DOCSLIB.ORG

Up-Regulated Genes

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Up-Regulated Genes Supplemental Table 1. Uniquely up- and down- regulated genes in the inguinal fat pads of wild-type ( MMP14 +/++/++/+ ) in response to nutritional change (HFD versus CD) Up-regulated genes HFD/CD (log2 Probe Symbol Description HFD 1 HFD 2 CD 1 CD 2 scale) 1434679_at Ncan neurocan 2.86 7.72 7.92 4.84 5.09 1422155_at Hist2h3c2 histone cluster 2, H3c2 2.08 8.53 8.53 6.41 6.50 1417688_at Fam20c family with sequence similarity 20, member C 2.02 9.45 9.37 7.39 7.39 1447520_at Lbp lipopolysaccharide binding protein 2.44 8.28 8.17 5.65 5.93 1452243_at Kcnj14 potassium inwardly-rectifying channel, subfamily J, member 14 1.87 7.48 7.56 5.61 5.69 1420674_at Pla2g2e phospholipase A2, group IIE 1.90 7.71 7.91 5.92 5.89 1417903_at Dfna5 deafness, autosomal dominant 5 (human) 1.73 6.90 7.01 5.23 5.22 1423294_at Mest mesoderm specific transcript 3.86 11.47 12.03 7.62 8.16 1424338_at Slc6a13 solute carrier family 6 (neurotransmitter transporter, GABA), member 13 1.67 8.97 9.03 7.29 7.36 1436829_at Trim67 tripartite motif-containing 67 2.07 7.95 8.27 6.01 6.07 1422561_at Adamts5 a disintegrin-like and metallopeptidase with thrombospondin type 1 motif, 5 (aggrecanase-2) 1.50 11.82 11.89 10.34 10.37 1422655_at Ptch2 patched homolog 2 1.55 7.91 8.09 6.45 6.45 1455099_at Mogat2 monoacylglycerol O-acyltransferase 2 1.53 6.75 6.54 5.12 5.10 1420553_x_at Serpina1a serine (or cysteine) peptidase inhibitor, clade A, member 1A 2.13 6.24 6.29 3.91 4.36 1455447_at D430019H16Rik RIKEN cDNA D430019H16 gene 1.88 9.74 9.73 7.68 8.04 1423516_a_at Nid2 nidogen 2 1.34 9.17 9.21 7.80 7.90 1423693_at Ela1 elastase 1, pancreatic 1.40 9.11 9.24 7.72 7.84 1435314_at Tph2 tryptophan hydroxylase 2 2.19 5.54 6.04 3.51 3.69 1425891_a_at Grtp1 GH regulated TBC protein 1 1.28 7.93 7.86 6.59 6.65 1428005_at Mosc1 MOCO sulphurase C-terminal domain containing 1 2.48 9.21 9.55 6.64 7.16 1452646_at Trp53inp2 transformation related protein 53 inducible nuclear protein 2 1.54 12.95 13.07 11.59 11.35 1434129_s_at Lhfpl2 lipoma HMGIC fusion partner-like 2 1.29 10.41 10.39 9.05 9.18 1435950_at Hr hairless 1.48 8.49 8.42 6.85 7.10 1416321_s_at Prelp proline arginine-rich end leucine-rich repeat 1.46 11.92 11.96 10.60 10.36 1449152_at Cdkn2b cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) 1.25 8.03 8.04 6.84 6.73 1434342_at S100b S100 protein, beta polypeptide, neural 1.70 8.50 8.38 6.92 6.57 1426562_a_at Olfm1 olfactomedin 1 1.80 8.37 8.31 6.34 6.75 1423136_at Fgf1 fibroblast growth factor 1 1.49 8.48 8.49 6.85 7.14 1445546_at AI844685 expressed sequence AI844685 1.42 9.70 9.93 8.35 8.45 1440649_at EG232599 predicted gene, EG232599 1.33 6.35 6.55 5.08 5.17 1425227_a_at Atp6v0a1 ATPase, H+ transporting, lysosomal V0 subunit A1 1.13 7.07 7.10 5.95 5.97 1434051_s_at Hspa12a heat shock protein 12A 1.36 9.31 9.38 7.86 8.11 1420655_at Pnpla3 patatin-like phospholipase domain containing 3 1.77 11.49 11.47 9.95 9.48 1429030_at C1qtnf7 C1q and tumor necrosis factor related protein 7 1.36 6.94 6.89 5.41 5.69 1416953_at Ctgf connective tissue growth factor 1.25 8.84 8.68 7.59 7.43 1425385_a_at Igh-6 immunoglobulin heavy chain 6 (heavy chain of IgM) 2.45 12.19 12.62 9.65 10.26 1426913_at Lss lanosterol synthase 1.61 7.13 7.12 5.30 5.72 1416121_at Lox lysyl oxidase 1.21 10.97 11.17 