DOCSLIB.ORG

Supplementary Figures

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Mena regulates the LINC complex to control actin–nuclear lamina associations, trans-nuclear membrane signalling and cancer gene expression Frederic Li Mow Chee!, Bruno Beernaert!, Alexander Loftus!, Yatendra Kumar", Billie G. C. Griffith!, Jimi C. Wills!, Ann P. Wheeler#, J. Douglas Armstrong$, Maddy Parsons%, Irene M. Leigh,(, Charlotte M. Proby&, Alex von Kriegsheim!, Wendy A. Bickmore", Margaret C. Frame,* & Adam Byron,* Supplementary Information Supplementary Figure 1 Supplementary Figure 2 Supplementary Figure 3 Supplementary Table 1 Supplementary Table 2 Supplementary Table 3 Supplementary Table 4 !Cancer Research UK Edinburgh Centre, Institute of Genetics and Cancer, University of Edinburgh, Edinburgh EH< =XR, UK. "MRC Human Genetics Unit, Institute of Genetics and Cancer, University of Edinburgh, Edinburgh EH< =XU, UK. #Advanced Imaging Resource, Institute of Genetics and Cancer, University of Edinburgh, Edinburgh EH< =XU, UK. $Simons Initiative for the Developing Brain, School of Informatics, University of Edinburgh, Edinburgh EHH IYL, UK. %Randall Centre for Cell and Molecular Biophysics, King’s College London, London SEM MUL, UK. &Division of Molecular and Clinical Medicine, School of Medicine, University of Dundee, Dundee DD <HN, UK. 'Institute of Dentistry, Barts and the London School of Medicine and Dentistry, Queen Mary University of London, London EM =AT, UK. *email: [email protected] or [email protected] 1 a cSCC IAC correlation b cSCC IAC pathways c Core adhesome network ENAH −log10(q) MACF1 CSRP1 Met1 Met4 0 5 10 + + CORO2A Integrin signalling + CFL1 pathway PRNP ILK + HSPB1 PALLD PPFIA1 TES RDX Cytoskeletal regulation + VASP + + ARPC2 by Rho GTPase PPP2CA + Met1 + LASP1 MYH9 + VIM TUBA4A Huntington ITGA3 + disease ITGB4 VCL CAV1 ACTB ROCK1 KTN1 FLNA+ CALR DNA FBLIM1 CORO1B RAC1 + replication +ACTN1 ITGA6 + Met4 ITGAV Parkinson ITGB1 disease Actin cytoskel. PXN + SVIL + MSN ABI1 + LIMS1 + CTTN Cell + Actin binding PLEC + RHOA cycle q + TLN1 + ARHGEF2 log10 PARVA + PTK2 mRNA scale EZR Pearson splicing ≥0.05 0.001 CAPN2 correlation TRIP6 TUBA1B + coefficient Overlap log (Met4/Met1) SLC3A2 2 RAVER1 MARCKS 0.7 1.0 0 >50 ≤−3 0 ≥3 FHL2 FERMT3 Physical interaction Pathway association d IAC principal component analysis e Core adhesome clustering 20 Met4 Actin cytoskeleton Met1 10 Actin binding Actin organisation 0 −10 ENAH TRIP6 CAV1 KTN1 SLC3A2 MARCKS LASP1 TUBA1B ABI1 FBLIM1 EZR VCL HSPB1 TES PRNP ARHGEF2 RAVER1 RAC1 SVIL PPP2CA PALLD CAPN2 PLEC MYH9 MACF1 CTTN CFL1 CSRP1 CORO2A ITGB1 RHOA TUBA4A ITGB4 FLNA ITGA6 FERMT3 ACTB ARPC2 ACTN1 PARVA VASP RDX ITGA3 LIMS1 PTK2 TLN1 CORO1B CALR PXN FHL2 MSN ILK ITGAV ROCK1 VIM PPFIA1 Component 2 (5.5%) −20 −25 0 25 50 Component 1 (83.4%) f IAC Mena validation IAC Lysate cSCC: Met1Met4 Met1Met4 Met1 Met4 100 Mena IAC 75 100 High exp. 75 High exp. Z-score Cyto. 37 GAPDH −1.3 0 1.3 20 Mito. 15 COX IV Meta-adhesome 20 dataset occurrence Nucl. 15 Histone H3 kDa 1 7 g IAC active module: alternative clustering h Actin regulation cluster: alternative Transcription Mena coactivator Network view Nesprin-2 Protein complex activity TCP-1ε + scaffold activity + WDR76 + GTPase activity HSPA6 hPrp4 