida 33458, USA. 35 dLaboratory of Molecular Physiology, NHLBI, National Institutes of Health, Bethesda, Maryland 36 20892, USA. 37 eCentre for Structural Systems Biology (CSSB), German Electron Synchrotron (DESY), 22607 38 Hamburg, Germany. 39 1K.C. and S.M.H. contributed equally to this work 40 2To whom correspondence may be addressed: E-mail: [email protected] or 41 [email protected] 42 43 1 44 Abstract 45 Despite a generic, highly conserved motor domain, ATP turnover kinetics and their activation by 46 F-actin vary greatly between myosin-2 isoforms. Here, we present a 2.25 Å crystal pre- 47 powerstroke state (ADPVO4) structure of the human nonmuscle myosin-2C motor domain, one 48 of the slowest myosins characterized. In combination with integrated mutagenesis, ensemble- 49 solution kinetics, and molecular dynamics simulation approaches, the structure reveals an 50 allosteric communication pathway that connects the distal end of the motor domain with the 51 active site. -
1 Metabolic Dysfunction Is Restricted to the Sciatic Nerve in Experimental
Page 1 of 255 Diabetes Metabolic dysfunction is restricted to the sciatic nerve in experimental diabetic neuropathy Oliver J. Freeman1,2, Richard D. Unwin2,3, Andrew W. Dowsey2,3, Paul Begley2,3, Sumia Ali1, Katherine A. Hollywood2,3, Nitin Rustogi2,3, Rasmus S. Petersen1, Warwick B. Dunn2,3†, Garth J.S. Cooper2,3,4,5* & Natalie J. Gardiner1* 1 Faculty of Life Sciences, University of Manchester, UK 2 Centre for Advanced Discovery and Experimental Therapeutics (CADET), Central Manchester University Hospitals NHS Foundation Trust, Manchester Academic Health Sciences Centre, Manchester, UK 3 Centre for Endocrinology and Diabetes, Institute of Human Development, Faculty of Medical and Human Sciences, University of Manchester, UK 4 School of Biological Sciences, University of Auckland, New Zealand 5 Department of Pharmacology, Medical Sciences Division, University of Oxford, UK † Present address: School of Biosciences, University of Birmingham, UK *Joint corresponding authors: Natalie J. Gardiner and Garth J.S. Cooper Email: [email protected]; [email protected] Address: University of Manchester, AV Hill Building, Oxford Road, Manchester, M13 9PT, United Kingdom Telephone: +44 161 275 5768; +44 161 701 0240 Word count: 4,490 Number of tables: 1, Number of figures: 6 Running title: Metabolic dysfunction in diabetic neuropathy 1 Diabetes Publish Ahead of Print, published online October 15, 2015 Diabetes Page 2 of 255 Abstract High glucose levels in the peripheral nervous system (PNS) have been implicated in the pathogenesis of diabetic neuropathy (DN). However our understanding of the molecular mechanisms which cause the marked distal pathology is incomplete. Here we performed a comprehensive, system-wide analysis of the PNS of a rodent model of DN. -
Research Article Characterization of the Equine Skeletal Muscle
McGivney et al. BMC Genomics 2010, 11:398 http://www.biomedcentral.com/1471-2164/11/398 RESEARCH ARTICLE Open Access CharacterizationResearch article of the equine skeletal muscle transcriptome identifies novel functional responses to exercise training Beatrice A McGivney1, Paul A McGettigan1, John A Browne1, Alexander CO Evans1,3, Rita G Fonseca2, Brendan J Loftus3, Amanda Lohan3, David E MacHugh1,3, Barbara A Murphy1, Lisa M Katz2 and Emmeline W Hill*1 Abstract Background: Digital gene expression profiling was used to characterize the assembly of genes expressed in equine skeletal muscle and to identify the subset of genes that were differentially expressed following a ten-month period of exercise training. The study cohort comprised seven Thoroughbred racehorses from a single training yard. Skeletal muscle biopsies were collected at rest from the gluteus medius at two time points: T1 - untrained, (9 ± 0.5 months old) and T2 - trained (20 ± 0.7 months old). Results: The most abundant mRNA transcripts in the muscle transcriptome were those involved in muscle contraction, aerobic respiration and mitochondrial function. A previously unreported over-representation of genes related to RNA processing, the stress response and proteolysis was observed. Following training 92 tags were differentially expressed of which 74 were annotated. Sixteen genes showed increased expression, including the mitochondrial genes ACADVL, MRPS21 and SLC25A29 encoded by the nuclear genome. Among the 58 genes with decreased expression, MSTN, a negative regulator of muscle growth, had the greatest decrease. Functional analysis of all expressed genes using FatiScan revealed an asymmetric distribution of 482 Gene Ontology (GO) groups and 18 KEGG pathways. -
Wnt/Β-Catenin Signaling Regulates Regeneration in Diverse Tissues of the Zebrafish
Wnt/β-catenin Signaling Regulates Regeneration in Diverse Tissues of the Zebrafish Nicholas Stockton Strand A dissertation Submitted in partial fulfillment of the Requirements for the degree of Doctor of Philosophy University of Washington 2016 Reading Committee: Randall Moon, Chair Neil Nathanson Ronald Kwon Program Authorized to Offer Degree: Pharmacology ©Copyright 2016 Nicholas Stockton Strand University of Washington Abstract Wnt/β-catenin Signaling Regulates Regeneration in Diverse Tissues of the Zebrafish Nicholas Stockton Strand Chair of the Supervisory Committee: Professor Randall T Moon Department of Pharmacology The ability to regenerate tissue after injury is limited by species, tissue type, and age of the organism. Understanding the mechanisms of endogenous regeneration provides greater insight into this remarkable biological process while also offering up potential therapeutic targets for promoting regeneration in humans. The Wnt/β-catenin signaling pathway has been implicated in zebrafish regeneration, including the fin and nervous system. The body of work presented here expands upon the role of Wnt/β-catenin signaling in regeneration, characterizing roles for Wnt/β-catenin signaling in multiple tissues. We show that cholinergic signaling is required for blastema formation and Wnt/β-catenin signaling initiation in the caudal fin, and that overexpression of Wnt/β-catenin ligand is sufficient to rescue blastema formation in fins lacking cholinergic activity. Next, we characterized the glial response to Wnt/β-catenin signaling after spinal cord injury, demonstrating that Wnt/β-catenin signaling is necessary for recovery of motor function and the formation of bipolar glia after spinal cord injury. Lastly, we defined a role for Wnt/β-catenin signaling in heart regeneration, showing that cardiomyocyte proliferation is regulated by Wnt/β-catenin signaling.