9.90 9.81 1416455_a_at Cryab crystallin, alpha B 1.13 10.55 10.71 9.52 9.48 1422558_at Gamt guanidinoacetate methyltransferase 1.15 8.71 8.68 7.45 7.64 1453592_at Lrrc39 leucine rich repeat containing 39 1.13 7.47 7.66 6.42 6.45 1416311_s_at Tuba3a tubulin, alpha 3A 1.10 7.83 7.69 6.62 6.71 1417673_at Grb14 growth factor receptor bound protein 14 2.27 10.51 10.38 7.81 8.53 1450344_a_at Ptger3 prostaglandin E receptor 3 (subtype EP3) 1.32 11.28 11.43 10.17 9.89 1422878_at Syt12 synaptotagmin XII 1.02 9.51 9.61 8.53 8.53 1422580_at Myl4 myosin, light polypeptide 4 1.45 8.72 8.58 7.01 7.39 1439849_at OTTMUSG00000008561 predicted gene, OTTMUSG00000008561 1.03 8.42 8.55 7.43 7.48 1433443_a_at LOC100040592 similar to Hmgcs1 protein 1.05 12.29 12.35 11.20 11.33 1434188_at Slc16a12 solute carrier family 16 (monocarboxylic acid transporters), member 12 1.50 9.01 9.18 7.39 7.78 1422582_at Lep leptin 2.38 12.60 12.58 9.81 10.61 1418884_x_at Tuba1a tubulin, alpha 1A 1.09 13.64 13.55 12.43 12.59 1450702_at Hfe hemochromatosis 1.03 9.09 9.12 8.00 8.15 1420944_at Zfp185 zinc finger protein 185 1.08 8.41 8.46 7.26 7.45 1423179_at Kcnb1 potassium voltage gated channel, Shab-related subfamily, member 1 1.22 7.11 7.19 6.07 5.79 1460583_at Golt1b golgi transport 1 homolog B (S. cerevisiae) 1.04 7.01 6.91 5.85 5.99 1450286_at Npr3 natriuretic peptide receptor 3 2.72 9.16 9.65 6.26 7.10 1455299_at Vgll3 vestigial like 3 (Drosophila) 1.70 8.35 8.69 6.61 7.03 1440888_at Oxtr oxytocin receptor 1.65 7.85 8.02 6.04 6.53 1423369_at Fmr1 fragile X mental retardation syndrome 1 homolog 1.33 11.45 11.52 9.98 10.33 1455025_at Paqr9 progestin and adipoQ receptor family member IX 1.26 10.20 10.22 9.11 8.78 1416529_at Emp1 epithelial membrane protein 1 1.70 12.48 12.45 10.49 11.04 1427247_at D3Bwg0562e DNA segment, Chr 3, Brigham & Women's Genetics 0562 expressed 1.33 6.77 6.83 5.29 5.66 1427123_s_at Copg2as2 coatomer protein complex, subunit gamma 2, antisense 2 1.06 7.44 7.31 6.23 6.39 1455720_at Adamts2 a disintegrin-like and metallopeptidase with thrombospondin type 1 motif, 2 1.44 6.89 7.17 5.75 5.41 1426513_at Rbm28 RNA binding motif protein 28 1.12 9.11 9.18 7.89 8.16 1427299_at Rps6ka3 ribosomal protein S6 kinase polypeptide 3 1.03 8.88 8.94 7.77 7.98 1434520_at Sc5d sterol-C5-desaturase (fungal ERG3, delta-5-desaturase) homolog (S. cerevisae) 1.21 9.93 10.12 8.95 8.67 1427352_at Krt79 keratin 79 1.02 8.00 7.97 7.07 6.86 1418123_at Unc119 unc-119 homolog (C. elegans) 1.01 9.61 9.74 8.57 8.74 1429135_at 1110059M19Rik RIKEN cDNA 1110059M19 gene 2.74 8.72 8.98 5.59 6.63 1438756_at Ankrd29 ankyrin repeat domain 29 1.54 7.54 7.71 5.82 6.34 1425039_at Itgbl1 integrin, beta-like 1 1.15 7.79 7.62 6.41 6.69 1436200_at Lonrf3 LON peptidase N-terminal domain and ring finger 3 1.18 6.39 6.35 5.36 5.02 1436359_at Ret ret proto-oncogene 1.54 7.50 7.74 5.82 6.32 1420427_a_at Dhx32 DEAH (Asp-Glu-Ala-His) box polypeptide 32 1.16 9.26 9.58 8.32 8.21 1429183_at Pkp2 plakophilin 2 1.39 8.56 8.84 7.11 7.51 1428738_a_at D14Ertd449e DNA segment, Chr 14, ERATO Doi 449, expressed 1.04 10.48 10.72 9.63 9.50 ©2010 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/cgi/content/full/db10-0073/DC1. 