snRNA 9 1 Helicase activity binding ATPase activity CDK9 + DNA binding DnaJA2 Actin regulation/ TCP-1δ + 8 2 protein binding + + TCP-1α Cell 7 6 TCP-1θ adhesion 3 Core cSCC molecule TRIM28 adhesome binding 5 4 ERK signalling Meta-adhesome + Actin binding log2(Met4/Met1) ECM Cell adhesion/ ≤−3 0 ≥3 Growth factor protein binding Core cSCC binding adhesome Hub 1 Nucleotidyl- 4 Ribosome 8 Actin binding Non-hub transferase rRNA binding Cytoskeleton log (Met4/Met1) activity 2 5 Lyase activity 9 Transcription 2 Cell adhesion ≤−3 0 ≥3 6 mRNA binding coactivator molecule binding activity Ribosome 3 Histone Nucleosome binding 7 Actin binding binding Supplementary Figure 1. See next page for caption. 2 Supplementary Figure 1. Proteomic analysis of patient-derived cSCC IACs. (a) Sample correlation analysis of mass spectrometric analyses of Met1 and Met4 IACs (n = 3 independent biological replicates). Pearson correlation coecients for all pairwise sample comparisons were subjected to hierarchical clustering. (b) Over-representation analysis of Panther pathways in the cSCC IAC subproteome. Purple shading intensity indicates size of subproteome overlap with respective gene sets (q < 0.05, hypergeometric test with Benjamini–Hochberg correction). (c) Functional association network of the core cSCC adhesome. Proteins (nodes) are coloured according to protein enrichment in Met1 or Met4 IACs and annotated with gene names for clarity. Node size represents signicance of dierential enrichment between Met1 and Met4 IACs (two-sided t-test with Benjamini–Hochberg correction; n = 3 independent biological replicates). Black node borders indicate actin-cytoskeletal proteins; actin-binding proteins are indicated by a plus sign. (d) Principal component analysis of Met1 and Met4 IACs. (e) Hierarchical cluster analysis of the core cSCC adhesome. Data are as for Fig. 1e with additional annotation. Frequency of occurrence in meta-adhesome datasets is indicated, and proteins are annotated with gene names for clarity. (f) Isolation of Mena in Met4 IACs as determined by western blotting. GAPDH (cyto., cytoplasmic), COX IV (mito., mitochondrial) and histone H3 (nucl., nuclear) were probed as non-adhesion control proteins. High exp., high exposure of blot. (g) Maximal-scoring active module of the cSCC IAC interactome. e network is based on that in Fig. 1g, but it was partitioned using the constant Potts model, resolved for maximum Surprise quality function. Proteins (nodes) are coloured according to assigned cluster (le panel). Molecular functions enriched in protein clusters were determined by Gene Ontology over-representation analysis (the two most signicant functional categories are labelled). For protein clusters with fewer than two signicant functional categories, clusters were annotated manually with a single representative term. Network view (right panel) shows corresponding protein interactions (edge densities) in the partitioned network; nodes are coloured according to protein enrichment in Met1 or Met4 IACs. e actin regulation cluster detailed in h is indicated with a red arrowhead. Large nodes indicate kinless and connector hubs; black node borders indicate core adhesome proteins. (h) Subnetwork analysis of the actin regulation cluster identied by active