DOCSLIB.ORG

Universidade Estadual De Campinas Instituto De Biologia

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Universidade Estadual De Campinas Instituto De Biologia UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA VERÔNICA APARECIDA MONTEIRO SAIA CEREDA O PROTEOMA DO CORPO CALOSO DA ESQUIZOFRENIA THE PROTEOME OF THE CORPUS CALLOSUM IN SCHIZOPHRENIA CAMPINAS 2016 1 VERÔNICA APARECIDA MONTEIRO SAIA CEREDA O PROTEOMA DO CORPO CALOSO DA ESQUIZOFRENIA THE PROTEOME OF THE CORPUS CALLOSUM IN SCHIZOPHRENIA Dissertação apresentada ao Instituto de Biologia da Universidade Estadual de Campinas como parte dos requisitos exigidos para a obtenção do Título de Mestra em Biologia Funcional e Molecular na área de concentração de Bioquímica. Dissertation presented to the Institute of Biology of the University of Campinas in partial fulfillment of the requirements for the degree of Master in Functional and Molecular Biology, in the area of Biochemistry. ESTE ARQUIVO DIGITAL CORRESPONDE À VERSÃO FINAL DA DISSERTAÇÃO DEFENDIDA PELA ALUNA VERÔNICA APARECIDA MONTEIRO SAIA CEREDA E ORIENTADA PELO DANIEL MARTINS-DE-SOUZA. Orientador: Daniel Martins-de-Souza CAMPINAS 2016 2 Agência(s) de fomento e nº(s) de processo(s): CNPq, 151787/2F2014-0 Ficha catalográfica Universidade Estadual de Campinas Biblioteca do Instituto de Biologia Mara Janaina de Oliveira - CRB 8/6972 Saia-Cereda, Verônica Aparecida Monteiro, 1988- Sa21p O proteoma do corpo caloso da esquizofrenia / Verônica Aparecida Monteiro Saia Cereda. – Campinas, SP : [s.n.], 2016. Orientador: Daniel Martins de Souza. Dissertação (mestrado) – Universidade Estadual de Campinas, Instituto de Biologia. 1. Esquizofrenia. 2. Espectrometria de massas. 3. Corpo caloso. I. Martins- de-Souza, Daniel,1979-. II. Universidade Estadual de Campinas. Instituto de Biologia. III. Título. Informações para Biblioteca Digital Título em outro idioma: The proteome of the corpus callosum in schizophrenia Palavras-chave em inglês: Schizophrenia Mass spectrometry Corpus callosum Área de concentração: Bioquímica Titulação: Mestra em Biologia Funcional e Molecular Banca examinadora: Daniel Martins de Souza [Orientador] Fábio Cesar Gozzo André Schwambach Vieira Data de defesa: 19-06-2016 Programa de Pós-Graduação: Biologia Funcional e Molecular 3 Campinas, 19 de julho de 2016. COMISSÃO EXAMINADORA Prof. Dr. Daniel Martins de Souza Prof. Dr. Fábio Cesar Gozzo Prof. Dr. André Schwambach Vieira Profa. Dra. Alessandra Sussulini Prof. Dr. José Camillo Novello Os membros da Comissão Examinadora acima assinaram a Ata de Defesa, que se encontra no processo de vida acadêmica do aluno. 4 DEDICATÓRIA Dedico essa dissertação á minha mãe, que sempre teve como objetivo a nossa educação, esse trabalho é uma forma de mostrar o meu reconhecimento ao seu esforço. Ao meu Luís por me encorajar em cada dificuldade, ter paciência comigo, me abraçar a cada obstáculo vencido e principalmente por me fazer desenvolver várias habilidades que eu não imaginava ter. 5 AGRADECIMENTOS Em particular ao Prof. Dr. Daniel Martins de Souza, por me confiar a responsabilidade de ser a sua primeira aluna, me incentivar a cada passo, investir em minha carreira me proporcionando inúmeras oportunidades. Me orgulho muito de fazer parte do seu time, sinto que não poderia ter me desenvolvido mais do que me desenvolvi nesses últimos dois anos. Ao Laboratório de Neuroproteomica, onde, como o chefe costuma falar, passei a maior parte do tempo nesses últimos dois anos. Quando me tornar uma professora, e tiver meu próprio lab, quero que ele tenha o nosso clima daqui. Tive a oportunidade de acompanhar seu crescimento do zero e aprendi muito com isso, não só sobre ciência mas também sobre vida. Tenho um carinho imenso por esse lugar, e o mais importante pelas pessoas dele. A JuMi e JuCa por aguentarem minhas Veridianices, pela companhia em viagens, pelas cervejas, risadas mil, ajudas em horários normais, mas principalmente nos inoportunos, porque são nas madrugadas e férias que surgem as maiores inquietações. Ao Paulinho, por todas as risadas e bobeiras, que foram muitas nesses últimos dois anos, principalmente as relacionadas com HD e por me ensinas muito dos seus truques de lab. A Sheilinha, fofura, que para mim sempre vai ser fofa. Por chegar e se tornar uma amiga tão rápido e por ser companheirona em todas as horas. 