Page 1 of 205 Diabetes

Calorie restriction prevents metabolic ageing caused by abnormal SIRT1 function in

adipose tissues

Cheng Xu1, Yu Cai1, Pengcheng Fan1, Bo Bai1, Jie Chen1, HanBing Deng1, ChiMing Che2,

Aimin Xu1, Paul M Vanhoutte1, Yu Wang*,1

1State Key Laboratory of Pharmaceutical Biotechnology and Department of Pharmacology

and Pharmacy, and 2Department of Chemistry and Chemical Biology Center, Jockey Club

Building for Interdisciplinary Research, The University of Hong Kong, Hong Kong, China.

*Correspondence to: Dr Yu Wang, Department of Pharmacology and Pharmacy, The

University of Hong Kong, Hong Kong, China, Tel: (852) 28192864; Fax (852) 28170859; E

mail: [email protected]

Running Title: SIRT1, histone biotinylation and metabolic ageing

1

Diabetes Publish Ahead of Print, published online December 4, 2014 Diabetes Page 2 of 205

Abstract

Adipose tissue is a pivotal organ determining longevity, due largely to its role in

maintaining whole body energy homeostasis and insulin sensitivity. SIRT1 is a NAD

dependent protein deacetylase possessing antiageing activities in a wide range of

organisms. The present study demonstrates that mice with adipose tissueselective

overexpression of hSIRT1(H363Y), a dominant negative mutant that disrupts endogenous

SIRT1 activity, show accelerated development of metabolic ageing. These mice, referred

to as AdipoH363Y, exhibit hyperglycemia, dyslipidemia, ectopic lipid deposition,

insulin resistance and glucose intolerance at a much younger age than their wild type

littermates. The metabolic defects of AdipoH363Y are associated with abnormal

epigenetic modifications and chromatin remodeling in their adipose tissues, as a result of

excess accumulation of biotin, which inhibits endogenous SIRT1 activity, leading to

increased inflammation, cellularity and collagen deposition. The enzyme acetylCoA

carboxylase 2 plays an important role in biotin accumulation within adipose tissues of

AdipoH363Y. Calorie restriction prevents biotin accumulation, abolishes abnormal

histone biotinylation, and completely restores the metabolic and adipose functions of

AdipoH363Y. The effects are mimicked by shortterm restriction of biotin intake, an

approach potentially translatable to humans for maintaining the epigenetic and chromatin

remodeling capacity of adipose tissues and preventing ageingassociated metabolic

disorders.

2

Page 3 of 205 Diabetes

Introduction

Advancing age is associated with loss of energy balance and deterioration of

metabolic functions. In older people, postprandial hyperglycemia is common (1). The

prevalence of glucose intolerance and insulin resistance increases progressively and

significantly with age (2). The redistribution of fat from subcutaneous depots to visceral

compartment and from adipose tissues to ectopic sites plays a critical role in the

development of ageingrelated metabolic abnormalities, in particular type 2 diabetes.

Older people exhibit elevated central fat deposition but decreased skeletal muscle mass

[referred to as sarcopenic obesity] (3). Preadipocytes isolated from aged animals and

humans have a reduced potential to differentiate and replicate, whereas aged adipocytes

show a decreased capacity for lipid storage (4). The mechanisms underlying age

associated changes in adipose tissue function and fat distribution remain incompletely

understood.

SIRT1 is a mammalian ortholog most closely related to SIR2 (Silent information

regulator 2), a protein identified in Saccharomyces cerevisiae that extends replicative

lifespan (5). Both SIRT1 and SIR2 belong to a conserved family of ageing regulators and

are NADdependent deacetylases that catalyze the removal of acetyl groups from protein

substrates (6). In yeast, SIR2 acts as a transcriptional silencer by modulating histone

modifications, especially at the matingtype loci and telomeric DNA regions (7). These

chromosome domains are analogous to the heterochromatin of multicellular eukaryotes.

When a conserved histidine within the catalytic domain of SIR2 was converted to a

tyrosine (H364Y), its histone modification activity was lost and the mutant acted in a

strong dominantnegative manner (8). Compared to SIR2, SIRT1 elicits a wider range of

3

Diabetes Page 4 of 205

biological functions by interacting with and regulating diversified protein substrates (5).

Animal studies reveal that SIRT1 is a key energy sensor controlling cellular responses to nutrient availability and in turn protecting against ageingrelated metabolic diseases (9).

SIRT1 is critically involved in the metabolic adaptation to fasting, exercise and calorie restriction (10), which upregulate the activity of this antiageing protein in adipocytes and adipose tissues (11). Activation of SIRT1 in turn stimulates fat mobilization and adiponectin production in adipose tissues (1214). Overexpression of SIRT1 in adipose tissues of mice induces a similar phenotype as calorie restriction [leaner and metabolically more active, with improved insulin sensitivity and glucose tolerance (14

16)]. This evidence suggest that adipose SIRT1 is a candidate drug target for promoting systemic energy homeostasis and healthy ageing.

Transgenic mice that selectively overexpress wild type human SIRT1 (hSIRT1) or hSIRT1(H363Y) mutant in adipose tissues have been established (14). In the present study, the metabolic functions of these two types of transgenic mice, referred as Adipo

SIRT1 and AdipoH363Y, respectively, are compared and related to those of the wild type (WT) controls. While AdipoSIRT1 are more insulin sensitive and metabolically healthier than their WT littermates (14), AdipoH363Y exhibit a phenotype of accelerated metabolic ageing. Calorie restriction has been applied to test whether or not this non genetic intervention is able to restore a normal metabolic function in AdipoH363Y. The results demonstrate that a large number of ageinginduced changes of gene expression in adipose tissues are prevented by calorie restriction, which significantly delays the development of insulin resistance, glucose intolerance and dyslipidemia in both WT and

AdipoH363Y. Limited biotin intake contributes to the beneficial effects of calorie

4

Page 5 of 205 Diabetes

restriction on enhancing SIRT1 activity in adipose tissues and improving systemic energy

homeostasis. At the epigenetic level, by preventing excessive histone biotinylation,

calorie restriction facilitates SIRT1mediated histone deacetylation and transcriptional

silencing.

Methods and Materials

Animal experiments

All procedures were approved by the Committee on the Use of Live Animals for

Teaching and Research (CULATR) of the University of Hong Kong and carried out in

accordance with the ARRIVE as well as institutional guidelines for the care and use of

laboratory animals. The generation of transgenic mice with selective overexpression of

human SIRT1 (AdipoSIRT1) or hSIRT1(H363Y) (AdipoH363Y) in adipose tissues has

been described (14). Mice were housed in a room under controlled temperature (23 ±

1°C) and 12hour lightdark cycles, with free access to water and standard mouse chow

[4.07 kcal/g composed of 20% protein, 52.9% carbohydrate, 5.6% fat, 4.7% fiber, 6.1%

minerals and vitamin mixture containing 0.3 mg/kg biotin; LabDiet 5053; LabDiet,

Purina Mills, Richmond, IN, USA]. All animals appeared normal and were fertile, giving

rise to healthy litters. Male mice were used for the present study.

The food intake for ad libitum fed mice was ~0.14g/g body weight/day. For calorie

restriction, mice received 60% of the normal food supply (~0.08 g/g body weight/day)

from the age of ten to 40weeks. To study the effects of biotin intake in the diet, mice

were given either biotinsufficient (4.11 kcal/g composed of 18% casein, 60% sucrose,

10% vegetable oil, 2% corn oil, 4% salt and vitamin mixture containing 0.45 mg/kg

biotin; 02960407, MP Biomedicals, Santa Ana, CA, USA) or biotindeficient (4.11 kcal/g

5

Diabetes Page 6 of 205

composed of 18% casein, 60% sucrose, 10% vegetable oil, 2% corn oil, 4% salt and vitamin mixture without biotin; 02901030, MP Biomedicals) diets. Mice were randomly assigned to each experimental group (n=810) for diet treatment starting at the age of ten weeks. Metabolic parameters were monitored on a weekly basis.

For in vivo RNAi treatment, three sets of chemically modified siRNAs for ACC2

were synthesized by RiboBio® (Guangdong, China), including Sense 5’–

CCUACGAGAUGUUCCGUAAdTdT–3’/Antisense 3’–dTdTGGAUGCUCUACAAGG

CAUU–5’, Sense 5’–GCAUCAAGUAUGCUCUCAAdTdT–3’/Antisense 3’–

dTdTCGUAGUUCAUACGAGAGUU–5’ and Sense 5’–

CCACCUAUGUGUACGACUUdTdT–3’/Antisense 3’–

dTdTGGUGGAUACACAUGCUGAA–5’. Mice were treated with the mixture of ACC2

siRNAs (5 nmol/mouse/day) or the same amount of scrambled RNAi by intraperitoneal

injection at six different sites for three consecutive days (17). The epididymal adipose

tissues were harvested 12hours after the last injection for subsequent analysis.

Metabolic evaluations

Body weight, blood glucose and fat mass composition were measured between

10:00am to 12:00noon for mice that were either starved overnight or fed ad libitum.

Blood glucose was monitored by tail nicking using an AccuCheck Advantage II

Glucometer (Roche Diagnostics, Mannheim, Germany). The body composition was

assessed in conscious and unanesthetized mice using a BruckerMinispec body

composition analyzer (Bruker Optics, Inc., Woodlands, TX, USA). The intraperitoneal

glucose tolerance test (ipGTT) and insulin tolerance test (ITT) were performed as

described (14; 18). Circulating and tissue contents of lipids, including triglycerides, total

6

Page 7 of 205 Diabetes

cholesterols and free fatty acids were analyzed using LiquiColor® Triglycerides and

Stanbio Cholesterol (Stanbio Laboratory, Boerne, TX, USA), and the Halfmicro test kit

(Roche Diagnostics), respectively. The fasting serum insulin concentration was quantified

using the commercial ELISA kits from Mercodia AB (Uppsala, Sweden). Serum

adiponectin and lipocalin2 concentrations were determined with the inhouse ELISA kit

as described (19; 20). Metabolic rate [VO2, VCO2, Respiratory Exchange Ratio (RER)]

was measured by indirect calorimetry using a sixchamber opencircuit Oxymax system

component of the Comprehensive Lab Animal Monitoring System (CLAMS; Columbus

Instruments, Columbus, OH, USA) as described (14). All mice were acclimatized to the

cage for 48 hours before recording the parameters during a twoday feeding and a 24

hour fasting period.

Microarray analysis

Total RNA was extracted from epididymal adipose tissues of WT, AdipoSIRT1 and

AdipoH363Y mice aged eight and 40weeks using RNeasy Mini Kit (Qiagen, Valencia,

CA, USA). Samples were derived from at least three mice in each group. The quality of

RNA was assessed by a spectrophotometer (ND1000, Nanodrop Technologies,

Wilmington, DE, USA) and the RNA 6000 Pico LabChip with the Agilent 2100

Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA). The A260/A280 ratios of all

RNA samples were between 1.9 and 2.1. The RNA Integrity Numbers were above 9.

After reverse transcription, the labeled cDNA samples were hybridized to the Mouse

Genome 430 2.0 expression arrays using the GeneChip® Fluidics Station 450

(Affymetrix Inc., Santa Clara, CA, USA). The intensity of the probed signals were

scanned and captured by GeneChip® Scanner 3000 (Affymetrix Inc.). Quality of the raw

7

Diabetes Page 8 of 205

intensity data was assessed using diagnostic plots by GeneSpring GX 12.6 (Agilent

Technologies) and Affymetrix Expression Console (Affymetrix Inc.). Raw intensity values of gene expression were normalized and backgroundcorrected using Robust

Multiarray Average (RMA) algorithm. Genes with expression values lower than the 20th percentile of all intensity values were excluded from further analyses. The expression profiles of samples derived from WT, AdipoSIRT1 and AdipoH363Y were clustered

and validated by principal component analysis. Data comparisons were performed between 1) eightweeks old WT, AdipoSIRT1 and AdipoH363Y, 2) 40weeks old WT,

AdipoSIRT1 and AdipoH363Y fed ad libitum, 3) eight and 40weeks old ad libitum

fed mice of the same genotypes, and 4) eight and 40weeks old mice of the same

genotypes under calorie restriction. Differentially expressed genes were defined as more

than a twofold change using a generalized linear model. In total, a list of 3,915 genes

that were changed in at least one set of the above comparisons was included in

Supplementary Table 1 for further analysis. Venn diagrams were used for presenting the

numbers of differentially or commonly changed genes. The MIAMEcompliant

microarray data have been submitted to and are available in the ArrayExpress database

(www.ebi.ac.uk/arrayexpress, accession number EMTAB2777).

Quantitative reverse-transcription polymerase chain reaction (QPCR)

Quantitation of target genes was performed using SYBR Green PCR Master Mix

(Qiagen) and an ABI PRISM 7900 HT Sequence Detection System (Applied Biosystems,

Foster City, CA). The primer sequences are listed in Supplementary Table 2. Data were

calculated and are presented as relative expression of transcripts normalized to βactin.

Chromatin immunoprecipitation (ChIP)-PCR

8

Page 9 of 205 Diabetes

The primers for ChIPPCR are listed in Supplemental Table 2. The histone acetylation

and/or biotinylation at the promoter regions of different genes were analyzed and

compared by ChIPPCR as described with modifications (21). In brief, epididymal

adipose tissue (100 mg) was minced into small pieces in cold phosphate buffered saline

(137mM NaCl. 4.3mM Na2HPO4, 2.7mM KCl, 1.4mM KH2PO4, pH 7.4) with protease

inhibitor cocktails. Formaldehyde was added to a final concentration of 1% and the

mixture was incubated at room temperature for 15minutes with moderate shaking. The

crosslinking was stopped by adding glycine to a final concentration of 0.125M. The

nuclei were isolated from the tissue lysates and resuspended in lysis buffer (1% SDS,

50mM TrisHCl, pH 8.0, 10 mM EDTA containing protease inhibitors) for sonication to

obtain chromatin fragment of 5001000bp. After preclearing with protein GSepharose

beads [(Pierce, Rockford, IL, USA), blocked with 0.2mg/ml salmon sperm DNA and

0.5mg/ml bovine serum albumin], 50g chromatin were incubated with 2g antibody

overnight at 4°C. Immunecomplexes were collected on protein GSepharose beads

(blocked as above), washed and eluted into 100l ChIP elution buffer (1% SDS and 0.1M

NaHCO3). Half of the elutes were reverse crosslinked and the other half diluted 1:10

with lysis buffer to perform the second ChIP with streptavidinconjugated beads (Pierce)

as described (22). After elution with ChIP elution buffer, the crosslink was reversed by

adding 8l of 5M NaCl and incubating for four hours at 65°C. The DNA was purified by

phenolchloroform extraction. PCR amplifications were performed using 10% of the

DNA samples and the resulting PCR products separated by agarose gel for image

quantification by densitometry (MultiAnalyst Software, BioRad). Quantitation was also

performed by QPCR analysis. The results were normalized against those from either the

9

Diabetes Page 10 of 205

input DNA samples or the first ChIP fractions and presented as fold changes.

SIRT1 activity measurements

SIRT1 activity was monitored using a Fluorometric Drug Discovery kit from Enzo

Life Sciences International, Inc (Plymouth Meeting, PA, USA). Fluorescence was measured with a fluorometric reader (CytofluorII 400 series, Applied Biosystems), whereby excitation was set at 360nm and emission detection at 460nm. The in vitro protein deacetylation assay was analyzed by highperformance liquid chromatography

(HPLC) as described (14). The histone H3 peptides, including

ARTKQTARKSTGGK14APRK18QLC with or without acetylation at K14 and/or biotinylation at K18, were used as substrates. In brief, recombinant SIRT1 (3.6M) was incubated with peptide substrate (500M) and NAD+ (500M) in 50mM Tris buffer (pH

7.5) at 37°C for ten minutes, in the presence and absence of 500M biotin.

Trifluoroacetic acid (TFA) was added to 0.1% before fractionation by a reversephased

HPLC on a Symmetry® C18 column (5m, 3.9×150 mm, Waters, Milford, MA, USA),

using a 40minutes linear gradient (0–40% buffer B containing acetonitrile with 0.5%

TFA) at a flow rate of 1 ml/minute. Chromatographic peaks were detected by a UV

detector at 214 nm. The sizes of the peaks obtained by calculating the areas under the peaks were used for comparison.

Quantification of tissue biotin contents

The amount of total biotin (bound and unbound) was determined as described (23)

with modifications. In brief, 30 mg of tissue or cell lysates were hydrolyzed in sulphuric

acid at 100°C for one hour. After neutralization, 3.5mg of activated charcoal was added to bind the liberated biotin. The mixture was centrifuged at 12,000 rpm for three minutes

10

Page 11 of 205 Diabetes

and the bound biotin was released by adding 1ml of 5% ammonia ethanol solution. The

supernatant was filtered and evaporated to dryness under nitrogen. The extract was

reconstituted in 100l methanol and mixed with 80l of 0.1% 9anthryldiazomethane

(ADAM, w/v in ethyl acetate) for one hour at room temperature. The fluorescent biotin

ADAM was detected at an excitation wavelength of 365nm and emission wavelength of

412nm using the fluorometric reader. Biotin solutions (150ng/ml) were used to generate

a standard curve for calibration and quantification.

Histological analysis

Paraffin sections (5m) were prepared for adipose tissues collected from different

groups of mice. Hematoxylin and eosin (H&E) staining was performed to analyze

adipocyte histology under a light microscope (Olympus, Tokyo, Japan). The sizes of

adipocytes were measured as described (18). Masson's trichrome staining was performed

using Accustain® Trichrome kits (Sigma Aldrich, St. Louis, MO, USA) to evaluate the

extracellular deposition of fibrillar collagens.

Western blotting

Antibodies against total ACC, ACC2, histone H3, histone H4, acetylated histone H3

(K9) and acetylated lysine were purchased from Cell Signaling (Beverly, MA, USA).

Antibodies against ACC1, SIRT1 and acetylated histone H4 (K5, K8, K12 and K16) were

from Millpore (Billerica, MA, USA). Monoclonal antibodies against betaactin and

streptavidinhorseradish peroxidase (HRP) conjugate were obtained from Sigma Aldrich.

For Western Blotting, proteins derived from cell or tissue lysates were separated by SDS

PAGE and transferred to polyvinylidenedifluoride membranes. After overnight blocking,

membranes were probed with various primary antibodies followed by secondary

11

Diabetes Page 12 of 205

antibodies. Immunoreactive antibodyantigen complexes were visualized with the enhanced chemiluminescence reagents from GE Healthcare (Uppsala, Sweden). For histone modification analysis, histones were extracted from the nuclear fractions of epididymal fat pads following a previously reported procedure (21). Briefly, the pellets of nuclei were resuspended overnight in 0.4M H2SO4 at 4°C. The supernatant was collected

after centrifugation (16,000g, 10minutes at 4°C) and precipitated with trichloroacetic

acid at 4°C for one hour. The acid soluble histone fraction was subjected to 18% SDS

PAGE and visualized by Coomassie Brilliant Blue (CBB) staining. The biotinylated protein was detected by Western blotting using streptavidinHRP conjugate and the

acetylated protein detected with antiacetyllysine antibodies.

Data analysis

The density of protein bands in Western blots were analyzed quantitatively using

Image J 1.45 (NIH, Bethesda, MD, USA) software for calculating the expression ratios

against loading controls. Representative Western blotting images are shown. Statistical

calculations were performed with the Statistical Package for the Social Sciences version

11.5 software package (SPSS, Inc., Chicago, IL, USA). For multiple comparisons, the

differences were analyzed by oneway ANOVA, followed by Dunnett's test. Differences

in other comparisons were determined by an unpaired twotailed Student’s t-test. In all

cases, statistically significant differences were accepted when P values were less than

0.05. All results were derived from at least three sets of independent experiments unless

otherwise specified. Data are presented as mean ± SEM.

Results

Overexpression of hSIRT1(H363Y) in adipose tissue accelerates the development of

12

Page 13 of 205 Diabetes

metabolic ageing

The metabolic parameters, including body weight, blood glucose, serum insulin, and

circulating lipid levels were monitored on a weekly basis. Systemic insulin sensitivity

was evaluated by insulin (ITT) and intraperitoneal glucose (ipGTT) tolerance tests.

Compared to both WT and AdipoSIRT1, AdipoH363Y showed a phenotype of

significantly accelerated metabolic ageing (Figure 1). At as early as the age of 20weeks,

abnormal responses to ITT and ipGTT were detected in AdipoH363Y when compared to

agematched WT (Supplementary Figure 1). At the age of 30weeks, the responses of

AdipoH363Y to either insulin (ITT) or intraperitoneal glucose (ipGTT) tolerance tests

were comparable to those of 60weeks old WT (Figure 1A). By contrast, these responses

in 60weeks old AdipoSIRT1 were not significantly different from mice at the age of 30

weeks. Although the body weight was not significantly different between the three

groups of mice at the age of 12weeks, AdipoH363Y showed consistently higher gain of

body weights than the other two groups of mice at other age points (Figure 1B). Fasting

glucose levels of AdipoH363Y were not significantly different from WT (data not

shown). However, from the age of 40weeks onwards, the nonfasting glucose levels

were significantly higher in AdipoH363Y than in the other two groups of mice (Figure

1C). Circulating insulin levels were rapidly rising with age, being higher in Adipo

H363Y by ~51%,~79% and ~85% than those of WT at the age of 20weeks, 40weeks,

and 60weeks, respectively (Figure 1D). The insulin concentration in 30weeks old

AdipoH363Y reached a level similar to that in WT at 60weeks of age. Circulating

triglyceride levels augmented progressively in both AdipoH363Y and WT, but remained

the lowest in AdipoSIRT1 (Figure 1E). Compared to WT, the development of ageing

13

Diabetes Page 14 of 205

associated hypertriglyceridemia was enhanced significantly by ~19%, ~21% and ~31% in

AdipoH363Y at 40, 50 and 60weeks of age, respectively.

In line with their higher body weight gain, AdipoH363Y showed significantly increased (by more than 10%) whole body adiposity from the age of 20weeks onwards when compared to WT, whereas changes in opposite directions were observed in Adipo

SIRT1 (decreased by ~20%, Figure 2A). However, the percentage compositions of lean and fluid mass were not significantly different between WT and AdipoH363Y

(Supplementary Figure 2). On the other hand, the weights of visceral fat pads collected post mortem were not elevated in AdipoH363Y when compared to those in WT (Figure

2B), indicating that the excess lipids were deposited in ectopic sites. Indeed, the triglyceride contents in liver and skeletal muscle of AdipoH363Y were augmented significantly by ~35% and ~61%, respectively, when compared to WT (Figure 2C). In adipose tissues of AdipoH363Y, the cholesterol and free fatty acid contents were significantly higher (by 1.5 and 1.9fold, respectively) than in those of WT (Figure 2C).

However, the size of adipocytes in epididymal adipose tissues of AdipoH363Y was significantly smaller (Supplementary Figure 3). Histological assessment showed an increased cellularity and trichromepositive streaks interspersed between adipocytes in adipose tissues of AdipoH363Y (Supplementary Figure 4A). The expressions of genes involved in adipogenesis were significantly downregulated, whereas those associated with inflammation upregulated in adipose tissues of AdipoH363Y (Supplementary

Figure 4B). Indirect calorimetric analysis revealed that the respiratory exchange ratio

(RER) was elevated significantly in AdipoH363Y during both dark and light periods

(Figure 2D). The increased RER in AdipoH363Y was attributed mainly to the higher

14

Page 15 of 205 Diabetes

CO2 production (VCO2), but not to differences in O2 consumption (VO2).

Collectively, the results demonstrate that overexpression of hSIRT1(H363Y)

selectively in adipose tissues of mice accelerates the development of insulin resistance,

glucose intolerance, postprandial hyperglycemia and dyslipidemia, a cluster of metabolic

defects that are closely associated with ageing.

Calorie restriction restores the metabolic functions of WT and Adipo-H363Y

Total SIRT1 protein expression was decreasing with age in adipose tissues of WT, but

remained higher in those of AdipoSIRT1 and AdipoH363Y (Figure 3A). Compared to

that of WT, SIRT1 activity was significantly augmented (by ~twofold) in adipose tissues

of AdipoSIRT1but decreased (by ~60%) in those of AdipoH363Y (Figure 3B).

Compared to mice at the age of 12weeks, SIRT1 activities were decreased by ~35%,

~10%, and ~55% in 40weeks old WT, AdipoSIRT1 and AdipoH363Y, respectively.

Calorie restriction [60% of ad libitum food intake] for 30weeks not only prevented the

downregulation of SIRT1 activities, but also significantly enhanced the latter in adipose

tissues of both WT and AdipoH363Y (Figure 3C). At the age of 40weeks, mice under

calorie restriction showed similar levels of SIRT1 activity in their adipose tissues, which

was elevated by ~2.1 and ~4.3fold compared to the corresponding ad libitum fed WT

and AdipoH363Y, respectively. Calorie restriction significantly reduced the nonfasting

glucose levels in all mice (Figure 3D), and improved the responses to ITT and ipGTT in

both WT and AdipoH363Y (Figure 3E). The area under the curve (AUC) values of

ipGTT and ITT in calorierestricted WT and AdipoH363Y were not significantly

different from those of agematched AdipoSIRT1 (Figure 3E, bottom panels). At the age

of 40weeks, the body weight gain and plasma insulin levels in the three groups of mice

15

Diabetes Page 16 of 205

under calorie restriction were not significantly different (Figure 3F), and comparable to those in 20weeks old WT (Figure 1, B and D).

Calorierestricted WT, AdipoSIRT1 and AdipoH363Y exhibited similar diurnal rhythmic patterns of RER, ~0.82 in dark cycles and ~0.75 in light cycles (Figure 4A).

The VCO2 of AdipoH363Y was significantly decreased by calorie restriction in both dark (~14%) and light (~23%) cycles, to comparable levels of those in WT and Adipo

SIRT1 (Figure 4A). The whole body adiposity was similar in the three types of mice across all age groups under calorie restriction (Figure 4B). The percentage weights of post mortem visceral fat pads in calorierestricted mice at the age of 40weeks were comparable to those in 20weeks old mice fed ad libitum (Figure 4B and 2B). The ageinginduced augmentation of circulating triglyceride levels was prevented by calorie restriction in WT and AdipoH363Y (Figure 4C). Calorie restriction significantly reduced the lipid contents in adipose tissues of all mice groups (Figure 4D), and attenuated the ectopic lipid deposition in AdipoH363Y (Figure 4E).

Together, these findings suggest that despite the decreased SIRT1 activity in adipose tissues of AdipoH363Y, calorie restriction can correct both local and systemic metabolic defects caused by adipose overexpression of the mutant hSIRT1(H363Y) and/or ageing.

Increased histone biotinylation causes abnormal chromatin remodeling in adipose tissues of Adipo-H363Y

Microarray analysis was performed using RNA samples extracted from adipose tissues of mice at the age of either eightweeks (referred to as ‘young’; when metabolic functions were comparable among the three groups) or 40weeks (referred to as ‘old’; when significant differences in metabolic functions were obvious). Principal component

16

Page 17 of 205 Diabetes

analysis of the adipose transcriptome revealed that samples derived from young WT,

AdipoSIRT1 and AdipoH363Ycould be separated into three distinct clusters

(Supplementary Figure 5A). The number of differentially expressed (by >twofold)

transcripts was obtained by pairwise comparison between mice of the same age group or

between young and old mice of the same genotype (3915 genes in total; Supplementary

Table 1). Compared to young WT, 1390 and 429 genes were differentially expressed in

adipose tissues of agematched AdipoSIRT1 and AdipoH363Y, respectively

(Supplementary Figure 5B). Over 90% (1269) of the altered gene expressions in young

AdipoSIRT1 were due to upregulation (Supplementary Figure 6A). In adipose tissues of

AdipoH363Y, genes related to cholesterol biosynthesis were significantly upregulated

and those of mitochondrial fatty acid oxidation significantly downregulated

(Supplementary Figure 6B). With the progression of ageing, different patterns of changes

in adipose gene expression were observed in the three types of mice (Figure 5A). In

general, the genome expression and chromatin state in adipose tissues of AdipoH363Y

was more rigid than the other two groups of mice. The average gene expression levels in

adipose tissues of young WT, AdipoSIRT1 and AdipoH363Y were 0.210, 0.746 and

0.061, respectively. Compared to the corresponding young mice, a significant decrease

was observed in the average gene expression level of old AdipoSIRT1 (0.081), whereas

that of old AdipoH363Y decreased slightly to 0.041 (Figure 5A). Compared to those of

WT (1107) and AdipoSIRT1 (2425), less (901) numbers of genes were changed by

ageing (>twofold) in adipose tissues of old AdipoH363Y (Supplementary Figure 7, top

panels). In addition to those involved in sterol lipid metabolism, genes encoding

extracellular matrix and tight junction proteins were further upregulated in old Adipo

17

Diabetes Page 18 of 205

H363Y (Supplementary Figure 7, bottom panel). A larger number (2425) of genes were changed in old compared to young AdipoSIRT1, with ~70% downregulated, suggesting a more flexible and dynamic chromatin structure in adipose tissues of these mice

(Supplementary Figures 7 and 8). Calorie restriction prevented ~45% and ~36% of ageinginduced gene changes in adipose tissues of WT and AdipoH363Y, respectively.

Especially, out of the 103 genes upregulated in old AdipoH363Y adipose tissues, 93

(~90%) was prevented by calorie restriction (Supplementary Figure 8, top left panel).

Among those that remained unchanged (≤twofold) during ageing, 888 and 1029 were altered by calorie restriction (>twofold) in WT and AdipoH363Y, respectively

(Supplementary Figure 7, top right panel). About 47% and 60% of genes changed by calorie restriction (>twofold) in WT and AdipoH363Y, respectively, showed similar up or downregulated patterns of change with those in old AdipoSIRT1 when compared to young AdipoSIRT1 (Supplementary Figure 8, bottom panels).

Histone modifications control the stability and flexibility/rigidity of chromatin structure and its remodeling (24). Thus, histones were purified from adipose tissues of

WT, AdipoSIRT1 and AdipoH363Y to analyze the modifications at the epigenetic levels. Western blotting showed that even at the young age (eightweeks old), the three types of mice contained different amounts of acetylated and/or biotinylated histones in their adipose tissues. AdipoH363Y showed the highest level of histone biotinylation, whereas histone acetylation was significantly decreased in AdipoSIRT1 (Figure 5B).

Coimmunoprecipitation was performed and the results further confirmed that histones, including H3 and H4, were acetylated and biotinylated in adipose tissues of the three groups of mice, with acetylated histones containing significantly higher amounts of

18

Page 19 of 205 Diabetes

biotinylation (Supplementary Figure 9). Profile plots revealed that calorie restriction

decreased the average gene expression levels in both old WT and old AdipoH363Y

(Figure 5C), which was in line with the reduced histone acetylation levels in both types of

calorie restricted mice (Figure 5D). In addition, calorie restriction significantly decreased

the biotinylation of histones in AdipoH363Y preparations. By contrast, calorie

restriction had no significant effects on histone acetylation and biotinylation in adipose

tissues of AdipoSIRT1, both of which were significantly lower than in those of Adipo

H363Y (Figure 5D).

To confirm the altered epigenetic modifications in AdipoH363Y, a number of genes

were selected for analysis of the associated histones using chromatin

immunoprecipitation coupled with quantitative PCR (ChIPPCR). The expression of

these genes, including CUGBP, GADD, TRDN and ADIPOQ, was altered by ageing

and/or overexpression of hSIRT1(H363Y) (EMTAB2777 in ArrayExpress). Histone

biotinylation was detected at the promoter regions of all four genes and samples derived

from AdipoH363Y exhibited the highest levels of biotinylated histones (Supplementary

Figure 10, left panels). Consistent with gene expression changes induced by calorie

restriction, the amount of biotinylated histones was significantly reduced in samples from

calorierestricted WT, AdipoSIRT1 and AdipoH363Y (Supplementary Figure 10, right

panels). The results further demonstrated that the amounts of biotinylated histones were

significantly lower in fractions of nonacetylated than in those of acetylated histones

(Supplementary Figures 11 and 12).