module partitioning in g. e weighted subnetwork was clustered using a force-directed algorithm. Nodes are coloured according to protein enrichment in Met1 or Met4 IACs. a Mena re-expression b Mena sequence alignment −/− −/− Met4 GGATCAACAATAGAAACAGAACAAAAAGAGGACAAAGGTGAAGATTCAGAGCCTGTAACT 355 Pan-Mena GGATCAACAATAGAAACAGAACAAAAAGAGGACAAAGGTGAAGATTCAGAGCCTGTAACT 1500 Mena11a GGATCAACAATAGAAACAGAACAAAAAGAGGACAAAGGTGAAGATTCAGAGCCTGTAACT 1500 Met4 Met4 MenaMet4 Mena ************************************************************ +Mena11a 100 75 Mena Met4 TCTAAGGCCTCTTCAACAAGTACACCTGAACCAACAAGAAAACCTTGGGAAAGAACAAAT 415 Pan-Mena TCTAAGGCCTCTTCAACAAGTACACCTGAACCAACAAGAAAACCTTGGGAAAGAACAAAT 1560 Lysate 37 Mena11a kDa GAPDH TCTAAGGCCTCTTCAACAAGTACACCTGAACCAACAAGAAAACCTTGGGAAAGAACAAAT 1560 ************************************************************ Met4 ACAATGAATGGCAGCAAGTCACCTGTTATCTCCAGACGGGATTCTCCAAGGAAAAATCAG 475 Pan-Mena ACAATGAATGGCAGCAAGTCACCTGTTATCTCCAGA------------------------ 1596 Mena11a ACAATGAATGGCAGCAAGTCACCTGTTATCTCCAGACGGGATTCTCCAAGGAAAAATCAG 1620 ************************************ Met4 ATTGTTTTTGACAACAGGTCCTATGATTCATTACACAGACCAAAATCCACACCCTTATCA 535 Pan-Mena ---------------------------------------CCAAAATCCACACCCTTATCA 1617 Mena11a ATTGTTTTTGACAACAGGTCCTATGATTCATTACACAGACCAAAATCCACACCCTTATCA 1680 ********************* Met4 CAGCCCAGTGCCAATGGAGTCCAGACGGAAGGACTTGACTATGACAGGCTGAAGCAGGAC 595 Pan-Mena CAGCCCAGTGCCAATGGAGTCCAGACGGAAGGACTTGACTATGACAGGCTGAAGCAGGAC 1677 Mena11a CAGCCCAGTGCCAATGGAGTCCAGACGGAAGGACTTGACTATGACAGGCTGAAGCAGGAC 1740 ************************************************************ Met4 ATTTTAGATGAAATGAGAAAAGAATTAACAAAGCTAAAAGAAGAGCTCATTGATGCAATC 655 Pan-Mena ATTTTAGATGAAATGAGAAAAGAATTAACAAAGCTAAAAGAAGAGCTCATTGATGCAATC 1737 Mena11a ATTTTAGATGAAATGAGAAAAGAATTAACAAAGCTAAAAGAAGAGCTCATTGATGCAATC 1800 ************************************************************ Supplementary Figure 2. Analysis of Mena expression in Met4 cSCC cells. (a) Western blot analysis of endogenous Mena in parental Met4 cells, absence of Mena in Mena-depleted Met4 cells (Met4 Mena−/−) and re-expression of Mena11a in Met4 Mena−/− cells (Met4 Mena−/− +Mena11a). (b) Nucleotide sequence alignment of endogenous Mena transcript sequenced from Met4 cells. Mena sequence compared to pan-Mena (GenBank accession KM214203.1) and Mena11a (GenBank accession KM214204.1) coding sequences. Grey boxes indicate the additional Mena11a exon coding sequence. Asterisks indicate exact residue conservation. 3 a H3K27me3 quantification b Multiplexed gene expression data normalisation −/− −/− H3K27me3 rel. intensity 2 (norm. to histone H3) n.s. * Met4 Met4 MenaMet4 Mena ** 20 +GFP-Mena11a H3K27me3 1.00 0 15 expression 2 20 0.75 15 Histone H3 0.50 Relative log −2 100 GFP-Mena11a 0.25 75 Mena kDa 0 −/− −/− Rep.: 1 2 3 4 1 2 3 4 Met4 Met4 Met4 Mena−/− Met4 MenaMet4 Mena +GFP-Mena11a c Gene expression principal component analysis d Gene expression clustering Cell migration Met4 Mena−/− ECM organisation Immune response Met4 25 CHAD CD24 COL18A1 ARAP2 GPR56 CTSH ARHGDIB ID1 ID2 LAMA5 NOTCH1 EPAS1 SRC TLR4 CLU ADAP1
Recommended publications
  • Cyclin D1/Cyclin-Dependent Kinase 4 Interacts with Filamin a and Affects the Migration and Invasion Potential of Breast Cancer Cells