6 A Dani, minha filinha do coração, por me deixar participar, mesmo que em pequenos detalhes, na sua formação, que tende ser uma jornada de sucesso, me orgulho muito de você. Aos meus colegas de lab, que tornam meus dias mais felizes, Aline, Helena, Adriano, Carol, Giu, Gui. A minha sogra, Cíntia, por me incentivar, por me ensinar a lidar com “ uma coisa de cada fez”, e ser muito fofa e companheira sempre. “Aqueles que passam por nós não vão sós. Deixam um pouco de si, levam um pouco de nós.” Antoine de Saint-Exupéry 7 RESUMO A esquizofrenia (SCZ) é um transtorno mental incurável que está relacionado ao neurodesenvolvimento e afeta cerca de 1% da população mundial. A SCZ pode ser considerada a principal forma de psicose devido a sua grande frequência e importância clínica, sendo devastadora tanto para o paciente quanto para os seus familiares. No presente trabalho foram analisados e comparados o proteoma e fosfoproteoma do corpo caloso provindos de pacientes com esquizofrenia e controles pareados coletados post-mortem. Foram usados amostras previamente enriquecida para as proteínas solúveis (citoplasma) e proteoma total, nessa última análise verificamos também o conjunto de proteínas diferencialmente fosforiladas. A análise desses conjuntos de amostras foram feitas por nano-cromatografia líquida seguida de espectrometria de massas em tandem (nano LC-MS/MS). As proteínas encontradas diferencialmente expressas em ambos os estudos foram submetidas a análise de vias metabólicas no programa Ingenuity Pathway Analysis. Foi encontrado que vias de sinalização celular estão desreguladas na maior região de substância branca cerebral, com destaque para as vias Efrina e 14-3-3. Os dados gerados nessa dissertação auxiliaram em uma melhor compreensão das bases moleculares da esquizofrenia, através da integração das vias bioquímicas e na identificação de moléculas-chave na patologia. 8 ABSTRACT Schizophrenia (SCZ) is an incurable mental disorder that is related to neurodevelopment and af- fects about 1% of world population. SCZ can be considered the main form of psychosis given its high frequency and clinical significance, and it is devastating for both patients and family. This study aimed to analyze and compare the proteome and phosphoproteome of the corpus callosum stemmed from schizophrenia patients and matched controls collected post-mortem. We used pre- viously enriched samples to analyze soluble proteins (cytoplasm) and total proteome, in which were also identified the set of differentially phosphorylated proteins. The analysis of these sets of samples were made by nano liquid chromatography followed by tandem mass spectrometry (nano LC-MS / MS). The proteins found differentially expressed in both studies were subjected to anal- ysis of metabolic pathways in the Ingenuity Pathway Analysis software. It was found that cell signaling pathways are deregulated in most of cerebral white matter, especially the Ephrin and 14- 3-3 way. The data generated in this work aided in better understanding the molecular basis of schizophrenia, through the integration of biochemical pathways and the identification of key mol- ecules in the pathology. 