1423771_at Prkcdbp protein kinase C, delta binding protein 1.15 10.96 11.02 9.66 10.02 1436876_at Rgs7bp regulator of G-protein signalling 7 binding protein 1.13 8.59 8.44 7.55 7.22 1447851_x_at Atp10a ATPase, class V, type 10A 1.93 7.74 7.26 5.25 5.89 1415822_at Scd2 stearoyl-Coenzyme A desaturase 2 1.47 12.69 12.98 11.12 11.61 1448280_at Syp synaptophysin 1.10 7.35 7.31 6.05 6.41 1449249_at Pcdh7 protocadherin 7 1.22 8.31 8.70 7.19 7.38 1418713_at Pcbd1 pterin 4 alpha carbinolamine dehydratase 1 1.01 7.95 7.81 6.72 7.00 1427422_at EG624219 predicted gene, EG624219 1.29 8.10 8.59 7.08 7.04 1449901_a_at Map3k6 mitogen-activated protein kinase kinase kinase 6 1.03 8.37 8.24 7.42 7.11 1419149_at Serpine1 serine (or cysteine) peptidase inhibitor, clade E, member 1 1.15 8.51 8.38 7.10 7.49 1441206_at Synpo2 synaptopodin 2 1.21 9.27 9.21 7.81 8.26 1415993_at Sqle squalene epoxidase 1.13 8.78 9.03 7.62 7.94 1456563_at 4933429F08Rik RIKEN cDNA 4933429F08 gene 1.09 6.28 5.93 4.94 5.09 1417430_at Cdr2 cerebellar degeneration-related 2 1.19 9.23 9.34 7.88 8.32 1416434_at Bcl2l10 Bcl2-like 10 1.06 6.68 6.85 5.87 5.54 1429571_a_at Spaca1 sperm acrosome associated 1 1.10 6.93 7.34 6.10 5.98 1418497_at Fgf13 fibroblast growth factor 13 1.33 10.11 10.12 8.50 9.08 1434581_at 2410066E13Rik RIKEN cDNA 2410066E13 gene 1.10 9.47 9.62 8.24 8.65 1424631_a_at Ighg Immunoglobulin heavy chain (gamma polypeptide) 2.21 11.15 11.12 9.47 8.38 1422533_at Cyp51 cytochrome P450, family 51 1.29 7.32 7.54 5.88 6.41 1418879_at Fam110c family with sequence similarity 110, member C 1.50 7.90 7.97 6.79 6.08 1418547_at Tfpi2 tissue factor pathway inhibitor 2 1.13 7.35 7.45 6.52 6.03 1454623_at Cpa2 carboxypeptidase A2, pancreatic 1.12 6.00 6.27 4.80 5.23 1423596_at Nek6 NIMA (never in mitosis gene a)-related expressed kinase 6 1.02 8.82 8.82 7.59 8.02 1433696_at Hn1l hematological and neurological expressed 1-like 1.00 8.22 8.58 7.29 7.50 1442051_at Hist2h3c1 histone cluster 2, H3c1 1.54 8.82 8.87 7.70 6.91 1436590_at Ppp1r3b protein phosphatase 1, regulatory (inhibitor) subunit 3B 1.28 9.47 9.80 8.64 8.07 1435484_at Slc5a3 solute carrier family 5 (inositol transporters), member 3 1.05 11.58 11.59 10.29 10.79 1434695_at Dtl denticleless homolog (Drosophila) 1.12 6.37 6.31 4.94 5.50 1439885_at Hoxc5 homeo box C5 1.20 8.96 9.11 7.53 8.14 1444089_at Spnb2 spectrin beta 2 1.10 9.17 9.21 7.82 8.38 1450871_a_at Bcat1 branched chain aminotransferase 1, cytosolic 1.02 6.66 6.62 5.36 5.87 1425681_a_at Prnd prion protein dublet 1.46 6.18 6.93 4.89 5.31 1426858_at Inhbb inhibin beta-B 1.16 9.63 9.64 8.13 8.82 1434411_at Col12a1 collagen, type XII, alpha 1 1.02 6.46 6.74 5.30 5.86 1452295_at Pmepa1 prostate transmembrane protein, androgen induced 1 1.01 9.45 9.58 8.82 8.20 Down-regulated genes HFD/CD (log2 Probe Symbol Description HFD 1 HFD 2 CD 1 CD 2 scale) 1422217_a_at Cyp1a1 cytochrome P450, family 1, subfamily a, polypeptide 1 -3.01 4.72 4.75 7.88 7.62 1419669_at Prtn3 proteinase 3 -2.06 7.84 7.89 10.03 9.83 1438403_s_at Malat1 metastasis associated lung adenocarcinoma transcript
Load more

Recommended publications
  • FLNC Missense Variants in Familial Noncompaction Cardiomyopathy