    Cyclin D1/Cyclin-Dependent Kinase 4 Interacts with Filamin a and Affects the Migration and Invasion Potential of Breast Cancer Cells

    Published OnlineFirst February 28, 2010; DOI: 10.1158/0008-5472.CAN-08-1108 Tumor and Stem Cell Biology Cancer Research Cyclin D1/Cyclin-Dependent Kinase 4 Interacts with Filamin A and Affects the Migration and Invasion Potential of Breast Cancer Cells Zhijiu Zhong, Wen-Shuz Yeow, Chunhua Zou, Richard Wassell, Chenguang Wang, Richard G. Pestell, Judy N. Quong, and Andrew A. Quong Abstract Cyclin D1 belongs to a family of proteins that regulate progression through the G1-S phase of the cell cycle by binding to cyclin-dependent kinase (cdk)-4 to phosphorylate the retinoblastoma protein and release E2F transcription factors for progression through cell cycle. Several cancers, including breast, colon, and prostate, overexpress the cyclin D1 gene. However, the correlation of cyclin D1 overexpression with E2F target gene regulation or of cdk-dependent cyclin D1 activity with tumor development has not been identified. This suggests that the role of cyclin D1 in oncogenesis may be independent of its function as a cell cycle regulator. One such function is the role of cyclin D1 in cell adhesion and motility. Filamin A (FLNa), a member of the actin-binding filamin protein family, regulates signaling events involved in cell motility and invasion. FLNa has also been associated with a variety of cancers including lung cancer, prostate cancer, melanoma, human bladder cancer, and neuroblastoma. We hypothesized that elevated cyclin D1 facilitates motility in the invasive MDA-MB-231 breast cancer cell line. We show that MDA-MB-231 motility is affected by disturbing cyclin D1 levels or cyclin D1-cdk4/6 kinase activity.
  • Tubulin in Platelets: When the Shape Matters

    Tubulin in Platelets: When the Shape Matters

    International Journal of Molecular Sciences Review Tubulin in Platelets: When the Shape Matters Ernesto José Cuenca-Zamora 1 , Francisca Ferrer-Marín 1,2,*, José Rivera 1 and Raúl Teruel-Montoya 1 1 Servicio de Hematología y Oncología Médica, Centro Regional de Hemodonación, Hospital Universitario Morales Meseguer, IMIB-Arrixaca, Red CIBERER CB15/00055, 30003 Murcia, Spain 2 Grado de Medicina, Universidad Católica San Antonio (UCAM), Campus de los Jerónimos, 30107 Murcia, Spain * Correspondence: ff[email protected]; Tel.: +34-968-341990 Received: 1 May 2019; Accepted: 17 June 2019; Published: 16 July 2019 Abstract: Platelets are anuclear cells with a short lifespan that play an essential role in many pathophysiological processes, including haemostasis, inflammation, infection, vascular integrity, and metastasis. Billions of platelets are produced daily from megakaryocytes (platelet precursors). Despite this high production, the number of circulating platelets is stable and, under resting conditions, they maintain their typical discoid shape thanks to cytoskeleton proteins. The activation of platelets is associated with dynamic and rapid changes in the cytoskeleton. Two cytoskeletal polymer systems exist in megakaryocytes and platelets: actin filaments and microtubules, based on actin, and α- and β-tubulin heterodimers, respectively. Herein, we will focus on platelet-specific tubulins and their alterations and role of the microtubules skeleton in platelet formation (thrombopoiesis). During this process, microtubules mediate elongation
  • Universidade Estadual De Campinas Instituto De Biologia