Taken together, these results suggest that augmented histone biotinylation contributes

to the rigid chromatin structure in adipose tissues of AdipoH363Y, which prevents the

19

Diabetes Page 20 of 205

adaptive responses of genomic activation and silencing, thus leading to an accelerated ageing phenotype of these mice. The abnormal epigenetic modifications can be largely removed by calorie restriction.

Biotin deficiency prevents the development of metabolic dysfunctions in WT and

Adipo-H363Y

During ageing, biotin is progressively accumulated in adipose tissues of mice and inhibits the deacetylase activity of SIRT1 (14). The biotin content in adipose tissues of

AdipoH363Y was augmented significantly (by ~twofold) even at the age of 20weeks when compared to those in WT (Figure 6A, left panel). Calorie restriction prevented the accumulation of biotin in adipose tissues of both WT and AdipoH363Y (Figure 6A, right panel). To further validate the involvement of biotin accumulation in adipose tissues as a

cause of systemic metabolic deregulation, WT and AdipoH363Y were given either a biotinsufficient or a biotindeficient diet from ten to 20weeks of age. This relatively short period of biotin deficiency did not induce obvious abnormalities, but significantly reduced the biotin content and elevated SIRT1 activity in adipose tissues of WT and

AdipoH363Y (Figure 6B). Compared to those receiving the biotinsufficient diet, the amount of acetylated and biotinylated histones was decreased significantly in adipose tissues of mice fed the biotindeficient diet (Figure 6C). The latter diet also reduced the contents of the vitamin in livers [from 961 ± 113 to 703 ± 83 ng/g in WT and from 1042

± 175 to 685 ± 92 ng/g in AdipoH363Y]. By contrast, restriction of total calorie intake did not change the biotin contents in livers of either WT (710±132 ng/g) or Adipo

H363Y (730±111 ng/g), which were comparable to those of mice fed ad libitum (651±98 ng/g and 680±88 ng/g for WT and AdipoH363Y, respectively).

20

Page 21 of 205 Diabetes

Biotindeficient mice exhibited significantly improved ipGTT and ITT responses

compared to those receiving a biotinsufficient diet (Figure 6D). There was no significant

difference between WT and AdipoH363Y. The plasma insulin level was reduced in both

WT and AdipoH363Y fed with biotindeficient diet (Figure 6E, left panel). The non

fasting blood glucose was not different between WT and AdipoH363Y receiving the

biotinsufficient diet, which contained higher amounts of sucrose (60%) and fat (12%)

than the standard mouse chow (3.18% and 5.6%, respectively). Nevertheless, after ad

libitum feeding with biotindeficient diet, the plasma glucose level was reduced in both

WT and AdipoH363Y (Figure 6E, middle panel). Circulating triglycerides were also

decreased by the biotindeficient diet to similar levels in WT and AdipoH363Y, when

compared with their respective biotinsufficient groups (Figure 6E, right panel). Likewise,

the triglyceride content in skeletal muscle and liver was significantly reduced to

comparable levels in biotindeficient WT and AdipoH363Y (Figure 6F, left panel).

AdipoH363Y under biotindeficient diet showed an enhanced capacity of triglyceride

storage in their adipose tissues. In addition, the free fatty acid contents of adipose tissues

were significantly reduced by the biotindeficient diet in both WT and AdipoH363Y

(Figure 6F, right panel). Both calorie restriction and the biotindeficient diet increased

SIRT1 protein expression in adipose tissues of WT, but did not change that of Adipo

SIRT1 and AdipoH363Y (Supplementary Figure 13A). The circulating adiponectin

levels were elevated by both calorie restriction and the biotindeficient diet, whereas the

circulating levels of the proinflammatory adipokine lipocalin2 were reduced by these

treatments (Supplementary Figure 13, B and C).

21

Diabetes Page 22 of 205

Taken in conjunction, the present results support the concept that biotin accumulation

in adipose tissue is causally involved in the development of ageingassociated metabolic

abnormalities, and thus that limiting the intake of biotin represents an effective way to

enhance adipose SIRT1 function and prevent metabolic ageing.

Up-regulated acetyl-CoA carboxylase 2 contributes to the dominant negative effects

of hSIRT1(H363Y) on inhibiting endogenous SIRT1

SIRT1 regulates the protein stability and acetylation status of acetylCoA carboxylase

(ACC), a biotin reservoir (14; 25). The protein expression of ACC was upregulated in

adipose tissues of AdipoH363Y (Figure 7A). Further analysis revealed that the total protein level of isoform ACC2, but not ACC1, and that of acetylated ACC2 were

augmented significantly in adipose tissues of AdipoH363Y (Supplementary Figure

14A). Both SIRT1 and ACC2 were present in mitochondria isolated from the three groups

of mice (Supplementary Figure 14B). Both calorie restriction and biotindeficient diet

decreased the total amount of ACC2 in adipose tissues of AdipoH363Y (Figure 7B). The

amount of acetylated ACC2 was also reduced by the treatments (Figure 7C). To confirm

that ACC2 is involved in regulating the total amount of biotin, specific chemically

modified ACC2 siRNAs were used to treat WT and AdipoH363Y in vivo. After

treatment, epididymal adipose tissues were collected for analysis. Reducing total ACC2 protein levels significantly decreased the amount of biotin in adipose tissues of both types

of mice, but increased their SIRT1 activities (Figure 7D). Moreover, ACC2 siRNA

treatment significantly inhibited the biotinylation and acetylation of histones in adipose

tissues of AdipoH363Y (Figure 7E). In addition, recombinant adenovirusmediated

overexpression of hSIRT1(H363Y) in cultured 3T3L1 adipocytes significantly increased

22

Page 23 of 205 Diabetes

the protein levels of ACC2, the intracellular accumulation of biotin, as well as the amount

of biotinylated histones (Figure 7F).

Histones are the most conserved protein substrates of SIRT1 (26). To define the

interrelationships between histone acetylation and biotinylation, a series of histone H3

peptides containing 21 amino acid residues with acetylated K14 and/or biotinylated K18

were synthesized (Supplementary Figure 15A). In vitro deacetylation assays were

performed to compare SIRT1mediated deacetylation of acetylH3 with that of biotinyl

acetylH3 (Supplementary Figure 15B). The ratios of nicotinamide (NAM)/NAD and

deacetylH3/acetylH3, which were calculated based on the sizes of the peaks, were both

significantly reduced (by ~80%) in reactions containing the peptide with biotinylated

K18 (Supplementary Figure 15B), indicating that biotinylated histones are less

susceptible to SIRT1mediated deacetylation. When biotin was present in the reaction

buffer, SIRT1 did not cause deacetylation of acetylH3 peptide (Supplementary Figure

7C). In fact, the addition of biotin facilitated the formation of biotinylacetylH3 peptide

clusters from acetylH3 peptide (Supplementary Figure 15C).

These results demonstrate that upregulated ACC2 in adipose tissues of Adipo

H363Y plays a major role in causing accumulation of biotin, which either directly

inhibits the endogenous SIRT1 activity (14), or promotes histone biotinylation in turn

preventing SIRT1mediated deacetylation.

Discussion

Adipose tissue stores the surplus of energy as triglycerides and regulates whole body

energy metabolism by secreting adipokines that elicit endocrine/paracrine functions.

During ageing, the distribution and composition of body fat change significantly (27). A

23

Diabetes Page 24 of 205

decline of fat storage in adipose depots and an elevation of fat accumulation in ectopic organs (e.g. liver and skeletal muscle) contribute to the deterioration of systemic metabolic functions, including insulin resistance, hyperlipidemia and hyperglycemia (28).

Overflow of lipids into organs other than the fat depots is also a significant contributing factor to the accelerated ageing process in obese populations (29). Calorie restriction is the most robust nongenetic approach to extend lifespan and improve health in mammals

(30). It counteracts obesity and related metabolic complications, by promoting weight loss and normalizing the function of adipose tissues (31). In particular, calorie restriction increases the production of adiponectin, an insulin sensitizing adipokine (32), and represses inflammation in adipose tissues (33). Yet, the molecular mechanisms underlying the beneficial effects of calorie restriction are still poorly understood. It has been questioned whether the actual decrease in calorie intake or the restriction of varying nutrients accounts for lifespan modulation by calorie restriction (34).

The present study demonstrates that restricting certain dietary components, in particular biotin, impacts positively on energy metabolism and prevents metabolic ageing, by enhancing SIRT1 activities in adipose tissues. Biotin and its metabolite, biotinyl5’AMP, are potent and competitive inhibitors of SIRT1 (14). Biotinyl5’AMP occupies the NAD binding site and prevents the breakdown of NAD by SIRT1. Since

NAD also acts as a cofactor permitting SIRT1 to interact with protein substrates, inhibition of NAD binding by biotinyl5’AMP prevents the interactions between SIRT1 and acetylated protein substrates (14). Biotin occupies the binding pocket of nicotinamide, which may prevent the conformational change from nonproductive to productive SIRT1 (35; 36). Calorie restriction reduces total biotin levels in adipose

24

Page 25 of 205 Diabetes

tissues; as a result, the direct inhibitory effects of this vitamin on SIRT1 activity in such

tissues of calorierestricted WT and AdipoH363Y are alleviated.

The present results further suggest that biotinylation of protein substrates represents

an indirect route by which biotin interferes with the enzymatic functions of SIRT1.

Biotinylated histone peptides are resistant to SIRT1mediated deacetylation. Although

being relatively rare (37), biotinylated histones have been detected in human cells and

play a functional role in gene silencing, responses to DNA damage, and cell proliferation

(38). Spontaneous histone biotinylation occurs in the presence of biotinyl5’AMP and in

the absence of biotin protein ligases (39). Thus, an increased intracellular biotin content

and/or turnover can elevate the amount of biotinylated histones. So far, eleven

biotinylation sites in histones have been identified, including K9, 13, 125, 127, 129 in

histone H2A, K4, 9, 18, 23 in histone H3, and K8, 12 in histone H4 (40). Biotinylated

histones contribute to epigenetic modulations involved in the regulation of chromatin

structure/stability and genome activation/inactivation. This conclusion is supported by the

present observation that different levels of histone biotinylation determine the distinctive

patterns of ageinginduced chromatin remodeling. Biotincontaining nucleosomes

maintain a more condensed average structure (41). In AdipoH363Y, increased

biotinylation prevents endogenous SIRT1mediated deacetylation of histones and renders

the genome more rigid even at a relatively young age. The resulting structural changes

alter the chromatin activities of AdipoH363Y, causing an imbalanced production of pro

and antiinflammatory adipokines, abnormal expression of genes involved in lipid

metabolism, adipogenesis and extracellular matrix deposition, and aberrant genetic

adaptations to external conditions and ageing. However, calorie restriction can restore the

25

Diabetes Page 26 of 205

nucleosomal remodeling process and reset the basal state of the genome structures in adipose tissues of AdipoH363Y. The present study further demonstrates that the beneficial effects of calorie restriction can be mimicked by restriction intake of biotin, which directly (14) and indirectly (by modifying its protein substrates) enhances the endogenous activity of SIRT1.

The initial breakthrough of identification of SIR2 as an enzyme came along with the identification of the Salmonella typhimurium CobB protein, a SIR2 homolog (42). CobB compensates for the lack of CobT mutants during vitamin B12 biosynthesis and possesses nicotinate mononucleotide (NaMN)dependent phosphoribosyltransferase activity. Thus,

CobB catalyzes the release of nicotinic acid from NaMN, whereas SIRT1 removes nicotinamide from NAD. Biotin and nicotinamide were originally discovered as the same class of heatstable vitamins (43). Unlike nicotinamide, nutritional deficiencies of biotin are rare. Biotin functions in mammals as a CO2 carrier for reactions in which a carboxyl

group is transferred to one of four biotindependent carboxylases. Consequently, biotin participates as an important cofactor in gluconeogenesis, fatty acid synthesis, and branchedchain amino acid catabolism (44). During ageing, the deacetylase activity of

SIRT1 is decreasing progressively in adipose tissues, and this is accompanied by

excessive biotin accumulation (14). The evidence from the present study and a previous

report suggest that biotin supply in diet dominantly inhibits SIRT1 activity and abolishes

the beneficial functions of this antiaging protein (14). However, a selfdefending

mechanism for preventing excess accumulation of biotin is controlled by SIRT1 via

ACC2, a major intracellular reservoir and a mitochondrial store of biotin (14; 45). The present results suggest that by reducing the total protein amount of ACC2, SIRT1 can

26

Page 27 of 205 Diabetes

regulate the intracellular biotin contents in adipocytes. Under conditions of low biotin

intake, enhanced SIRT1 activity downregulates ACC2, leading to a further decrease of

intracellular biotin content and the elimination of biotinylated histones, in turn facilitating

the dynamic chromatin remodeling and genome activation/inactivation.

The highly conserved H363 residue of SIRT1 forms the binding site for NAD. In

yeast, the hSIRT1(H363Y) equivalent mutant SIR2(H364Y) possesses an impaired NAD

dependent histone deacetylase activity (7; 26). The strong dominantnegative effects of

SIR2(H364Y) has been suggested to result from the incorporation of an inactive SIR2

into silencing complexes. In mammalian cells, while the histone deacetylation activity of

hSIRT1(H363Y) is impaired, the silencing effects of this mutant are not completely lost

(46; 47). The hSIRT1(H363Y) mutant exhibits defective substrate binding and catalytic

activity that are not locus or speciesspecific (35). The present study reveals that in

adipose tissues of AdipoH363Y, increased biotin contents and augmented biotinylation

of histones play a dominantnegative role in preventing endogenous SIRT1mediated

deacetylation and chromatin remodeling. In adipose tissues of AdipoSIRT1, the

interactions between SIRT1 and ACC2 are significantly enhanced and more sensitive to

nutritional changes. By contrast, mice with overexpression of hSIRT1(H363Y) in adipose

tissues show significantly decreased interactions between ACC2 and SIRT1 (data not

shown), leading to a persistent elevation of the protein levels of ACC2, both under basal

conditions and during dietary interventions. The present results demonstrate that down

regulation of ACC2 [the mitochondrial form of ACC (48)] reduces the biotin content in

adipose tissues and leads to a significantly decreased level of histone biotinylation.

Previous radioactive tracer studies suggest that a significant portion of biotin is localized

27

Diabetes Page 28 of 205

as bound forms in both nuclei and mitochondria (49). While ACC2 and SIRT1 are both localized in mitochondria, the amount of SIRT1(H363Y) in this organelle is significantly reduced, which may be attributed to the augmented ACC2 protein levels in adipose tissues of these mice.

In summary, histone biotinylation was significantly enhanced in adipose tissues of

AdipoH363Y, causing deranged epigenetic modifications and chromatin remodeling,

which contributed to the accelerated ageing phenotype in these mice. Calorie restriction

reduces biotinylated histone levels in adipose tissues of AdipoH363Y, allowing

nucleosome deacetylation to occur in these mice at similar levels as in WT. However,

unlike biotindeficient diet, calorie restriction could not further improve most of the

metabolic parameters beyond the levels of those in AdipoSIRT1, which correlates with

its milder effects on biotin reduction in mice adipose tissues. By contrast, the biotin

deficient diet more aggressively decreases biotin contents in adipose tissues of WT and

AdipoH363Y beyond those in AdipoSIRT1, supporting the interpretation that short

term biotin restriction in the diet is more effective in improving metabolic function than a

general restriction of total calorie intake. Thus, while biotinylation directly inhibits

SIRT1mediated deacetylation of histones, calorie restriction or a diet deficient in biotin prevents histone biotinylation independent of SIRT1, which subsequently facilitates gene

silencing and prevent ageing (Figure 8). Based on this information, one could speculate

that in mammals, caloric restriction may enhance SIRT1 activity by selective depletion of biotin storage in adipose tissue, in turn preventing ageingassociated metabolic disorders and promoting lifespan extension.

28

Page 29 of 205 Diabetes

29

Diabetes Page 30 of 205

Acknowledgements

CX, YC, PF, BB and JC – performed the experiment; CX, YC, PF, HBD and YW – data analysis and results presentation; CX, PMV and YW – manuscript preparation; AX, PMV and

YW – experimental design and project supervision; CMC, AX, PMV and YW – funding support and manuscript revision. This work was supported in part by grants from Seeding

Funds for Basic Research of the University of Hong Kong, Research Grant Council grants

(HKU779712M and HKU780613M) of Hong Kong; the Special Equipment Grant Scheme

(SEGHKU02) from University Grants Committee, HKSAR; and the National Basic Research

Program of China (973 Program 2015CB553603).

All authors have no conflicts of interest to declare.

30

Page 31 of 205 Diabetes

References

1. Jamali R, BachrachLindstrom M, Mohseni S: Continuous glucose monitoring system

signals the occurrence of marked postprandial hyperglycemia in the elderly. Diabetes

Technol Ther 2005;7:509515

2. Kalyani RR, Egan JM: Diabetes and altered glucose metabolism with aging.

Endocrinology and metabolism clinics of North America 2013;42:333347

3. Russell SJ, Kahn CR: Endocrine regulation of ageing. Nat Rev Mol Cell Biol

2007;8:681691

4. Tchkonia T, Thomou T, Zhu Y, Karagiannides I, Pothoulakis C, Jensen MD, Kirkland

JL: Mechanisms and metabolic implications of regional differences among fat depots.

Cell Metab 2013;17:644656

5. Wang Y, Xu C, Liang Y, Vanhoutte PM: SIRT1 in metabolic syndrome: where to target

matters. Pharmacology & therapeutics 2012;136:305318

6. Wang Y: Molecular Links between Caloric Restriction and Sir2/SIRT1 Activation.

Diabetes & Metabolism Journal 2014;38:321329

7. Tanny JC, Dowd GJ, Huang J, Hilz H, Moazed D: An enzymatic activity in the yeast

Sir2 protein that is essential for gene silencing. Cell 1999;99:735745

8. Frye RA: Characterization of five human cDNAs with homology to the yeast SIR2

gene: Sir2like proteins (sirtuins) metabolize NAD and may have protein ADP

ribosyltransferase activity. Biochem Biophys Res Commun 1999;260:273279

9. Chalkiadaki A, Guarente L: Sirtuins mediate mammalian metabolic responses to

nutrient availability. Nat Rev Endocrinol 2012;8:287296

10. Corbi G, Conti V, Scapagnini G, Filippelli A, Ferrara N: Role of sirtuins, calorie

31

Diabetes Page 32 of 205

restriction and physical activity in aging. Front Biosci (Elite Ed) 2011;4:768778

11. Cohen HY, Miller C, Bitterman KJ, Wall NR, Hekking B, Kessler B, Howitz KT,

Gorospe M, de Cabo R, Sinclair DA: Calorie restriction promotes mammalian cell survival by inducing the SIRT1 deacetylase. Science 2004;305:390392

12. Picard F, Kurtev M, Chung N, ToparkNgarm A, Senawong T, Machado De Oliveira

R, Leid M, McBurney MW, Guarente L: Sirt1 promotes fat mobilization in white adipocytes by repressing PPARgamma. Nature 2004;429:771776

13. Chen D, Bruno J, Easlon E, Lin SJ, Cheng HL, Alt FW, Guarente L: Tissuespecific regulation of SIRT1 by calorie restriction. Genes Dev 2008;22:17531757

14. Xu C, Bai B, Fan P, Cai Y, Huang B, Law IK, Liu L, Xu A, Tung C, Li X, Siu FM,

Che CM, Vanhoutte PM, Wang Y: Selective overexpression of human SIRT1 in adipose tissue enhances energy homeostasis and prevents the deterioration of insulin sensitivity with ageing in mice. Am J Transl Res 2013;5:412426

15. Bordone L, Cohen D, Robinson A, Motta MC, van Veen E, Czopik A, Steele AD,

Crowe H, Marmor S, Luo J, Gu W, Guarente L: SIRT1 transgenic mice show phenotypes resembling calorie restriction. Aging Cell 2007;6:759767

16. Banks AS, Kon N, Knight C, Matsumoto M, GutierrezJuarez R, Rossetti L, Gu W,

Accili D: SirT1 gain of function increases energy efficiency and prevents diabetes in mice. Cell Metab 2008;8:333341

17. Kraus D, Yang Q, Kong D, Banks AS, Zhang L, Rodgers JT, Pirinen E, Pulinilkunnil

TC, Gong F, Wang YC, Cen Y, Sauve AA, Asara JM, Peroni OD, Monia BP, Bhanot S,

Alhonen L, Puigserver P, Kahn BB: Nicotinamide Nmethyltransferase knockdown protects against dietinduced obesity. Nature 2014;508:258262

32

Page 33 of 205 Diabetes

18. Law IK, Xu A, Lam KS, Berger T, Mak TW, Vanhoutte PM, Liu JT, Sweeney G,

Zhou M, Yang B, Wang Y: Lipocalin2 deficiency attenuates insulin resistance associated

with aging and obesity. Diabetes 2010;59:872882

19. Wang Y, Lam KS, Chan L, Chan KW, Lam JB, Lam MC, Hoo RC, Mak WW, Cooper

GJ, Xu A: Posttranslational modifications of the four conserved lysine residues within

the collagenous domain of adiponectin are required for the formation of its high

molecular weight oligomeric complex. J Biol Chem 2006;281:1639116400

20. Wang Y, Lam KS, Kraegen EW, Sweeney G, Zhang J, Tso AW, Chow WS, Wat NM,

Xu JY, Hoo RL, Xu A: Lipocalin2 is an inflammatory marker closely associated with

obesity, insulin resistance, and hyperglycemia in humans. Clin Chem 2007;53:3441

21. Chow KH, Sun RW, Lam JB, Li CK, Xu A, Ma DL, Abagyan R, Wang Y, Che CM: A

gold(III) porphyrin complex with antitumor properties targets the Wnt/betacatenin

pathway. Cancer Res 2010;70:329337

22. Peng GH, Chen S: Double chromatin immunoprecipitation: analysis of target co

occupancy of retinal transcription factors. Methods in molecular biology 2013;935:311

328

23. Hayakawa K, Oizumi J: Determination of free biotin in plasma by liquid

chromatography with fluorimetric detection. Journal of chromatography 1987;413:247

250

24. Fang WQ, Ip JP, Li R, Ng YP, Lin SC, Chen Y, Fu AK, Ip NY: Cdk5mediated

phosphorylation of Axin directs axon formation during cerebral cortex development. The

Journal of neuroscience : the official journal of the Society for Neuroscience

2011;31:1361313624

33

Diabetes Page 34 of 205

25. Law IK, Liu L, Xu A, Lam KS, Vanhoutte PM, Che CM, Leung PT, Wang Y:

Identification and characterization of proteins interacting with SIRT1 and SIRT3: implications in the antiaging and metabolic effects of sirtuins. Proteomics 2009;9:2444

2456

26. Imai S, Armstrong CM, Kaeberlein M, Guarente L: Transcriptional silencing and longevity protein Sir2 is an NADdependent histone deacetylase. Nature 2000;403:795

800

27. Tchkonia T, Morbeck DE, Von Zglinicki T, Van Deursen J, Lustgarten J, Scrable H,

Khosla S, Jensen MD, Kirkland JL: Fat tissue, aging, and cellular senescence. Aging Cell

2010;9:667684

28. Ahima RS: Connecting obesity, aging and diabetes. Nat Med 2009;15:996997

29. Tzanetakou IP, Katsilambros NL, Benetos A, Mikhailidis DP, Perrea DN: "Is obesity linked to aging?": adipose tissue and the role of telomeres. Ageing Res Rev 2012;11:220

229

30. Mattison JA, Roth GS, Beasley TM, Tilmont EM, Handy AM, Herbert RL, Longo

DL, Allison DB, Young JE, Bryant M, Barnard D, Ward WF, Qi W, Ingram DK, de Cabo

R: Impact of caloric restriction on health and survival in rhesus monkeys from the NIA study. Nature 2012;489:318321

31. Liao CY, Rikke BA, Johnson TE, Gelfond JA, Diaz V, Nelson JF: Fat maintenance is a predictor of the murine lifespan response to dietary restriction. Aging Cell 2011;10:629

639

32. Wang Y, Lam KS, Yau MH, Xu A: Posttranslational modifications of adiponectin: mechanisms and functional implications. Biochem J 2008;409:623633

34

Page 35 of 205 Diabetes

33. Ding Q, Ash C, Mracek T, Merry B, Bing C: Caloric restriction increases adiponectin

expression by adipose tissue and prevents the inhibitory effect of insulin on circulating

adiponectin in rats. J Nutr Biochem 2012;23:867874

34. Szafranski K, Mekhail K: The fine line between lifespan extension and shortening in

response to caloric restriction. Nucleus 2014;5:5665

35. Min J, Landry J, Sternglanz R, Xu RM: Crystal structure of a SIR2 homologNAD

complex. Cell 2001;105:269279

36. Zhao K, Harshaw R, Chai X, Marmorstein R: Structural basis for nicotinamide

cleavage and ADPribose transfer by NAD(+)dependent Sir2 histone/protein

deacetylases. Proc Natl Acad Sci U S A 2004;101:85638568

37. Kuroishi T, RiosAvila L, Pestinger V, Wijeratne SS, Zempleni J: Biotinylation is a

natural, albeit rare, modification of human histones. Mol Genet Metab 2011;104:537545

38. Filenko NA, Kolar C, West JT, Smith SA, Hassan YI, Borgstahl GE, Zempleni J,

Lyubchenko YL: The role of histone H4 biotinylation in the structure of nucleosomes.

PLoS One 2011;6:e16299

39. Healy S, Heightman TD, Hohmann L, Schriemer D, Gravel RA: Nonenzymatic

biotinylation of histone H2A. Protein science : a publication of the Protein Society

2009;18:314328

40. Zempleni J, Teixeira DC, Kuroishi T, Cordonier EL, Baier S: Biotin requirements for

DNA damage prevention. Mutation research 2012;733:5860

41. Singh MP, Wijeratne SS, Zempleni J: Biotinylation of lysine 16 in histone H4

contributes toward nucleosome condensation. Arch Biochem Biophys 2013;529:105111

42. Tsang AW, EscalanteSemerena JC: CobB, a new member of the SIR2 family of

35

Diabetes Page 36 of 205

eucaryotic regulatory proteins, is required to compensate for the lack of nicotinate mononucleotide:5,6dimethylbenzimidazole phosphoribosyltransferase activity in cobT mutants during cobalamin biosynthesis in Salmonella typhimurium LT2. J Biol Chem

1998;273:3178831794

43. Lanska DJ: The discovery of niacin, biotin, and pantothenic acid. Annals of nutrition

& metabolism 2012;61:246253

44. Depeint F, Bruce WR, Shangari N, Mehta R, O'Brien PJ: Mitochondrial function and toxicity: role of the B vitamin family on mitochondrial energy metabolism. Chemico biological interactions 2006;163:94112

45. Shriver BJ, RomanShriver C, Allred JB: Depletion and repletion of biotinyl enzymes in liver of biotindeficient rats: evidence of a biotin storage system. J Nutr

1993;123:11401149

46. Senawong T, Peterson VJ, Leid M: BCL11Adependent recruitment of SIRT1 to a promoter template in mammalian cells results in histone deacetylation and transcriptional repression. Arch Biochem Biophys 2005;434:316325

47. Langley E, Pearson M, Faretta M, Bauer UM, Frye RA, Minucci S, Pelicci PG,

Kouzarides T: Human SIR2 deacetylates p53 and antagonizes PML/p53induced cellular senescence. EMBO J 2002;21:23832396

48. AbuElheiga L, Matzuk MM, AboHashema KA, Wakil SJ: Continuous fatty acid oxidation and reduced fat storage in mice lacking acetylCoA carboxylase 2. Science

2001;291:26132616

49. Dakshinamurti K: Biotina regulator of gene expression. J Nutr Biochem

2005;16:419423

36

Page 37 of 205 Diabetes

50. Wang Y, Xu A, Knight C, Xu LY, Cooper GJ: Hydroxylation and glycosylation of the

four conserved lysine residues in the collagenous domain of adiponectin. Potential role in

the modulation of its insulinsensitizing activity. J Biol Chem 2002;277:1952119529

51. Zu Y, Liu L, Lee MY, Xu C, Liang Y, Man RY, Vanhoutte PM, Wang Y: SIRT1

promotes proliferation and prevents senescence through targeting LKB1 in primary

porcine aortic endothelial cells. Circ Res 2010;106:13841393

37

Diabetes Page 38 of 205

Figure legends

Figure 1. Overexpression of hSIRT1(H363Y) in adipose tissue accelerates the development of metabolic ageing in mice. A, Insulin tolerance (ITT) and intraperitoneal glucose tolerance test (ipGTT) were performed and compared between 30 and 60weeks old WT, AdipoSIRT1 and AdipoH363Y. B, Body weight was recorded after overnight fasting and the body weight gain calculated by referring to those of WT, AdipoSIRT1 and AdipoH363Y at the age of eightweeks. C, Blood glucose was recorded at 10:00 am in mice fed ad libitum. D, Circulating insulin levels were measured in sera collected from

WT, AdipoSIRT1 and AdipoH363Y after overnight fasting. E, Mice were sacrificed at

different ages and the fasting serum triglyceride concentration measured. *, P<0.05

compared with the corresponding WT group (n=8).

Figure 2. Selective overexpression of hSIRT1(H363Y) in adipose tissues leads to

augmented body fat mass and ectopic lipid accumulation. A, Body fat composition

(fat content/body weight%) was analyzed and compared in WT, AdipoSIRT1 and

AdipoH363Y from different age groups. The results are calculated as percentage values

of the body weights. B, The wet weights of epididymal and perirenal fat pads were

recorded and combined to calculate the percentage amounts of visceral fat compared to

the total body weight. C, Triglycerides (upper), cholesterols (middle) and free fatty acids

(bottom) were measured in epididymal (epi) fat, liver and skeletal muscle collected from

WT, AdipoSIRT1 and AdipoH363Y (40weeks old, fasted for 16 hours). D, Indirect

calorimetry analysis was performed to obtain the RER, VO2 and VCO2 values in WT,

AdipoSIRT1 and AdipoH363Y (30weeks old, fed ad libitum) (light period 07001900).

*, P<0.05 compared with corresponding WT (n=10).

38

Page 39 of 205 Diabetes

Figure 3. Caloric restriction prevents ageing- and/or hSIRT1(H363Y)

overexpression-induced metabolic defects in WT and Adipo-H363Y. A, Protein

expression of SIRT1 was monitored in epididymal fat lysates of WT, AdipoSIRT1 and

AdipoH363Y by Western blotting using an antibody recognizing both the murine and

human species of this protein. B, A Fluorometric Drug Discovery kit was used to

measure the SIRT1 activity in epididymal fat pads collected from different age groups of

WT, AdipoSIRT1 and AdipoH363Y. For each sample, tissue lysates containing 20 g

of proteins were used. Fluorescent readings are presented as arbitrary fluorescence unit

(AFU) in equal amount of proteins for comparison. C, SIRT1 activity was determined in

epididymal fat pads collected from WT, AdipoSIRT1 and AdipoH363Y subjected to

30weeks of calorie restriction (CR). D, Blood glucose was recorded at 10:00 am for

mice under calorie restriction and compared across different groups. E, ITT (top left) and

ipGTT (top right) were performed in ~30weeks old WT, AdipoSIRT1 and Adipo

H363Y either fed ad libitum (AL) or subjected to calorie restriction (CR). The areas

under the curve (AUC) are compared (bottom left and right, respectively). F, Body

weight gain was calculated as in Figure 1B for WT, AdipoSIRT1 and AdipoH363Y

subjected to calorie restriction from the age of 12weeks onwards (left). Fasting (16 hours)

insulin concentration (right) was measured using sera samples collected from 40weeks

old WT, AdipoSIRT1 and AdipoH363Y under calorie restriction. *, P<0.05 compared

with the corresponding WT group; #, P<0.05 compared with the corresponding AL group

(n=8).

Figure 4. Caloric restriction restores the metabolic capacity and reduces ectopic

lipid accumulation in Adipo-H363Y. A, Indirect calorimetric analysis was performed

39

Diabetes Page 40 of 205

in30weeks old WT, AdipoSIRT1 and AdipoH363Y under calorie restriction (light period 07001900). B, Percentage body fat mass (total fat content/body weight%, left panel) and visceral (epididymal and per renal fat/body weight%, right panel) fat were

measured and calculated for calorierestricted WT, AdipoSIRT1 and AdipoH363Y as in

Figure 2. C, Serum triglyceride concentration was monitored in calorierestricted mice

sacrificed at the ages of 20, 30, or 40weeks. D, Tissue contents of triglycerides (left),

cholesterols (middle) and free fatty acids (right) were measured in epididymal fat pads

collected from WT, AdipoSIRT1 and AdipoH363Y after 30weeks of calorie restriction.