    Cardiogenetics 2019; volume 9:8181 FLNC missense variants than 2 according to current echocardio- in familial noncompaction graphic criteria, or 2.3 on CMR.1,2 Correspondence: Jaap I. van Waning, Approximately 10% of patients diagnosed Department of Clinical Genetics, EE 2038, cardiomyopathy with NCCM have concurrent congenital Erasmus MC, POB 2040, 3000CA Rotterdam, heart defects (CHD).3,4 the Netherlands. Tel.: +3107038388 - Fax: +3107043072. Jaap I. van Waning,1 In 30-40% of cases diagnosed with E-mail: [email protected] Yvonne M. Hoedemaekers,2 NCCM a pathogenic variant can be identi- 2,3 4 Wouter P. te Rijdt, Arne I. Jpma, fied. Around 80% of these pathogenic vari- Acknowledgements: JVW was supported by a Daphne Heijsman,4 Kadir Caliskan,5 ants involve the same sarcomere genes, that grant from the Jaap Schouten Foundation. Elke S. Hoendermis,6 are the major causes for hypertrophic car- WPTR was supported by a Young Talent Program (CVON PREDICT) grant 2017T001 Tineke P. Willems,7 diomyopathy (HCM) and dilated cardiomy- - Dutch Heart Foundation. 8 opathy (DCM), in particular MYH7, Arthur van den Wijngaard, 5,6 3 MYBPC3 and TTN. Filamin C (FLNC) Albert Suurmeijer, Conflict of interest: the authors declare no plays a central role in muscle functioning Marjon A. van Slegtenhorst,1 potential conflict of interest. by maintaining the structural integrity of the Jan D.H. Jongbloed,2 muscle fibers. Pathogenic variants in FLNC Received for publication: 20 March 2019. Danielle F. Majoor-Krakauer,1 2 were found to be associated with a wide Revision received: 29 July 2019. Paul A.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Lectin-Affinity Chromatography Brain Glycoproteomics and Alzheimer
    50 DOI 10.1002/prca.201000070 Proteomics Clin. Appl. 2011, 5, 50–56 REVIEW Lectin-affinity chromatography brain glycoproteomics and Alzheimer disease: Insights into protein alterations consistent with the pathology and progression of this dementing disorder D. Allan Butterfield and Joshua B. Owen Department of Chemistry, Center of Membrane Sciences, and Sanders-Brown Center on Aging, University of Kentucky, Lexington KY, USA Alzheimer disease (AD) is a neurodegenerative disorder characterized pathologically by the Received: July 7, 2010 accumulation of senile plaques and neurofibrillary tangles, and both these pathological Revised: August 4, 2010 hallmarks of AD are extensively modified by glycosylation. Mounting evidence shows that Accepted: August 10, 2010 alterations in glycosylation patterns influence the pathogenesis and progression of AD, but the vast number of glycan motifs and potential glycosylation sites of glycoproteins has made the field of glycobiology difficult. However, the advent of glycoproteomics has produced major strides in glycoprotein identification and glycosylation site mapping. The use of lectins, proteins that have strong affinity for specific carbohydrate epitopes, to enrich glycoprotein fractions coupled with modern MS, have yielded techniques to elucidate the glycoproteome in AD. Proteomic studies have identified brain proteins in AD and arguably the earliest form of AD, mild cognitive impairment, with altered affinity for Concanavalin-A and wheat germ agglutinin lectins that are consistent with the pathology and progression of this disorder. This is a relatively nascent field of proteomics research in brain, so future studies of lectin-based brain protein separations may lead to additional insights into AD pathogenesis and progression. Keywords: Alzheimers disease (AD) / Lectin-chromatography / Mild cognitive impairment (MCI) / MS / Synaptic alterations 1 Introduction ized pathologically by the accumulation of senile plaques (SPs) and neurofibrillary tangles (NFTs).