    Universidade Estadual De Campinas Instituto De Biologia

    UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA VERÔNICA APARECIDA MONTEIRO SAIA CEREDA O PROTEOMA DO CORPO CALOSO DA ESQUIZOFRENIA THE PROTEOME OF THE CORPUS CALLOSUM IN SCHIZOPHRENIA CAMPINAS 2016 1 VERÔNICA APARECIDA MONTEIRO SAIA CEREDA O PROTEOMA DO CORPO CALOSO DA ESQUIZOFRENIA THE PROTEOME OF THE CORPUS CALLOSUM IN SCHIZOPHRENIA Dissertação apresentada ao Instituto de Biologia da Universidade Estadual de Campinas como parte dos requisitos exigidos para a obtenção do Título de Mestra em Biologia Funcional e Molecular na área de concentração de Bioquímica. Dissertation presented to the Institute of Biology of the University of Campinas in partial fulfillment of the requirements for the degree of Master in Functional and Molecular Biology, in the area of Biochemistry. ESTE ARQUIVO DIGITAL CORRESPONDE À VERSÃO FINAL DA DISSERTAÇÃO DEFENDIDA PELA ALUNA VERÔNICA APARECIDA MONTEIRO SAIA CEREDA E ORIENTADA PELO DANIEL MARTINS-DE-SOUZA. Orientador: Daniel Martins-de-Souza CAMPINAS 2016 2 Agência(s) de fomento e nº(s) de processo(s): CNPq, 151787/2F2014-0 Ficha catalográfica Universidade Estadual de Campinas Biblioteca do Instituto de Biologia Mara Janaina de Oliveira - CRB 8/6972 Saia-Cereda, Verônica Aparecida Monteiro, 1988- Sa21p O proteoma do corpo caloso da esquizofrenia / Verônica Aparecida Monteiro Saia Cereda. – Campinas, SP : [s.n.], 2016. Orientador: Daniel Martins de Souza. Dissertação (mestrado) – Universidade Estadual de Campinas, Instituto de Biologia. 1. Esquizofrenia. 2. Espectrometria de massas. 3. Corpo caloso.
  • Plakins, a Versatile Family of Cytolinkers: Roles in Skin Integrity and in Human Diseases Jamal-Eddine Bouameur1,2, Bertrand Favre1 and Luca Borradori1

    Plakins, a Versatile Family of Cytolinkers: Roles in Skin Integrity and in Human Diseases Jamal-Eddine Bouameur1,2, Bertrand Favre1 and Luca Borradori1

    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector REVIEW Plakins, a Versatile Family of Cytolinkers: Roles in Skin Integrity and in Human Diseases Jamal-Eddine Bouameur1,2, Bertrand Favre1 and Luca Borradori1 The plakin family consists of giant proteins involved in in (Roper et al., 2002; Jefferson et al., 2004; Sonnenberg and the cross-linking and organization of the cytoskeleton Liem, 2007; Boyer et al., 2010; Suozzi et al., 2012). and adhesion complexes. They further modulate sev- Mammalian plakins share a similar structural organization eral fundamental biological processes, such as cell and comprise seven members: bullous pemphigoid antigen 1 adhesion, migration, and polarization or signaling (BPAG1), desmoplakin, envoplakin, epiplakin, microtubule- pathways. Inherited and acquired defects of plakins actin cross-linking factor 1 (MACF1), periplakin, and plectin in humans and in animal models potentially lead to (Figure 1) (Choi et al., 2002; Jefferson et al., 2007; Choi and dramatic manifestations in the skin, striated muscles, Weis, 2011; Ortega et al., 2011). The existence of develop- and/or nervous system. These observations unequivo- mentally regulated and tissue-specific splice variants of some cally demonstrate the key role of plakins in the plakins further increases the diversity and versatility of these proteins (Table 1; Figure 1; Leung et al., 2001; Rezniczek et al., maintenance of tissue integrity. Here we review the 2003; Lin et al., 2005; Jefferson et al., 2006; Cabral et al., 2010). characteristics of the mammalian plakin members BPAG1 (bullous pemphigoid antigen 1), desmoplakin, PLAKINS IN THE EPIDERMIS plectin, envoplakin, epiplakin, MACF1 (microtubule- Epithelial BPAG1 (BPAG1e, also called BP230) constitutes the actin cross-linking factor 1), and periplakin, highlight- epithelium-specific isoform of BPAG1 and is localized in basal ing their role in skin homeostasis and diseases.
  • How Microtubules Control Focal Adhesion Dynamics