E, Tissue triglyceride contents in livers and skeletal muscles collected from calorie

restricted WT, AdipoSIRT1 and AdipoH363Ywere measured and compared. (n=8)

Figure 5. Calorie restriction prevents ageing- and hSIRT1(H363Y)-induced gene

changes by inhibiting histone biotinylation and promoting histone acetylation. A,

Profile plot was performed by GeneSpring GX 12.6 to display the normalized intensity changes between young (eightweeks) and old (40weeks) WT, AdipoSIRT1 or Adipo

H363Y. Each line represents a single gene of the 3915 gene list summary (Supplementary

Table 1). The average intensities of all genes were calculated for both ‘young’ and ‘old’ samples and are listed at the bottom of each graph. B, Histone enrichment was performed

using epididymal adipose tissues collected from eightweeks old WT, AdipoSIRT1 and

AdipoH363Y. Western blotting was performed to analyze the global acetylated (top left,

detected with antiacetylated lysine antibody) and biotinylated (top middle, probed with

streptavidinHRP) histone levels in isolated histone fractions (top right, stained with

CBB). The band signals were quantified and presented as fold changes for H3 and H4,

respectively (bottom left and right). C, Profile plot was performed as in Figure 5A to

40

Page 41 of 205 Diabetes

display the normalized intensity changes between young (eightweeks) and calorie

restricted old (old_CR, 40weeks) WT or AdipoH363Y. Each line represents a single

gene of the 3915 gene list (Supplementary Table 1). The average intensities of all genes

were calculated and are listed at the bottom of each sample group. D, Epididymal fat pads

were collected from mice (40weeks old) that were either fed ad libitum (AL) or

subjected to calorie restriction (CR). Global acetylated and biotinylated histone levels

were determined as in panel B. *, P<0.05 compared with corresponding WT group; #,

P<0.05 compared with corresponding AL group (n=36).

Figure 6. Biotin-deficient diet restores metabolic functions in WT and Adipo-H363Y.

A,The tissue content of biotin was measured in epididymal fat pads collected from WT

and AdipoH363Y at different ages (left), and compared between mice (30weeks old)

that were fed ad libitum and under calorie restriction treatment (right). B, Biotin content

(left) and SIRT1 activity (right) were measured in epididymal adipose tissues of WT and

AdipoH363Y subjected to treatments with biotinsufficient (SU) or biotindeficient (DE)

diet. C, Acetylated or biotinylated histones were detected as in Figure 5 using adipose

tissues collected from WT and AdipoH363Y fed with either SU or DE diets. D,

Intraperitoneal glucose tolerance test (ipGTT) (top) and insulin tolerance test (ITT)

(bottom) were performed in WT and AdipoH363Y subjected to tenweeks of SU or DE

diets. The areas under the curve (AUC) were calculated and compared (right panels). E,

Serum insulin, nonfasting glucose and circulating triglyceride levels were measured and

compared in WT and AdipoH363Y fed with SU or DE diets. F, Tissue triglycerides (left)

and free fatty acids (right) were measured in WT and AdipoH363Y fed with SU or DE

41

Diabetes Page 42 of 205

diets. *, P<0.05 compared with corresponding WT control group; #, P<0.05 compared

with the corresponding SU group (n=8).

Figure 7. ACC2 regulates total biotin content in adipose tissues. A, Western blotting

analysis of ACC protein expression in epididymal fat pads collected from WT and Adipo

H363Y at different ages. B, Expression of ACC2 was compared in epididymal fat pads of

WT and AdipoH363Y fed ad libitum (AL) or under calorie restriction (CR) (top), or subjected to biotinsufficient (SU) or biotindeficient (DE) diet treatments (bottom). C,

Immunoprecipitation was performed using antibodies against ACC2 and the acetylated

ACC2 was measured in the immunoprecipitates by Western blotting. D, Biotin content

(top), ACC expressions (middle) and SIRT1 activity (bottom) were measured in epididymal fat lysates of WT and AdipoH363Y treated in vivo with specific ACC2 silencing RNA (siRNA) or scrambled siRNA (scRNA). E, Biotinylated and acetylated level of histones were compared in epididymal fat pads of WT and AdipoH363Y after

RNAi treatment as in panel D. F, Murine 3T3L1 preadipocytes induced to differentiate as described (50), followed by infection with recombinant adenoviruses encoding luciferase or the human SIRT1 mutant hSIRT1(H363Y) at a moi of 100 (51). The cells were harvested 48 hours after infection. Protein expression of SIRT1 and ACC2 (top left), biotin content (bottom left) and biotinylated histones (right) were measured as above. *,

P<0.05 compared with corresponding control groups;#, P<0.05 compared with the corresponding scRNA groups (n=34).

Figure 8. Schematic summary. Calorie restriction prevents SIRT1 dysfunctioninduced abnormal chromosome remodeling and epigenetic modification in adipose tissues.

42

Page 43 of 205 Diabetes Diabetes Page 44 of 205 Page 45 of 205 Diabetes Diabetes Page 46 of 205 Page 47 of 205 Diabetes Diabetes Page 48 of 205 Page 49 of 205 Diabetes Diabetes Page 50 of 205 Page 51 of 205 Diabetes

Online Supplemental Materials Diabetes Page 52 of 205

Supplementary Figure Legends

Supplementary Figure 1. ITT (left) and ipGTT (right) were performed in WT, Adipo

SIRT1 and AdipoH363Y at different ages. The areas under the curve (AUC) are compared. *,

P<0.05 compared with the corresponding WTM group (n=8).

Supplementary Figure 2. Body lean and fluid mass compositions were analyzed and compared in WT, AdipoSIRT1 and AdipoH363Y from different age groups. The results are calculated as percentage values of the body weight (n=10).

Supplementary Figure 3. After H&E staining of the adipose tissue sections, the size of adipocytes was measured and calculated using Image J software. Ten fields were randomly chosen and the size of adipocytes is presented as average crosssectional area (bottom left panel) and the frequency distribution (bottom right panel). * P<0.05 compared with corresponding WT group. Magnification, 200x.

Supplementary Figure 4. A, Masson's trichrome staining was performed for adipose tissue sections collected from 30weeks old WT, AdipoSIRT1 and AdipoH363Y under standard chow.

Extracellular collagens are stained with blue, as indicated by arrow heads. B, The gene expressions in adipose tissues of WT, AdipoSIRT1 and AdipoH363Y were measure by QPCR.

Results are normalized to βactin and presented as fold changes against WT group. *, P<0.05 compared with corresponding WT group.

Supplementary Figure 5. Microarray analysis was performed to distinguish the patterns of gene expression changes in adipose tissues of WT, AdipoSIRT1 and AdipoH363Y during ageing. A,

Principal component analysis was performed by GeneSpring GX 12.6 for clustering the gene Page 53 of 205 Diabetes

expression profiles in adipose tissues of the three types of mice (eightweeks old). Three

dimensional plots based on the first three principle components are presented. B, Venn diagram

presentation of the gene entities that were significantly changed (>2fold) between any two

groups of young WT, AdipoSIRT1 and AdipoH363Y.

Supplementary Figure 6. A, Venn diagram presentation of genes up or downregulated among

the young groups of mice. B, The list of gene changes was analyzed by referring to the Kyoto

Encyclopedia of Genes and Genomes (KEGG) Pathway database and presented according to

individual pathway category. The up or downregulation are presented as arrows and the

numbers of the arrows illustrate the relative pathway enrichment.

Supplementary Figure 7. Venn diagram presentation of genes that were changed (>2fold, top

left panel) or unchanged (≤2fold, top right panel) in old WT (green), old AdipoSIRT1 (blue)

and old AdipoH363Y (red) when compared to their respective groups of young mice. Yellow

numbers refer to those corrected (left, ≤2 in changed group) or changed (right, ≥2 in unchanged

group) by caloric restriction, when compared between calorierestricted old mice and their

respective young groups fed ad libitum. KEGG pathways were listed in bottom panel for those

genes changed by ageing or calorie restriction in different groups of mice.

Supplementary Figure 8. Venn diagram presentation of genes that were up (left) or down

(right) regulated in WT (green), AdipoSIRT1 (blue) and AdipoH363Y (red) mice compared

between the old and respective young groups (top panels), or the calorierestricted old and

respective young groups (bottom panels). Yellow numbers refer to those corrected by caloric

restriction, which was defined as fold change ≤2 when compared between calorierestricted old

mice and their corresponding young groups fed ad libitum. Diabetes Page 54 of 205

Supplementary Figure 9. Epididymal fat pads of eightweeks old WT, AdipoSIRT1 and

AdipoH363Y were collected. Immunoprecipitation (IP) was performed using antibodies against

total or acetylated histone H3 (A) and histone H4 (B). The biotinylation of precipitated histones

was measured by Western blotting. The image intensity was analyzed by Image J and is presented as fold changes compared with corresponding levels in total histone of WT group

(bottom panels). *, P<0.05 compared with WT groups; #, P<0.05 compared with corresponding total histone groups (n=3).

Supplementary Figure 10. Histone modifications were quantified by ChIPPCR for four different genes, including CUGBP, TRDN, GADD and ADIPOQ. The first ChIP was performed by using antibody recognizing acetylhistone H4 (K5, 8, 12 and 16). The immunoprecipitated chromatin complex was analyzed further with a second round of ChIP using Streptavidin conjugated agarose beads. The products were visualized by densitometry and representative gel images are shown (left panels). QPCR analysis was performed for both the first and the second round of ChIP templates (middle panel). The total mRNA expressions (right panel) of CUGBP,

TRDN, GADD and ADIPOQ were determined by QPCR and the results normalized to βactin.

All comparisons are presented as fold changes versus WT fed ad libitum (AL). *, P<0.05 compared with the corresponding WT group; #, P<0.05 compared with corresponding ad libitum

(AL) group (n=6).

Supplementary Figure 11. Experiment was based on Supplementary Figure 10 except that

ChIPPCR was performed in sequence for detecting biotinylated histone H3 in acetyl and non acetyl fractions. The first ChIP was performed using antibody recognizing acetylhistone H3

(K9). The supernatant, referred as the nonacetyl fraction, was used for ChIP using antitotal Page 55 of 205 Diabetes

histone H3 antibody. The two sets of immunoprecipitated chromatin complexes were further

analyzed with a second round of ChIP using Streptavidinconjugated agarose beads. The

products were visualized by densitometry and representative gel images are shown (left panels).

QPCR analysis results for both the first and the second round of ChIP were presented as fold

changes (right panel). *, P<0.05 compared with the corresponding WT group; #, P<0.05

compared with corresponding nonacetyl group (n=3).

Supplementary Figure 12. Experiment was based on Supplementary Figure 10 except that

ChIPPCR was performed in sequence for detecting biotinylated histone H4 in acetyl and non

acetyl fractions. The first ChIP was performed using antibody recognizing acetylhistone H4 (K5,

8, 12 and 16). The supernatant, referred as the nonacetyl fraction, was used for ChIP using anti

total histone H3 antibody. The two sets of immunoprecipitated chromatin complexes were

further analyzed with a second round of ChIP using Streptavidinconjugated agarose beads. The

products were visualized by densitometry and representative gel images are shown (left panels).

QPCR analysis results for both the first and the second round of ChIP were presented as fold

changes (right panel). *, P<0.05 compared with the corresponding WT group; #, P<0.05

compared with corresponding nonacetyl group (n=3).

Supplementary Figure 13. Epididymal adipose tissues and sera samples were collected from

WT, AdipoSIRT1 and AdipoH363Y fed ad libitum (AL) or under calorie restriction (CR), or

subjected to biotinsufficient (SU) or biotindeficient (DE) diet treatments. A, SIRT1 expression

was determined in adipose tissue lysates by Western blotting. B, Circulating adiponectin levels

were determined in sera using an inhouse ELISA.C, Circulating lipocalin2 levels were Diabetes Page 56 of 205

quantified in sera using an inhouse ELISA. *, P<0.05 compared with WT control groups; #,

P<0.05 compared with corresponding SU or AL groups (n=6).

Supplementary Figure 14. A, Expressions of ACC1 and ACC2 were evaluated in epididymal

fat of WT and AdipoH363Y (left). Immunoprecipitation was performed using antibodies against

ACC2 and the acetylated ACC2 was measured in the immunoprecipitates by Western blotting

(right). B, The presence of ACC1, ACC2, transgenic hSIRT1 (recognized by antiFlag antibody)

and total SIRT1 (detected by antibody recognizing both human and murine SIRT1) was detected by Western blotting in the mitochondrial fractions isolated from epididymal adipose tissues of

WT, AdipoSIRT1 and AdipoH363Y.

Supplementary Figure 15. HPLC was performed for in vitro evaluations of the deacetylase

activity of SIRT1. A, HPLC chromatograms of deacetyl, acetyl, biotinyl and biotinylacetyl

histone H3 peptides (500 mol/Leach). B, HPLC chromatograms of SIRT1mediated

deacetylation of acetyl and biotinylacetylhistone H3 peptides. The ratio of NAM/NAD and

deacetylH3/acetylH3 for both reactions were calculated and compared using area under the

curve values. *, P<0.05 compared with SIRT1mediated deacetylation of acetylH3 peptide

(n=3). C, HPLC chromatograms of SIRT1mediated deacetylation of acetylH3 in the presence

of 500 M biotin. Page 57 of 205 Diabetes

Supplementary Table 1. File uploaded individually

Supplementary Table 2. Sequences for primers used for ChIP-PCR and QPCR analysis.

Gene name Gene Usage Sequence Product Primer sequences

symbol range size

(bp)

CUG triplet repeat RNA Celf1 ChIP 525~ 173 Forward 5’AGAACTGATGCCACGGAGTGTCTT3’ PCR 353 binding protein (CUGBP) Reverse 5’AAGGCAGGGTTTCTCTGTGTACCT3’

QPCR 395~ 162 Forward 5’TCCTAAGGGATAGGAGCCAA3’ 556 Forward 5’TTTCACTGTCAGCAGGCTTC3’

Adiponectin Adipoq ChIP 356~ 159 Forward 5’GCTTCACATTTAGTTACAAA3’ PCR 198 (ADIPOQ) Forward 5’TAATTCAGCATGTTTCTGA3’

QPCR 94~ 200 Forward 5’ACGACACCAAAAGGGCTCAGGA3’ 293 Forward 5’CCATCACGGCCTGGTGTGCC3’

CEBPhomologous Ddit3 ChIP 640 ~ 200 Forward 5’ TTTGGGACGCATTAGAAGGCT3’ PCR 441 protein (GADD) Reverse 5’ TCCTGAACTTGTCTGCCCAC 3’

QPCR 291~ 154 Forward 5’ CCAGGAAACGAAGAGGAAGA3’ 444 Forward 5’ CCTCCTGGGCCATAGAACT3’

Triadin Trdn ChIP 643~ 215 Forward 5’ TAACAACTGCCCTCCCCTCT 3’ PCR 429 (TRDN) Forward 5’ AAAGTGCTGTCTAAGCCCCC 3’

QPCR 257~ 177 Forward 5’ GCTGAAGGAAATGCATCGACA3’ 433 Forward 5’ AGCAACAGCTGACCATGTGA3’

βactin Actb QPCR 930~1107 178 Forward 5’AGTGTGACGTTGACATCCGT 3’

Forward 5’CCACCGATCCACACAGAGTA 3’ Diabetes Page 58 of 205

Peroxisome proliferator Pparg QPCR 346544 199 Forward 5’CAGCATTTCTGCTCCACACT3’ Reverse 5’AATGGCCATGAGGGAGTTAG3’ activated receptor gamma

(PPARγ)

CCAAT/enhancer binding Cebpa QPCR 9611144 184 Forward 5’GTGGACAAGAACAGCAACGA3’ protein alpha (CEBPα) Reverse 5’GCAGCGTGTCCAGTTCAC3’ CCAAT/enhancer binding Cebpb QPCR 765921 157 Forward 5’AAGCTGAGCGACGAGTACAA3’ protein beta (CEBPβ) Reverse 5’ACAGCTGCTCCACCTTCTTC 3’ TNFα Tnf QPCR 440646 207 Forward 5' TCGTAGCAAACCACCAAGTG3' Reverse 5' AGATAGCAAATCGGCTGACG 3' EGFlike module Emr1 QPCR 2114 127 Forward 5' TTGGCCAAGATTCTCTTCCT3' containing mucinlike 2240 Reverse 5' TCACTGCCTCCACTAGCATC3' hormone receptorlike 1 (F4/80) Lipocalin2 Lcn2 QPCR 216383 168 Forward 5’CAGAAGGCAGCTTTACGATG 3’ Reverse 5’TGTGCATATTTCCCAGAGTGA 3’

PageSupplementary 59 of 205 Figure 1 Diabetes

WT Adipo-SIRT1 Adipo-H363Y WT Adipo-SIRT1 Adipo-H363Y

80 300 * 60 * * * 200 * * * *

40 (Arbitrary Unit) * * * * * * * 100 20 0 0 12 20 30 40 60 12 20 30 40 60 AUC_ITT (Arbitrary Unit)

Age (weeks) AUC_ipGTT Age (weeks) Diabetes Page 60 of 205 Supplementary Figure 2

WT Adipo-SIRT1 Adipo-H363Y WT Adipo-SIRT1 Adipo-H363Y

80 20 75 15 70 10 65 5 60 0 Percentage lean lean mass Percentage 12 20 30 40 60 fluid mass Percentage 12 20 30 40 60 Age (weeks) Age (weeks) Page 61 of 205 Diabetes Supplementary Figure 3

WT Adipo-SIRT1 Adipo-H363Y

50um

WT WT Adipo-SIRT1 Adipo-SIRT1 Adipo-H363Y Adipo-H363Y

2000 50

) 40 2

sectional 1500

m * 30 μ 1000 of adipocytes 20 cross- 500

area ( area 10 0 0 0 1000 2000 3000 dipocyte 2 Percentage Percentage

A Cross-sectional area (μm ) Diabetes Page 62 of 205 Supplementary Figure 4

A

WT Adipo-SIRT1 Adipo-H363Y

B

WT Adipo-SIRT1 Adipo-H363Y 4 3 * 2 * *

(fold change) (fold 1 * * * *

mRNA expression mRNA * 0 Page 63 of 205 Diabetes Supplementary Figure 5

A B

Adipo-SIRT1 vs WT Adipo-H363Y vs WT 1390 entities 429 entities Adipo-H363Y 100 Adipo-SIRT1 217 184 35 1038 110 WT 370

Adipo-SIRT1 vs Adipo-H363Y 1553 entities Diabetes Page 64 of 205 Supplementary Figure 6

A Up-regulated genes Down-regulated genes

Young Young Young Young Adipo-SIRT1 Adipo-H363Y Adipo-SIRT1 Adipo-H363Y vs WT vs WT vs WT 83 vs WT 17 (1269 entities) 139 138 (325 entities) (121 entities) 78 46 (104 entities)

23 12 1024 81 14 29

258 112

Young Young Adipo-SIRT1 Adipo-SIRT1 vs Adipo-H363Y vs Adipo-H363Y (1386 entities) (167 entities) B

Comparison Focal Cholester Phosphatidyl Mitochondria Inflam Phosph Cell Antioxidant Pyruvate among young adhesion ol inositol l β-oxidation matio olipase cycle and metabolis mice groups and Wnt synthesis signaling of long chain n and and mitochondri m signaling fatty acids calcium oncogen al function signalin e g Adipo-SIRT1 vs. ↓ ↑↑ ↑ ↑ ↑ WT Adipos-H363Y ↑↑ ↓ vs. WT Adipo-SIRT1 vs. ↓ ↓ ↑ ↑ ↑ Adipo-H363Y PageSupplementary 65 of 205 Figure 7 Diabetes Changed genes Un-changed gene genes Adipo-H363Y old Adipo-SIRT1 old Adipo-H363Y old Adipo-SIRT1 old vs young vs young vs young vs young (901 entities) 236 (2425 entities) (3014 entities) 381 (1490 entities) 58 26 198 1608 248 117 43 117 342 847 125 53 239 1538 321 145 96 100 498 11 401 278 252 199 WT old vs young WT old vs young (1107 entities) (2808 entities)

Comparison Extracellu Glycero Sterol FFA Inflam Phospholipas Apoptosi Antioxi Glycolysis Amino between old lar matrix l lipid lipid oxida matio e and calcium s and cell dant and acid and young and tight metabol metaboli tion n signaling cycle enzyme pyruvate metabolis mice junction ism sm metabolis m m WT ↑↑ ↓ ↑ ↓ ↑ ↑ ↓ ↑ Old vs. Young

Adipo-SIRT1 ↑ ↓ ↓ ↓ ↓ ↓ ↓ ↓ Old vs. Young

Adipo-H363Y ↑↑ ↓ ↑ ↓ ↓ ↑ Old vs. Young

WT ↓ ↓ ↓ ↓ ↓ ↓ CR vs. Young

Adipo-H363Y ↓ ↓↓ ↓ ↓ ↓ CR vs. Young Diabetes Page 66 of 205 Supplementary Figure 8

Up-regulated genes Down-regulated genes Adipo-H363Y old vs young Adipo-SIRT1 old vs young Adipo-H363Y old vs young Adipo-SIRT1 old vs young (442 entities) (732 entities) (459 entities) (1693 entities) 23 213 103 7 51 307 95 93 24 1301 249 93 36 58 17 86 67 153 36 56 64 40

199 202 128 124

WT old vs young WT old vs young (668 entities) (439 entities)

Up-regulated genes Down-regulated genes Adipo-H363Y old CR vs young Adipo-SIRT1 old vs young Adipo-H363Y old CR vs young Adipo-SIRT1 old vs young (468 entities) (732 entities) (452 entities) (1693 entities)

87 86 148 351 139 1238

180 195 53 114 32 174

534 116

WT old CR vs young WT old CR vs young (881 entities) (517 entities) Page 67 of 205 Diabetes Supplementary Figure 9

A B

Streptavidin Streptavidin

H3 H4

IP: total H3 IP: acetyl- H3 IP: total H4 IP: acetyl-H4

WT WT # Adipo-SIRT1 # Adipo-SIRT1 Adipo-H363Y Adipo-H363Y 10 # # # 10 # * 8 8 6 6 * * 4 4 * 2 2 * * 0 0

Total H3 Acetyl-H3 (fold histone change) histone (fold (fold histone change) Total H4 Acetyl-H4 Relative amount of biotinylated amount of biotinylated Relative Relative amount of biotinylated Relative Supplementary Figure 10 Diabetes Page 68 of 205 AL CR WT WT Adipo-SIRT1 Adipo-SIRT1 Adipo-H363Y Adipo-H363Y 1st 2nd CUGBP Streptavidin agarose # # nd 2.5 # 2.5 2.5 2 ChIP # # # Blank agarose 2.0 # 2.0 # 2.0 * * Acetyl-H4 1.5 * 1.5 1.5 IgG 1st ChIP 1.0 1.0 1.0 * Fold change Fold Fold change Fold 0.5 0.5 change) (fold Input 0.5

0.0 0.0 expression mRNA 0.0 CUGBP AL CR AL CR AL CR 1st 2nd # TRDN Streptavidin agarose 2.5 # 2.5 # 2.5 2nd ChIP # # Blank agarose 2.0 # 2.0 * 2.0 # * 1.5 Acetyl-H4 1.5 1.5 * st 1.0 1.0 * 1.0 IgG 1 ChIP * change old * F

Fold change Fold 0.5 0.5 (fold change) (fold 0.5 Input

0.0 0.0 expression mRNA 0.0 TRDN AL CR AL CR AL CR

1st 2nd GADD Streptavidin agarose nd 2.5 2.5 # 2.5 # 2 ChIP # Blank agarose # # # 2.0 2.0 2.0 # Acetyl-H4 1.5 * 1.5 * 1.5 * st IgG 1 ChIP 1.0 1.0 1.0 Fold change Fold Fold change Fold 0.5 0.5 change) (fold Input 0.5

0.0 0.0 expression mRNA 0.0 GADD AL CR AL CR AL CR

Streptavidin agarose 1st 2nd ADIPOQ nd 2.5 2.5 2.5 # 2 ChIP # Blank agarose 2.0 2.0 2.0 # Acetyl-H4 1.5 1.5 * 1.5 * IgG 1st ChIP 1.0 1.0 1.0 (fold change) (fold Fold change Fold

Fold change Fold 0.5 Input 0.5 0.5 0.0 0.0 expression mRNA 0.0 ADIPOQ AL CR AL CR AL CR PageSupplementary 69 of 205 Figure 11 Histone H3 Diabetes Acetyl Non-Acetyl WT Adipo-SIRT1 Adipo-H363Y 1st 2nd Streptavidin agarose 2.5 2.5 # 2nd ChIP # Blank agarose 2.0 2.0 # 1st antibody 1.5 * 1.5 * IgG 1st ChIP 1.0 1.0 *

Fold change Fold 0.5 0.5 Input change Fold 0.0 0.0 CUGBP Acetyl Non-Acetyl Acetyl Non-Acetyl

Streptavidin agarose 1st 2nd nd # 2 ChIP 2.5 2.5 # Blank agarose 2.0 2.0 # * 1st antibody 1.5 * 1.5 1st ChIP 1.0 1.0 IgG * Fold change Fold Input change Fold 0.5 0.5 0.0 0.0 TRDN Acetyl Non-Acetyl Acetyl Non-Acetyl

Streptavidin agarose 1st 2nd 2nd ChIP 2.5 2.5 # # Blank agarose 2.0 2.0 # 1st antibody 1.5 * 1.5 * st IgG 1 ChIP 1.0 * 1.0 Fold change Fold Input 0.5 change Fold 0.5 0.0 0.0 GADD Acetyl Non-Acetyl Acetyl Non-Acetyl

Streptavidin agarose 2nd 2nd ChIP 2.5 1st 2.5 Blank agarose # # 2.0 2.0 # 1st antibody 1.5 1.5 st * IgG 1 ChIP 1.0 1.0

Input change Fold Fold change Fold 0.5 0.5 ADIPOQ 0.0 0.0 Acetyl Non-Acetyl Acetyl Non-Acetyl Supplementary Figure 12 Histone H4 Diabetes Page 70 of 205 Acetyl Non-Acetyl WT Adipo-SIRT1 Adipo-H363Y 1st 2nd # Streptavidin agarose 2.5 2.5 # 2nd ChIP # Blank agarose 2.0 2.0 * 1.5 * 1.5 1st antibody 1.0 1.0 IgG 1st ChIP 0.5 0.5 Fold change Fold Input change Fold 0.0 0.0 CUGBP Acetyl Non-Acetyl Acetyl Non-Acetyl

Streptavidin agarose 1st 2nd nd 2.5 2.5 # 2 ChIP # Blank agarose 2.0 2.0 # st * 1 antibody 1.5 * 1.5 IgG 1st ChIP 1.0 * 1.0 Fold change Fold Input 0.5 change Fold 0.5 0.0 0.0 TRDN Acetyl Non-Acetyl Acetyl Non-Acetyl 1st 2nd Streptavidin agarose nd 2.5 2.5 # 2 ChIP # Blank agarose 2.0 2.0 # 1.5 * 1st antibody 1.5 * st 1.0 1.0 IgG 1 ChIP

Fold change Fold 0.5 Fold change Fold 0.5 Input 0.0 0.0 GADD Acetyl Non-Acetyl Acetyl Non-Acetyl

Streptavidin agarose 1st 2.5 2nd nd 2.5 # 2 ChIP # Blank agarose 2.0 2.0 # 1st antibody 1.5 1.5 * 1.0 1.0 IgG 1st ChIP

0.5 change Fold 0.5 Input change Fold 0.0 0.0 ADIPOQ Acetyl Non-Acetyl Acetyl Non-Acetyl Page 71 of 205 Diabetes Supplementary Figure 13 A

SIRT1

β-actin

AL CR SU DE

B

# # WT 80 80 # Adipo-SIRT1 # # Adipo-H363Y 60 60 40 40 (ug/ml) * (ug/ml) * 20 20 Serum adiponectin Serum 0 adiponectin Serum 0 AL CR SU DE

C

# # WT

2 # 250 250 Adipo-SIRT1 # # Adipo-H363Y 200 * 200 *

150 /ml) 150

ng * ( 100(ng/ml) 100 50 * 50 *

-2 lipocalin Serum *

- lipocalin Serum * * 0 0 AL CR SU DE Supplementary Figure 14 Diabetes Page 72 of 205

A

ACC1 Acetyl-ACC2 ACC2 ACC2 β-actin Immunoprecipitates Tissue lysates

B

ACC1

ACC2

Flag

SIRT1

COX IV PageSupplementary 73 of 205 Figure 15 Diabetes

mAU mAU A NAD B 2000 2000 NAM Deacetyl-H3 Deacetyl-H3 Acetyl-H3 1000 ARTKQTARKSTGGKAPRKQLC 1000

0 0 mAU Acetyl-H3 NAD mAU Biotinyl-acetyl-H3 ARTKQTARKSTGGK(Ac)APRKQLC 2000 2000

1000 1000 NAM

0 0 mAU 1.5 Acetyl-H3 Biotinyl-H3 Biotinyl-acetyl-H3 2000 ARTKQTARKSTGGKAPRK(Bio)QLC 1.0 Ratio 1000 0.5 * * 0.0 0 NAM/NAD Deacetyl-H3/Acetyl-H3 Biotinyl-acetyl-H3 mAU ARTKQTARKSTGGK(Ac)APRK(Bio)QLC mAU C 2000 2000 1000 Biotinyl-acetyl-H3 1000 0 0 0 5 10 15 20 25 0 5 10 15 20 25 Elution time (min) Elution time (min) Diabetes Page 74 of 205