    [Show full text]
  • Targeted Genes and Methodology Details for Neuromuscular Genetic Panels
    Targeted Genes and Methodology Details for Neuromuscular Genetic Panels Reference transcripts based on build GRCh37 (hg19) interrogated by Neuromuscular Genetic Panels Next-generation sequencing (NGS) and/or Sanger sequencing is performed Motor Neuron Disease Panel to test for the presence of a mutation in these genes. Gene GenBank Accession Number Regions of homology, high GC-rich content, and repetitive sequences may ALS2 NM_020919 not provide accurate sequence. Therefore, all reported alterations detected ANG NM_001145 by NGS are confirmed by an independent reference method based on laboratory developed criteria. However, this does not rule out the possibility CHMP2B NM_014043 of a false-negative result in these regions. ERBB4 NM_005235 Sanger sequencing is used to confirm alterations detected by NGS when FIG4 NM_014845 appropriate.(Unpublished Mayo method) FUS NM_004960 HNRNPA1 NM_031157 OPTN NM_021980 PFN1 NM_005022 SETX NM_015046 SIGMAR1 NM_005866 SOD1 NM_000454 SQSTM1 NM_003900 TARDBP NM_007375 UBQLN2 NM_013444 VAPB NM_004738 VCP NM_007126 ©2018 Mayo Foundation for Medical Education and Research Page 1 of 14 MC4091-83rev1018 Muscular Dystrophy Panel Muscular Dystrophy Panel Gene GenBank Accession Number Gene GenBank Accession Number ACTA1 NM_001100 LMNA NM_170707 ANO5 NM_213599 LPIN1 NM_145693 B3GALNT2 NM_152490 MATR3 NM_199189 B4GAT1 NM_006876 MYH2 NM_017534 BAG3 NM_004281 MYH7 NM_000257 BIN1 NM_139343 MYOT NM_006790 BVES NM_007073 NEB NM_004543 CAPN3 NM_000070 PLEC NM_000445 CAV3 NM_033337 POMGNT1 NM_017739 CAVIN1 NM_012232 POMGNT2
    [Show full text]
  • Viewed Under 23 (B) Or 203 (C) fi M M Male Cko Mice, and Largely Unaffected Magni Cation; Scale Bars, 500 M (B) and 50 M (C)
    BRIEF COMMUNICATION www.jasn.org Renal Fanconi Syndrome and Hypophosphatemic Rickets in the Absence of Xenotropic and Polytropic Retroviral Receptor in the Nephron Camille Ansermet,* Matthias B. Moor,* Gabriel Centeno,* Muriel Auberson,* † † ‡ Dorothy Zhang Hu, Roland Baron, Svetlana Nikolaeva,* Barbara Haenzi,* | Natalya Katanaeva,* Ivan Gautschi,* Vladimir Katanaev,*§ Samuel Rotman, Robert Koesters,¶ †† Laurent Schild,* Sylvain Pradervand,** Olivier Bonny,* and Dmitri Firsov* BRIEF COMMUNICATION *Department of Pharmacology and Toxicology and **Genomic Technologies Facility, University of Lausanne, Lausanne, Switzerland; †Department of Oral Medicine, Infection, and Immunity, Harvard School of Dental Medicine, Boston, Massachusetts; ‡Institute of Evolutionary Physiology and Biochemistry, St. Petersburg, Russia; §School of Biomedicine, Far Eastern Federal University, Vladivostok, Russia; |Services of Pathology and ††Nephrology, Department of Medicine, University Hospital of Lausanne, Lausanne, Switzerland; and ¶Université Pierre et Marie Curie, Paris, France ABSTRACT Tight control of extracellular and intracellular inorganic phosphate (Pi) levels is crit- leaves.4 Most recently, Legati et al. have ical to most biochemical and physiologic processes. Urinary Pi is freely filtered at the shown an association between genetic kidney glomerulus and is reabsorbed in the renal tubule by the action of the apical polymorphisms in Xpr1 and primary fa- sodium-dependent phosphate transporters, NaPi-IIa/NaPi-IIc/Pit2. However, the milial brain calcification disorder.5 How- molecular identity of the protein(s) participating in the basolateral Pi efflux remains ever, the role of XPR1 in the maintenance unknown. Evidence has suggested that xenotropic and polytropic retroviral recep- of Pi homeostasis remains unknown. Here, tor 1 (XPR1) might be involved in this process. Here, we show that conditional in- we addressed this issue in mice deficient for activation of Xpr1 in the renal tubule in mice resulted in impaired renal Pi Xpr1 in the nephron.