    How Microtubules Control Focal Adhesion Dynamics

    JCB: Review Targeting and transport: How microtubules control focal adhesion dynamics Samantha Stehbens and Torsten Wittmann Department of Cell and Tissue Biology, University of California, San Francisco, San Francisco, CA 94143 Directional cell migration requires force generation that of integrin-mediated, nascent adhesions near the cell’s leading relies on the coordinated remodeling of interactions with edge, which either rapidly turn over or connect to the actin cytoskeleton (Parsons et al., 2010). Actomyosin-mediated the extracellular matrix (ECM), which is mediated by pulling forces allow a subset of these nascent FAs to grow integrin-based focal adhesions (FAs). Normal FA turn- and mature, and provide forward traction forces. However, in over requires dynamic microtubules, and three members order for cells to productively move forward, FAs also have to of the diverse group of microtubule plus-end-tracking release and disassemble underneath the cell body and in the proteins are principally involved in mediating micro- rear of the cell. Spatial and temporal control of turnover of tubule interactions with FAs. Microtubules also alter these mature FAs is important, as they provide a counterbalance to forward traction forces, and regulated FA disassembly is the assembly state of FAs by modulating Rho GTPase required for forward translocation of the cell body. An important signaling, and recent evidence suggests that microtubule- question that we are only beginning to understand is how FA mediated clathrin-dependent and -independent endo­ turnover is spatially and temporally regulated to allow cells cytosis regulates FA dynamics. In addition, FA-associated to appropriately respond to extracellular signals, allowing for microtubules may provide a polarized microtubule track for coordinated and productive movement.
  • Isoforms, Structures, and Functions of Versatile Spectraplakin MACF1

    Isoforms, Structures, and Functions of Versatile Spectraplakin MACF1

    BMB Rep. 2016; 49(1): 37-44 BMB www.bmbreports.org Reports Contiributed Mini Review Isoforms, structures, and functions of versatile spectraplakin MACF1 Lifang Hu1, Peihong Su1, Runzhi Li1, Chong Yin1, Yan Zhang1, Peng Shang1, Tuanmin Yang2 & Airong Qian1,* 1Key Laboratory for Space Bioscience and Biotechnology, Institute of Special Environmental Biophysics, School of Life Sciences, Northwestern Polytechnical University, Xi’an, Shaanxi 710072, 2Honghui Hospital, Xi’an Jiaotong University College of Medicine, Xi’an, Shaanxi 710054, P. R. China Spectraplakins are crucially important communicators, linking ability of interacting with all three types of cytoskeletal fila- cytoskeletal components to each other and cellular junctions. ments, i.e., F-actin, MTs, and IFs (1). Microtubule actin crosslinking factor 1 (MACF1), also known Spectraplakins are exceptionally long and gigantic with mo- as actin crosslinking family 7 (ACF7), is a member of the spec- lecular weight of ＞500 kD. They are multi-domain cytoskele- traplakin family. It is expressed in numerous tissues and cells tal proteins and master orchestrators for coordinating cytoske- as one extensively studied spectraplakin. MACF1 has several letal elements by binding to F-actin, MTs, and IFs (1, 2). isoforms with unique structures and well-known function to be Spectraplakins are evolutionarily conserved. They belong to able to crosslink F-actin and microtubules. MACF1 is one ver- both spectrin and plakin superfamilies (3). “Spectraplakins” are satile spectraplakin with various functions in cell processes, named as combinations of “spectrin” and “plakin” because embryo development, tissue-specific functions, and human they share features of both spectrins and plakins (3, 4). So far, diseases. The importance of MACF1 has become more appa- mammalian spectraplakins have two members: microtubule rent in recent years.
  • Vascular and Connective Tissue Anomalies Associated with X-Linked Periventricular Heterotopia Due to Mutations in Filamin A

    Vascular and Connective Tissue Anomalies Associated with X-Linked Periventricular Heterotopia Due to Mutations in Filamin A