9 ÍNDICE DE FIGURAS Figura 1 - Esquema com a compilação de estudos proteômicos realizados em tecidos cerebrais post-mortem de pacientes com esquizofrenia e controles................................................................4 Figura 2 - Esquema cérebro humano com destaque a região do corpo caloso.................................5 Figura 3 - Esquema de um espectrômetro de massa usado em análises proteômicas ....................10 Figura 4 - Ilustração esquemática do equipamento Synapt G2 Si, adaptado de Waters Corporation....................................................................................................................................11 Figura 5 - Esquema dos tipos de fragmentação dissociação induzida por colisão (CID) adaptado de Santos (2011).............................................................................................................................12 Figure 6 - Venn diagram depicting differences between expressed proteins in schizophrenia (SCZ), bipolar disorder (BPD) and major depressive disorder (MDD)………………………………….24 Figure 7 - Differentially expressed proteins commonly found in SCZ, MDD and BPD and their functional correlations using STRING database ………………………………………………...25 Figure 8 - Differentially expressed proteins predicted proteins as affected by deregulation them in SCZ, MDD and BPD……………………………………………………………………………..26 Figure 9 - Interaction network depicting similar proteins among diseases……………………....28 Figure 10 - 14-3-3-mediated Signaling as the main canonical pathway related to differentially expressed proteins in SCZ………………………………………………………………………..30 Figure 11 - Mitochondrial dysfunction as the main canonical pathway related to differentially expressed proteins in BPD……………………………………………………………………….33 Figure 12 - Oxidative phosphorylation as the main canonical pathways related to differentially expressed proteins in MDD………………………………………………………………………35 Figure 13 - Network of interactions among differentially expressed proteins according to an analysis of biological systems by Ingenuity Pathway Analysis………………………………….58 Figure 14 - Canonical pathways associated with differentially expressed proteins by Ingenuity Pathway Analysis………………………………………………………………………………...59
Load more

Recommended publications
  • Aberrant Methylation Underlies Insulin Gene Expression in Human Insulinoma
    ARTICLE https://doi.org/10.1038/s41467-020-18839-1 OPEN Aberrant methylation underlies insulin gene expression in human insulinoma Esra Karakose1,6, Huan Wang 2,6, William Inabnet1, Rajesh V. Thakker 3, Steven Libutti4, Gustavo Fernandez-Ranvier 1, Hyunsuk Suh1, Mark Stevenson 3, Yayoi Kinoshita1, Michael Donovan1, Yevgeniy Antipin1,2, Yan Li5, Xiaoxiao Liu 5, Fulai Jin 5, Peng Wang 1, Andrew Uzilov 1,2, ✉ Carmen Argmann 1, Eric E. Schadt 1,2, Andrew F. Stewart 1,7 , Donald K. Scott 1,7 & Luca Lambertini 1,6 1234567890():,; Human insulinomas are rare, benign, slowly proliferating, insulin-producing beta cell tumors that provide a molecular “recipe” or “roadmap” for pathways that control human beta cell regeneration. An earlier study revealed abnormal methylation in the imprinted p15.5-p15.4 region of chromosome 11, known to be abnormally methylated in another disorder of expanded beta cell mass and function: the focal variant of congenital hyperinsulinism. Here, we compare deep DNA methylome sequencing on 19 human insulinomas, and five sets of normal beta cells. We find a remarkably consistent, abnormal methylation pattern in insu- linomas. The findings suggest that abnormal insulin (INS) promoter methylation and altered transcription factor expression create alternative drivers of INS expression, replacing cano- nical PDX1-driven beta cell specification with a pathological, looping, distal enhancer-based form of transcriptional regulation. Finally, NFaT transcription factors, rather than the cano- nical PDX1 enhancer complex, are predicted to drive INS transactivation. 1 From the Diabetes Obesity and Metabolism Institute, The Department of Surgery, The Department of Pathology, The Department of Genetics and Genomics Sciences and The Institute for Genomics and Multiscale Biology, The Icahn School of Medicine at Mount Sinai, New York, NY 10029, USA.