Probe Set ID[Young WT](normalized)[Young Adipo-SIRT1](normalized)[Young Adipo-H363Y](normalized)[Old WT](normalized)[Old Adipo-SIRT1](normalized)[Old Adipo-H363Y](normalized)[CR Old WT](normalized)[CR Old Adipo-H363Y](normalized) 1415673_at 0.3738636 1.1063838 0.8773379 0.3740783 -0.5305812 -0.071881 -0.2324732 -0.2771357 1415776_at -0.0224028 -0.136124 0.9294057 0.049942 -0.039437 0.0279301 0.0956198 0.1632055 1415800_at 0.8438342 0.4372461 0.2946575 -0.4581823 -0.1111435 -0.3314013 -0.2309545 -0.1672761 1415810_at 0.2831758 0.734033 -0.3705759 -0.0619123 -0.238224 0.0154241 0.421147 -0.2697959 1415818_at -0.6457243 -1.210314 -0.5415875 0.9952307 0.6235521 0.7342102 0.624603 0.7280331 1415822_at 0.557224 1.3290882 0.0798254 0.0223637 -1.2207524 -0.2465996 -0.5274057 -0.671045 1415823_at 0.7155803 1.2261416 -0.1213895 0.3317277 -0.4793608 0.1158191 -0.3722846 -0.375957 1415832_at 1.0048726 0.1641312 0.0399156 -0.109882 -0.0756428 -0.0932693 -0.0473955 0.0046489 1415846_a_at0.0904752 5.046564 -1.1203111 0.2908142 -0.3379211 0.0290345 0.8915436 -3.1289024 1415847_at 0.2577384 4.78985 -0.6138934 0.6613731 0.586178 0.5646287 1.5171185 -1.7515739 1415856_at 0.361756 0.9534049 0.8035305 -0.2686739 -0.4058238 -0.4147585 -0.3109676 -0.7274935 1415857_at 0.3785911 0.9791517 0.7504299 -0.2421207 -0.3893633 -0.404265 -0.3825057 -0.8293818 1415901_at -0.059907 -0.761313 -0.3427668 0.935957 0.3869223 0.4325319 0.5463817 0.778732 1415909_at 0.1602229 -0.285396 -0.5153507 0.6517167 0.1629263 0.0565717 0.4609847 0.6909792 1415923_at -0.2959468 -0.906418 -0.5436175 0.6969485 0.2615204 0.5660483 0.6157029 0.7459237 1415924_at -0.1883408 4.9221644 -0.6055051 0.8895528 -0.1466185 0.4987043 1.592856 -2.5661871 1415932_x_at-0.808399 -0.634421 -0.5603592 0.4732757 0.2201178 0.3351418 0.3224583 0.6284409 1415936_at -0.4172804 -0.851887 -0.2220419 0.6944208 0.4352127 0.8704613 0.6182531 1.0087982 1415938_at 1.9058143 2.1291351 -0.095283 0.1119953 0.0639866 0.0098759 -0.0685947 0.0678017 1415949_at 0.1091485 0.0029798 0.3485527 -0.4962573 -0.3871252 -0.7808918 0.1621345 -0.5191002 1415950_a_at0.0695901 1.0625172 -0.0833538 0.1477504 -0.1983343 -0.2283039 0.1547047 -0.3601914 1415955_x_at-0.2617874 4.0598707 -0.5561746 0.7548616 -0.097646 0.3009777 1.152862 -2.1236093 1415958_at 0.1728251 -0.612442 -0.2412279 0.2124705 -0.0417631 0.1866219 0.5363935 0.8387969 1415959_at 0.1360204 -0.786173 -0.6111271 0.1922927 -0.1450731 0.0202864 0.4197745 0.7534113 1415969_s_at 1.486342 1.1623945 -0.0726535 0.0478086 0.0321175 -0.2302588 -0.0634965 -0.1683296 1415972_at -0.3492053 -0.742607 -0.1734512 0.5683446 0.2710783 0.5185458 0.7793226 0.5174268 1415977_at 0.3681959 0.9275855 -0.4208714 0.1256161 -0.5142123 -0.5660834 0.5350955 -0.1347364 1415993_at 0.2530705 0.6323619 0.0345022 -0.3394897 -0.4450645 -0.4778334 0.1804497 -0.066457 1416003_at 0.4295437 0.7516189 -0.191304 -0.3448041 -0.4000756 -0.7309891 1.2095904 -0.3499339 1416022_at 0.3352749 -0.757165 0.2204194 0.0060554 0.1921999 0.3401077 -0.4127483 -0.3341061 1416023_at -0.0407695 1.9329817 -0.0614767 -0.5438898 -0.0349698 0.0176343 1.1436983 -0.5605782 1416034_at 0.8641079 0.8197649 0.3913362 -0.0707135 -0.1805334 -0.514029 0.1140251 -0.4545625 1416039_x_at-1.044016 0.0787804 -0.2137866 0.4278083 0.2409582 0.430014 0.1202822 -0.2394104 1416040_at -1.0015483 -1.26001 -1.3337959 1.5247965 0.864907 1.5001137 0.0824108 0.119796 1416042_s_at0.1439502 1.4081197 0.0094035 -0.4337249 0.099908 -0.203772 0.4527288 -0.4201666 1416043_at -0.0586328 1.2282585 -0.0418377 -0.0618751 0.2762699 0.1681815 0.6073205 -0.1800068 1416049_at 0.9055105 1.8401389 0.7250009 1.5397263 -1.2971498 -1.132353 -0.595596 -1.5942501 1416076_at 0.3233733 1.3385518 -0.2410018 -0.4541071 0.2827918 0.1119815 0.8087918 -0.3459253 1416092_a_at-0.4266868 -0.523582 -0.3997691 0.5818582 0.2170298 0.4065619 0.3908787 0.2430143 1416111_at -0.4249754 -0.911627 -0.0744629 0.2525144 0.3222107 0.2690533 -0.0754035 0.2190266 1416125_at 0.0557926 0.6230872 0.1374149 0.3104997 -0.3548328 -0.1251982 -0.6989803 -0.2838484 1416129_at 0.2558045 1.1048667 0.1865935 0.2361779 -0.0101332 -0.2843908 -0.369401 -0.1298157 1416130_at -0.2022691 -0.811385 -0.2690263 0.3939366 0.5168947 0.3644871 0.004461 0.1452163 1416155_at 0.449235 0.9568117 0.1756067 -0.0193553 -0.5534376 -0.4522009 -0.1604722 -0.1521447 1416168_at -0.0449936 -0.728732 -0.1207762 0.7251897 0.3978497 0.680736 0.1412729 0.2030064 1416204_at 0.1661891 -0.793271 -0.1252788 0.4247348 0.3184809 0.6193709 0.1465488 0.8572335 1416231_at 0.1814845 -0.26983 -0.3937695 0.4050751 0.0198281 0.0953607 0.3001525 0.6305159 1416236_a_at0.8929896 1.1044875 0.4524216 -0.251245 -0.5748577 -1.2924174 -0.1222442 -0.1453864 1416239_at -0.0300711 -0.348976 -0.1835485 0.7279072 0.094416 0.8728099 -0.0152683 0.0258853 1416242_at -0.1167519 -0.867018 -0.1448524 0.3412805 0.2290489 0.2299117 0.0188766 0.0704344 1416250_at -0.2494719 1.0459642 0.4986596 -0.2452474 0.121203 0.1851687 -0.2036613 -0.4114812 1416271_at 1.1677184 1.3014596 1.8867408 -0.3385234 -0.3720709 -1.1767645 -0.1282007 -0.4980637 1416289_at 0.0908465 -0.955072 -0.2909029 0.6035709 0.1092831 0.2853375 0.1982009 0.3666344 1416299_at 0.2597644 0.8133789 -0.2709371 -0.5059271 0.1163357 0.0655535 0.2062203 -0.478878 1416311_s_at-0.6801472 1.9332936 -0.7958617 0.0877206 0.2967118 0.0970212 1.4130206 0.2389256 1416316_at 0.8420607 0.9358381 0.4060043 -0.5454354 -0.7411465 -1.206383 -0.5132907 -1.1854092 1416321_s_at-2.196209 -1.785848 -1.0521545 0.9928169 0.5180115 0.8482765 0.5872838 0.7444928 1416322_at -1.2798222 -1.320118 -0.6593462 0.9864922 0.5755698 0.901885 0.7431107 0.8913975 1416325_at -1.6452737 -1.489294 0.596607 0.5588136 -5.8114905 -7.025637 -4.0325375 -4.6635804 Page 75 of 205 Diabetes

1416332_at 0.319412 0.5238845 0.0806584 -0.6452389 -0.7193653 -0.6634508 -0.0033531 -0.2741712 1416357_a_at-0.3881657 -1.099731 -0.2498183 0.835619 0.3190792 0.2600369 0.9919961 1.1352113 1416362_a_at0.5310907 0.8064213 -0.1513429 0.0268621 -0.3887813 -0.5031421 0.1638616 -0.1867669 1416371_at 0.8961217 0.8477776 0.2067084 0.048665 -0.5557579 -0.5404962 -0.2636061 -0.0832373 1416383_a_at0.4379194 -0.623678 -0.2558475 0.1868019 0.0414688 -0.0607538 0.2137492 0.3804821 1416406_at -0.3269839 -0.569342 -0.2328069 0.8595004 0.293577 0.6163998 0.463589 0.5038624 1416407_at -0.3388538 -0.656441 -0.6082156 0.8019099 0.1321268 0.4635052 0.1595205 0.3009695 1416410_at 0.2330142 0.859288 0.1183765 0.104233 -0.3572969 -0.1706477 -0.0963957 -0.290112 1416444_at 0.0173054 2.6593418 -0.348462 0.8080895 -0.9501802 -1.336924 0.0252123 -1.5522943 1416454_s_at-0.9591315 -0.629109 -0.3600607 0.7546139 0.6205128 0.4736092 0.0866019 0.0726207 1416455_a_at-1.2005938 -1.437395 -0.7702014 1.1262875 0.7562044 1.2087009 0.7095864 0.7956826 1416490_at 1.0861832 2.5634036 0.9512925 1.8640435 -2.8628204 -2.6980083 -2.0127888 -3.2801917 1416505_at -0.280647 1.0266738 0.1828325 -0.1687298 -0.176189 -0.3040619 0.4690183 0.1063536 1416529_at -1.4911382 -0.881918 -0.6012499 0.4665999 0.1654991 0.1789986 0.349027 0.4305042 1416536_at -0.2023077 0.1667848 -0.2881187 -0.0367227 -0.0864058 0.0135565 0.815279 0.6075332 1416548_at 0.2984458 -0.231563 -0.3281291 0.5467887 -0.0777335 0.0682649 0.4234141 0.7228017 1416564_at -0.8610313 -0.609264 -0.4434561 0.6624384 0.7633351 -0.4310432 1.0887547 0.765914 1416579_a_at1.2956182 2.0131335 0.8863196 0.2670097 -2.6869788 -2.842634 -1.3765129 -2.570922 1416596_at 0.63783 1.1922008 0.3881991 0.2065134 -0.5576827 -0.5554713 -0.6856542 -0.2117229 1416612_at 0.9400854 1.1187923 0.7876267 -0.4532499 -0.0212296 -0.2404627 -0.2411194 -0.5251598 1416613_at 0.9262819 0.8540158 0.5987817 -0.1896415 0.0955993 -0.3928288 -0.3190047 -0.3846254 1416627_at 0.9079624 1.3957462 0.5601964 0.3620262 -0.4333361 -0.5435772 0.0565427 -0.1576325 1416630_at -0.4777579 -0.329277 -0.030376 0.0932298 -0.0640883 0.3056046 0.6681147 0.2191855 1416639_at -0.1745318 1.3716365 -0.1531737 -0.0663815 -0.1319659 -0.2139005 0.3391601 -0.7569841 1416640_at -0.3301231 -0.51174 -0.3718694 0.8825812 0.7312346 0.6695706 0.7294908 0.8657463 1416651_at 0.104701 0.8299844 -0.3008422 -0.0827069 -0.0540735 -0.0836209 0.5547584 -0.0540187 1416652_at -0.1757066 -0.825787 -0.1747205 0.3934245 0.3159779 0.3863972 -0.1021493 0.0313304 1416664_at 0.3580341 0.9299573 -0.1426666 -0.5530324 2.07E-04 -0.1643658 0.369223 -0.6192061 1416666_at -0.355633 -0.209934 -0.2128463 0.1544662 0.3884331 0.263847 0.7026479 0.6009636 1416692_at 0.0135175 0.9500883 -0.138812 0.0151734 0.0886716 -0.0150257 0.7244231 -0.0652967 1416694_at 0.2816238 4.6702867 -0.3449594 0.7865434 1.1939037 0.899131 1.9467486 -0.7204905 1416713_at -0.1491211 -0.639188 -0.227694 0.520649 0.391527 0.2990477 0.2097451 0.3295422 1416715_at 0.5139539 0.9053707 0.6043067 -0.0395651 -0.203668 -0.203011 -0.2500831 -0.394992 1416717_at -0.5177068 3.9455562 -1.0167656 0.5178533 0.1736292 0.3938466 1.0190095 -1.8039721 1416750_at 0.604615 -0.457201 -0.1925464 0.4257064 0.1693299 0.002422 -0.0619442 0.1047896 1416784_at -0.1281123 3.7347655 -0.7938843 0.3011942 0.2030186 0.2269642 1.0647527 -1.6255856 1416804_at -0.2360554 -0.668066 -0.1979469 0.5144017 0.3418177 0.4335762 0.3134704 0.4876089 1416805_at -0.219605 -0.250764 -0.117707 1.145225 0.5192928 1.1354578 0.408377 -0.0047296 1416818_at 0.1057568 -0.794324 -0.5144435 0.9335649 0.4233631 0.396979 0.397092 0.6239068 1416825_at -0.3092817 -0.538646 -0.1905867 1.341003 0.6021372 1.0171769 0.9890156 1.2382904 1416832_at 0.0446222 0.5233281 0.2567589 -0.0040178 -0.059487 -0.5341482 -0.3524949 -1.2154671 1416840_at 0.9934158 1.3935328 0.159297 0.5001369 -0.3245382 -0.3176451 0.0912453 -0.0823924 1416842_at 0.3078072 1.0806692 -0.0113688 -0.0587215 0.0066254 -0.1584843 0.4157594 -0.3617033 1416854_at 0.0313983 1.2909026 -0.0200295 0.4967568 -0.3115467 -0.384488 -0.1753357 -0.6648626 1416871_at -0.2926508 -0.339847 -0.2446312 0.4985645 0.7011262 1.1146083 -0.1611234 0.1196899 1416889_at 0.2299086 -0.091547 -0.0796843 0.3133042 -0.0094248 0.1670691 0.4524924 1.198522 1416893_at -0.1717422 0.9920946 -0.3329085 0.1982133 0.1339252 0.3875689 0.7167584 -0.199982 1416916_at 0.7123004 0.7240151 0.1208274 0.1996753 -0.3918949 -0.4922192 -0.353789 -0.4376489 1416926_at 0.6556065 1.1071188 0.4882541 0.0129075 0.0810158 -0.0963024 -0.8228636 -0.6741524 1416930_at -0.1478188 -0.265505 0.8990388 0.1587181 0.2148633 0.536394 0.1484968 -0.4226264 1416935_at -1.2204964 -1.062245 -0.1516811 0.6397305 0.4348852 0.0306106 0.0477613 0.3808721 1416936_at 0.0924337 -0.950527 -0.2226775 0.4399147 0.0642884 0.122682 0.1832358 0.4959833 1416939_at 0.6632783 0.0625458 0.505271 -0.4735289 -0.0472162 -0.2878712 -0.5761213 -0.3139569 1416957_at -0.5331109 -0.523083 0.2972951 0.8691852 0.4746065 0.7217656 0.2689233 -0.5090597 1416980_at -0.1512921 -0.71248 -0.6217568 0.6067798 0.2179423 0.7474896 0.5522921 0.9896026 1416992_at -0.3244332 -1.520126 -0.2123456 0.634902 0.3492491 0.2568535 0.8739297 1.2773987 1416996_at 0.524169 1.0809355 0.1595348 0.1864483 -0.4524476 -0.0230597 -0.1711326 0.2636452 1417017_at 0.2871028 1.7483938 0.4799608 0.589493 -0.869723 -0.7345746 -0.3993554 -1.1629649 1417020_at 0.0338151 4.8680816 -0.7209864 0.5402944 0.3362718 0.5164362 1.4153099 -2.1729088 1417021_a_at0.0704654 1.471099 -0.1771022 0.0096598 0.101148 0.050338 0.7525992 0.2582577 Diabetes Page 76 of 205

1417030_at -0.098707 -0.254576 -0.5920299 0.1539373 0.0727739 0.0628255 0.5377191 0.4476301 1417047_at 1.0059737 2.633419 1.3909429 1.772716 -1.3723319 -0.6235002 -1.2069174 -0.9193484 1417050_at 0.1375792 2.3613396 -0.3562183 -0.155756 -0.5068014 -0.5934441 0.6685937 -0.9335613 1417061_at 0.0742638 -0.263175 0.7638145 -0.3756905 0.1746862 0.088155 -0.072326 -0.3173447 1417065_at -0.2827888 1.2453806 0.4906969 -0.759408 0.0015169 0.1734653 0.8900414 0.2378957 1417070_at -1.463492 -1.663107 -0.6092147 0.9712429 0.6939987 0.7441303 0.3965915 0.3913826 1417071_s_at-1.3442218 -1.271753 -0.2366769 0.6340509 0.6951372 0.7766575 0.2420006 0.2233076 1417074_at 1.3023034 2.325851 1.7462597 1.7347202 -3.5242302 -2.802096 -2.1715908 -3.1530876 1417076_at 0.142254 4.4905195 -0.2769629 0.7926326 0.7008765 0.6854922 1.6686043 -1.1973852 1417090_at 0.3864374 0.7614639 0.1508918 0.2011666 -0.298667 -0.1112268 -0.0976814 -0.1425937 1417097_at -0.1000415 -1.01795 -0.4448724 0.6238003 0.3453793 0.4439016 0.3982223 0.577604 1417098_s_at-0.2914892 -1.02559 -0.5172484 0.4376307 0.2177584 0.3356371 0.2202098 0.4586338 1417101_at -0.2427096 1.3821857 -0.707231 0.0764153 0.1944377 -0.0491491 0.992116 -0.1882436 1417125_at 0.9173687 0.7676582 0.4055889 -0.0903821 -0.0251572 -0.2852152 -0.0430613 -0.0575371 1417149_at 0.2459147 0.2963612 -0.2402872 0.3815842 0.09311 0.2747751 0.2842833 0.7860873 1417151_a_at-0.1819464 3.0926962 -0.5719873 0.9273081 0.0955772 -0.0470122 -0.1838317 -0.1075467 1417155_at 0.2960101 0.9382509 -0.1068493 0.1594446 -0.1028362 -0.01883 -0.1016415 -0.1382084 1417156_at 1.0122406 0.3546917 0.3606157 -0.3093629 0.0981713 -0.510731 0.1804662 -0.6267346 1417160_s_at0.2944725 -0.032019 1.4900568 -0.0649333 0.1074863 -0.0170284 -0.1493656 -0.2562556 1417164_at -0.7866885 -0.665073 -0.4070034 0.2120791 0.3052092 0.3022923 0.3308741 0.2638534 1417168_a_at0.3002124 1.3917549 -0.1517021 0.0803077 -0.1506123 -0.25625 0.5728609 -0.1485992 1417178_at 1.0484815 0.7474108 0.2039539 -0.2448478 -0.4306835 -0.4551964 -0.2471542 -0.482303 1417220_at -0.1990154 -0.855171 -0.2658315 0.2536922 0.2156824 0.2022921 0.3618139 0.4796944 1417231_at 1.6037378 1.6456449 -0.0924262 -1.4594352 -1.1556542 -1.8987945 -0.452065 -0.5235656 1417235_at -1.2852298 -0.692136 -1.0232456 0.889473 0.4432845 1.2329617 0.3427521 0.113245 1417236_at -1.0826167 -0.441169 -0.8301684 0.7544763 0.5402346 1.2558616 0.268686 0.0739636 1417251_at -0.8952179 -0.986886 -0.2715824 0.4756293 0.2803286 0.4491047 0.4437669 0.5244907 1417262_at 1.1621212 1.7851343 2.4586883 -1.0156462 0.8612899 -0.7072901 2.0511606 -0.3242692 1417263_at 0.0383399 0.2799346 1.2885122 -0.0890068 0.6597084 -0.1868493 1.3113805 -0.0407762 1417273_at -0.2812903 -0.104682 0.0848572 0.4994073 0.3090107 0.2663837 -0.6726551 -0.4625985 1417275_at 1.3934933 2.4763823 0.568108 1.020369 -2.354094 -2.7842522 -1.3664818 -1.9055138 1417276_at 0.1619449 3.5626378 -0.211597 0.84918 0.9824104 0.7982104 1.6953726 -0.2329139 1417278_a_at-0.2302541 -0.199337 -0.4020778 0.5930862 0.1248149 0.3564546 0.6912133 0.8729027 1417288_at -0.7095764 -0.553547 -0.3015595 0.762094 0.4869993 0.972204 0.397158 0.3001541 1417289_at -0.2564707 -0.75882 -0.3919505 0.8237987 0.6610574 0.9699175 0.5110806 0.4539477 1417301_at 0.4825072 0.8603396 0.3765302 -0.6564622 -0.6719173 -0.6062657 -0.6228126 -0.7414597 1417311_at -0.1556425 -0.445777 -0.3224816 0.8846936 0.3701859 0.5396956 0.7779007 0.589475 1417314_at -0.3431809 -0.747529 0.1378822 0.4112263 0.2649574 0.4787726 -0.0298424 0.0183474 1417327_at -0.6119783 -0.952055 -0.2562549 0.0902004 0.0666721 0.1453928 0.0900434 0.2102865 1417336_a_at0.7845694 2.0409496 -0.2650104 0.2856104 -0.6481266 -0.5204387 -0.2126783 0.2814094 1417355_at -0.5911136 -0.146847 -0.2899878 0.5206189 0.1589077 -0.2269838 0.0728699 0.327603 1417358_s_at-0.3940111 -0.710534 -0.0719706 -0.0068712 0.5268321 0.4856973 -0.1670149 0.1042485 1417362_at 0.1375476 1.7311687 -0.1534964 0.3876152 -0.0054454 -0.118431 0.1744291 -0.0732408 1417373_a_at0.4125929 0.8447738 0.1290534 -0.947711 -0.5584736 -0.8639402 -0.3903612 -0.4622828 1417374_at 0.3695903 0.7286542 0.0541999 -0.6261454 -0.4774271 -0.7105405 -0.0911611 -0.25002 1417388_at 0.9502823 2.0234098 -0.1681635 0.4378877 -0.4859583 -0.5636674 -0.2258358 -0.1722023 1417389_at -1.1426635 -0.958344 -0.7996634 1.2576575 0.2223458 0.758584 0.5255143 1.1126589 1417401_at -0.1570245 1.9512746 -0.3082169 0.4888394 0.4646896 0.4464634 0.7441337 -0.3886696 1417403_at 0.4926226 0.9863012 -0.1417775 -0.1479666 -0.2991415 -0.1547423 -0.1165082 0.1363219 1417404_at 0.5752746 0.9336507 -0.0846202 0.0263541 -0.3612914 0.0078885 -0.0434049 0.4302716 1417411_at -0.2764419 -0.49932 -0.3837962 0.2536511 0.0543771 0.2294599 0.4348241 0.8245673 1417413_at 1.3648164 2.141105 1.6924951 2.315229 -3.3237717 -3.520565 -2.5766692 -2.8450277 1417430_at -0.8590033 -0.956764 -0.4415844 1.0296092 0.3432733 0.6929495 0.4396483 0.9211267 1417434_at -0.2822626 0.8808079 -0.3779564 -0.2289615 0.168673 -0.0019039 0.5234795 0.026475 1417457_at 0.201515 0.8622794 -0.2340958 -0.1630406 -0.0307773 0.0693184 0.0126686 -0.356115 1417458_s_at 0.118795 0.6777421 -0.5290884 -0.1153107 -0.1468615 -0.0160835 -0.0398698 -0.4155173 1417464_at -0.0497446 -0.242486 0.6652298 0.2749021 -0.0029557 0.0445163 1.241409 0.9767129 1417481_at 0.5956833 1.6662219 1.1257713 0.5962405 -0.7318014 -0.4907324 -0.2799115 -0.8415592 1417492_at -0.3032401 -0.601269 -0.1555457 0.5749292 0.4682003 0.7396542 0.145429 0.3136253 1417507_at 0.9317108 2.3926291 0.6626684 1.8784428 -0.9381952 -0.5128056 -0.5915413 -0.8242028 Page 77 of 205 Diabetes

1417509_at -0.053691 1.1643254 -0.3052925 -0.0669951 0.2589609 0.1270804 0.6736544 -0.20554 1417511_at 0.010565 1.3128891 -0.0383325 -0.0727944 0.17524 0.0910118 0.7709179 -0.163051 1417514_at -0.1372532 2.339131 -0.3643049 0.1838856 0.1822116 0.1706543 0.9267491 -0.6766243 1417520_at 0.5911579 1.1017846 0.4013161 -0.1358044 -0.3528579 -0.6111233 -0.3713993 -0.669885 1417526_at -0.5295155 0.2844821 -0.6832881 0.2783985 -0.1995536 -0.1653207 0.7628365 0.1580133 1417528_at 0.1586233 1.7836989 -0.1697834 -0.0966954 0.1882825 0.1292207 0.8348215 -0.4864575 1417533_a_at-0.3250842 -0.610067 -0.3007402 0.9265018 0.4778177 0.5358334 0.7291082 0.7685483 1417534_at -0.3025994 -0.595305 -0.2108548 0.9266353 0.4324135 0.5115206 0.707551 0.7582166 1417541_at 0.1166401 0.7406052 -0.3295596 -0.2911518 -0.0626494 0.0702962 0.1793792 -0.1345375 1417550_a_at0.0284147 3.2962353 -0.7652711 0.6261725 0.4158604 0.3931814 1.260857 -1.2949567 1417552_at -0.1951627 -0.779658 -0.0983098 0.46667 0.4762173 0.8784744 -0.1130276 0.2816604 1417561_at 0.6752815 0.445514 0.5266876 -0.1618757 -0.2234297 -0.0420712 -0.40802 -0.4394382 1417574_at 0.0260246 0.1031437 0.3330581 -0.8912921 -0.3492659 -0.4994686 -0.5880089 -0.7683277 1417576_a_at0.0756775 3.5500224 -0.1472978 0.5365607 0.8599516 0.7184669 1.2749516 -0.7438877 1417585_at -0.3918481 0.5997605 -0.3689053 0.89744 -0.2312619 0.0060053 -0.1930725 0.3795648 1417588_at -0.0377384 1.6196337 -0.0700284 -0.5031893 -1.4457283 -1.3535382 -0.6714652 -2.1905217 1417590_at -0.4080007 -0.519905 -0.2624521 0.6246872 0.568282 0.5260531 0.5919473 0.7461472 1417600_at 0.2793242 1.0013297 0.2601079 -0.2481842 -0.3428146 -0.2524852 -0.5393891 -0.368907 1417601_at -0.9354863 -0.106422 -0.251215 0.3845 0.5151489 0.9621075 -0.5406261 -0.3960045 1417602_at -0.819957 -0.153762 -0.2878566 0.3832657 0.3268669 0.5386027 0.588566 1.3991671 1417604_at -8.72E-04 -0.802728 -0.590982 0.5591505 0.2963367 0.2676109 0.5675576 0.6507238 1417605_s_at-0.0506072 -0.778717 -0.3584533 0.4517975 0.2520323 0.3166731 0.4393743 0.5731227 1417616_at -0.0087674 1.3040664 -0.4359707 -0.4687374 -0.5599299 -0.3849105 -0.1471971 -0.7641174 1417622_at 0.6687615 0.1690836 0.3819623 -0.4462304 -0.1294298 -0.1609493 -0.1184918 0.081529 1417626_at 0.630084 -0.013364 -0.1422983 -0.4184105 -0.1413664 -0.2980517 0.5690263 0.4387153 1417633_at -0.7783139 -1.250269 -0.6961821 1.0134735 0.5685667 0.6225311 0.4117317 0.5614834 1417634_at -0.3561072 -0.602787 -0.2070854 0.5363252 0.4932302 0.4863496 0.0658099 0.1903121 1417635_at 0.2412107 2.7073543 -0.252341 0.3479235 0.2492366 0.0551853 1.0232029 -0.6201718 1417639_at 0.3696017 -0.908332 -0.0568223 -0.0240469 0.0711512 0.307789 -0.3605706 -0.0576413 1417640_at -0.4621481 -0.705329 0.1502496 0.4674509 0.6251135 0.9796709 0.2219213 -0.2407572 1417641_at -0.1126264 3.746993 -0.2310442 0.7065127 0.7563836 0.6380981 1.5346022 -0.5670373 1417643_at 0.3295382 2.8101535 -0.1897743 -0.3382063 0.1556747 -0.2694573 0.9353951 -0.9871594 1417645_at -0.6004827 -0.741865 -0.1946534 0.6653452 0.4661573 0.6665962 0.6780217 0.7447875 1417653_at -0.0396017 -0.363956 -0.1192465 0.563694 0.1967072 0.4974254 0.2709597 0.9814938 1417667_a_at-0.2232016 -0.692701 -0.0834906 0.3373451 0.3568602 0.6498909 0.2302233 0.2601972 1417673_at -1.4863559 -0.681902 -0.1469253 0.3211618 0.4218294 0.7984436 -0.0970942 -0.5070529 1417677_at 0.4574082 -0.594746 -0.0840375 -0.2572646 0.2456606 0.2329809 0.0539703 0.4393765 1417680_at -0.196148 -0.563016 -0.112489 0.5830479 0.2788205 0.741272 -0.6464564 0.3075749 1417686_at -0.6327796 -1.468417 -0.2048895 0.1473069 0.2647284 0.1564903 0.4788729 0.7718115 1417687_at -0.3897505 -1.483524 -0.2612426 0.1709163 0.2681786 0.130217 0.2978738 0.5933774 1417688_at -0.7879515 -0.941417 -0.5199949 1.0922503 0.660414 0.7237369 1.2953266 1.8120264 1417689_a_at0.6617901 1.579823 0.1013889 0.2344751 -1.293963 -1.4984084 -0.6786838 -2.1988873 1417695_a_at-0.0224571 0.3485515 1.0909717 -0.1278873 0.0157915 0.1140554 -0.3435488 -0.7303932 1417696_at 0.0347191 0.2545607 1.0088196 0.0655451 0.0655134 0.1046575 -0.2969492 -0.5333951 1417697_at -0.2849908 0.1306722 0.7222909 0.2901533 -0.0169458 0.1024714 -0.2031015 -0.3215421 1417700_at -0.562917 -1.063565 -0.1660408 0.3465657 0.321866 0.4824545 0.2873909 0.378722 1417702_a_at-0.4877579 -0.98645 -0.2431388 0.2135449 0.3138651 0.0807438 0.3388583 0.4811646 1417715_a_at0.5725853 1.327878 0.1534188 0.7465859 -0.3885248 -0.2059294 -0.068711 -0.1729666 1417716_at 0.4622716 1.115813 0.0562202 0.5630064 -0.1996671 -0.2256463 -0.0649811 -0.08697 1417732_at 0.830699 0.059978 0.8921518 -0.053112 0.166974 -0.1098399 -0.0262748 -0.1442054 1417745_at 1.1126139 1.6132882 0.2928799 1.540379 -0.4748055 -0.4485237 -0.3714414 -0.5430496 1417787_at 0.1265672 2.6736999 -0.5680882 -0.0051131 0.2450764 -0.1704378 1.2213749 -0.7508772 1417788_at -1.4657519 -1.345331 -0.6670432 0.4938631 0.1721851 0.3399731 0.3653132 0.3919388 1417789_at -0.4390876 -0.773734 -0.3047068 0.4913797 0.5071833 0.3473473 0.2983189 0.5471363 1417795_at -0.0794674 3.5443523 0.1218807 0.6863245 0.9103321 0.6258786 1.3472162 -0.4513761 1417797_a_at1.0463239 2.046352 0.760837 0.5245786 -1.3955863 -1.628575 -0.8476849 -1.1816605 1417812_a_at-0.591866 -0.581341 -0.8717505 1.0818467 0.2138923 0.5932113 0.0461888 0.1962708 1417821_at 1.0889987 0.7790978 0.4152023 0.097328 -0.8066068 -0.4505309 -0.4678062 -0.595619 1417822_at 0.8303748 0.7355231 0.4904077 -2.64E-04 -0.8838279 -0.3434725 -0.62586 -0.7102366 1417823_at -0.1296449 -0.222799 -0.3594888 0.2342293 0.1251528 0.1652605 0.5181565 0.6758458 Diabetes Page 78 of 205