    European Journal of Human Genetics (2013) 21, 494–502 & 2013 Macmillan Publishers Limited All rights reserved 1018-4813/13 www.nature.com/ejhg ARTICLE Vascular and connective tissue anomalies associated with X-linked periventricular heterotopia due to mutations in Filamin A Eyal Reinstein*,1, Sophia Frentz2, Tim Morgan2, Sixto Garcı´a-Min˜au´r3, Richard J Leventer4, George McGillivray5, Mitchel Pariani1, Anthony van der Steen6, Michael Pope6, Muriel Holder-Espinasse7, Richard Scott8,9, Elizabeth M Thompson10, Terry Robertson11, Brian Coppin12, Robert Siegel13, Montserrat Bret Zurita14, Jose I Rodrı´guez15, Carmen Morales15, Yuri Rodrigues15, Joaquı´n Arcas16, Anand Saggar17, Margaret Horton18, Elaine Zackai18, John M Graham1, David L Rimoin1,{ and Stephen P Robertson2 Mutations conferring loss of function at the FLNA (encoding filamin A) locus lead to X-linked periventricular nodular heterotopia (XL-PH), with seizures constituting the most common clinical manifestation of this disorder in female heterozygotes. Vascular dilatation (mainly the aorta), joint hypermobility and variable skin findings are also associated anomalies, with some reports suggesting that this might represents a separate syndrome allelic to XL-PH, termed as Ehlers-Danlos syndrome-periventricular heterotopia variant (EDS-PH). Here, we report a cohort of 11 males and females with both hypomorphic and null mutations in FLNA that manifest a wide spectrum of connective tissue and vascular anomalies. The spectrum of cutaneous defects was broader than previously described and is inconsistent with a specific type of EDS. We also extend the range of vascular anomalies associated with XL-PH to included peripheral arterial dilatation and atresia. Based on these observations, we suggest that there is little molecular or clinical justification for considering EDS-PH as a separate entity from XL-PH, but instead propose that there is a spectrum of vascular and connective tissues anomalies associated with this condition for which all individuals with loss-of-function mutations in FLNA should be evaluated.
  • Original Article Plasma CAMK2A Predicts Chemotherapy Resistance in Metastatic Triple Negative Breast Cancer

    Original Article Plasma CAMK2A Predicts Chemotherapy Resistance in Metastatic Triple Negative Breast Cancer

    Int J Clin Exp Pathol 2018;11(2):650-663 www.ijcep.com /ISSN:1936-2625/IJCEP0069558 Original Article Plasma CAMK2A predicts chemotherapy resistance in metastatic triple negative breast cancer Bin Shao1*, Zhihua Tian2*, Huirong Ding2*, Qingsong Wang3, Guohong Song1, Lijun Di1, Hong Zhang2, Huiping Li1, Jing Shen2 Key Laboratory of Carcinogenesis and Translational Research (Ministry of Education/Beijing), 1Department of Medical Oncology, 2Central Laboratory, Peking University Cancer Hospital & Institute, Beijing, P. R. China; 3State Key Laboratory of Protein and Plant Gene Research, College of Life Sciences, Peking University, Beijing, P. R. China. *Equal contributors. Received November 21, 2017; Accepted December 15, 2017; Epub February 1, 2018; Published February 15, 2018 Abstract: Background: Chemotherapy resistance is a great obstacle in effective treatment for metastatic triple nega- tive breast cancer (TNBC). The ability to predict chemotherapy response would allow chemotherapy administration to be directed toward only those patients who would benefit, thus maximizing treatment efficiency. Differentially expressed plasma proteins may serve as putative biomarkers for predicting chemotherapy outcomes. Patients and methods: In this study, 26 plasma samples (10 samples with partial response (S) and 16 samples with progression disease (R)) from patients with metastatic TNBC were measured by Tandem Mass Tag (TMT)-based proteomics analysis to identify differentially expressed proteins between the S and R group. Potential proteinswere validated with enzyme-linked immunosorbent assay (ELISA) in another 67 plasma samples. Results: A total of 320 plasma proteins were identified, and statistical analysis showed that 108 proteins were significantly dysregulated between R and S groups in the screening stage. Bioinformatics revealed relevant pathways and regulatory networks of the differentially expressed proteins.
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Phenomic Profiling Through Live-Cell Imaging in a Panel of Reporter Cell

    Phenomic Profiling Through Live-Cell Imaging in a Panel of Reporter Cell

    www.nature.com/scientificreports OPEN Tales of 1,008 small molecules: phenomic profling through live‑cell imaging in a panel of reporter cell lines Michael J. Cox1,5, Stefen Jaensch1,5*, Jelle Van de Waeter1, Laure Cougnaud2, Daan Seynaeve2, Soulaiman Benalla1, Seong Joo Koo1, Ilse Van Den Wyngaert1, Jean‑Marc Neefs1, Dmitry Malkov3, Mart Bittremieux1, Margino Steemans1, Pieter J. Peeters1, Jörg Kurt Wegner1, Hugo Ceulemans1, Emmanuel Gustin1, Yolanda T. Chong1,4 & Hinrich W. H. Göhlmann1 Phenomic profles are high‑dimensional sets of readouts that can comprehensively capture the biological impact of chemical and genetic perturbations in cellular assay systems. Phenomic profling of compound libraries can be used for compound target identifcation or mechanism of action (MoA) prediction and other applications in drug discovery. To devise an economical set of phenomic profling assays, we assembled a library of 1,008 approved drugs and well‑characterized tool compounds manually annotated to 218 unique MoAs, and we profled each compound at four concentrations in live‑cell, high‑content imaging screens against a panel of 15 reporter cell lines, which expressed a diverse set of fuorescent organelle and pathway markers in three distinct cell lineages. For 41 of 83 testable MoAs, phenomic profles accurately ranked the reference compounds (AUC‑ROC ≥ 0.9). MoAs could be better resolved by screening compounds at multiple concentrations than by including replicates at a single concentration. Screening additional cell lineages and fuorescent markers increased the number of distinguishable MoAs but this efect quickly plateaued. There remains a substantial number of MoAs that were hard to distinguish from others under the current study’s conditions.
  • Documentation and Localization of Force-Mediated Filamin a Domain