    [Show full text]
  • Cyclin D1/Cyclin-Dependent Kinase 4 Interacts with Filamin a and Affects the Migration and Invasion Potential of Breast Cancer Cells
    Published OnlineFirst February 28, 2010; DOI: 10.1158/0008-5472.CAN-08-1108 Tumor and Stem Cell Biology Cancer Research Cyclin D1/Cyclin-Dependent Kinase 4 Interacts with Filamin A and Affects the Migration and Invasion Potential of Breast Cancer Cells Zhijiu Zhong, Wen-Shuz Yeow, Chunhua Zou, Richard Wassell, Chenguang Wang, Richard G. Pestell, Judy N. Quong, and Andrew A. Quong Abstract Cyclin D1 belongs to a family of proteins that regulate progression through the G1-S phase of the cell cycle by binding to cyclin-dependent kinase (cdk)-4 to phosphorylate the retinoblastoma protein and release E2F transcription factors for progression through cell cycle. Several cancers, including breast, colon, and prostate, overexpress the cyclin D1 gene. However, the correlation of cyclin D1 overexpression with E2F target gene regulation or of cdk-dependent cyclin D1 activity with tumor development has not been identified. This suggests that the role of cyclin D1 in oncogenesis may be independent of its function as a cell cycle regulator. One such function is the role of cyclin D1 in cell adhesion and motility. Filamin A (FLNa), a member of the actin-binding filamin protein family, regulates signaling events involved in cell motility and invasion. FLNa has also been associated with a variety of cancers including lung cancer, prostate cancer, melanoma, human bladder cancer, and neuroblastoma. We hypothesized that elevated cyclin D1 facilitates motility in the invasive MDA-MB-231 breast cancer cell line. We show that MDA-MB-231 motility is affected by disturbing cyclin D1 levels or cyclin D1-cdk4/6 kinase activity.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • And Β-Keratins on Developing Chicken Skin Integuments: Functional Interaction and Evolutionary Perspectives
    Topographical mapping of α- and β-keratins on developing chicken skin integuments: Functional interaction and evolutionary perspectives Ping Wua,1, Chen Siang Ngb,1, Jie Yana,c, Yung-Chih Laia,d,e, Chih-Kuan Chenb,f, Yu-Ting Laib, Siao-Man Wub, Jiun-Jie Chenb, Weiqi Luoa, Randall B. Widelitza, Wen-Hsiung Lib,g,2, and Cheng-Ming Chuonga,d,e,h,2 aDepartment of Pathology, Keck School of Medicine, University of Southern California, Los Angeles, CA 90033; bBiodiversity Research Center, Academia Sinica, Taipei 11529, Taiwan; cJiangsu Key Laboratory for Biodiversity and Biotechnology, College of Life Sciences, Nanjing Normal University, Nanjing 210023, China; dResearch Center for Developmental Biology and Regenerative Medicine, National Taiwan University, Taipei 10041, Taiwan; eIntegrative Stem Cell Center, China Medical University, Taichung 40447, Taiwan; fInstitute of Ecology and Evolutionary Biology, National Taiwan University, Taipei 10617, Taiwan; gDepartment of Ecology and Evolution, University of Chicago, Chicago, IL 60637; and hCenter for the Integrative and Evolutionary Galliform Genomics, National Chung Hsing University, Taichung 40227, Taiwan Contributed by Wen-Hsiung Li, October 19, 2015 (sent for review July 19, 2015; reviewed by Scott V. Edwards and Roger H. Sawyer) Avian integumentary organs include feathers, scales, claws, and innovations of feather development genes predate the origin of beaks. They cover the body surface and play various functions to feathers, suggesting that the avian dinosaur ancestor already had help adapt birds to diverse environments. These keratinized struc- the nonkeratin protein-coding toolkit for making feathers (12). α tures are mainly composed of corneous materials made of -keratins, While fewer new genes have been found in bird genomes (13) β which exist in all vertebrates, and -keratins, which only exist in birds and the α-keratin gene family has shrunk in birds relative to and reptiles.