1417838_at -1.1125318 2.0197477 0.0322919 0.2039273 0.6696997 0.2836511 1.0156904 -0.8190163 1417851_at -0.3954402 -0.034667 0.592351 -0.2443833 -0.4436836 0.2634568 -0.0732765 -1.0583488 1417852_x_at0.4550082 0.6525266 0.1572344 -0.6532965 -0.7079175 -0.8561319 -0.1299238 -0.5076774 1417863_at 0.1849489 4.3156033 -0.1149829 1.1345135 0.9103349 0.8882703 1.6748677 -0.5335767 1417868_a_at-0.2459521 -0.907603 -0.3117797 0.6954231 0.2881451 0.4887795 0.4587561 0.3689 1417869_s_at-0.2969983 -0.761252 -0.2542338 0.6191435 0.3450594 0.605311 0.3237823 0.2710911 1417870_x_at-0.1909618 -0.719501 -0.286238 0.6423445 0.2923422 0.5039375 0.3882443 0.3232813 1417877_at -0.9557738 -1.197117 -0.1123366 0.4941826 0.3416596 0.6102686 0.8248529 0.9372266 1417899_at 0.0344824 1.8783695 -0.1816323 0.1034746 0.7763032 0.4050521 0.990392 -0.1217933 1417900_a_at-0.2762604 -0.859322 -0.6465337 0.5014901 0.1926943 0.6368713 0.2685413 0.619353 1417903_at 0.3928113 -0.813887 0.0687424 0.1041529 0.1693183 0.1223042 0.1095119 0.3549957 1417906_at 0.1453528 2.9019003 -0.1368536 0.1898229 0.8685579 0.4044007 1.7120056 -0.0726478 1417910_at 0.5339766 -0.040853 0.0756455 -0.2603483 -0.1012596 0.1588477 -0.6893899 -0.4455005 1417917_at 1.0518309 0.8580397 1.9385161 -0.3031824 0.4844713 -0.5807895 1.8200231 -0.1725264 1417926_at 0.742034 0.2956004 0.4459471 -0.3782246 0.0691147 -0.1818951 -0.2135595 -0.1506532 1417953_at 0.2057791 0.8884296 0.0321219 0.1115222 -0.3088675 -0.1596464 -0.2757527 -0.2605232 1417956_at -0.7561915 -1.217839 0.6262832 0.3435013 -0.1924429 0.4661699 0.8456788 1.061323 1417957_a_at0.5969266 1.3414927 -0.0846173 0.0047264 -0.0466016 -0.0437975 -0.0467288 0.0567582 1417959_at -0.9795709 -0.887396 -0.5979856 0.5353105 0.1978855 0.3578764 0.3229152 0.1856875 1417969_at 0.9152107 0.7969096 0.407341 -0.1558108 -0.1664619 -0.5953538 0.057436 0.0733862 1417989_at 0.0523113 1.5223302 -0.1658602 0.1699574 0.2243673 0.181634 0.6945767 -0.3556118 1417992_a_at1.9109466 2.4110575 -3.31E-04 -0.0601513 -0.0042054 0.0556129 -0.0240414 0.0157575 1417993_at 1.6092874 2.2951689 0.0929209 -0.0953355 -3.49E-04 0.1192616 -0.0908346 -0.0024425 1418037_at 0.8657093 2.338431 0.6297611 1.7486587 -3.9282753 -3.4010987 -2.8196843 -2.0142565 1418056_at 0.1820134 2.609715 -0.0338118 0.0774224 0.4163741 0.3248774 1.046709 -0.5124683 1418069_at 1.1728851 0.8983411 0.6084828 -0.3288536 -0.0653359 0.0150286 -0.555963 -0.4183593 1418076_at 0.9424721 1.2028064 0.4122641 0.5061853 -0.6618058 -0.5219728 -0.5058739 -0.4107566 1418091_at 0.3653574 0.7156608 0.0222272 0.1622057 -0.477143 -0.6639107 -0.1101386 -0.5474606 1418093_a_at0.4883333 1.6400807 0.816956 0.7013705 -0.5221208 -0.7044066 -0.4488902 -0.7153862 1418095_at 0.4634671 1.897256 0.9983912 -0.5976713 0.1608388 -0.474009 2.006202 -0.4154461 1418107_at 0.1264055 1.69677 -0.3317397 -0.1191688 0.1620728 -0.0526238 1.049592 -0.1106968 1418109_at 0.3386926 1.2142832 -0.0215247 0.1628966 -0.193755 -0.6213656 -0.2419235 -0.3354322 1418123_at -0.1387837 -0.636712 -0.1482155 0.5574746 0.1497574 0.4421137 0.5979602 1.037569 1418129_at -0.4371401 -0.625176 0.8389353 0.5467045 0.2973695 0.4694465 0.0402072 0.4480322 1418138_at 1.0546646 0.1186742 0.1488952 0.0124149 -0.2036337 -0.3211091 -0.0699 -0.2146943 1418153_at 0.9463668 1.020636 0.2563896 -0.1501088 -0.4030787 -0.6044313 -0.3127799 -0.5977023 1418157_at 0.931365 -0.098415 0.2378852 -0.5340962 -0.1803457 -0.4850913 0.3999211 0.1887178 1418158_at 1.3871816 1.5691664 0.972312 -0.4224639 -1.1015112 -1.0573776 -0.6133704 -0.0469538 1418172_at -0.432545 -0.623444 -0.1376665 0.4003515 0.4239388 0.4362885 0.1098763 0.3600982 1418174_at 0.1981797 -0.223896 -0.3109767 -0.2992253 -0.3868493 -0.103084 1.7688833 1.6639026 1418186_at -0.3432913 -0.37517 -0.1249239 0.0440173 0.1797466 0.1008495 0.8130124 0.6698316 1418188_a_at-1.0523338 0.3093216 0.3322444 0.1328149 -0.0049669 0.0232285 -0.3636678 -0.0487967 1418189_s_at-1.1812403 0.1262932 0.1027193 0.2205811 -0.0310677 0.0157463 -0.3241765 -0.0589403 1418190_at 0.9979448 0.4921424 1.5568147 -1.0384312 -0.3324444 -1.1521523 -0.6752157 -0.4211615 1418191_at 0.6228942 0.1186286 0.3972768 -0.3951607 -0.0980504 -0.0264736 -0.0383007 0.1627539 1418204_s_at-0.2665308 0.5580983 -0.0632833 -0.2640638 -0.4588352 0.0227525 0.5398674 -0.1619589 1418206_at 0.1445594 0.5945327 -0.4202919 0.3438025 0.0363513 0.0672482 -0.2282028 -0.2642644 1418207_at 1.4031519 1.0065318 1.449051 -0.1322303 0.3158777 -0.346202 1.153666 -0.3970119 1418208_at 1.0487148 1.4416233 0.3511618 0.8558915 -0.595713 -0.7631232 0.134274 -0.3522296 1418209_a_at0.3813136 1.1316302 0.0741117 -0.1482124 -0.4229685 -0.3973118 0.0698465 -0.3739084 1418210_at 0.2728734 1.0303073 0.0448916 -0.1089282 -0.4551363 -0.3833853 0.0740226 -0.2749418 1418253_a_at-0.5103234 2.2349238 -0.6441908 0.4239302 0.5979655 0.4812952 1.0849043 -0.5153087 1418263_at 0.0521348 2.4098651 -0.3361553 0.3251436 0.4969339 0.203081 1.4289055 -0.4805416 1418272_at 0.1317792 2.4992595 -0.1611024 0.3473268 0.4703696 0.3868337 1.209838 -0.3528017 1418278_at 3.3261895 2.4218092 1.6234273 -0.3601146 -0.1344722 -1.2587892 -0.4730225 -0.3741873 1418279_a_at0.1118423 1.0979437 -0.3760263 0.0039949 0.0340531 -0.1699379 0.705129 5.67E-05 1418283_at 1.2496177 0.7840102 0.5765382 -2.38E-07 -0.2200215 -0.439581 0.0962243 0.4247422 1418294_at 0.8992736 1.0587173 0.2334187 0.2468095 -0.289972 -0.5555661 -0.0583968 -0.1507559 1418295_s_at0.9341018 0.1036763 0.3566668 -0.4672437 -0.2595245 -0.2570503 -0.2783073 0.1836999 1418301_at 1.4298147 1.9353404 1.0498508 0.4606371 -0.8658239 -1.3002497 -0.0825926 -1.1205541 Page 79 of 205 Diabetes

1418303_at -0.0415471 3.1605806 -0.1955098 0.8198912 0.5018323 0.7253344 1.4640459 -0.2913951 1418307_a_at-0.0448514 -0.075367 0.0137184 1.4419367 0.0573116 0.0128574 -0.0082829 0.0494281 1418318_at 0.9359316 1.5752729 0.4721916 -0.1073303 -1.5999094 -1.2529395 -1.4328748 -1.4100515 1418320_at 1.0272985 1.486221 0.6180314 0.4127061 -0.7442471 -0.9928684 -0.3035286 -0.6008155 1418323_at -0.2023215 0.9235522 -0.2716941 -0.1164405 0.2164559 0.0241015 0.7924819 -0.2231935 1418325_at 0.6336765 -0.017084 0.1305366 -0.2895489 -0.0469116 -0.9597198 0.1747122 0.0800947 1418326_at 0.8950512 1.5397108 0.2052388 -0.1168788 -0.2858642 -0.2036439 0.5146235 0.6580262 1418346_at -0.3108221 0.8740921 -0.6222409 0.0765576 -0.0545375 -0.0095987 0.5330709 -0.2147082 1418355_at 0.3533955 1.3846004 0.3045032 0.2083802 -0.3222734 -0.2269693 -0.2649422 -0.4490643 1418358_at -0.8861499 2.4896395 -1.1341997 -0.00424 -1.0978609 -0.5603226 0.0130682 -2.44407 1418367_x_at-0.7011881 -0.375729 -0.5830784 0.3587894 0.2778198 0.3572682 0.0745637 0.096439 1418373_at 0.2061254 3.2455008 -0.4256858 0.6347816 0.4642023 0.4695594 1.2918544 -0.3624787 1418382_at -0.1621504 -1.030546 -0.2774899 0.2332134 0.1092617 0.0495432 0.6865622 0.6357473 1418383_at 0.0198863 -1.105851 -0.4077785 0.602983 0.2796644 0.2316664 1.0597883 1.1394027 1418393_a_at-0.1163701 -1.013484 -0.2669712 0.6920667 0.1878346 0.4628712 0.5937631 0.8926725 1418407_at -0.7967351 0.1785164 -0.5324721 0.2491643 0.0167773 0.3048169 0.0441068 -0.010949 1418412_at 0.469329 1.5246916 0.1704502 -0.6646597 -0.798228 -1.2810504 -0.2187611 -0.4265075 1418426_at 0.1036923 3.4970834 -0.2226682 0.2647408 0.767446 0.5032097 1.482037 -0.3293859 1418444_a_at1.0963569 0.871464 0.6417 -0.5810556 -0.1237589 -0.6190882 -0.2959789 -0.3380276 1418445_at 0.7445977 1.118841 0.4372851 0.0743268 -0.3960965 -0.4041519 -0.2864924 -0.3094519 1418446_at 0.3581188 0.8439497 0.2965181 0.1198335 -0.3694159 -0.2960205 -0.0629115 -0.1726228 1418449_at 1.0693688 1.0586152 0.5562939 0.1353111 -0.1074158 -0.2041411 -0.2402298 -0.0036421 1418450_at 0.2779431 -0.829794 -0.3577623 0.8290358 0.1645037 0.4308363 0.6506112 0.6745669 1418451_at -0.1530645 -0.539193 -0.1240066 0.4368289 0.4868196 0.6097401 0.0755391 0.347268 1418453_a_at0.6573954 0.7733824 0.2154353 0.0924916 -0.2817268 -0.707291 -0.062576 -0.5929289 1418455_at -0.2039135 -0.707912 -0.3609203 0.523993 0.296159 0.2743879 0.3946819 0.5472177 1418457_at 0.6671368 1.1496501 0.8421391 0.0794768 -0.1853796 -0.319953 -0.2719909 -0.17591 1418459_at -0.113945 1.713727 -0.3278624 0.048255 0.5198469 0.3804473 0.7350235 -0.487278 1418467_at 0.4984962 1.5948167 0.4259363 1.0944142 -0.640408 -0.2331042 -0.1930766 -0.2095327 1418480_at -0.7086483 -0.620967 -0.7430542 0.418308 0.2836706 0.0977884 0.0052311 -0.0464385 1418484_at -0.057102 1.6453643 -0.3752766 0.030581 0.4143849 0.1133892 1.0216101 -0.2955279 1418488_s_at-0.9000828 0.39621 -0.9513179 0.2427716 0.1598037 -0.3707361 -0.3414874 0.2867112 1418490_at -0.7489473 -0.808891 -0.4432871 0.8135362 0.4766942 0.7236654 0.455053 0.6267279 1418492_at -0.5083813 0.5579979 0.0442594 -1.0119305 0.8060652 -1.5248464 0.0029774 -1.0680748 1418493_a_at-0.2431873 -0.921098 0.167891 -0.2559514 0.1416485 -0.1490269 0.2384027 -0.349027 1418497_at -2.899151 -3.276181 -2.2298384 1.5634813 1.1172295 2.0762315 0.8579801 1.2882303 1418498_at -0.2692706 -0.324456 -0.0421567 0.7559607 0.3511069 0.9615642 0.04434 0.3360523 1418499_a_at0.1032477 1.5453329 -0.2268595 0.1064129 0.2226643 0.2832433 0.6326879 -0.4704109 1418500_at -0.7255461 -0.66492 -0.7579536 0.1840804 0.2361294 0.2275816 0.3883017 0.4389706 1418507_s_at0.7306321 -0.055382 0.3878597 -0.4010122 -0.2186815 -0.3674811 -0.544322 -0.2898699 1418547_at -0.1501468 -0.764376 -0.3290339 1.5285964 0.9055368 1.458466 0.1995252 0.4109554 1418548_at 2.1911006 2.9552808 -0.0473213 -0.209264 -0.1419399 -0.0743124 0.0954409 -0.0111494 1418556_at 0.2997783 4.5616827 -0.0126979 1.2954706 1.2773699 1.2736794 1.9872185 -0.13954 1418557_s_at 0.00262 3.2687893 -0.3143048 0.7551618 0.844195 0.7162376 1.6458282 -0.4545532 1418559_at 0.1183523 2.0305624 -0.3632549 0.3598006 0.4069595 0.2800655 1.3126717 -0.5129201 1418580_at 0.5258279 0.0738721 0.4711676 -0.7283707 -0.2631338 0.0142839 -0.2841657 -0.0248801 1418589_a_at0.7357225 3.6660562 -0.2873569 0.3534195 0.5255535 0.3984009 1.1686956 -0.8875046 1418592_at 0.1676887 1.7308424 -0.3470171 0.0604138 0.2750392 0.1088024 0.5479567 -0.5692487 1418596_at 0.7308571 -0.116572 0.1009473 -0.3047516 0.0779361 -0.2679823 -0.0473172 -0.2305559 1418601_at -1.0487819 -0.833984 -0.629962 0.0402594 0.2261442 0.2482603 -0.0859989 0.1543554 1418606_at 0.1810731 -0.077941 0.7583162 -0.1455941 -0.0143268 -0.2530058 0.2177615 0.0422382 1418608_at 1.1868604 1.7183356 0.8500027 -0.5618756 -1.7021434 -2.0897071 -1.5245036 -2.0283198 1418616_at -0.5899247 -0.291671 -0.107965 0.7856422 0.4336807 0.3187788 0.3529027 0.0262286 1418617_x_at0.1329405 3.1130755 -0.0755712 0.1256492 0.7482596 0.2844478 1.4367723 -0.3047205 1418626_a_at0.3921402 1.7800508 -0.0520825 0.179039 -0.3639446 -0.4415548 0.029782 -0.8177627 1418645_at -0.2601951 0.5834969 0.8822595 0.2036727 0.9348013 0.6279726 -0.3026217 -0.4411899 1418649_at 0.7012776 0.0874324 0.3571314 -0.4716816 -0.3468389 -0.8897438 0.1325816 0.3707976 1418650_at -0.4397833 1.4866462 -0.4785359 0.2504993 0.2811932 0.4073752 0.9266612 -0.227317 1418652_at -0.8456407 -0.912143 0.1878681 -0.1336107 0.2695417 0.2428686 0.3839423 0.5284087 1418663_at -0.3068587 -0.635524 -0.2002742 0.4964893 0.4485512 0.6979815 0.0544318 0.2584424 Diabetes Page 80 of 205

1418664_at -0.7927334 -0.735319 -0.2953405 0.3952513 0.2906633 0.7375927 0.1910458 0.3010492 1418682_at 0.2467371 4.285231 -0.2856251 0.5944843 1.1041613 0.6479136 1.7149181 -0.7578025 1418701_at -1.1935668 -0.512773 -0.312645 0.3816347 0.2713026 0.4002516 0.0749083 -0.0752389 1418708_at 0.9894918 0.0471107 0.1201819 -0.1296628 -0.0401241 0.0463592 -0.4133474 -0.4246807 1418709_at -0.6524208 -1.369373 -0.9247533 0.4858046 0.3836627 0.6829222 0.0802897 0.4728578 1418710_at -0.9120874 -0.763855 -0.4265719 0.5305982 0.4383265 0.6142696 0.2755524 0.302837 1418713_at -0.8690221 -0.585625 -1.1163337 0.5389338 0.0230598 0.4079929 -0.0669181 0.0443077 1418715_at 1.0010359 1.717515 0.9150598 0.3550913 -0.9041845 -0.9266442 -0.2967847 -0.5506422 1418716_at -0.4119749 -0.662058 -0.4465656 0.3995824 0.447384 0.5250766 0.1497738 0.2521189 1418723_at -0.5861326 0.0306177 -0.6028949 0.6193354 0.1112569 0.4796031 0.8080247 0.6136839 1418724_at 0.9057039 0.6449161 0.2256174 -0.4019539 -0.3924613 0.2998727 -0.4294718 -0.5487573 1418725_at 0.1751858 2.8475099 -0.112303 0.4680553 0.7282443 0.7449466 1.2223458 -0.4487 1418726_a_at0.8797783 0.5796943 -0.2355716 0.1804512 -0.4559403 -0.64176 0.0795221 -0.1585906 1418734_at 0.717223 1.0062773 0.2332253 0.0964967 -0.3190135 -0.392049 -0.1873409 -0.3812619 1418740_at 0.1012992 2.364945 -0.1805394 0.5109177 0.5323094 0.6296399 1.081461 -0.1084393 1418746_at 0.3825632 0.9327431 0.180485 0.164083 -0.6483645 -0.2758951 0.2119843 -0.1675466 1418754_at 1.1544452 1.4868056 0.0968982 0.1857691 -0.1899195 -0.4280986 -0.4453878 -0.2089613 1418757_at -0.0903055 1.6929342 -0.1498613 -0.0270531 0.3893767 0.2231315 0.9959214 -0.0537031 1418759_at 0.1500844 2.6983457 -0.1461883 -0.1405958 0.4359203 0.288139 1.4151214 -0.2808982 1418762_at -0.2123294 -0.697373 -0.1238797 0.3656855 0.3353222 0.2591799 0.0105941 0.1809902 1418770_at -0.4662112 -0.738353 -0.2869293 0.3968597 0.4957847 0.4302161 0.1371096 0.4148353 1418773_at -1.6891358 -1.465076 -0.5046909 0.3468232 0.2882843 0.5374624 0.1363948 0.3063933 1418780_at 0.566066 0.5500612 0.0071883 0.3245213 -0.4574102 -0.3426875 0.3544642 -0.0372725 1418791_at 0.6141459 1.4547243 -0.0357989 -0.1646981 -0.9282556 -1.1050285 -0.3743291 -0.7856083 1418792_at 0.665782 1.023532 -0.1483456 0.1401033 -0.3371068 -0.4458551 -0.0438248 -0.0348169 1418807_at -0.2266469 1.1158521 -0.5692313 0.0117741 0.0723051 -0.0041733 0.9062745 -0.0749984 1418813_at -0.1158315 1.3591596 0.0263928 -0.0184691 0.2946543 -0.0369274 1.0124655 -0.1430925 1418815_at -0.2180792 0.3847386 -0.0232475 -0.3245363 -0.352291 -0.0350746 0.996556 -0.0078011 1418847_at 1.4617631 1.8154719 0.7762957 0.0836916 -1.5064087 -2.1278214 -0.6672737 -1.5731664 1418849_x_at0.0762453 -1.279961 -0.4326811 1.0212474 0.326424 0.4309845 0.8231958 1.0005617 1418856_a_at0.4703852 0.7610928 0.2206256 0.1912715 -0.3929648 -0.3202367 -0.0588444 -0.3677837 1418860_a_at0.5210148 -0.479389 -0.157037 0.4609785 0.2273724 -0.0140885 0.8247495 1.0564836 1418878_at 0.0162303 2.8581533 -0.3268752 0.753973 0.8529209 0.7110403 1.0545152 -0.4071941 1418884_x_at-1.038562 -0.56703 -0.3461909 0.0917864 0.0654533 0.2466888 0.2176819 0.1841348 1418890_a_at-0.0744205 -0.628366 -0.3092766 0.5946536 0.183399 0.4240111 0.6144133 0.7002948 1418908_at -0.3321414 -0.64965 -0.2713108 1.2078247 0.6282238 0.9981333 0.5896619 0.5845782 1418918_at 1.1934854 0.312249 0.6481295 -0.111985 0.2806042 -0.0783074 -0.1979327 -0.0755524 1418925_at 0.8879811 0.190216 0.3682307 -0.3796051 -0.3533135 -0.3051346 -0.1255293 -0.3687679 1418930_at 0.9464967 -0.441151 0.1627098 -0.7266359 0.0286176 -0.0659827 0.5811191 0.2706927 1418932_at 0.2565949 0.2811784 0.3385248 0.0839045 0.0091763 -0.2375828 -0.7801051 -0.7832699 1418936_at -0.7216449 -0.012225 -0.0055864 0.457871 0.1962921 -0.1338858 0.2828144 -0.0298599 1418948_at 0.0576609 2.1333036 -0.086828 0.3374579 0.1871431 0.3487601 0.8674877 -0.2536643 1418956_at -0.1272605 2.4707854 -0.426975 0.4310641 0.240763 0.2872408 0.9689671 -0.9169443 1418979_at -0.1425898 -0.677783 -0.0223731 0.6289902 0.4118967 0.4558777 0.019045 -0.090134 1418980_a_at0.2465024 -0.390813 -0.3283675 0.747386 0.1684711 0.2882789 0.8413575 0.7036427 1418983_at 0.5412351 0.9587779 0.2742902 -0.0310452 -0.2830065 -0.5904187 -0.0696638 0.0067781 1418984_at 0.3766315 0.7370536 -0.0563706 -0.2171037 -0.3557309 -0.5488966 -0.0619942 -0.2615918 1418994_at 0.1723005 3.5713503 -0.2267463 0.5489299 0.9366869 0.6872534 1.1942903 -0.6519979 1419009_at -0.0492035 1.620943 -0.1307021 0.0948827 0.1850522 0.257199 0.7011802 -0.3289121 1419010_x_at0.8918515 1.6963747 0.2630401 0.8451875 -0.1020243 -0.142247 0.1518487 -0.2292342 1419015_at -1.2005467 -0.943129 -0.581225 2.778174 1.2674437 2.2546601 0.9809215 0.4585403 1419016_at 0.1860782 3.269379 -0.2553846 0.6630809 0.578108 0.466165 1.2443091 -0.769991 1419019_a_at0.1939628 3.158464 -0.3704507 0.6758514 0.2532687 0.6677844 1.3817172 -0.6680986 1419021_at 0.4250994 1.2617973 0.0720079 0.0187055 -0.1142738 -0.2563067 0.1585682 -0.0914847 1419022_a_at0.0509508 -0.60428 -0.5633278 0.8432827 0.2951723 0.3932497 0.7009831 0.7291148 1419023_x_at0.0734603 -0.622125 -0.4614489 0.7318554 0.3045883 0.4269539 0.5934827 0.6479638 1419031_at 0.6561842 1.0363486 0.6911335 0.2105699 -0.8206304 -0.9420852 0.2320566 -0.5308304 1419042_at 0.5290422 -0.25814 0.5326273 -0.7862577 -0.2635846 0.3970517 0.0398703 0.261037 1419043_a_at0.4622994 -0.175675 0.5814858 -0.7399187 -0.2483767 0.4431049 0.0501836 0.3769156 1419056_at -0.6141447 -1.285736 -0.437188 0.8264298 0.5611866 0.7899277 0.7005447 0.8499584 Page 81 of 205 Diabetes

1419072_at 1.5825033 2.2533722 0.5036842 1.718163 -1.4067171 -1.3125613 -0.8677117 -1.1156436 1419075_s_at1.0232787 2.0874517 0.4155256 -0.1100369 -0.0122824 -0.0307559 -0.1021103 -0.2387029 1419082_at -0.2564389 -0.128862 1.1748698 0.0101566 0.0949355 0.0514627 0.1373038 -0.6253592 1419091_a_at-0.7237217 -0.629507 -0.4687762 0.3678255 0.3096701 0.4405813 0.0816031 0.1376963 1419093_at 0.6182849 0.4155414 0.0895827 -0.2770443 -0.1603755 -0.9477884 0.6021593 -0.7099909 1419117_at -0.5992564 -0.786516 -0.3857491 0.9918804 0.60365 0.8773813 0.281086 0.3085574 1419126_at 0.7354509 0.7406791 0.1234078 0.1592417 -0.308757 -0.2965093 0.3186539 0.2023954 1419127_at 2.1628356 3.3294463 2.3191032 2.6539714 -0.3318484 0.1310892 -0.613044 -0.5389404 1419128_at -0.9842535 -0.829055 -0.471122 0.9645252 0.6102201 0.921535 0.1524304 0.644413 1419143_at 0.0594467 3.7326999 -0.1557722 0.7976093 0.8870753 0.965619 1.536018 -0.3209932 1419147_at 0.3626846 0.9693407 -0.0660267 -0.1530976 -0.192962 -0.2064336 0.1913659 -0.5187913 1419149_at -2.5699613 -1.589553 -1.1800709 1.0516753 0.4287601 0.3635645 0.3864797 0.3265963 1419154_at 0.7842875 0.8239424 0.7642831 -0.0576775 -0.5386048 -0.6024851 0.0189125 -0.3349331 1419156_at 0.7462103 0.8300209 0.0774041 -0.448652 -0.2860242 -0.2666836 -0.2173433 -0.6083714 1419187_at -0.1366851 1.9504584 -0.1074207 0.2045 0.3716868 0.1909848 0.9352616 -0.5216567 1419191_at -0.3806274 -0.214798 -0.3303741 0.4948425 0.5362436 0.2813433 0.6483078 0.1810654 1419195_at 1.0495627 1.9445864 1.8838677 1.6494431 -3.1147807 -2.6994991 -2.4500554 -2.4167593 1419209_at -0.4269792 0.6051956 0.2624667 -0.4222717 0.1540521 0.3753498 0.5894942 0.2058005 1419227_at -0.0110331 2.6687107 -0.3164405 0.2914903 0.7670636 0.4955917 1.3848122 -0.2278709 1419232_a_at0.8061761 0.3855809 0.3944032 -0.1778464 -0.1323868 -0.3457137 -0.4160194 -0.1220606 1419247_at 1.9029846 1.2373824 0.984452 -0.1724067 0.3727293 -0.4213768 -0.3615345 -0.139068 1419248_at 1.8375223 1.2873042 0.9651866 -0.2279768 0.36059 -0.4790222 -0.4234003 -0.1981916 1419249_at -0.3755981 -0.725726 -0.2819331 0.4260297 0.2756004 0.4560801 0.3073553 0.4058816 1419253_at 0.3526425 1.2711198 0.2623911 0.4627895 -0.2532763 -0.1410905 -0.3500954 -0.4602784 1419254_at 0.4550482 1.5673403 0.2180553 0.5801482 -0.4866543 -0.3561029 -0.6228964 -0.701566 1419256_at -0.9587038 -0.559091 -0.2860532 0.7119598 0.5887211 0.5723587 0.2101097 0.1682145 1419268_at 0.4152196 3.0571048 0.1408207 0.3600161 -0.0584838 -0.174143 0.137888 0.0820409 1419276_at 1.063093 3.456551 0.6722133 1.9787002 -0.3814527 -0.1992292 -0.4791657 -0.6428321 1419282_at 0.338599 -0.103268 0.7795309 -0.8402829 -1.017815 -0.2645147 -0.0677851 -0.6689466 1419283_s_at-0.7302508 -0.658207 -0.2154498 0.4968314 0.3720387 0.3834671 0.3745073 0.2904329 1419288_at -0.7713274 -0.357957 -0.2975704 0.2720575 0.2625784 0.2220341 0.0566487 0.0195866 1419292_at -0.4316399 -0.624617 -0.1493745 0.536427 0.375557 0.4899195 0.1908538 0.5485497 1419294_at 0.7399023 1.8210423 0.5913351 -0.0246797 -2.4286823 -2.621074 -1.7811912 -3.3020694 1419301_at -1.7128242 -1.268118 -0.4380994 0.1206608 0.2608078 0.5742449 0.2554442 0.2851699 1419306_at 0.2147098 2.4364998 -0.3554199 0.0133979 0.4164718 0.0586441 1.1218709 -0.5472302 1419314_at 1.0848835 0.0130315 0.2376584 -0.2370327 0.1698825 0.2086474 -0.183394 -0.2012366 1419321_at -0.2360542 -0.194451 -0.2300383 0.7329657 0.4971536 0.7907065 -0.0459874 -0.0664454 1419326_at 0.3402399 1.8575451 -0.0957792 -0.1706679 0.6068071 0.1964865 0.8727226 -0.2969691 1419332_at 2.141287 1.7655342 0.6473188 -0.6363356 -0.9279988 -0.9991045 -0.3367742 -0.5461972 1419336_at 4.4042535 7.0494337 0.446119 4.2736454 -0.3605494 -0.7530679 1.4444045 0.2518382 1419337_at 0.0401649 1.8552264 -0.2561224 0.3653996 0.2594503 0.2576663 1.034061 -0.1613687 1419346_a_at2.3401175 3.6827712 4.24E-05 -0.1044861 -0.0036007 -0.1306913 0.6119494 -0.1012583 1419347_x_at 2.775406 4.0191555 0.1658551 -0.3280392 -0.1065172 -0.2378278 0.5291801 -0.3365115 1419350_at 0.194368 0.8381344 -0.0260154 -0.3397567 -0.4075162 -0.3839877 0.3250092 -0.3499095 1419358_at 0.734738 0.1312689 -0.0592824 -0.2717962 -0.0600299 -0.2128568 -0.3076139 -0.326588 1419368_a_at0.1758736 1.7611368 0.0089749 0.2362576 0.3563877 0.2574412 0.9142847 -0.197539 1419378_a_at-0.0602444 -0.879675 -0.7342806 0.4881444 0.1774881 0.3390316 0.3413579 0.2863067 1419394_s_at0.0762491 -0.72591 -0.070272 1.0871754 0.5834034 1.2869059 -0.0189069 0.0850105 1419398_a_at -5.63E-05 -0.963933 -0.4650269 0.2191076 0.0404491 0.1588715 0.255345 0.3065608 1419402_at 0.2552605 2.1356406 -0.2466787 -0.0961371 0.3892918 0.2317846 1.0957867 -0.2749434 1419419_at -0.0189177 1.0219029 -0.1229192 -0.0406573 0.0267213 0.0822195 0.6286189 -0.1072876 1419423_at -0.419692 -0.700618 -0.2307665 0.5863781 0.5640332 0.3451096 0.3870265 0.2614195 1419426_s_at-0.1108878 -0.506215 -0.2550144 0.2594466 0.1653786 -0.0972439 1.0901159 0.5774136 1419428_a_at0.0150335 -0.376513 -0.4376285 0.8698602 0.1551771 0.326539 0.5684655 0.7014065 1419432_at 0.0258412 0.8367658 -0.148082 -0.1618006 0.4538307 0.0557397 0.9069827 0.0857924 1419434_at 0.1277539 0.504732 -0.5769383 0.9871872 -0.3816919 0.0280195 0.1921924 0.10373 1419463_at 2.142817 1.9240774 1.3604567 0.3955097 -0.7767568 -0.6825402 -0.4414834 -0.4310525 1419473_a_at0.1112368 0.0128138 0.2377584 0.5221486 -0.0449326 1.4321712 -0.1173507 -0.1903498 1419474_a_at 1.000496 2.17989 1.072396 0.8500462 -0.6342626 -0.5913114 -0.2443922 -0.6091911 1419475_a_at 1.052591 1.651087 0.8972557 0.6718195 -0.4238945 -0.4352958 -0.2208473 -0.4399169 Diabetes Page 82 of 205