    [Show full text]
  • Diseasespecific and Inflammationindependent Stromal
    Full Length Arthritis & Rheumatism DOI 10.1002/art.37704 Disease-specific and inflammation-independent stromal alterations in spondyloarthritis synovitis Nataliya Yeremenko1,2, Troy Noordenbos1,2, Tineke Cantaert1,3, Melissa van Tok1,2, Marleen van de Sande1, Juan D. Cañete4, Paul P. Tak1,5*, Dominique Baeten1,2 1Department of Clinical Immunology and Rheumatology and 2Department of Experimental Immunology, Academic Medical Center/University of Amsterdam, the Netherlands. 3Department of Immunobiology, Yale University School of Medicine, New Haven, CT, USA. 4Department of Rheumatology, Hospital Clinic de Barcelona and IDIBAPS, Spain. 5Arthrogen B.V., Amsterdam, the Netherlands. *Currently also: GlaxoSmithKline, Stevenage, U.K. Corresponding author: Dominique Baeten, MD, PhD, Department of Clinical Immunology and Rheumatology, F4-105, Academic Medical Center/University of Amsterdam, Meibergdreef 9, 1105 AZ Amsterdam, The Netherlands. E-mail: [email protected] This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process which may lead to differences between this version and the Version of Record. Please cite this article as an ‘Accepted Article’, doi: 10.1002/art.37704 © 2012 American College of Rheumatology Received: Apr 11, 2012; Revised: Jul 25, 2012; Accepted: Sep 06, 2012 Arthritis & Rheumatism Page 2 of 36 Abstract Objective: The molecular processes driving the distinct patterns of synovial inflammation and tissue remodelling in spondyloarthritis (SpA) versus rheumatoid arthritis (RA) remain largely unknown. Therefore, we aimed to identify novel and unsuspected disease- specific pathways in SpA by a systematic and unbiased synovial gene expression analysis. Methods: Differentially expressed genes were identified by pan-genomic microarray and confirmed by quantitative PCR and immunohistochemistry using synovial tissue biopsies of SpA (n=63), RA (n=28) and gout (n=9) patients.
    [Show full text]
  • Universidade Estadual De Campinas Instituto De Biologia
    UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA VERÔNICA APARECIDA MONTEIRO SAIA CEREDA O PROTEOMA DO CORPO CALOSO DA ESQUIZOFRENIA THE PROTEOME OF THE CORPUS CALLOSUM IN SCHIZOPHRENIA CAMPINAS 2016 1 VERÔNICA APARECIDA MONTEIRO SAIA CEREDA O PROTEOMA DO CORPO CALOSO DA ESQUIZOFRENIA THE PROTEOME OF THE CORPUS CALLOSUM IN SCHIZOPHRENIA Dissertação apresentada ao Instituto de Biologia da Universidade Estadual de Campinas como parte dos requisitos exigidos para a obtenção do Título de Mestra em Biologia Funcional e Molecular na área de concentração de Bioquímica. Dissertation presented to the Institute of Biology of the University of Campinas in partial fulfillment of the requirements for the degree of Master in Functional and Molecular Biology, in the area of Biochemistry. ESTE ARQUIVO DIGITAL CORRESPONDE À VERSÃO FINAL DA DISSERTAÇÃO DEFENDIDA PELA ALUNA VERÔNICA APARECIDA MONTEIRO SAIA CEREDA E ORIENTADA PELO DANIEL MARTINS-DE-SOUZA. Orientador: Daniel Martins-de-Souza CAMPINAS 2016 2 Agência(s) de fomento e nº(s) de processo(s): CNPq, 151787/2F2014-0 Ficha catalográfica Universidade Estadual de Campinas Biblioteca do Instituto de Biologia Mara Janaina de Oliveira - CRB 8/6972 Saia-Cereda, Verônica Aparecida Monteiro, 1988- Sa21p O proteoma do corpo caloso da esquizofrenia / Verônica Aparecida Monteiro Saia Cereda. – Campinas, SP : [s.n.], 2016. Orientador: Daniel Martins de Souza. Dissertação (mestrado) – Universidade Estadual de Campinas, Instituto de Biologia. 1. Esquizofrenia. 2. Espectrometria de massas. 3. Corpo caloso.
    [Show full text]
  • Developmental Plasticity and Circuit Mechanisms of Dopamine-Modulated Aggression Darshini Mahadevia Submitted in Partial Fulfill
    Developmental plasticity and circuit mechanisms of dopamine-modulated aggression Darshini Mahadevia Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy under the Executive Committee of the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2018 © 2018 Darshini Mahadevia All rights reserved ABSTRACT Developmental plasticity and circuit mechanisms of dopamine-modulated aggression Darshini Mahadevia Aggression and violence pose a significant public health concern to society. Aggression is a highly conserved behavior that shares common biological correlates across species. While aggression developed as an evolutionary adaptation to competition, its untimely and uncontrolled expression is maladaptive and presents itself in a number of neuropsychiatric disorders. A mechanistic hypothesis for pathological aggression links aberrant behavior with heightened dopamine function. However, while dopamine hyper-activity is a neural correlate of aggression, the developmental aspects and circuit level contributions of dopaminergic signaling have not been elucidated. In this dissertation, I aim to address these questions regarding the specifics of dopamine function in a murine model of aggressive behavior. In chapter I, I provide a review of the literature that describes the current state of research on aggression. I describe the background elements that lay the foundation for experimental questions and original data presented in later chapters. I introduce, in detail, published studies that describe the clinical manifestation and epidemiological spread, the dominant categories, the anatomy and physiology, and the pharmacology of aggression, with a particular emphasis on the dopaminergic system. Finally, I describe instances of genetic and environmental risk factors impacting aggression, concluding with studies revealing an important role for interactions among genetics, environmental factors, and age in the development of aggression.