    [Show full text]
  • DNA Methylation Signatures of Early Childhood Malnutrition Associated with Impairments in Attention and Cognition
    Biological Archival Report Psychiatry DNA Methylation Signatures of Early Childhood Malnutrition Associated With Impairments in Attention and Cognition Cyril J. Peter, Laura K. Fischer, Marija Kundakovic, Paras Garg, Mira Jakovcevski, Aslihan Dincer, Ana C. Amaral, Edward I. Ginns, Marzena Galdzicka, Cyralene P. Bryce, Chana Ratner, Deborah P. Waber, David Mokler, Gayle Medford, Frances A. Champagne, Douglas L. Rosene, Jill A. McGaughy, Andrew J. Sharp, Janina R. Galler, and Schahram Akbarian ABSTRACT BACKGROUND: Early childhood malnutrition affects 113 million children worldwide, impacting health and increasing vulnerability for cognitive and behavioral disorders later in life. Molecular signatures after childhood malnutrition, including the potential for intergenerational transmission, remain unexplored. METHODS: We surveyed blood DNA methylomes (483,000 individual CpG sites) in 168 subjects across two generations, including 50 generation 1 individuals hospitalized during the first year of life for moderate to severe protein-energy malnutrition, then followed up to 48 years in the Barbados Nutrition Study. Attention deficits and cognitive performance were evaluated with the Connors Adult Attention Rating Scale and Wechsler Abbreviated Scale of Intelligence. Expression of nutrition-sensitive genes was explored by quantitative reverse transcriptase polymerase chain reaction in rat prefrontal cortex. RESULTS: We identified 134 nutrition-sensitive, differentially methylated genomic regions, with most (87%) specific for generation 1. Multiple neuropsychiatric risk genes, including COMT, IFNG, MIR200B, SYNGAP1, and VIPR2 showed associations of specific methyl-CpGs with attention and IQ. IFNG expression was decreased in prefrontal cortex of rats showing attention deficits after developmental malnutrition. CONCLUSIONS: Early childhood malnutrition entails long-lasting epigenetic signatures associated with liability for attention and cognition, and limited potential for intergenerational transmission.
    [Show full text]
  • Supplementary Figures
    Mena regulates the LINC complex to control actin–nuclear lamina associations, trans-nuclear membrane signalling and cancer gene expression Frederic Li Mow Chee!, Bruno Beernaert!, Alexander Loftus!, Yatendra Kumar", Billie G. C. Griffith!, Jimi C. Wills!, Ann P. Wheeler#, J. Douglas Armstrong$, Maddy Parsons%, Irene M. Leigh,(, Charlotte M. Proby&, Alex von Kriegsheim!, Wendy A. Bickmore", Margaret C. Frame,* & Adam Byron,* Supplementary Information Supplementary Figure 1 Supplementary Figure 2 Supplementary Figure 3 Supplementary Table 1 Supplementary Table 2 Supplementary Table 3 Supplementary Table 4 !Cancer Research UK Edinburgh Centre, Institute of Genetics and Cancer, University of Edinburgh, Edinburgh EH< =XR, UK. "MRC Human Genetics Unit, Institute of Genetics and Cancer, University of Edinburgh, Edinburgh EH< =XU, UK. #Advanced Imaging Resource, Institute of Genetics and Cancer, University of Edinburgh, Edinburgh EH< =XU, UK. $Simons Initiative for the Developing Brain, School of Informatics, University of Edinburgh, Edinburgh EHH IYL, UK. %Randall Centre for Cell and Molecular Biophysics, King’s College London, London SEM MUL, UK. &Division of Molecular and Clinical Medicine, School of Medicine, University of Dundee, Dundee DD <HN, UK. 'Institute of Dentistry, Barts and the London School of Medicine and Dentistry, Queen Mary University of London, London EM =AT, UK. *email: [email protected] or [email protected] 1 a cSCC IAC correlation b cSCC IAC pathways c Core adhesome network ENAH −log10(q) MACF1 CSRP1 Met1 Met4 0 5 10 + + CORO2A Integrin signalling + CFL1 pathway PRNP ILK + HSPB1 PALLD PPFIA1 TES RDX Cytoskeletal regulation + VASP + + ARPC2 by Rho GTPase PPP2CA + Met1 + LASP1 MYH9 + VIM TUBA4A Huntington ITGA3 + disease ITGB4 VCL CAV1 ACTB ROCK1 KTN1 FLNA+ CALR DNA FBLIM1 CORO1B RAC1 + replication +ACTN1 ITGA6 + Met4 ITGAV Parkinson ITGB1 disease Actin cytoskel.