1419476_at 1.1157897 0.9054235 0.5137904 -0.0535922 0.0614042 -0.0720776 0.0144951 0.7431781 1419478_at 1.1639776 0.1840063 0.3562585 -0.0753453 0.1583302 -0.1414862 -0.0875471 -0.2413565 1419483_at -0.2233205 -0.721975 -0.0150028 0.2418943 0.3492056 0.5839946 -0.0033045 0.0184102 1419491_at 2.055831 2.64545 2.0439844 1.7115266 -1.9689255 -1.5085226 -1.7185473 -1.1377769 1419492_s_at 1.569197 1.8179076 1.5086623 0.7960174 -0.7324098 -0.8032273 -0.7495949 -0.4988341 1419493_a_at0.3238096 0.9378114 0.1793618 0.1772499 -0.2354458 0.0598274 -0.4284595 -0.4637833 1419494_a_at0.2361436 0.72785 0.036046 0.2062383 -0.2973761 0.0397154 -0.4297524 -0.3701645 1419499_at 0.9711762 0.5837784 0.4605069 -0.5568461 -0.0982208 -0.4495832 -0.1036148 -0.0468499 1419500_at 0.1195049 3.7184258 -0.2553166 0.4684877 0.7831515 0.42579 1.5530926 -0.5333503 1419510_at 0.2769615 1.0672424 0.6295013 0.4624648 -0.2206522 -0.2307799 0.1545952 -0.2490854 1419518_at 0.2290483 1.2902919 -0.0018198 -0.1855094 -0.1403976 -0.2112349 0.5438681 -0.4207946 1419527_at -0.2162426 1.9487997 -0.1935258 0.1437304 0.1168859 0.2539418 0.7970138 -0.5073957 1419531_at -0.0358986 1.7372509 -0.1151406 0.0826688 0.4544769 0.0973409 0.9490797 -0.1881178 1419535_at 0.0059866 1.4148004 -0.2656877 -0.1320062 0.3599647 -0.0087418 0.9933507 -0.2261597 1419537_at 0.1148818 -0.55405 0.4646723 -0.3187547 0.1168774 0.2846578 -0.1202437 0.0809225 1419542_at -0.1602975 2.4078026 -0.1368866 0.0594642 0.7621769 0.0246496 1.6641827 -0.1475096 1419549_at -0.3025448 -0.368702 0.7882839 0.1926684 0.2707709 0.3981631 -0.3277771 0.4917874 1419552_at 0.5453117 -0.474563 0.434226 -0.0650377 0.1703676 0.1037731 -0.2028554 0.0882842 1419555_at 0.8557332 0.9245684 0.9663343 -0.1751053 0.1960199 -0.1494774 0.8890379 -0.12485 1419567_at 0.2812175 2.269753 -0.3979731 0.1909397 0.3205628 0.2411261 0.7943945 -0.6441147 1419569_a_at0.3562188 1.2058272 0.3678834 0.4963474 -0.1493073 -0.2683926 -0.1500778 -0.4565862 1419586_at -0.0889936 -0.805026 -0.2349439 0.636905 0.5066932 0.617877 0.3611725 0.5441976 1419593_at 0.4590124 1.1352392 0.1101006 -0.1438341 -0.475901 -0.6489886 -0.3821333 -0.2262945 1419608_a_at0.9801267 1.3146524 0.5577412 -0.6373265 -0.9710946 -1.3703487 -0.6829168 -1.2882743 1419615_at 0.9517719 1.8079163 0.4953854 0.8980086 -0.3171414 -0.2378677 -0.1879465 -0.3850382 1419618_at 0.9984745 0.2039021 0.7067198 -0.7101004 -0.0402995 -0.4111592 -0.1333596 -0.6117304 1419623_at -0.0260121 1.3046144 -0.2002087 -0.0222604 0.2207131 0.0679158 1.0831546 -0.2004644 1419624_a_at-0.0744607 3.0143652 -0.3566246 0.3002038 0.5107344 0.2998149 1.3973188 -0.3425551 1419625_at 0.2555972 3.5910907 -0.1865684 1.1997013 0.8059437 0.8258379 1.9539466 -0.2705964 1419627_s_at0.2179117 -0.099807 1.0265377 -0.7665129 -0.5938188 -0.6496065 -0.577769 -0.9096982 1419632_at 0.4600477 0.521818 0.0368323 0.0352659 0.0818409 0.0085796 0.1421882 1.0988994 1419648_at -0.2407942 -0.752468 -0.2973075 0.8515668 0.3947109 0.6041222 0.8237025 0.8891093 1419655_at -0.58583 -0.191196 -0.0677273 0.5296307 0.2768612 0.1803555 0.0671139 0.1648801 1419666_x_at-0.1157844 -0.486809 0.5475223 0.2912226 0.1516647 0.1435051 0.0195141 0.1075462 1419684_at 0.0020413 -0.327402 0.9945481 0.2270436 -0.2169931 0.7482882 -0.4407377 -0.4623829 1419700_a_at0.7672126 2.0826457 0.6597502 0.6211948 -2.7382362 -2.7877903 -2.0023444 -3.020919 1419703_at 0.5704572 -0.852422 0.0149581 0.5160828 0.2817928 0.239859 -0.1244526 0.058692 1419706_a_at-0.6990969 0.046521 -0.4424048 0.1444731 0.0796509 0.0412396 0.413681 0.0324513 1419715_at -0.0901638 1.0022073 -0.2457969 -0.016511 0.1017032 0.1360722 0.5093557 -0.3617816 1419717_at -0.3705329 -0.881956 0.2333734 0.5147002 0.2466714 0.2013326 0.6310785 0.6116031 1419718_at -0.1726152 1.4688357 -0.2380191 0.2782108 0.2137706 0.2308914 0.7293956 -0.2100147 1419719_at 0.1192181 1.2480025 0.3372504 -0.1136615 -0.3959343 -0.6433102 -0.2446489 -0.2778009 1419721_at 0.030176 -1.23322 0.0219799 -0.0412242 0.4115881 0.2698363 0.4890205 0.6470275 1419726_at -0.1138722 1.6580337 -0.2366556 0.0336995 0.2528958 0.1421479 1.1780882 -0.1976398 1419727_at -0.0031894 1.837472 -0.0404617 0.3609586 0.3732343 0.301643 1.1666179 -0.2102206 1419730_at -0.7873161 0.0450015 0.2785468 -0.1330743 0.0534343 0.1336421 -0.2431933 0.2648605 1419731_at -0.0083578 -0.031091 1.4463718 0.0777969 -0.0133402 -0.0399673 -0.0952714 0.0752497 1419733_at 0.092155 1.5894532 -0.0663572 -0.1538918 0.2183469 0.0807101 0.8833964 -0.1515505 1419738_a_at0.5796268 0.5513911 1.2161283 -0.4395046 0.2735573 -0.4905228 0.8908021 -0.357563 1419748_at -0.7598879 -0.914577 -0.2082529 0.3329248 0.5118223 0.3198982 0.2270269 0.2929382 1419762_at -0.6086696 -1.752857 -0.3656027 1.120533 0.2310905 1.4323924 0.1415817 0.0491846 1419764_at 0.4560913 0.0775721 0.2983747 -0.6071909 0.3935855 0.2767139 -0.7234923 0.0106198 1419820_at 1.8046489 2.2680378 0.5703406 0.7459228 -0.6751162 -0.7098707 -0.9805175 -0.874212 1419827_s_at0.0759319 1.6920527 -0.1188611 0.115063 0.2736273 -0.016029 0.6534407 -0.3287869 1419905_s_at-0.9602499 -0.571797 0.1838946 0.0401707 0.2448402 0.2008198 0.1733297 -0.1868804 1419943_s_at0.2748598 1.0052645 -0.2759142 -0.2029817 0.1887315 0.1244325 0.5687885 -0.839762 1420008_s_at0.8157506 1.6888177 0.3934522 0.3389382 -0.6093071 -0.8734528 -0.4961729 -0.7808949 1420054_s_at0.3772564 -0.131757 -0.3120589 0.4654539 -0.0036839 0.1101127 0.7066491 0.701595 1420062_at 0.1235009 0.9736567 0.1141403 0.5822465 -0.0821727 0.0179152 -0.0335072 -0.1371031 1420089_at 0.7650033 0.2908262 0.4406009 -0.0763967 0.0222317 -0.0588228 -0.4523403 -0.1460619 Page 83 of 205 Diabetes

1420123_at -0.2342124 -0.122391 -0.2573576 -1.1099567 -0.2651486 0.8193941 -0.1119277 -0.0393613 1420124_s_at-0.0086679 -0.161314 -0.2974709 -0.8141658 -0.1492951 0.848073 0.1068538 0.1583204 1420132_s_at0.8827658 -0.163547 0.2635576 -0.1148026 0.1010031 0.0562435 -0.0299783 -0.050851 1420150_at -1.0261655 -0.775453 -0.534593 0.5605111 0.4243141 0.2581665 0.3710391 0.2764002 1420191_s_at0.4147832 0.8755727 0.0400993 -0.5908184 -0.6522698 -0.5074304 -0.2179402 -0.1802502 1420278_at -0.059771 1.1228238 -0.1268935 0.327361 0.1632331 0.2298009 0.8077424 -0.1622892 1420333_at -0.0653632 2.4336255 -0.1442509 0.3976405 0.4884162 0.5040314 0.9770724 -0.7443946 1420338_at -0.2386119 0.019516 0.6968606 0.1747515 0.0679643 -0.2716224 0.1111614 -0.514404 1420341_at 0.2010138 2.7699468 -0.1278272 0.5388897 0.8600557 0.5139992 1.4351586 -0.2602728 1420355_at 0.0334635 0.9645466 -0.0636196 -0.2043517 0.0920679 0.0663512 0.6813133 -0.4852341 1420357_s_at-0.8721427 0.2861102 -1.7875953 0.3169019 0.206111 0.2594989 -0.8281296 0.7650933 1420359_at 2.0637305 2.3898695 0.109942 -0.0402989 0.025129 -0.0070037 -0.0010691 -0.0482534 1420366_at 0.2287793 3.342298 -0.2857598 0.4441304 1.0002254 0.6286365 1.6564193 -0.4473489 1420380_at -0.3332514 -0.553473 -0.1321179 0.5893962 0.3555691 0.8752958 0.5200756 -0.074355 1420392_at 0.0833739 2.4482865 -0.1544719 0.4113004 0.4603849 0.4921433 1.1457057 -0.3100621 1420398_at -0.499657 -0.893054 -0.0674461 0.1351178 0.2214768 0.417055 0.3199094 0.1947597 1420401_a_at1.6155201 2.7711933 0.9514812 2.6081214 -0.6824398 -0.6012262 -0.5799241 -0.8324183 1420411_a_at0.7958137 -0.16228 0.0385969 0.001091 0.0080523 -0.2273992 -0.2727934 -0.4829691 1420413_at 0.533893 1.47665 0.1808659 0.6132851 -0.2270858 -0.2844067 -0.2847355 -0.025936 1420424_at 0.158448 2.823254 -0.2861438 0.690778 0.5536993 0.6762897 1.3996964 -0.4386263 1420430_a_at-0.7026373 0.1813341 -0.6411359 0.0421028 0.1140756 0.101585 0.3775187 0.0517435 1420437_at 1.493409 4.0886073 0.3139013 1.8026426 -0.6753465 -0.5079746 -0.2641161 -0.2209582 1420438_at -0.2584568 -0.662987 -0.3770678 0.6941378 0.448626 0.6948006 0.1768408 0.4694824 1420439_at -0.1830782 1.3511118 -0.069647 0.0794619 0.2525174 0.1194269 0.931405 -0.2155791 1420444_at -0.9602027 -0.915033 -0.2334156 0.2074132 0.2888224 0.1803799 0.3284098 0.4122616 1420446_at -0.1431581 1.1395985 -0.2465943 -0.0320878 0.2084805 0.1416673 0.4583821 -0.4151518 1420464_s_at-0.153939 -0.781338 -0.33472 0.8829413 0.2569087 0.391384 0.3693328 0.4837124 1420465_s_at1.1300449 -0.809139 1.1548798 -0.2473481 0.0408874 -0.1510214 -0.1693964 -0.1971993 1420466_at 0.0334833 -0.228287 -0.2411817 0.2233293 -0.0850827 -0.2254489 0.8455207 0.9926561 1420468_at 0.3571118 4.69234 -0.0783185 1.2776325 1.137742 1.3194907 2.0527983 -0.2636406 1420481_at 0.0874982 -0.268015 -0.2357383 0.8122327 0.3347339 0.2465926 0.7922484 0.8841761 1420487_at 0.6630671 0.2062708 0.291515 -0.0707998 0.0397591 -0.0457883 -0.5370018 -0.3815123 1420502_at 0.4568832 0.8780654 0.3004391 0.078476 -0.2246561 -0.1726749 -0.3678942 -0.4422945 1420513_at 0.148469 1.0942094 -0.0795563 0.0219743 0.2176337 0.063703 0.5536469 -0.1030736 1420527_s_at0.0970852 3.820872 -0.2758541 0.5929565 0.9018821 0.7279159 1.6295327 -0.4773339 1420541_at 0.8994875 0.0124763 0.5819381 -0.2873781 0.0286258 -0.1753718 -0.1248303 -0.2626862 1420545_a_at-0.3381976 0.1117363 -0.5210527 0.2637131 0.3741508 0.4247051 0.6247657 0.5978367 1420552_s_at0.1422777 2.5788078 -0.1546959 0.4369645 0.7235143 0.47666 1.0645012 -0.403684 1420574_at -0.0288603 0.9987224 -0.238054 -0.0326004 0.1843209 0.0045394 0.5717123 -0.2208118 1420579_s_at 1.122783 0.7773536 0.1152644 -0.2829053 -0.1934176 -0.2331492 0.1558757 0.5116703 1420587_at -0.1146754 1.3001273 -0.5719625 -0.0407615 -0.2492903 -0.4752727 0.2965938 -0.4135523 1420588_at 0.3530994 2.144568 0.5356787 0.9816392 -2.8875442 -2.4445825 -1.9095135 -2.1368778 1420647_a_at1.1642208 1.2262366 0.4330447 0.1174817 -0.6181148 -1.1692293 -0.5515496 -1.3012905 1420655_at -0.2406653 -0.715591 0.1006174 0.3384776 0.3572466 0.8493081 -0.4005335 0.6921007 1420657_at -0.359121 -0.836265 -0.161814 0.1397934 0.321446 -0.008346 0.1452564 0.3987017 1420660_at 0.2106738 1.6946937 -0.0463192 -0.1025205 0.3258355 -0.0537453 1.0849975 -0.2437713 1420674_at 0.2782915 -0.771796 -0.1172431 0.3644288 0.290641 0.038325 -0.2575553 0.0739007 1420686_at 1.2698636 2.055145 0.4772993 -0.1242557 -0.1527623 0.0250116 0.312442 1.188718 1420689_at 0.0395742 3.1434903 -0.3756946 0.4448391 0.5155028 0.3050005 1.3211194 -0.7720825 1420690_at -0.1558141 -0.645484 -0.0503445 -0.146467 0.369929 -0.0642764 0.178795 0.2456422 1420698_at 2.0773613 3.3190978 1.511534 -0.0988596 0.0503008 -0.1281874 2.2686272 2.293143 1420702_at -0.251968 3.2743194 -0.1880521 0.3096229 0.9846322 0.693673 1.3989528 -0.1585769 1420709_s_at1.1263843 0.4921919 0.2901728 -0.2122448 -0.1182384 -0.1588632 -0.2031186 -0.2637943 1420717_at -0.5807838 0.0368942 -0.8193427 0.1827784 0.0708288 0.0373668 0.6126087 0.1480818 1420719_at -0.089842 1.2109307 0.0040838 -0.2475381 0.3055937 -0.1663461 0.7500207 -0.4097435 1420724_at 0.1038157 1.7649025 -0.2707022 0.3118024 0.5681853 0.3090605 0.7898293 -0.2490433 1420725_at -0.111739 -0.843031 -0.1366348 0.2352235 0.2151361 0.3015118 0.1743302 0.233565 1420726_x_at-0.1677256 -0.81044 -0.0741262 0.2054472 0.246188 0.2994314 0.2297556 0.274109 1420730_a_at-0.2349304 0.810385 -0.2210926 -0.0936496 0.0293724 0.0979737 0.4931445 -0.5019944 1420731_a_at0.9176796 0.3419209 0.4660678 -0.4717178 -0.0580652 -0.2223631 0.1780043 -0.2508116 Diabetes Page 84 of 205

1420735_at -0.83289 -0.839724 -0.5063098 1.9320505 1.2713683 1.7207237 0.9039456 1.4735241 1420737_at -0.0654577 1.5633681 -0.2789328 0.546005 0.3878967 0.1917825 1.0037851 -0.2435371 1420742_at -0.1198309 1.3937267 1.0508447 1.0100098 -4.569552 -3.9963799 -2.92136 -2.1590726 1420760_s_at-0.7063777 -0.390366 -0.1395142 0.6023789 0.2665871 0.3115231 0.7355919 0.446257 1420766_at 0.0132034 0.9884814 -0.3166499 0.2289364 0.1844894 0.2549389 0.5541714 -0.11901 1420770_at 0.0920565 1.860575 0.0313125 0.0489596 -0.0491725 -0.0736918 0.0603348 -0.1446509 1420772_a_at-0.3569336 -0.001583 0.011508 0.8559418 0.3487864 0.5020455 -0.3852498 0.1234058 1420774_a_at-0.1138198 1.1800603 0.080565 0.0748971 -0.0983332 -0.0688304 0.4954201 -0.1477367 1420775_at 0.0739549 2.1174228 -0.0702496 0.3089297 0.3804866 0.3351489 0.6967028 -0.2443117 1420777_a_at 0.063351 1.7925427 -0.18488 0.2030895 0.355285 0.2260962 1.1806108 -0.1409171 1420798_s_at-0.0871884 -0.168684 -0.1852208 0.0525432 0.1073743 0.0252983 0.9578085 0.5706509 1420804_s_at-0.1426556 0.3158293 0.7539303 -0.6196208 0.4239974 0.1820858 -1.0128981 -1.3587674 1420805_at 0.0836431 1.7927015 -0.2121759 -0.0813332 0.4340879 0.0983427 1.1904426 -0.459973 1420817_at 0.0516 -0.595741 -0.2992902 0.9505339 0.3444529 0.5752577 0.9536536 1.1514505 1420821_at 0.2428043 0.6862742 0.7299688 0.4702992 -0.4005055 -0.5310885 0.0227528 -0.2163995 1420822_s_at0.2989194 0.737462 0.7965703 0.4660239 -0.4600845 -0.4764074 -0.0402397 -0.3334929 1420838_at -0.4981105 -0.324822 -0.0529773 0.511085 0.3407667 0.2732716 0.3330437 0.3777103 1420842_at 0.546989 0.9277637 0.4180279 -0.0476918 -0.3540897 -0.3204831 -0.1989705 -0.3424877 1420843_at 0.5145187 0.952234 0.3705792 -0.0082746 -0.3545189 -0.3475447 -0.2331797 -0.4292634 1420848_at -0.5300343 0.4819409 -0.3484521 0.0272613 0.3351086 0.2271967 0.2550705 0.0222631 1420851_at 0.7584205 0.0577767 0.2426059 -0.5125308 -0.2494367 -0.3205701 0.4815273 0.5540349 1420855_at 1.0523477 -0.043199 0.3342047 0.2442007 0.0337179 -0.1438438 0.1292518 -0.2516089 1420858_at -0.3479259 -0.349121 -0.4679905 0.7854626 0.5183269 0.8782008 0.1963456 0.2784978 1420859_at -0.2931083 -0.250992 -0.1317552 0.8661094 0.3228666 0.8743212 0.4002079 0.1626771 1420911_a_at-0.3289871 -0.355788 -0.5335681 0.5644517 0.0082577 0.4390917 0.2415495 0.5287259 1420928_at 0.0604773 2.0637424 0.0021389 0.2599812 -0.0999445 0.0581423 -0.1805035 -0.298859 1420943_at -0.0064206 0.7955997 -0.2471397 0.2661603 -0.0699902 -0.1818682 -0.0691799 0.0915634 1420944_at 0.3379521 1.0892568 0.1086884 0.3957729 -0.1884836 -0.126585 -0.1392584 0.1248776 1420954_a_at-0.5057941 -0.606954 -0.4115994 0.6496153 0.2924245 0.3940539 0.5544483 0.5492614 1420964_at -0.5663012 -0.223861 0.0189743 0.5314322 0.9216181 0.0658598 -0.2037773 0.1055347 1420965_a_at-0.7033451 -0.235264 -0.012789 0.5751824 0.4964571 -0.1684891 -0.1848466 0.1830982 1420984_at 0.4158827 1.0057969 -0.1471986 -0.0581207 -0.2513789 -0.1658788 -0.1654631 -0.138979 1420989_at -0.2217523 0.851404 -0.2034694 0.0392585 0.0990302 -0.2730216 0.4490943 -0.0045366 1421002_at 0.0931035 -0.940679 -0.5223204 0.1985631 0.0741573 0.6234067 0.4832954 0.4209177 1421008_at 0.6245096 -0.477652 0.4361104 -0.396467 -0.0160123 0.0395615 0.0048151 -0.1139803 1421009_at 0.4903505 -0.509658 0.5141755 -0.7073596 -0.2212907 -0.0115064 0.0562002 -0.2655889 1421014_a_at-0.6272681 -1.269309 -0.7926889 0.3674326 0.3338076 0.4080824 0.3361228 0.633536 1421031_a_at-0.4876697 -0.59837 0.4613819 0.4463306 0.6061961 0.1117502 0.0696777 -0.0533498 1421037_at 1.3324332 0.3295362 0.6694739 -0.2045221 -0.0021821 -0.6521176 -0.2959091 -0.9513356 1421040_a_at0.4351428 1.8832433 0.7596346 -0.2142694 -0.3143085 -1.5066631 1.1018509 -1.7132267 1421041_s_at0.5936267 1.0555404 0.3553612 -0.1147935 -0.1862156 -0.4931579 0.6933572 -0.5814052 1421045_at -0.1438631 -0.677683 -0.2854478 1.6841626 0.512822 1.2332673 0.2352786 0.3003264 1421048_a_at-0.1088574 1.2462587 -0.4790913 0.1054421 -0.0473156 0.0431961 0.8885754 -0.2833233 1421063_s_at-0.171361 -0.388152 -0.6157471 0.4735289 0.2804716 0.3915568 0.3834778 0.4731719 1421074_at 0.4243493 0.4828709 0.4713341 -0.3651822 -0.6140701 -0.4541076 0.168589 -0.3763461 1421087_at -0.1404319 -0.164151 -0.1108227 -0.3611193 -0.2174318 0.1424284 0.8485975 1.1319695 1421090_at -0.169277 -0.607818 -0.2473671 0.4303098 0.2756223 0.3972344 0.6775085 0.8158131 1421093_at -0.0460763 -1.216894 -0.181025 0.1852913 0.0928474 0.1249823 0.2369026 0.480264 1421098_at -0.0105326 0.9053602 -0.0216548 0.2202668 -0.4027087 0.1301801 -0.5323129 -0.4614015 1421116_a_at-0.4439402 -0.557919 -0.0501568 0.1749344 0.4831993 0.632768 0.0375923 0.2962503 1421129_a_at-0.5084016 -0.967327 -0.4815183 1.1658654 0.5413832 0.9243437 0.798508 1.0186507 1421138_a_at0.0909408 2.2557755 -0.2930648 0.3603745 0.2671681 0.2814801 1.0974036 -0.5882679 1421144_at -0.0501195 0.7735837 0.1048323 -0.2795391 -0.3793392 -0.1485385 0.1853499 -0.3785979 1421161_at -1.3320509 -0.938398 -0.6111655 0.8978193 0.7031733 0.8389521 0.1656761 0.1719217 1421172_at 0.440117 -0.234662 0.3068858 0.1650794 0.2847264 0.5370008 -0.6230471 -0.2420152 1421173_at 0.3669984 0.6261516 0.5346911 0.2049422 0.3409542 -1.2427552 -1.4649116 -0.7018423 1421183_at -0.0824125 1.2274288 -0.230062 -0.0419701 0.4128675 -0.0387666 0.8199957 -0.0694476 1421218_at -0.4623956 -0.69736 -0.1733451 0.2774785 0.4862219 0.3277446 -0.1120823 0.4171106 1421228_at -0.6479005 -0.705229 -0.254908 0.5501614 0.3872098 0.5774754 0.2659949 0.1656529 1421262_at 0.8960349 3.0471644 0.5996902 1.4171882 -0.2795236 -0.3318182 -0.264755 -0.443591 Page 85 of 205 Diabetes

1421276_a_at-0.5015823 -0.582081 -0.39451 0.7804847 0.3399925 0.310915 0.3148966 0.3556976 1421286_a_at1.0013447 2.3399124 0.203333 0.65993 -0.1866283 -0.2110487 0.2905218 -0.2779967 1421289_at -0.6075919 -0.484893 -0.2909653 1.430119 0.7174372 1.1449648 0.4189278 0.5380781 1421290_at -1.1979399 -1.059381 -0.5605676 2.0933752 0.9514993 1.4801672 0.8761986 0.8612211 1421293_at -0.2079644 0.8318011 -0.1649472 0.1992219 0.2434261 0.0404305 1.1849372 -0.0853521 1421294_at -0.1307834 1.2001342 0.0740787 0.066437 0.2545613 -0.0341055 0.8954597 -0.2942831 1421295_at -0.406552 -0.827719 -0.366168 0.3352447 0.4848585 0.2693697 0.4417175 0.4312808 1421308_at 0.5043864 -0.542548 0.2864453 -0.1632423 0.3480424 -0.1412807 0.0774055 0.1537724 1421317_x_at0.7753317 1.1696893 0.4404182 -0.1709492 -0.5238752 -0.7699674 -0.7657711 -0.6770387 1421321_a_at0.8658142 0.1510794 0.3742385 -0.1669765 0.2370407 -0.815213 -0.0770095 -0.1829383 1421347_at 0.0534895 1.2041758 -0.1045693 0.1260841 0.5629755 0.2163864 0.7998851 -0.3229776 1421415_s_at-0.3278734 -0.581279 -0.1824288 0.6157301 0.6898127 0.2148856 0.3060211 0.3411201 1421428_at -0.3973895 -0.523126 -0.1419108 0.8151097 0.4086518 0.7146584 0.0615851 0.5443628 1421431_at -0.2779846 -0.640769 -0.3727468 0.2468772 0.3993931 0.252106 0.1687004 0.2952191 1421445_at 0.702029 1.1934882 0.1952182 -0.1771054 -0.6410466 -0.7728913 -0.2689015 -0.9334824 1421469_a_at0.3905733 -0.477209 -0.0531449 0.5046759 -0.2333789 -0.2297916 0.8739494 0.9006831 1421479_at -0.0590484 0.5739899 -0.1475725 -0.3511453 -0.1335481 -0.126183 0.6501754 0.0644698 1421489_a_at0.6857524 1.092738 0.4217369 -0.3857118 -0.0437582 -0.3921595 0.084958 -0.3424112 1421496_at -0.38772 0.1525029 0.8011208 0.0413442 -0.0357819 0.0954938 -0.1011459 0.1211371 1421521_at -0.0576326 1.1500366 -0.1806528 0.0926726 0.0940213 -0.1340016 0.5831006 -0.2409081 1421534_at 0.9405804 0.3461986 0.5979961 -0.3593416 -0.1093917 -0.2606033 0.0410007 -0.2881126 1421555_at 0.4845445 -0.652476 -0.0033092 0.0076354 0.5236265 -0.4245186 0.650486 1.0336272 1421556_at -0.5147028 0.3143643 -0.4216049 0.5210261 0.6068794 0.5367252 0.5882955 -0.1290766 1421559_at 0.6238309 1.3800688 0.4812171 0.532655 -0.1156608 -0.1706771 -0.0742951 -0.1248704 1421564_at -0.4874001 -1.122607 -0.8437564 0.6348777 0.0919064 0.4336428 0.4443003 0.528759 1421587_at 0.0725707 1.2892277 0.0933912 -0.1336937 -0.125343 0.0449324 -0.1023459 -0.2743948 1421595_at 0.2661212 0.9077828 0.0301987 -0.0653131 -0.2183807 -0.40762 -0.1538091 -0.350835 1421621_at -0.6412185 -0.747915 -0.4914762 0.2593854 0.2798159 0.2353376 0.2639275 0.3157129 1421624_a_at 0.385441 1.2019655 -0.3303852 -0.1707287 -0.0940816 -0.2906318 0.133059 -0.5556061 1421653_a_at-0.9781084 -0.57979 0.4690867 0.2805672 0.0732006 -0.1243255 0.8436572 0.6512933 1421679_a_at -6.71E-04 0.2121794 0.0386257 0.4230199 -0.0120188 0.064295 -1.1896667 -1.0605397 1421681_at -0.4033537 -0.783923 0.1117501 0.0559888 0.4346293 -0.1337343 0.1514282 0.6028376 1421682_a_at0.3820682 4.041968 -0.8631084 0.1124916 -0.2014095 -0.1745614 1.1344045 -1.6709012 1421683_at 0.185703 3.1313758 -0.3269818 0.2668757 0.2010475 0.1644617 0.9610356 -1.0447205 1421702_at 0.3093894 0.372722 1.183568 0.1112406 -0.0730384 -0.133025 -0.0981782 -0.1588992 1421708_a_at-0.0839838 -0.498793 -0.213011 0.9627464 0.3150588 0.4637486 0.6810964 0.852885 1421720_a_at-0.1011153 -0.725446 -0.2106851 0.6807647 0.2696274 0.3641429 0.9117792 0.9749945 1421732_at 0.6292714 2.174796 0.6508524 0.7278552 -0.4227925 -0.4592764 -0.550203 -0.6543865 1421752_a_at 0.149209 0.5710709 0.8282622 0.0228329 -0.0846403 -0.2952169 -0.183754 -0.1759329 1421802_at 0.0293708 0.052453 1.1345146 0.0332999 -0.0760637 0.2458522 0.0762964 0.0401079 1421804_at 0.1267771 1.5185871 -0.1349127 0.0908126 0.3003335 0.2519596 0.9974808 -0.1378517 1421807_at 0.1714476 -0.148747 2.095621 -0.1145439 0.0134767 0.0063467 -0.1033023 -0.1198209 1421811_at -1.3262367 -1.018708 -0.3909922 0.5285268 0.5262774 0.3149059 0.2757711 0.0046673 1421813_a_at0.0449379 -0.60322 -0.343148 0.9127164 0.2862904 0.3416048 0.6844037 0.6598066 1421830_at 0.3208867 1.2380524 0.5461052 -0.0293236 -0.7126868 -0.7102341 -0.4336882 -0.4233977 1421833_at 0.454042 1.001261 0.0463762 0.526155 -0.2735829 -0.3678363 -0.1533871 -0.1623402 1421834_at 0.5245056 1.3080003 0.2608775 0.6790783 -0.1946135 -0.3181238 -0.0975424 -0.2583434 1421865_at -0.5104966 3.27675 -0.9075295 0.5019178 -0.5460674 -0.0658651 0.433941 -2.7486994 1421889_a_at-0.1996617 -0.882531 -0.3549256 0.417819 0.3606407 0.2713333 0.2785578 0.3586083 1421891_at 0.1908455 -0.525075 -0.4968633 0.8580725 0.0085626 0.1678328 0.7493885 0.9534351 1421892_at -0.2107366 -0.357254 -0.4058902 0.4137547 0.0199088 0.2696945 0.3309145 0.6228259 1421921_at 1.5846908 1.3387495 0.7190208 0.0241797 -0.0312889 0.1925614 -0.9021499 -0.5003912 1421992_a_at0.1277173 -0.930562 -0.4540572 0.7129178 0.2460726 0.3804417 0.50547 0.6420596 1421996_at 0.5759158 1.0419576 0.7324821 0.1603501 -0.3208967 -0.4250504 -0.4858192 -0.352646 1422000_at 0.1675122 1.177003 0.6488892 0.810328 -0.2667323 0.1796174 -0.1974063 -0.1159215 1422003_at -0.2837718 -0.497676 0.1226621 0.5856628 0.5534353 0.5484363 -0.0040894 -0.1554341 1422004_at 2.4857593 4.32752 0.4114863 0.5264192 -0.2251153 -0.0472811 0.9679924 -0.1982729 1422041_at -0.3428725 -0.798957 -0.1627657 0.2409873 0.2774943 0.3301346 0.3347971 0.4123789 1422070_at -0.685865 -0.172658 -0.6603308 0.6953757 0.5595095 0.8026919 0.428662 0.0581606 1422072_a_at0.4765017 1.2702283 -0.2381821 0.9392235 -0.4257452 -0.0826853 -0.0964621 -0.1925395 Diabetes Page 86 of 205