    [Show full text]
  • Tfr2, Hfe, and Hjv in the Regulation of Body Iron Homeostasis
    TFR2, HFE, AND HJV IN THE REGULATION OF BODY IRON HOMEOSTASIS By Christal Anna Worthen A DISSERTATION Presented to the Department of Cell & Developmental Biology and the Oregon Health and Science University School of Medicine in partial fulfillment of the requirements for the degree of Doctor of Philosophy June 2014 School of Medicine Oregon Health & Science University CERTIFICATE OF APPROVAL ___________________________________ This is to certify that the PhD dissertation of Christal A Worthen has been approved ______________________________________ Caroline Enns, Ph.D., mentor ______________________________________ Peter Mayinger, Ph.D., Chairman ______________________________________ Philip Stork, M.D. ______________________________________ David Koeller, M.D. ______________________________________ Alex Nechiporuk, Ph.D. TABLE OF CONTENTS i List of Figures ii Acknowledgements iv Abbreviations v Abstract: 1 Chapter 1: Introduction 5 Abstract and Introduction 6 Binding partners, regulation, and trafficking of TFR2 9 Disease-causing mutations in TFR2 12 Hepcidin regulation 12 Physiological function of TFR2 15 Current TFR2 models 18 Summary 19 Figure 21 Chapter 2: The cytoplasmic domain of TFR2 is necessary for 22 HFE, HJV, and TFR2 regulation of hepcidin Abstract 23 Capsule & Introduction 24 Materials and Methods 26 Results 32 Figures 41 Discussion 49 Chapter 3: Lack of functional TFR2 results in stress erythropoiesis 53 Introduction 54 Materials and Methods 55 Results 57 Figures 60 Discussion 65 Chapter 4: Conclusions and future directions 67 Appendices Appendix A: Coculture of HepG2 cells reduces hepcidin expression 71 Appendix B: Hfe-/- macrophages handle iron differently 80 Appendix C: Both ZIP14A and ZIP14B are regulated by HFE and iron 91 Appendix D: The cytoplasmic domain of HFE does not interact with 99 ZIP14 loop 2 by yeast-2-hybris References 105 i LIST OF FIGURES Figure Abstract 1: Body iron homeostasis.
    [Show full text]
  • JAD 5478.Pdf
    JAD-05478; No of Pages 9 Journal of Affective Disorders xxx (2012) xxx–xxx Contents lists available at SciVerse ScienceDirect Journal of Affective Disorders journal homepage: www.elsevier.com/locate/jad Research report Association of TPH1, TPH2, and 5HTTLPR with PTSD and depressive symptoms Armen K. Goenjian a,b,e,⁎, Julia N. Bailey c,d, David P. Walling b, Alan M. Steinberg a, Devon Schmidt b, Uma Dandekar d, Ernest P. Noble e a UCLA/Duke University National Center for Child Traumatic Stress, Department of Psychiatry and Biobehavioral Sciences, University of California, Los Angeles (UCLA), United States b Collaborative Neuroscience Network, Garden Grove, CA 92845, United States c Department of Epidemiology, UCLA School of Public Health, Los Angeles, CA, United States d Epilepsy Genetics/Genomics Laboratories, VA GLAHS, Los Angeles, CA, United States e Alcohol Research Center, Department of Psychiatry and Biobehavioral Sciences, University of California, Los Angeles, United States article info abstract Article history: Objective: To examine the potential contribution of the serotonin hydroxylase (TPH1 and Received 29 January 2012 TPH2) genes, and the serotonin transporter promoter polymorphism (5HTTLPR) to the unique Accepted 5 February 2012 and pleiotropic risk of PTSD symptoms and depressive symptoms. Available online xxxx Methods: Participants included 200 adults exposed to the 1988 Spitak earthquake from 12 multigenerational families (3 to 5 generations). Severity of trauma exposure, PTSD, and de- Keywords: pressive symptoms were assessed using standard psychometric instruments. Pedigree-based Genetics variance component analysis was used to assess the association between select genes and PTSD the phenotypes. Depression Results: After adjusting for age, sex, exposure and environmental variables, there was a signif- Tryptophan hydroxylase icant association of PTSD symptoms with the ‘t’ allele of TPH1 SNP rs2108977 (pb0.004), Serotonin transporter explaining 3% of the phenotypic variance.