    [Show full text]
  • Dog Coat Colour Genetics: a Review Date Published Online: 31/08/2020; 1,2 1 1 3 Rashid Saif *, Ali Iftekhar , Fatima Asif , Mohammad Suliman Alghanem
    www.als-journal.com/ ISSN 2310-5380/ August 2020 Review Article Advancements in Life Sciences – International Quarterly Journal of Biological Sciences ARTICLE INFO Open Access Date Received: 02/05/2020; Date Revised: 20/08/2020; Dog Coat Colour Genetics: A Review Date Published Online: 31/08/2020; 1,2 1 1 3 Rashid Saif *, Ali Iftekhar , Fatima Asif , Mohammad Suliman Alghanem Authors’ Affiliation: 1. Institute of Abstract Biotechnology, Gulab Devi Educational anis lupus familiaris is one of the most beloved pet species with hundreds of world-wide recognized Complex, Lahore - Pakistan breeds, which can be differentiated from each other by specific morphological, behavioral and adoptive 2. Decode Genomics, traits. Morphological characteristics of dog breeds get more attention which can be defined mostly by 323-D, Town II, coat color and its texture, and considered to be incredibly lucrative traits in this valued species. Although Punjab University C Employees Housing the genetic foundation of coat color has been well stated in the literature, but still very little is known about the Scheme, Lahore - growth pattern, hair length and curly coat trait genes. Skin pigmentation is determined by eumelanin and Pakistan 3. Department of pheomelanin switching phenomenon which is under the control of Melanocortin 1 Receptor and Agouti Signaling Biology, Tabuk Protein genes. Genetic variations in the genes involved in pigmentation pathway provide basic understanding of University - Kingdom melanocortin physiology and evolutionary adaptation of this trait. So in this review, we highlighted, gathered and of Saudi Arabia comprehend the genetic mutations, associated and likely to be associated variants in the genes involved in the coat color and texture trait along with their phenotypes.
    [Show full text]
  • Downregulation of Salivary Proteins, Protective Against Dental Caries, in Type 1 Diabetes
    proteomes Article Downregulation of Salivary Proteins, Protective against Dental Caries, in Type 1 Diabetes Eftychia Pappa 1,* , Konstantinos Vougas 2, Jerome Zoidakis 2 , William Papaioannou 3, Christos Rahiotis 1 and Heleni Vastardis 4 1 Department of Operative Dentistry, School of Dentistry, National and Kapodistrian University of Athens, 11527 Athens, Greece; [email protected] 2 Proteomics Laboratory, Biomedical Research Foundation Academy of Athens, 11527 Athens, Greece; [email protected] (K.V.); [email protected] (J.Z.) 3 Department of Preventive and Community Dentistry, School of Dentistry, National and Kapodistrian University of Athens, 11527 Athens, Greece; [email protected] 4 Department of Orthodontics, School of Dentistry, National and Kapodistrian University of Athens, 11527 Athens, Greece; [email protected] * Correspondence: effi[email protected] Abstract: Saliva, an essential oral secretion involved in protecting the oral cavity’s hard and soft tissues, is readily available and straightforward to collect. Recent studies have analyzed the sali- vary proteome in children and adolescents with extensive carious lesions to identify diagnostic and prognostic biomarkers. The current study aimed to investigate saliva’s diagnostic ability through proteomics to detect the potential differential expression of proteins specific for the occurrence of carious lesions. For this study, we performed bioinformatics and functional analysis of proteomic datasets, previously examined by our group, from samples of adolescents with regulated and unreg- ulated type 1 diabetes, as they compare with healthy controls. Among the differentially expressed Citation: Pappa, E.; Vougas, K.; proteins relevant to caries pathology, alpha-amylase 2B, beta-defensin 4A, BPI fold containing family Zoidakis, J.; Papaioannou, W.; Rahiotis, C.; Vastardis, H.