    Documentation and Localization of Force-Mediated Filamin a Domain

    ARTICLE Received 29 May 2014 | Accepted 10 Jul 2014 | Published 14 Aug 2014 DOI: 10.1038/ncomms5656 Documentation and localization of force-mediated filamin A domain perturbations in moving cells Fumihiko Nakamura1, Mia Song1, John H. Hartwig1 & Thomas P. Stossel1 Endogenously and externally generated mechanical forces influence diverse cellular activities, a phenomenon defined as mechanotransduction. Deformation of protein domains by application of stress, previously documented to alter macromolecular interactions in vitro, could mediate these effects. We engineered a photon-emitting system responsive to unfolding of two repeat domains of the actin filament (F-actin) crosslinker protein filamin A (FLNA) that binds multiple partners involved in cell signalling reactions and validated the system using F-actin networks subjected to myosin-based contraction. Expressed in cultured cells, the sensor-containing FLNA construct reproducibly reported FLNA domain unfolding strikingly localized to dynamic, actively protruding, leading cell edges. The unfolding signal depends upon coherence of F-actin-FLNA networks and is enhanced by stimulating cell contractility. The results establish protein domain distortion as a bona fide mechanism for mechanotransduction in vivo. 1 Translational Medicine Division, Department of Medicine, Brigham and Women’s Hospital, Harvard Medical School, Boston, Massachusetts 02445, USA. Correspondence and requests for materials should be addressed to F.N. (email: [email protected]). NATURE COMMUNICATIONS | 5:4656 | DOI: 10.1038/ncomms5656
  • Filamin-A Susceptibility to Calpain-Mediated Cleavage As a Marker of Dynamic Conformational Changes in Intact Platelets

    Filamin-A Susceptibility to Calpain-Mediated Cleavage As a Marker of Dynamic Conformational Changes in Intact Platelets

    bioRxiv preprint doi: https://doi.org/10.1101/307397; this version posted April 24, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Filamin-A susceptibility to calpain-mediated cleavage as a marker of dynamic conformational changes in intact platelets Lorena Buitrago Ph.D* and Barry S. Coller MD. Allen and Frances Adler Laboratory of Blood and Vascular Biology, The Rockefeller University, 1230 York Ave New York, NY, USA 10065 Running Title: Fln-A cleavage as a marker of conformational changes in platelets *To whom correspondence should be addressed: Lorena Buitrago. Allen and Frances Adler Laboratory of Blood and Vascular Biology, The Rockefeller University, 1230 York Ave New York, NY, USA 10065 [email protected] Tel: (212)324-7248. Key words: Calpain, Cytoskeleton, Filamin, Mechanotransduction, Platelet, integrin, platelet glycoprotein Ib. ABSTRACT Filamin-A (FlnA), an actin-binding protein that organizes the actin cytoskeleton and mechanically links transmembrane glycoproteins to the cytoskeleton, associates with platelet receptors integrin αIIbβ3, glycoprotein-Ib (GPIb), and integrin α2β1. Fibrinogen, von Willebrand Factor (vWF) and collagen, binding to these receptors mechanically connect the extracellular matrix to the cytoskeleton. Here we identified that under standardized conditions, platelet activation and ligand binding to αIIbβ3, GPIb, or α2β1, generates reproducible patterns of FlnA cleavage after platelet lysis. We exploited this novel assay to study the impact of ligand binding and receptor activation on the platelet cytoskeleton.