1422076_at 0.2836307 -0.234811 -0.1135438 -0.2693188 -0.0404532 -0.6085922 0.1650766 0.6952763 1422077_at 0.2268106 -0.078056 0.1326073 -0.9202515 -0.0664568 -0.6493118 -0.1637592 0.1821655 1422107_at -0.7772532 -0.709579 -0.1734415 0.4128132 0.5902566 0.5913976 0.0573568 0.0193262 1422140_at -0.1721212 -0.456835 -0.2612409 1.5740991 0.5092476 1.9695246 0.1182725 0.9941953 1422141_s_at-0.3303883 -0.260231 -0.1945648 2.1254692 0.5387939 2.2995872 0.2100539 1.2516328 1422153_a_at1.7689874 3.3650346 1.5526602 2.2729359 -0.6725909 -0.3870849 -0.4025342 -0.6850302 1422155_at -0.446196 -0.254402 -0.9064952 0.5192027 0.3927832 0.5634433 -0.3557922 -0.1790172 1422168_a_at-0.8738366 -0.697762 -0.6813739 1.2774677 0.8685983 1.162728 0.3066658 0.7270606 1422177_at 0.0842024 0.6251198 0.1138873 0.2362421 -0.4121214 0.4284655 -0.3264004 -0.3340848 1422178_a_at0.8925577 1.0915868 0.6605344 0.3360696 -0.5227732 -0.7430543 -0.1659924 -0.813485 1422185_a_at-0.0791984 -0.718897 -0.3916221 0.948731 0.2963627 0.432662 0.657615 0.6544387 1422224_at 0.4278262 3.637072 -0.2067131 0.8910868 0.9815434 0.6767324 1.5395607 -0.4917778 1422225_s_at0.1285865 2.2067432 -0.1624925 0.1369603 0.470484 0.2622792 0.9331851 -0.235432 1422236_at 0.0588409 1.6942054 -0.2642816 0.4932408 0.3742153 0.2364915 1.0282845 -0.2212839 1422257_s_at4.0456934 3.0809917 2.363574 -0.1938357 -0.0038733 -0.4170409 -0.8242085 -0.8891811 1422308_a_at0.9343824 0.0067229 1.5163705 -0.3111255 0.1074602 -0.535598 -0.0987628 -0.5812319 1422327_s_at-0.1715554 -0.954382 -0.5603102 0.90978 0.5089296 0.5077819 0.5316919 0.5639079 1422340_a_at0.6250105 1.4538035 0.9294112 -0.6508861 -0.5809583 -1.0508475 1.6007385 0.6628649 1422397_a_at-0.0437766 -0.608705 -0.1044097 0.2939012 0.4217208 -0.1476584 0.5752346 0.7961981 1422400_a_at-0.0518506 1.1343515 -0.1701983 -0.0850884 0.5735927 -0.0485254 1.1022972 -0.1721359 1422419_s_at0.5497197 4.788893 -0.3227025 1.5266871 0.5644692 0.9589885 2.4376736 -1.0443388 1422427_a_at 2.586718 2.8166661 -0.08853 -0.0527612 -0.0140919 0.0300533 -0.025248 0.0317156 1422428_at 0.4878185 0.9584538 0.1385785 -0.2257974 -0.1644319 -0.5779621 0.3184972 -0.3505386 1422430_at 0.1400669 1.0975243 -0.2944683 -0.2823272 0.1803716 0.1130271 0.4585471 -0.1631619 1422438_at -0.1631448 -0.581836 -0.3755508 0.8578262 0.3428246 0.9300095 0.5948642 0.4140504 1422462_at 0.0882633 1.6708013 -0.2391117 -0.3590879 0.2221127 0.2255233 0.8024567 -0.3087139 1422477_at -0.1500962 -0.413118 -0.1542544 0.8452559 0.6315621 0.2090517 0.3490559 0.4683434 1422500_at -0.4879297 -1.202699 -0.6344547 0.2909515 0.2647736 0.4388503 0.2147787 0.4911834 1422501_s_at-0.3080406 -1.0715 -0.6003846 0.3500462 0.3283855 0.4763876 0.154191 0.4635363 1422504_at -0.3099483 0.1461952 -0.499459 0.5340731 0.0301541 0.7237986 -0.0164989 0.2900739 1422515_at 2.1639 3.6603475 0.7460657 0.8564975 -0.1760004 -0.1434043 -0.2612019 -0.3176588 1422521_at 0.2205125 -0.184836 -0.1811839 0.7868145 0.1877777 0.3143651 0.7812093 0.8435006 1422526_at 0.7432642 0.1276839 0.0155473 -0.3720284 -0.1352995 -0.3085169 -0.3638099 0.117691 1422533_at 1.6748576 1.1331984 0.8957269 -0.3537881 -0.6437466 -0.8973643 -0.2302858 0.0263305 1422543_at -0.1059791 2.4541202 -0.3489269 0.346575 0.6528449 0.3960027 1.1732494 -0.2377378 1422545_at 0.890713 0.7991576 0.0036269 -0.1403422 -0.4932463 -0.4856534 0.1610405 -0.1792574 1422550_a_at-0.3383966 -0.857422 -0.5050601 0.9336994 0.448554 0.6150998 0.5982769 0.9998959 1422552_at 0.8982261 1.3933191 0.4439879 0.5313041 -0.6540278 -0.5112072 -0.3954492 -0.3439422 1422558_at -0.4512065 0.4802802 -1.2645926 0.6950369 -0.067611 0.3364849 -0.1781187 -0.0225528 1422561_at -1.1007237 -0.725384 -0.3900194 0.584199 0.3594702 0.7497332 0.3737758 0.1705049 1422571_at -0.9491141 -1.055951 -0.3951812 0.5912471 0.3026741 0.2981072 -0.1434202 -0.1355317 1422580_at -1.0924432 -1.014328 -0.7303058 0.3568888 0.2037792 0.5908883 0.1726901 0.3199892 1422582_at -3.14539 -2.810882 -1.026459 1.264216 0.6129195 1.2904425 0.4883213 0.6941178 1422585_at -0.666393 2.372104 -0.9429342 0.3074305 -0.8586111 -0.7850011 -0.1378884 -2.6992493 1422600_at 0.0623785 0.7176776 -0.3072238 0.0947845 -0.1872623 -0.2070864 0.0294743 0.0497189 1422605_at 1.0763776 0.0292194 0.306252 -0.4196544 0.0064358 -0.1981806 -0.0153316 0.2177591 1422610_s_at-0.0049977 1.8483937 -0.0557435 -0.1483008 0.0652179 0.0789184 0.778076 -0.509301 1422617_at 0.1655709 3.4296293 -0.1336324 0.4785438 1.182772 0.6916584 1.7565278 -0.391045 1422618_x_at0.1306455 3.8815765 -0.1033012 0.590024 1.5203086 0.7397794 1.7904963 -0.3038362 1422633_at 0.1964742 3.1312876 -0.303452 0.0774289 0.8165608 0.4284166 1.6227055 -0.4270953 1422642_at -0.649195 -0.093525 -0.2576213 0.0297189 -0.0108135 0.3762625 0.4172455 -0.1134357 1422644_at 0.6995624 0.7291066 1.3577554 -0.5471273 0.0570031 -0.8029526 0.8981395 -0.2136447 1422645_at -0.5899432 -1.194078 -0.1947672 0.7174711 0.6038668 0.8588435 0.1442086 0.2336613 1422656_at 0.1127703 2.360005 -0.3414612 0.0109103 0.2886644 0.2288836 1.3888439 -0.1301128 1422658_at 0.1196843 3.0400462 -0.1564374 0.5370429 0.7667972 0.569531 1.2938862 -0.4072464 1422667_at 0.6385061 1.1245916 0.9215642 0.1571517 -0.080601 -0.1302772 -0.0727595 -0.1869257 1422670_at 0.058567 -0.230835 -0.3253754 0.9044912 0.197279 0.5322514 0.7981424 0.6849731 1422674_s_at0.3757074 0.4612697 1.4895489 -0.0368567 0.7583515 -0.0601813 1.276846 -0.071715 1422677_at -0.7916832 -0.920334 -0.9986681 0.8353591 0.2850136 0.6866884 0.9137046 1.2227268 1422678_at -0.7457156 -1.388298 -0.6771655 0.7780147 0.3766995 0.8461071 0.9257752 1.2956823 Page 87 of 205 Diabetes

1422689_at 0.1130617 2.1256237 -0.1063443 0.083984 0.5312749 0.3275918 1.4214911 -0.1725605 1422694_at 0.5323509 0.9763597 -0.0897448 0.2980912 -0.4275135 -0.4062289 0.1563317 0.0114339 1422695_at 0.0854991 0.9381981 -0.2205051 0.0143166 -0.2510353 -0.5115832 0.2225944 -0.3683503 1422703_at 0.6320945 1.318901 0.4333689 0.5333433 -0.7067688 -0.5903093 -0.5674779 -0.4248599 1422704_at 0.9030173 1.5341077 0.6949439 0.5094538 -0.8546546 -0.720047 -0.6142079 -0.6648841 1422705_at -0.7522717 -0.678076 -0.3698676 0.9430041 0.6455372 0.2155638 0.9500294 1.1286911 1422706_at -0.6337214 -0.416849 -0.1938632 0.3674722 0.3868544 -0.0359991 0.3433895 0.5008939 1422710_a_at0.0805782 1.1502819 0.1307321 -0.1182289 0.0527284 -0.0420143 0.5561767 -0.4542424 1422720_at 0.5926839 0.1850845 0.3257028 -0.6054957 0.0357389 -0.3409004 0.3128317 -0.1187803 1422721_at 0.3040553 0.6962538 0.1162877 0.2646902 -0.4194711 -0.4360494 0.0825599 0.1683388 1422722_at -0.1667087 1.6072147 -0.2704681 -0.003845 0.1284192 0.3498241 0.6604784 -0.3167685 1422724_at 0.0508381 1.1284678 -0.1975554 -0.2149892 0.292007 0.0430362 0.4752626 -0.2786073 1422726_x_at0.0095188 0.701109 -0.0234386 -0.0637858 0.1629568 -0.0363686 1.1052874 -0.1583478 1422727_at 0.3924358 1.1036261 -0.037096 -0.2643571 0.1538266 -0.411624 0.4790455 -0.5088018 1422728_at 0.0928645 1.4046891 -0.0794431 -0.1778934 -0.2282421 -0.3703965 0.5490033 -0.5849627 1422741_a_at -0.02065 0.9215571 -0.3071141 0.3796341 -0.0629043 -0.2277234 0.1947182 -0.1790578 1422749_at -0.1153116 -0.04011 1.016127 0.0090473 0.0298292 4.13E-04 0.0403061 -0.1156059 1422750_a_at0.0127057 1.9687588 0.0037903 8.31E-04 0.0495626 -0.1301297 0.7255945 -0.485178 1422771_at -0.6481955 -0.690678 -0.2379993 0.2291703 0.2093338 0.2233814 0.5439854 0.2946558 1422784_at 0.0754426 -0.116543 1.3063973 0.0288014 0.0289681 0.0381096 0.0094768 -0.031057 1422803_at -0.4345093 -0.465263 -0.1734699 0.9840708 0.4395426 0.4786989 0.470575 0.4646691 1422809_at 0.4810582 1.1589798 0.0132629 -0.0142746 -0.3731743 -0.3593103 0.1806173 -0.2364723 1422811_at 0.8935161 -0.23578 -0.1440511 -0.0270548 -0.2877348 -0.5251598 0.2287658 0.3890657 1422818_at -1.1434314 -0.709231 -0.508328 0.5660315 0.4023634 0.5512387 0.4246302 0.2692976 1422820_at 0.0698903 -0.636448 -0.2383456 0.7140803 0.1762688 0.1745758 0.865525 0.9961322 1422826_at -0.3688535 -0.953107 -0.8897822 1.0892029 0.2598324 1.1626107 0.5733695 0.825847 1422836_at 1.1703048 4.3541274 -0.1461732 1.6561115 -0.6894975 -0.1587008 -0.2051551 -0.7514994 1422837_at 0.6583307 1.1225212 0.4031335 0.4614389 -0.8464581 -0.5265141 -0.417597 -0.4693805 1422838_at -0.4039778 0.2725488 -0.7775577 0.1169012 0.1438854 0.2997888 0.5309107 -0.2213678 1422840_at 0.1207004 2.9688835 -0.3004065 0.2050985 0.6532589 0.4113603 1.6857986 -0.1460106 1422852_at -0.5057337 -1.211828 -0.4510081 0.3621111 0.3685781 0.321164 0.4008319 0.4969931 1422875_at -0.2943004 -0.235201 0.2566171 -0.0734038 0.3171551 0.6157644 -0.4308036 -0.4257329 1422906_at 0.1323705 0.361779 0.8244293 -0.569221 0.0662634 -0.1466635 0.3696022 -0.5008023 1422913_at -0.0789071 2.4953005 -0.2383363 0.1429341 0.4105903 0.3914299 0.9545798 -0.3603913 1422916_at -1.0467461 -0.723816 -0.133316 0.8713856 0.444809 0.2239791 0.1102034 0.2008507 1422919_at -0.4384816 2.050895 -1.1947452 0.4209905 0.2520205 0.4064798 0.8812172 -0.1724178 1422925_s_at1.7445462 0.9780427 0.4700917 -0.2881541 -0.2215902 -0.4015138 -0.0200214 0.1380131 1422947_at -0.6310211 -0.132503 -0.9610373 0.2575584 0.5307177 -0.3161847 0.5787582 0.4065698 1422948_s_at-0.7760656 -0.780957 -0.6818583 0.6489859 0.7239636 0.6621078 0.1874991 0.334439 1422956_at 0.0110581 0.9231257 -0.1381236 -0.2409294 0.1490734 0.0909365 0.4132796 -0.2265425 1422960_at 0.871856 1.3707844 0.111797 0.3430839 -0.1818686 -0.229955 -0.1902636 0.1514158 1422972_s_at0.3661983 -0.387871 -0.1893997 0.446871 -0.0871894 0.0715091 0.5489766 0.8471828 1422973_a_at0.5880146 -0.789392 0.0425723 -0.0331807 0.3268387 0.6613426 0.3621524 0.7966328 1422997_s_at1.0047566 0.5574676 0.9700927 -0.2713671 -0.3589097 -0.5977463 -0.0340982 -0.0857622 1423021_s_at0.0671465 1.4695156 -0.0412114 -0.0876079 0.0763153 -0.1321859 1.0393242 -0.2596528 1423023_at -0.6693444 -0.78079 -0.8413022 1.8041849 0.9519244 1.5949256 0.772137 1.0660839 1423062_at 0.960223 0.2947953 0.0821395 0.3690791 -0.0698834 -0.4050694 -0.6694905 -0.6702681 1423071_x_at0.2304013 0.185786 0.6198275 -0.576633 -0.3679121 -0.430423 -0.2605359 -0.439806 1423072_at 0.3389634 0.319381 0.5827241 -0.3383691 -0.4513545 -0.4945738 -0.0569115 -0.4889619 1423084_at 0.4584253 -0.826762 0.3787315 -0.1110153 0.0705299 -0.6720374 0.2540051 0.4149834 1423100_at -1.1523999 1.0409036 0.4620111 0.1616216 0.1483273 0.602109 0.3445978 0.0233307 1423101_at -0.0230032 -0.536649 -0.3213769 0.5484638 0.1112453 0.3312716 0.4560097 0.7646201 1423104_at 0.6620464 0.0535502 0.1330867 -0.6474648 -0.2330372 -0.6146534 0.05277 0.2089014 1423110_at 1.0603478 0.0430365 0.3678093 0.0167193 -0.0789303 0.0176853 -0.3097995 -0.5113335 1423150_at 0.3404224 0.8661579 0.1503893 -0.0311177 -0.2822043 -0.1888465 0.0621508 -0.1472731 1423156_at 0.638315 0.5369289 0.1368575 -0.3945293 -0.1110743 -0.5403172 -0.4216528 -0.2961153 1423158_at 0.7984984 0.5517533 0.1343644 -0.3398905 -0.035951 -0.589529 -0.3296633 -0.290439 1423179_at -0.5189494 -1.068779 -0.299898 0.4683609 0.315679 0.479873 0.3841289 0.4949242 1423180_at -0.5132817 -1.030187 -0.35428 0.4673772 0.315475 0.5125985 0.2227674 0.5621688 1423203_a_at0.3232262 4.2885704 -0.2679938 0.5895094 0.8689057 0.6925616 1.7566161 -0.7745213 Diabetes Page 88 of 205

1423222_at 0.1485891 1.7726729 -0.2264924 0.2514093 0.0643641 0.2632249 0.8836734 -0.3731519 1423226_at -0.7294375 -0.542808 0.3394395 0.4906421 0.7025406 1.0105426 0.4313272 -0.426545 1423227_at 0.2503208 -0.057972 1.1029761 -0.0607064 0.0106597 7.38E-04 -0.1552997 -0.0150023 1423259_at 0.1052915 0.4193467 -0.0508215 -0.6393473 -0.3838525 -0.6644883 0.7706431 -0.1159619 1423261_at 0.888918 0.4197412 0.6761357 -0.2366254 -0.4465968 -0.5626448 0.2188964 -0.5378124 1423266_at -0.4340925 -0.987793 -0.3018038 0.4993115 0.3578892 0.4206104 0.2001947 0.464448 1423271_at 0.2361831 -0.006485 1.9666872 0.0412507 -0.0548731 0.1510915 -0.1055365 -0.1106721 1423277_at -0.4753774 -0.697666 -0.2149214 0.4723258 0.3500468 0.3984967 -0.1637243 0.0250812 1423294_at -2.60922 -2.102296 -1.5333384 1.7121181 0.8471466 1.157685 1.3565127 1.5768617 1423313_at -0.6091194 -0.610401 -0.4870484 0.9944739 0.5074406 0.9953837 0.6935315 0.8985489 1423314_s_at-0.5547559 -0.669939 -0.3369258 0.8623862 0.5188884 1.0542657 0.6909034 0.8212832 1423323_at 1.6636109 0.8819928 1.0041249 0.0644275 -0.1491328 -0.1190134 -0.1741559 -0.0967229 1423327_at 0.2619122 4.284423 -0.2586668 0.5192726 1.0803837 0.4787697 1.645862 -0.7961147 1423331_a_at 0.143027 1.2211342 -0.3907652 -0.0808415 0.2269128 0.0684208 0.8104184 -0.243362 1423340_at 1.4577107 3.0453262 1.5388772 2.2873647 -0.6265825 -0.5695335 -0.43694 -0.8144286 1423369_at -0.8747644 -0.897797 -0.4292212 0.4081016 0.3594503 0.7166185 0.2421258 0.5801624 1423381_at -0.6763352 1.4695414 0.3941975 -0.0331643 0.2789435 0.0610174 1.76431 -0.1297957 1423403_at 0.7879796 0.5171666 0.0750448 -0.2579343 -0.0949146 -0.4983509 0.0128466 -0.0085338 1423405_at -1.206995 -0.840153 -0.3777895 0.6490407 0.3631376 0.5476114 0.4050461 0.558225 1423407_a_at-0.042515 -0.635276 -0.0080528 0.6212649 0.4463892 0.4039709 0.1772213 -0.0551895 1423410_at 0.3356071 4.306724 -0.5437638 0.3317239 0.2377639 0.1120901 1.3388457 -1.7918415 1423413_at -0.630486 -0.543006 -0.2937019 1.1439748 0.668088 0.5411357 1.1497375 0.8302703 1423420_at -0.1376143 -0.671387 -0.0089475 0.1510022 0.25794 0.1555162 0.5049232 1.010728 1423436_at 0.7768028 0.21436 0.7442362 -0.6114574 -0.0312111 -0.2539759 0.0255547 0.1319415 1423437_at 0.571727 0.1139388 0.7261713 -0.4986804 0.083219 -0.187661 0.016572 0.1950038 1423463_a_at0.1270412 0.7973454 -0.2922061 -0.1196177 0.0239514 0.0570472 0.0999603 -0.1558499 1423467_at 0.0232099 -0.503105 0.2653043 -0.6952667 -0.4621593 0.5918517 -0.0261065 0.431044 1423469_at 0.0297678 2.5374362 -0.0877873 0.3022838 0.5435312 0.4635218 1.2891668 -0.168831 1423476_at 0.8485553 2.082242 1.3885322 2.0485983 -0.1299424 0.060034 -0.1666984 -0.4241407 1423488_at -0.6485758 -1.153307 -0.3126123 0.2862682 0.2702995 0.3927012 0.0593828 0.2322728 1423489_at -0.6050143 -0.969467 -0.31075 0.1792855 0.1156292 0.2062101 0.0915616 0.2453499 1423493_a_at0.2971523 -0.473958 -0.2488904 0.5529699 0.1346541 0.1489513 0.8431527 0.8411255 1423494_at 0.0861183 -0.096968 0.9058205 0.0586598 -0.0381634 0.0867871 -0.0105057 -0.0474725 1423495_at 0.0060487 -0.630027 -0.4266899 0.7852681 0.2770613 0.3398051 0.4952342 0.6763849 1423497_at 0.0733984 2.6984324 -0.3954492 0.4496002 0.4636679 0.3457885 0.78948 -0.7220128 1423498_at -0.0851506 1.1234708 -0.134309 0.3155184 0.2197337 0.1358849 1.0303888 -0.1989027 1423500_a_at-0.436901 0.507941 -0.3716916 0.0101781 0.2431426 0.0793648 0.651608 -0.0593298 1423506_a_at-1.0265625 -1.595987 -0.6043057 0.6119037 0.6105259 0.571599 1.0574169 1.4055738 1423514_at 0.1589359 3.8944907 -0.2319556 0.6601332 1.1712354 0.8600639 1.8412496 -0.3582102 1423523_at 0.302516 1.3907629 -0.1804282 0.3543959 -0.2971339 0.3414489 -0.0200386 0.1189292 1423527_at -0.0373412 2.2925699 -0.3263809 0.6155708 0.4722985 0.2779695 1.3454905 -0.1193522 1423541_at 0.1878147 2.6089625 -0.0922569 0.4637442 0.722203 0.6553089 1.1453086 -0.2220664 1423542_at -0.0693381 -0.366401 0.6587651 0.0318573 0.0300661 0.044267 -0.0488666 -0.0810423 1423553_at 0.569998 3.9326398 -0.3885742 0.8749931 0.5877293 0.5806935 1.536404 -0.6115524 1423554_at -0.2077808 -0.87941 -0.5209074 0.6377273 0.367087 0.3157161 0.4323306 0.5729806 1423556_at 1.3577443 1.710047 3.467696 0.0362618 0.2859365 -1.3674756 1.0430816 -0.8981293 1423566_a_at-0.4505191 -0.193619 -0.7066206 1.0115395 0.7281125 0.435821 -0.1273152 0.3345121 1423576_a_at0.0432571 4.054821 -0.4926459 0.5147052 0.5063213 0.5344079 1.4836531 -1.0460225 1423580_at -0.0581082 1.5618331 -0.0643942 0.0977882 0.280377 0.3119156 0.9298854 -0.1321183 1423592_at -0.6577809 -0.734183 -0.2160983 0.445425 0.2466711 0.481949 0.2842522 0.3639383 1423596_at -0.5884531 -0.632265 -0.3207139 0.9441199 0.5039465 0.7519459 0.5082391 0.4994768 1423597_at -0.790599 -0.469082 -0.150651 0.3996546 0.1197464 0.5258434 -0.099538 0.1104024 1423608_at 2.019787 0.9073665 1.1249282 -0.4167185 -0.5527498 -0.9250119 -0.0417782 -0.1369079 1423619_at 0.1306648 -0.110533 0.0435257 -1.0121489 -0.586012 -0.6842402 1.112516 0.2974367 1423626_at -0.9583461 -0.737979 -0.3278458 0.4071908 0.1571093 0.2339234 0.1706727 0.219909 1423627_at 0.5508477 1.3744849 0.5696658 0.5174804 -0.2905656 -0.3443599 -0.2694856 -0.4490571 1423634_at 0.1924083 -0.007495 1.1777657 -0.0587293 0.1303857 -0.0889469 0.0820699 -0.1314604 1423635_at -0.4680351 -0.568341 -0.3129016 0.6728005 0.3916241 0.3416168 0.3605963 0.0415713 1423636_at 0.1569058 1.4470004 -0.1140846 -0.0050344 0.0256257 -0.0564303 0.6243509 -0.3855979 1423669_at 1.3753443 0.0563108 0.3292978 0.3911409 -0.003616 0.1604932 -0.2072438 -0.1382907 Page 89 of 205 Diabetes

1423691_x_at1.1423407 1.1332071 0.265121 0.164722 -0.6625189 -1.1086991 -0.6288732 -1.1933028 1423693_at -0.8848749 -0.752124 -0.7612732 1.1800528 0.4021294 0.9857561 0.4495144 0.6302239 1423713_at 0.091539 -0.315276 -0.3222051 0.4348533 0.109337 0.0663383 0.5083132 0.6796377 1423717_at -0.4056542 -0.634501 -0.222863 0.7105298 0.4595726 0.6357107 0.6782389 0.6681535 1423718_at -0.457911 -0.815013 -0.4525967 0.755311 0.5264786 0.618782 0.6308937 0.6592611 1423725_at 0.1717663 0.8403144 0.0173366 0.2044253 -0.1652571 -0.1889347 -0.1021357 -0.186979 1423748_at 0.5298796 0.6683137 0.1840961 -0.1515913 -0.3351179 -0.3677872 -0.0955394 0.0202532 1423756_s_at0.0211556 -0.827949 -0.277679 0.854629 0.3429375 0.4702679 0.7307813 0.7678 1423760_at -0.6796413 -0.549148 4.77E-05 0.4157052 0.5711998 0.6633293 -0.3158321 -0.1140156 1423771_at -0.4515581 -1.195883 -0.4932406 0.5120945 0.3635382 0.7953314 0.3834814 0.5988305 1423777_at 0.1558452 0.4670243 -0.5566133 0.3221784 -0.4049977 -0.2019153 0.2050109 0.3068123 1423790_at -0.2842352 -0.266173 -0.5879173 0.7691207 0.153046 0.3021042 0.2397868 0.2486483 1423804_a_at-0.0235325 -0.228827 1.9619875 -0.2435479 -0.0731412 -0.1494064 0.0628365 0.0886369 1423828_at -0.3321486 -1.135021 -0.6258564 0.5630994 0.5323923 0.6568705 0.2970031 0.8793917 1423832_at -0.3348748 0.1566465 -0.6261214 0.1343315 5.31E-04 -0.1241798 0.7835107 0.609049 1423851_a_at-0.0788876 0.1813891 -0.681803 -0.0306973 0.1057071 -0.3869223 0.5779278 0.547801 1423852_at -0.2383056 0.2278094 -0.79723 0.1467736 0.1465865 -0.2216116 0.6826196 0.6499441 1423858_a_at-0.2960224 -0.394297 -0.7243586 0.886508 0.3088442 0.4696198 0.7539218 0.2127276 1423859_a_at-0.2396407 1.7036006 -0.1524379 -0.0182967 -2.2155864 -2.339602 -1.67392 -2.7749202 1423860_at -0.2538565 1.9363627 -0.2096108 -0.0706573 -3.1193109 -3.572368 -1.8203479 -3.6504526 1423866_at 3.8479137 1.7033515 1.1974758 -0.562844 0.1839317 -0.3618865 -0.226062 -0.5400917 1423889_at 0.2200711 1.238653 -0.2090247 -0.0257211 0.134086 -0.116971 0.5920245 -0.2277508 1423890_x_at 0.625366 0.9340422 0.2427065 -0.020833 -0.4212175 -0.7769243 -0.1918062 -0.7169749 1423904_a_at-0.8023816 -0.64173 -0.2931403 0.6547184 0.5080112 0.1132007 0.2806616 0.5315669 1423905_at -0.4659023 -0.942279 -0.5543732 0.8520439 0.4698821 0.0999611 0.4829326 0.645103 1423916_s_at 0.189112 -0.604849 -0.4668572 0.3707047 0.1628223 0.0422054 0.4570219 0.5857506 1423933_a_at 1.012549 0.6998414 0.8950375 -0.776474 -1.1198744 -1.6239033 -0.8433628 -1.9288869 1423935_x_at0.5682589 0.3767581 1.7133272 0.3224158 0.0428656 -0.0701058 -0.500464 -0.2356032 1423959_at -0.1159813 2.405412 -0.4417346 0.1878986 0.6564686 0.3860029 1.1661025 -0.286581 1423968_at -0.492327 -0.602013 -0.5440757 1.551249 1.0473706 1.2791176 0.4932086 0.7123075 1424011_at 0.5363861 1.6184651 0.3815432 0.4408736 -1.0289812 -1.1012185 -0.1608315 -1.084292 1424046_at 0.1599438 1.809929 -0.4201618 -0.516995 0.2592441 -0.0373643 0.6574779 -0.7554996 1424068_at 0.0847499 -0.218682 -0.2973893 -0.5802097 -0.0358036 0.7925794 0.1344606 0.2223744 1424076_at 0.0987302 0.670004 1.2973136 -0.1569178 -0.1664949 -0.054856 -0.0677104 -0.6660287 1424077_at -0.1505772 1.01423 0.9349028 0.0317607 -0.1138107 -0.0351387 0.2972444 -0.8706214 1424081_at 0.2295531 0.8235598 0.0957769 -0.301259 -0.3261401 -0.3065464 0.1546189 -0.2204687 1424090_at 0.3339427 0.5139498 0.1690242 -0.5260949 -0.0183686 -0.1671818 -0.6955736 -0.1958631 1424108_at 0.6069603 0.6043115 0.1849654 -0.626061 0.0211617 -0.3790127 -0.4030523 -0.39173 1424109_a_at1.1473789 0.9038243 0.3666039 -0.4519329 0.0614361 -0.4424419 -0.185461 -0.2267138 1424127_at -0.2197835 -0.621904 -0.4997926 1.3974886 0.3275352 0.4913651 0.9953971 1.0917834 1424130_a_at-0.4363987 -0.721462 -0.2636669 0.6643996 0.3119585 0.4270933 0.5158374 0.5300102 1424148_a_at0.6491041 0.5994085 0.0504304 -0.0508335 -0.5522804 -0.2925817 0.0240719 -0.1650249 1424155_at -0.7334993 -0.110512 0.3466091 -0.469286 -0.1413313 0.1493799 -0.0681028 0.1398045 1424157_at -0.4087005 -1.185764 -0.3301566 0.8171001 0.3585823 0.4901581 0.768199 0.8230512 1424162_at 0.280196 0.2111974 1.0269079 -0.0945611 0.0358418 -0.1595709 -0.7204107 -0.2408182 1424187_at -0.9194334 -1.125393 -0.5326133 0.3420916 0.3676006 0.0539665 0.2434203 0.176954 1424218_a_at0.0138332 2.801848 -0.271709 0.405875 0.8753459 0.6179107 1.374828 -0.1130927 1424221_at 0.9281294 1.5535996 -0.1285045 -0.0299008 -0.4493941 -0.855077 -0.3064977 -0.2674734 1424226_at -0.3188036 -1.014485 -0.7007304 0.5784788 0.4048911 0.8763347 0.1215825 0.3407644 1424229_at 0.4446303 1.4875609 -0.3143494 0.0575676 0.0648991 -0.0077252 0.9267755 -0.4542694 1424259_at 0.0962535 -0.322468 -0.4841613 0.5040083 0.2204733 0.1385425 0.7501311 0.7407699 1424266_s_at0.7041669 -0.17754 0.5942226 -0.9620361 -0.2939709 -1.0373685 -0.1118848 0.1585048 1424279_at 0.3630834 0.9923531 0.4581888 0.1805863 -0.0671549 -0.1954275 -0.1425833 -0.1709784 1424281_at -0.4612548 -0.438741 -0.5302072 0.5726771 0.1569092 0.3826744 0.3665066 0.3270954 1424303_at 0.7679918 1.8561105 0.4705987 0.7921755 -0.6184322 -0.4390034 -0.9247732 -0.627609 1424305_at -2.0449247 -1.550126 -0.2431035 -0.1556349 0.2330113 0.8618282 0.3842996 0.48762 1424306_at 0.9412817 0.8487999 1.4311883 -0.0332115 -0.0401812 0.0205601 0.2945256 0.8777793 1424308_at -0.5103233 -1.059303 -0.3202984 0.2295327 0.1439306 0.3144413 0.2934707 0.2776003 1424316_at -0.1041991 -0.884549 -0.3660858 0.2994473 0.2654704 0.4804722 0.131327 0.6592274 1424317_at -0.1285942 -0.616766 -0.2998046 0.3889747 0.2392223 0.5155861 0.189395 0.8549633 Diabetes Page 90 of 205