    [Show full text]
  • Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas
    Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • (Pnss) En Genes Candidatos Para Las Características De La Fibra En Alpacas
    Revista peruana de biología 26(1): 087 - 094 (2019) Identificación bioinformática de Polimorfismos de doi: http://dx.doi.org/10.15381/rpb.v26i1.15911 ISSN-L 1561-0837; eISSN: 1727-9933 Nucleótido Simple (PNSs) en genes candidatos para Universidad Nacional Mayor de San Marcos las características de la fibra en alpacas (Vicugna pacos) Bioinformatic identification of Single Nucleotide Polymor- Trabajos originales phisms (SNPs) in candidate genes for fiber characteristics in Presentado: 31/07/2018 alpacas (Vicugna pacos) Aceptado: 03/02/2019 Publicado online: 30/03/2019 Correspondencia: 1 *Autor para correspondencia Alvaro Gonzalo Fernández Suárez* , Gustavo Augusto Gutiérrez 1 Universidad Nacional Agraria La Molina. Av. La Reynoso 1, Federico Abel Ponce de León Bravo 2 Molina S/N, Lima 12. 2 University of Minnesota, St. Paul, MN 55108, 1 Universidad Nacional Agraria La Molina, Perú. United States. 2 University of Minnesota, United States. Email AGFS: [email protected] Email GAGR: [email protected] Email FAPLB: [email protected] ORCID FAPdLB: 0000-0001-8645-553X ORCID GAGR: 0000-0002-1896-0048 Citación: Resumen Fernández Suárez A.G., G.A. Gutiérrez Reynoso, El objetivo fue identificar y predecir la ubicación de polimorfismos de nucleótido F.A. Ponce de León Bravo. 2019. Bioinformatic simple (PNSs) en genes relacionados al crecimiento de la fibra. Se realizó el estudio identification of Single Nucleotide Polymorphisms con un total de 31 genes de queratina (KRT9, KRT12, KRT13, KRT14, KRT16, KRT18, (SNPs) in candidate genes for fiber characteristics KRT20, KRT25, KRT1, KRT3, KRT5, KRT6a, KRT6b, KRT6c, KRT7, KRT8, KRT71, KRT80, in alpacas (Vicugna pacos). Revista peruana de KRT31, KRT32, KIRT40, KRT81, KRT82, KRT10, KRT15, KRT17 KRT19, KRT2, KRT4, biología 26(1): 087 - 094 (Febrero 2019).
    [Show full text]
  • Structural and Biochemical Changes Underlying a Keratoderma-Like Phenotype in Mice Lacking Suprabasal AP1 Transcription Factor Function
    Citation: Cell Death and Disease (2015) 6, e1647; doi:10.1038/cddis.2015.21 OPEN & 2015 Macmillan Publishers Limited All rights reserved 2041-4889/15 www.nature.com/cddis Structural and biochemical changes underlying a keratoderma-like phenotype in mice lacking suprabasal AP1 transcription factor function EA Rorke*,1, G Adhikary2, CA Young2, RH Rice3, PM Elias4, D Crumrine4, J Meyer4, M Blumenberg5 and RL Eckert2,6,7,8 Epidermal keratinocyte differentiation on the body surface is a carefully choreographed process that leads to assembly of a barrier that is essential for life. Perturbation of keratinocyte differentiation leads to disease. Activator protein 1 (AP1) transcription factors are key controllers of this process. We have shown that inhibiting AP1 transcription factor activity in the suprabasal murine epidermis, by expression of dominant-negative c-jun (TAM67), produces a phenotype type that resembles human keratoderma. However, little is understood regarding the structural and molecular changes that drive this phenotype. In the present study we show that TAM67-positive epidermis displays altered cornified envelope, filaggrin-type keratohyalin granule, keratin filament, desmosome formation and lamellar body secretion leading to reduced barrier integrity. To understand the molecular changes underlying this process, we performed proteomic and RNA array analysis. Proteomic study of the corneocyte cross-linked proteome reveals a reduction in incorporation of cutaneous keratins, filaggrin, filaggrin2, late cornified envelope precursor proteins, hair keratins and hair keratin-associated proteins. This is coupled with increased incorporation of desmosome linker, small proline-rich, S100, transglutaminase and inflammation-associated proteins. Incorporation of most cutaneous keratins (Krt1, Krt5 and Krt10) is reduced, but incorporation of hyperproliferation-associated epidermal keratins (Krt6a, Krt6b and Krt16) is increased.
    [Show full text]