    [Show full text]
  • List of Genes Associated with Sudden Cardiac Death (Scdgseta) Gene
    List of genes associated with sudden cardiac death (SCDgseta) mRNA expression in normal human heart Entrez_I Gene symbol Gene name Uniprot ID Uniprot name fromb D GTEx BioGPS SAGE c d e ATP-binding cassette subfamily B ABCB1 P08183 MDR1_HUMAN 5243 √ √ member 1 ATP-binding cassette subfamily C ABCC9 O60706 ABCC9_HUMAN 10060 √ √ member 9 ACE Angiotensin I–converting enzyme P12821 ACE_HUMAN 1636 √ √ ACE2 Angiotensin I–converting enzyme 2 Q9BYF1 ACE2_HUMAN 59272 √ √ Acetylcholinesterase (Cartwright ACHE P22303 ACES_HUMAN 43 √ √ blood group) ACTC1 Actin, alpha, cardiac muscle 1 P68032 ACTC_HUMAN 70 √ √ ACTN2 Actinin alpha 2 P35609 ACTN2_HUMAN 88 √ √ √ ACTN4 Actinin alpha 4 O43707 ACTN4_HUMAN 81 √ √ √ ADRA2B Adrenoceptor alpha 2B P18089 ADA2B_HUMAN 151 √ √ AGT Angiotensinogen P01019 ANGT_HUMAN 183 √ √ √ AGTR1 Angiotensin II receptor type 1 P30556 AGTR1_HUMAN 185 √ √ AGTR2 Angiotensin II receptor type 2 P50052 AGTR2_HUMAN 186 √ √ AKAP9 A-kinase anchoring protein 9 Q99996 AKAP9_HUMAN 10142 √ √ √ ANK2/ANKB/ANKYRI Ankyrin 2 Q01484 ANK2_HUMAN 287 √ √ √ N B ANKRD1 Ankyrin repeat domain 1 Q15327 ANKR1_HUMAN 27063 √ √ √ ANKRD9 Ankyrin repeat domain 9 Q96BM1 ANKR9_HUMAN 122416 √ √ ARHGAP24 Rho GTPase–activating protein 24 Q8N264 RHG24_HUMAN 83478 √ √ ATPase Na+/K+–transporting ATP1B1 P05026 AT1B1_HUMAN 481 √ √ √ subunit beta 1 ATPase sarcoplasmic/endoplasmic ATP2A2 P16615 AT2A2_HUMAN 488 √ √ √ reticulum Ca2+ transporting 2 AZIN1 Antizyme inhibitor 1 O14977 AZIN1_HUMAN 51582 √ √ √ UDP-GlcNAc: betaGal B3GNT7 beta-1,3-N-acetylglucosaminyltransfe Q8NFL0
    [Show full text]
  • Estrogen-Related Receptor Alpha: an Under-Appreciated Potential Target for the Treatment of Metabolic Diseases
    International Journal of Molecular Sciences Review Estrogen-Related Receptor Alpha: An Under-Appreciated Potential Target for the Treatment of Metabolic Diseases Madhulika Tripathi, Paul Michael Yen and Brijesh Kumar Singh * Laboratory of Hormonal Regulation, Cardiovascular and Metabolic Disorders Program, Duke-NUS Medical School, Singapore 169857, Singapore; [email protected] (M.T.); [email protected] (P.M.Y.) * Correspondence: [email protected] Received: 7 February 2020; Accepted: 24 February 2020; Published: 28 February 2020 Abstract: The estrogen-related receptor alpha (ESRRA) is an orphan nuclear receptor (NR) that significantly influences cellular metabolism. ESRRA is predominantly expressed in metabolically-active tissues and regulates the transcription of metabolic genes, including those involved in mitochondrial turnover and autophagy. Although ESRRA activity is well-characterized in several types of cancer, recent reports suggest that it also has an important role in metabolic diseases. This minireview focuses on the regulation of cellular metabolism and function by ESRRA and its potential as a target for the treatment of metabolic disorders. Keywords: estrogen-related receptor alpha; mitophagy; mitochondrial turnover; metabolic diseases; non-alcoholic fatty liver disease (NAFLD); adipogenesis; adaptive thermogenesis 1. Introduction When the estrogen-related receptor alpha (ESRRA) was first cloned, it was found to be a nuclear receptor (NR) that had DNA sequence homology to the estrogen receptor alpha (ESR1) [1]. There are several examples of estrogen-related receptor (ESRR) and estrogen-signaling cross-talk via mutual transcriptional regulation or reciprocal binding to each other’s response elements of common target genes in a context-specific manner [2,3].
    [Show full text]