1424334_at -0.7533588 -1.155221 -0.5337449 1.3031492 0.6038647 1.0275131 0.7942273 0.7225621 1424338_at -1.7042603 -1.899869 -0.967369 0.6242132 0.3778402 0.5978834 0.6644176 0.9535297 1424349_a_at-0.9021292 -0.797629 -0.3952727 0.6025128 0.4356518 0.7687979 0.0738608 0.2938589 1424350_s_at-1.2555233 -0.941612 -0.5117879 0.8970161 0.555642 1.096755 0.2124214 0.5146325 1424351_at 0.9328121 0.3903769 0.104596 0.1907785 -0.2807099 -0.2315354 -0.2834571 -0.2508879 1424352_at 0.4729575 1.0869749 0.6095806 0.8266113 -0.0930339 -0.0916873 -0.2576224 -0.1704162 1424355_a_at0.1658824 0.9371738 0.0210555 0.0556583 -0.1021688 -0.1418722 -0.0211862 -0.181118 1424357_at -0.6702733 -1.548988 -0.9381826 1.1578941 0.5586926 0.9900574 1.1202847 1.1381785 1424383_at 0.7724685 1.3268791 0.142955 0.3376358 -0.4533388 -0.394173 0.0504764 -0.1376403 1424395_at -0.1505786 1.1938714 -0.1406916 -0.1084473 0.2348965 0.1515792 0.5442026 -0.2120738 1424396_a_at-0.2383823 1.3892989 -0.2085507 0.0214291 0.4061897 0.2387489 0.7198483 -0.1743905 1424399_at 0.9001641 -0.166739 0.1556387 -0.0278792 -0.0089933 -0.2542807 0.3372043 0.4482743 1424409_at 0.9371012 1.8499194 0.7065091 1.1314616 -0.7478058 -0.642465 -0.7135656 -1.0090607 1424433_at -0.3540304 -0.720212 -0.3312825 0.2907624 0.4237476 0.4112496 0.2828045 0.4302753 1424450_at 0.6555927 0.891843 0.0961639 0.3392987 -0.4043981 -0.3471073 0.0638927 -0.1002835 1424470_a_at-0.9798644 -0.280471 -0.0240207 0.2395906 0.2749003 0.6035532 -0.2625702 -0.009155 1424471_at -0.6620886 -0.312202 -0.1503815 0.590425 0.2031521 0.5081913 0.0299239 0.2193607 1424477_at -0.0509346 0.9541109 -0.077168 0 0.0019085 -0.2452493 0.8060486 -0.3904363 1424479_at 0.1798195 2.8462203 -0.7370008 -1.3664737 -1.4503883 -1.484954 1.1045328 0.0951206 1424485_at -0.7361089 -0.974497 -0.2764815 0.68471 0.5815099 0.7636932 0.3538837 0.5290628 1424495_a_at-0.0155437 0.7362568 -0.4418465 0.0595264 -0.0597387 -0.0815726 0.4681366 -0.2433065 1424502_at 0.8297122 0.8648861 -0.0777112 -0.1072636 -0.2330167 0.0217068 0.3981635 -0.301089 1424511_at 0.2059062 1.279729 -0.1810031 -0.0898728 0.1847013 0.1367804 1.0558767 -0.1854005 1424537_at -0.2873759 1.9981403 -0.061914 0.0617458 0.4470432 0.3953225 0.7948396 -0.4428748 1424556_at -0.253392 -0.314376 -0.5466932 0.4332409 0.29842 0.5279455 0.0217643 0.4024162 1424558_a_at-0.0426875 1.4809768 -0.2660612 0.2490878 0.4158168 0.142196 0.6447306 -0.1427064 1424576_s_at-0.5144459 -0.593125 -0.2739344 2.022681 1.2461827 1.8014942 0.6659141 0.8031322 1424594_at -0.5707083 -0.777168 -0.0810244 0.4560266 0.3592642 0.2814768 0.1188971 -0.0107845 1424599_at 1.1318119 1.259056 0.4137131 -0.0905483 -0.0820031 -0.164471 -0.2397451 -0.0484584 1424607_a_at-0.7722344 0.63328 0.6566777 -0.1708493 -0.0115986 0.1011889 -0.3357636 -0.3501914 1424609_a_at-0.7834187 0.6401701 0.6580708 -0.2211118 -0.055748 0.1033817 -0.3843432 -0.3839706 1424614_at 0.4726896 1.234348 -0.0516012 0.6139116 -0.5957121 -0.4589005 -0.0119727 -0.2380816 1424615_at 0.6508064 1.41908 0.4932101 0.5749421 -0.3291653 -0.3337538 -0.1336238 -0.1604433 1424616_s_at0.6972323 1.323338 0.2836759 0.661644 -0.423202 -0.3364658 -0.1911891 -0.2159046 1424626_at 0.2710164 -0.9975 0.0035304 0.3016002 0.3695672 0.4516689 -0.194037 0.1958742 1424627_at 1.2421887 3.8800738 0.6075617 -0.8841887 -0.0663056 -0.8066698 2.5680265 1.878735 1424631_a_at-1.5237685 -1.457064 -0.1314297 0.3874869 1.0195255 0.45785 0.2148795 1.2009329 1424638_at -0.1874178 0.2709742 0.1290398 0.3663683 -0.009483 0.1416935 -1.319871 -1.0702072 1424649_a_at0.7128992 0.694517 0.2695192 -0.3546243 0.0514026 -0.5097975 0.5632756 -0.4760812 1424650_at 0.2858765 1.0714982 -0.2917925 0.2380643 -0.2459904 -0.1112219 -0.0938177 -0.289402 1424652_at 0.7678983 0.2297264 0.2269144 -0.504873 -0.22372 -0.3447599 -0.3319047 -0.3314427 1424678_at 0.0089056 1.53643 -0.250519 0.2610552 0.3969755 0.1562429 0.8027242 -0.2352095 1424683_at 0.6500864 0.4054287 0.4666982 -0.2546306 -0.6059515 -0.8896239 -0.3745709 -0.0983041 1424699_at -0.0942856 2.1617033 -0.1954615 -0.113539 0.2057998 0.0146634 0.8969958 -0.5862227 1424704_at -0.666208 -0.653919 -0.7096502 0.3659082 -0.1117835 0.238216 0.3841459 0.9913452 1424715_at -0.3489149 -1.177394 -0.3791583 0.251771 0.3984253 0.3595808 0.3935102 0.3517488 1424716_at -0.7172668 -1.510909 -0.4296291 0.2282667 0.4213423 0.5272299 0.155392 0.2131332 1424730_a_at0.3775687 1.1330799 0.1928951 0.0444455 -0.1937324 -0.2992994 0.1014787 0.1126668 1424733_at -0.222464 -0.773265 -0.0784174 0.3036444 0.4492842 0.3193431 0.0137943 0.1348801 1424737_at 0.2176976 -0.773545 -0.0300951 -0.0672145 0.2550499 0.5458441 0.2755083 0.6367375 1424743_at -0.0964248 -0.522584 -0.5584886 0.5585039 0.2722589 0.3556303 0.4098803 0.5606739 1424755_at -0.4779367 -0.656777 -0.2910389 1.1072884 0.4860992 0.6638203 0.6689313 0.914261 1424763_at 0.1165859 0.8165506 0.0572437 -0.4084396 -0.1726078 -0.3979926 0.6370587 -0.2989151 1424768_at -0.8828833 -0.529782 -0.2132933 0.3554459 0.3977928 0.2506203 0.1202189 0.00829 1424779_at 0.7059295 0.3580639 0.3930602 -0.4274068 -0.0282974 -0.3683655 -0.273543 -0.2490199 1424793_a_at0.0593116 1.5194591 -0.358388 -0.0723803 0.2700034 0.1496744 1.0146132 -0.3100427 1424794_at 1.0329795 1.262657 0.1635525 0.3096361 -0.2620873 -0.2913624 -0.003585 0.2743859 1424795_a_at0.0677465 1.2974839 -0.3051877 0.2343438 0.2235782 0.3342921 0.734444 -0.2745382 1424797_a_at0.8749273 0.1544268 2.29257 -0.0982698 0.0230406 -0.1043822 0.1098909 -0.1742851 1424798_a_at0.2212943 4.222338 -0.3653243 0.7016411 0.8537459 0.6083475 1.7136713 -0.7990878 Page 91 of 205 Diabetes

1424800_at 0.3936338 1.0005164 0.2459679 -0.4124041 -0.5865811 -0.5808531 -0.5888224 -0.7350063 1424801_at 0.3674977 0.8141251 0.2099719 -0.3953702 -0.2773712 -0.4317273 -0.4659893 -0.5679665 1424808_at -0.5239401 -0.606411 -0.0648936 0.2597876 0.476993 0.2328842 0.0066379 0.1954176 1424814_a_at-0.0707642 1.7197809 -0.3089202 -0.2122979 -0.2512624 -0.0881393 0.3070512 -1.0845045 1424815_at 0.620775 -0.176108 -0.3866121 1.1173253 -0.1699882 0.6426716 -0.2155965 0.9138272 1424831_at -0.1464452 -0.78992 -0.176927 0.6089683 0.2473719 0.4808969 0.5032322 0.9534105 1424835_at -0.5608903 -0.469437 -0.4859465 0.583539 0.2652288 0.4531431 0.3519386 0.3341929 1424855_at -0.0499058 -0.022572 1.4281087 0.0362202 0.0700425 0.0200099 0.0705026 -0.0302033 1424863_a_at-0.6435541 -1.081214 -0.3953989 0.5878406 0.3996962 0.7292902 0.1905727 0.5326357 1424893_at -0.6464472 0.1307043 0.5609429 -0.3465378 -0.0022844 0.0884652 -0.4181045 -0.056129 1424906_at -0.4449014 -0.967145 -0.4753168 0.8412857 0.6669644 0.9305395 0.5403226 0.7565129 1424909_at 0.2518232 1.7413051 -0.3371135 0.2305639 0.2418174 0.1611048 0.9074717 -0.3975484 1424911_a_at0.0302639 0.9640064 -0.0941633 -0.0087039 0.2111758 0.096547 0.4152613 -0.3730162 1424931_s_at-1.2659163 -1.21322 0.0692017 0.6028528 0.2374551 0.7042413 -0.1451217 1.1522073 1424936_a_at0.0969912 2.6777081 -0.176842 0.0670698 0.3965377 0.3167861 1.5066661 -0.3422157 1424945_at -0.3483704 -0.641828 -0.2031308 0.2047691 0.2565332 0.2110981 0.872536 0.7354822 1424950_at 0.7525566 0.3570038 0.3046584 -0.456768 -0.1578014 -0.1864108 0.1448671 0.2195842 1424951_at 0.5237577 0.9019405 0.2053282 0.1725831 -0.3911695 -0.638319 -0.0113285 -0.7714637 1424959_at 1.313155 1.9758819 2.1098218 0.4042921 -0.5286437 -1.0132163 0.458703 -1.3077909 1424967_x_at0.8681222 0.7020819 -0.1535733 -0.04914 -0.4225207 -0.7238835 -0.0064192 -0.2789067 1424977_at 0.1141236 2.1502953 -0.0118499 0.0564951 0.3887666 0.324672 1.2659539 -0.1578112 1424978_at 0.0225893 1.5508406 -0.2406938 0.2127049 0.4637299 0.1794829 0.8574264 -0.298481 1424983_a_at-0.3044043 1.3224713 -0.4031359 0.2316983 0.4456045 0.0186862 0.2734075 -0.263841 1425023_at 0.6971941 0.6101997 0.5112777 -0.3415346 -0.1249978 -0.3463852 -0.1052785 -0.2525878 1425028_a_at 0.726567 0.4741342 1.2207298 -0.4715118 0.2818298 -0.4745901 1.0829563 -0.2356011 1425029_a_at0.7489377 1.9039334 1.4699827 1.0122504 -0.5891274 -0.7215309 -0.671446 -0.8353741 1425047_a_at0.2462786 0.8702343 -0.160242 -0.2953849 -0.0035898 -0.1148855 0.3950492 -0.1272451 1425050_at -0.6785507 -0.809485 -0.5584629 0.1407309 0.2917557 0.2674145 0.2021507 0.37546 1425051_at -0.5877061 -0.848828 -0.4090037 0.1516085 0.3377905 0.4010792 0.1359084 0.4319496 1425053_at -0.6435565 -0.946215 -0.391206 0.0975509 0.3635031 0.5077318 0.0885738 0.4159832 1425076_at -0.2272034 0.8401796 -0.3448813 0.0501406 0.1782268 0.0658167 0.5281811 -0.3140197 1425098_at -0.4484947 -0.63489 -0.4981167 0.554502 0.27771 0.5663909 0.3372614 0.6559555 1425099_a_at0.0522621 -0.135931 0.1928265 -0.3260322 0.0601713 -0.1998008 -0.8415327 -1.0957867 1425133_s_at-0.2521761 -0.182794 -0.3401498 0.4960609 0.0970021 0.3634209 0.6459842 0.6888716 1425137_a_at1.5218694 0.0175275 0.4925979 -0.5192902 -0.185181 -0.3545997 -0.0058854 0.3237699 1425145_at -0.4042507 -0.555922 -0.2405008 0.4800348 0.5118367 0.4632689 0.350737 0.5551186 1425159_at 0.6426779 1.0169822 0.2727087 0.1577444 -0.3168941 -0.306522 -0.2811484 -0.3745667 1425164_a_at0.4595944 -0.140131 0.2560184 -0.3137572 0.0994257 -0.4005356 0.9230919 0.572611 1425182_x_at0.0406712 1.315703 -0.2484909 -0.0605764 -0.0083455 -0.0329534 0.1653107 -0.3083094 1425199_a_at0.6667676 1.3794746 0.2929933 0.2780056 -0.38798 -0.459809 -0.2547059 -0.5054698 1425202_a_at0.8570277 0.8747842 0.4105438 0.1789835 -0.2126462 -0.4066201 -0.0571481 -0.1735981 1425217_a_at-0.4724383 0.5888026 -0.4313383 -0.0017943 -0.0363774 -0.0313916 0.6081963 0.0928413 1425244_a_at0.1421841 1.2622459 -0.2343432 0.2883639 0.3081965 0.1171262 0.8240565 -0.3256237 1425257_at 0.700146 0.3201133 1.1430241 -0.0624108 -0.1104528 -0.0484372 -0.0503092 0.0074784 1425258_at 2.3696165 2.2233548 1.5426235 -0.0503097 0.0351562 -0.0201003 1.6408125 2.400816 1425260_at -0.7940162 -1.206401 -0.1392845 0.2009265 0.4978581 0.2389266 0.5113633 0.855931 1425270_at -0.3899778 -0.536692 -0.1231356 0.4717591 0.5688123 0.2596387 -0.097271 0.3985783 1425271_at 0.0397468 1.3749831 -0.3345497 -0.0875127 0.1475023 -0.0165192 0.8502841 -0.1563395 1425281_a_at-0.325953 0.1036511 0.038435 0.9187603 0.5429943 0.6091616 -0.5363824 0.0661942 1425283_a_at-0.0649525 0.8680372 -0.1845675 0.1193938 0.1808521 0.1969616 0.6337259 -0.0908286 1425291_at 1.0060452 0.2196128 0.2200639 0.0020585 -0.0058393 -0.0779979 0.2628199 0.0444458 1425295_at -0.3367261 -0.925533 -0.5196464 1.5145493 3.3187275 0.7337958 0.1701519 1.3228093 1425309_at -0.0277734 1.1663845 0.0210761 -0.3083928 0.1126092 -0.0106819 0.5287652 -0.314424 1425314_at 1.0994052 0.5754442 0.5501754 -0.1598139 -0.0329092 -0.0803446 -0.4546839 -0.2601293 1425317_x_at-0.1128449 1.2304437 -0.0729707 0.0291133 0.4953171 0.0177331 0.9548397 -0.0881337 1425381_a_at-0.3821193 -0.420435 -0.296369 0.7461169 0.2418713 0.9941266 -0.0047124 0.1574775 1425385_a_at-0.809904 -0.543265 0.7230026 0.4502554 0.2939838 0.8795719 1.4869738 0.9079962 1425395_at 0.052693 0.947758 -0.1491199 0.0400885 0.3472617 0.0605709 0.4690658 -0.2370884 1425400_a_at1.2025265 1.1170715 0.2071765 0.5479143 -0.3379762 -0.3343116 -0.0194475 0.2661362 1425409_at 0.740301 0.6321977 0.2788279 0.5070803 -0.1987978 -0.377611 -0.3746168 -0.6005187 Diabetes Page 92 of 205

1425411_at 0.9821732 0.2988669 0.4934248 -0.3159297 -0.0745869 -0.2378312 -0.4852673 0.0402288 1425415_a_at0.2655719 1.7281972 0.6521702 0.8297329 -0.3683048 0.0486211 -0.1963234 0.823535 1425420_s_at-0.1778214 -0.226011 -0.0055387 0.8200808 0.1914887 1.0904468 0.5531667 0.4482409 1425452_s_at0.4671255 1.0824665 0.9293208 -0.4260478 -0.8914954 -1.1429515 0.1042307 -0.3301644 1425469_a_at0.6278706 0.8877834 0.3229485 0.1163435 -0.6452264 -0.707316 -0.4505957 -0.029038 1425470_at 0.8086046 0.9555985 0.4745657 0.2612181 -1.3758831 -1.3332223 -0.8654954 -0.3521757 1425471_x_at0.7627654 0.9864545 0.4213767 0.2526193 -1.0663198 -1.0326912 -0.7695351 -0.2189978 1425476_at 1.0243683 0.2327118 0.4004872 -0.0523257 0.0344563 -0.207305 0.1774677 -0.1933918 1425503_at -0.9498417 -0.86629 -0.215858 0.6551652 0.4837425 0.2417524 0.3135335 0.2632294 1425559_a_at0.5242043 0.2656953 0.2075455 -0.6843021 0.2122474 -1.1536515 0.1953821 0.2305336 1425597_a_at-0.6107941 -0.657892 -0.1756157 0.2514412 0.4124726 0.4848309 -0.1258241 0.2565757 1425608_at -0.5039157 -0.375486 -0.26203 0.5563078 0.4346066 0.4170422 0.2116825 0.2268353 1425619_s_at0.9900074 1.2106466 0.4070636 0.0483243 -0.2527586 -0.2344738 -0.3675885 -0.2142282 1425638_at -0.9021347 -0.453211 -0.1446312 0.7289882 0.5613882 0.2864353 0.4641317 0.4420118 1425639_at -0.9580436 -0.126245 -0.0364015 0.6146011 0.4443106 0.1832159 0.1114168 0.1827704 1425644_at 0.8849061 0.3570799 0.1408826 -0.65363 -0.3194484 -0.276479 0.0278304 -0.0489343 1425645_s_at4.0660057 3.3577375 2.437277 -0.2759514 0.0140312 -0.4633902 -0.5772217 -0.9531595 1425652_s_at0.0260406 -0.410241 -0.3483361 0.6566081 0.1245388 0.183857 0.5864337 0.6522653 1425684_at 0.1411127 0.8032656 0.4696182 -0.2112126 -0.4893114 -0.2128258 -0.0258458 -0.2027001 1425701_a_at1.0168579 0.2058547 -0.0889361 -0.1498365 0.1358804 -0.5108995 -0.4322947 0.2896687 1425705_a_at-0.413494 1.029044 -0.586641 0.0182788 -0.0071119 0.0954721 0.2958333 -0.4098024 1425737_at 0.2012211 -0.137841 0.8744259 -0.0199852 -0.0152779 0.0420672 -0.1196976 0.0481396 1425746_at 0.7866936 1.0460781 0.3779501 0.38166 -0.3147639 -0.4163749 -0.2549308 -0.5512242 1425749_at -0.1833286 -0.295728 -0.7151191 0.6507549 0.2563345 0.8479446 0.403347 0.5433558 1425763_x_at-0.8750484 -0.530887 0.4906766 0.1301115 0.0275085 -0.1803143 0.6791989 0.6075907 1425784_a_at-0.3370975 -0.824802 -0.4017651 0.9279823 0.5918282 1.2083298 0.5355632 0.7606761 1425789_s_at0.9193291 -0.095919 0.7130419 0.0877388 0.178711 -0.0955831 0.09974 0.0283969 1425805_a_at0.1336719 2.1289864 0.0284964 0.3309169 0.6023701 0.4789636 1.3556007 -0.2658412 1425809_at -0.8593185 -0.056937 0.2185721 -0.4400673 -0.0282694 0.106992 -0.1184133 0.0899576 1425826_a_at-1.0943139 -1.242537 -0.4938002 0.2772775 0.2328304 0.3026792 0.2059797 0.3462528 1425832_a_at0.0030644 -0.862051 -0.1545968 0.0601327 0.2114053 0.4562802 0.2351246 0.4478038 1425834_a_at0.8174944 0.4002583 0.4667631 -0.0754392 0.0210608 -0.2008384 -0.3555686 -0.2648454 1425850_a_at-0.4646732 -0.960152 -0.6294066 1.1402335 0.5412244 0.6472147 0.6400539 0.537968 1425878_at 1.2600137 0.1849943 0.243668 -0.1350355 -0.0593819 -0.3342317 0.009131 0.1505756 1425891_a_at-0.2928711 -0.287753 -0.7449882 0.3022914 0.1248263 0.4992117 0.2954221 0.3118388 1425893_a_at-0.3911717 -0.7836 -0.2314931 0.4903832 0.3284296 0.5431227 0.2795566 0.4399395 1425896_a_at0.0602539 -0.679665 -0.0638065 0.7304192 0.3389727 0.280546 0.115502 -0.0238237 1425899_a_at-0.304468 -0.692189 -0.2402242 0.640831 0.4185845 0.3058858 0.3362293 0.6730018 1425918_at -1.2290732 -0.442434 0.5320983 0.1098056 0.4703222 0.1259701 -0.5550086 0.1594868 1425951_a_at0.2813474 -0.145714 1.0542746 -0.5316238 -0.658502 -0.6217648 -0.3599548 -0.8488296 1425970_a_at0.8529925 1.7267505 0.1091679 0.3163025 -0.0619185 -0.0938411 0.0070979 0.5206844 1425983_x_at-0.5443424 -0.814208 -0.2732459 0.6424737 0.3980755 0.6620186 0.2269249 0.493351 1425993_a_at-0.4057658 -0.263822 -0.3191216 0.864944 0.6936281 0.5367981 -0.3305283 0.2452596 1426010_a_at0.0382309 0.7481422 -0.4765335 -0.0042419 -0.1590824 -0.0873473 0.2610749 -0.4708494 1426040_a_at0.1987011 3.732424 -0.2540399 0.4459076 0.5445362 0.6137992 1.2550553 -0.8988106 1426043_a_at0.2278341 1.1248996 0.29486 0.4047484 -0.1202496 -0.0612409 -0.3004745 -0.1233705 1426044_a_at-0.2976686 0.7508538 -0.0660229 0.1157591 0.2410679 0.3020915 0.5876808 -0.1043426 1426060_at -0.6440257 0.2235518 0.4433558 0.0323529 -0.1640756 0.1336661 -0.1865619 -0.0896133 1426061_x_at-0.6315371 0.1981273 0.4461155 -0.0082905 -0.1172386 0.1064762 -0.2084986 -0.1417163 1426068_at 0.5728574 0.83184 0.059502 0.8981485 -0.3939261 -0.2603383 -0.0491605 -0.2149413 1426069_s_at0.8447281 1.6278855 0.5587833 1.0481632 -0.8034951 -0.8653539 -0.3143843 -0.5606893 1426072_at -0.9119337 -0.640111 -0.27573 0.5466697 0.5524331 0.2942249 0.3942123 0.6480143 1426094_at 0.1890476 -0.268085 -0.0061437 0.6051703 0.378483 0.2494268 0.8608424 1.0350275 1426102_at 0.6324973 1.6359478 0.7246053 0.8293333 -0.052855 0.0655775 -0.2394109 -0.3336423 1426114_at -0.0956507 0.2562115 0.2774558 -0.8644176 -0.2228157 -0.1843575 -1.0331227 -1.001144 1426134_at -0.0856829 -0.005664 -0.1300996 0.7522749 -6.73E-04 1.5668199 -0.0075312 0.0369973 1426142_a_at-0.2353559 -0.367801 -0.1951733 2.760684 0.4152767 2.8756135 0.1181843 0.6153653 1426143_at -0.1968162 -0.391924 -0.2181474 1.9050667 0.4998488 2.599779 0.0945608 0.2006958 1426144_x_at-0.3619697 -0.393523 -0.2347932 2.3773837 0.6397404 3.0776687 0.2220543 0.3433553 1426147_s_at1.0499787 0.6741937 0.3378154 -0.4313242 -0.2157145 -0.5774461 0.0377498 -0.0577122 Page 93 of 205 Diabetes

1426172_a_at-0.2557725 -0.684152 -0.3388845 0.7539592 0.4972067 0.4160037 0.4541656 0.4190958 1426174_s_at-0.2983071 -0.494588 0.0658624 0.7007358 0.9774912 0.2574713 0.2984328 0.8325129 1426183_a_at-0.6438841 -1.045151 -0.5458881 0.8234305 0.3699301 0.7503605 0.5800985 0.7130753 1426210_x_at-0.4223325 -0.805979 -0.1347754 0.4204969 0.2314438 0.567584 0.2379596 0.3742717 1426215_at 1.1641091 1.058172 0.2898648 -0.614012 -0.1818831 -0.4370819 -0.2764009 -0.2759334 1426218_at -0.3986759 -0.584032 -0.1794783 0.2951319 0.1562445 0.3044142 0.6959788 0.568525 1426224_x_at0.4527653 3.8365185 -0.284523 0.684998 0.930464 0.5153442 2.083115 -0.3478906 1426225_at -0.8832851 -1.233348 -0.4435775 0.2685685 0.3334703 0.2732359 0.2583424 0.372187 1426237_at -0.1262469 -0.549862 -0.2860276 0.1896009 0.1473149 0.1413248 0.4895434 0.7355493 1426243_at 1.1220009 1.731924 0.775377 0.4443235 -1.3078253 -0.6136131 -1.12916 -1.0571135 1426251_at 1.08576 0.0223848 0.3142917 0.1208835 -0.2266506 -0.2977719 0.2775351 -0.0538325 1426268_at 2.2072525 3.2862043 2.5581183 1.7926478 -0.9608844 -0.512988 -0.2811054 -1.5568236 1426288_at 0.8959967 0.9699479 0.1279401 0.0214789 -0.5056955 -0.4214839 -0.121847 -0.085736 1426298_at 0.2494865 0.5947768 1.4378386 -0.0559299 -0.0759193 -0.2600532 0.0370755 -0.3493802 1426308_at 0.0589881 1.0963846 -0.1480631 0.0794227 -0.0711486 -0.1022594 0.3676828 -0.150542 1426309_at 0.0529189 1.4970329 -0.110949 0.3224821 0.2386648 0.1820398 0.5408807 -0.0981488 1426317_at -0.1893091 2.6009738 -0.4282943 0.4904809 0.6761508 0.6055322 1.3162559 -0.3818064 1426332_a_at0.8889979 0.9755331 0.0873036 0.5404768 -0.5169314 -0.7157728 -0.3533084 -0.4324945 1426340_at 0.3356397 -0.319964 0.0266509 -0.2571178 -0.0307322 -0.6473557 0.3247547 0.3738035 1426353_at -0.1657372 -0.535042 -0.1854556 0.8341746 0.3396564 0.5967161 0.6978121 0.8227463 1426369_at -0.3386712 0.0657854 1.0066836 -0.011167 0.0337561 0.0569891 -0.0738188 -0.0246013 1426370_at -0.5221199 0.2140384 0.8044745 -0.2082334 0.0331615 0.0482466 -0.0424247 -0.3245384 1426371_at -0.5060475 -0.087116 0.8919663 0.0902796 0.1146477 0.0212498 -0.0390387 0.0793158 1426376_at -0.6274929 -1.054916 -0.5227039 0.7403455 0.4321531 0.6509436 0.5435394 0.5687997 1426403_at 0.4273737 -0.396462 -0.3285571 0.45822 0.1424013 0.0698643 0.6759507 0.7764298 1426434_at -0.3458788 -1.272759 -0.6172361 0.4722133 0.2441793 0.2464026 0.676926 0.8351558 1426435_at -0.6265762 -0.95245 -0.2545977 0.2578178 0.2700957 0.5698713 0.0055707 0.1353232 1426456_a_at0.1887116 1.2615948 -0.0702708 -0.0783696 0.1912203 0.0122122 0.6400976 -0.0775016 1426464_at 0.4512706 -0.075784 -0.017329 0.0622814 0.0937683 0.0013659 1.1595396 0.8066629 1426499_at 0.3163296 -0.445128 -0.1106783 0.4807096 0.2335573 0.2997665 0.7309752 0.8900541 1426502_s_at-0.5431173 -1.581221 -0.6360338 0.7622347 0.4464853 0.8134056 0.6460934 0.9950702 1426513_at -0.2008917 -0.555441 -0.3754567 1.2500024 0.6303982 1.0849946 0.7351754 1.1077452 1426530_a_at-0.878515 -0.75739 -0.3803713 0.1859551 0.1638781 0.2170233 0.2299836 0.2182725 1426547_at 2.3808134 4.1997643 -0.040172 1.8455244 -0.1171718 -0.0130321 0.0449244 -0.2515999 1426557_at -0.0588695 1.0776491 -0.0674529 -0.0603588 0.0178144 0.010009 0.6670391 -0.3687987 1426562_a_at-0.4248991 -1.339352 -0.5682883 0.9981146 0.7510554 1.1180757 0.4750023 0.7384027 1426569_a_at0.7475852 1.1508917 0.4577333 -0.0091977 -0.6531191 -0.7267199 -0.2074954 -0.4385301 1426570_a_at0.7327863 1.1985934 0.2443432 0.2314642 -0.2689875 -0.4671237 -0.0365057 -0.3017066 1426575_at -0.6007108 0.3916894 -0.6277829 0.0709639 0.0336933 0.1235173 0.1826611 -0.0702902 1426603_at -0.4020441 -0.405926 -0.2317036 0.5984426 0.383606 0.6506087 0.3788757 0.2414354 1426606_at -2.1116743 -1.942729 -1.1213648 1.5392809 0.8065931 1.5352463 1.3761622 1.6825962 1426607_at -0.4365412 0.5997757 -1.2600865 -0.0112405 0.032866 -0.4442124 0.7091643 -0.0291058 1426615_s_at0.4893894 1.0989971 0.1119034 0.5447917 -0.2140564 -0.2247973 -0.1862447 -0.4410397 1426621_a_at0.6623057 1.8375437 0.0998265 0.1607823 0.0437019 -0.042864 0.8671999 -0.1817266 1426633_s_at0.5254197 0.9579499 -0.0679202 -0.5372312 -0.4069461 -0.4662778 -0.2050659 -0.5671892 1426657_s_at -0.444 -1.121654 -0.7977097 1.4322658 0.7296667 0.8742905 1.0848093 1.5005909 1426658_x_at-0.5463953 -0.987898 -0.6664898 1.0863242 0.5030766 0.7347452 0.758455 1.0289608 1426663_s_at0.4969188 0.4547 0.3157036 -0.1942587 -0.1997304 -0.4314795 0.3983688 0.6608763 1426677_at -0.369025 -0.472293 -0.3402226 0.8603807 0.2883225 0.4096613 0.6454744 0.5364927 1426806_at -0.3526979 -0.970555 0.0204227 -0.2705555 0.1311356 0.1662621 0.1344159 0.4454832 1426817_at 0.5363567 0.1335596 0.2319078 -0.3413096 -0.2330212 0.1601633 -0.7637935 -0.5414696 1426832_at 0.2263441 0.9681697 0.6681321 -0.3191948 -0.2397755 -0.2135634 -0.0617018 -0.0658417 1426851_a_at-0.6728171 -1.183446 -0.4989039 0.7413054 0.4380497 0.2608757 0.5612543 0.4947918 1426852_x_at-0.7321326 -1.092882 -0.5368743 0.6514049 0.382476 0.1315108 0.3767719 0.2975175 1426864_a_at0.7165886 1.6210713 0.5932542 0.6333206 -0.7690269 -0.9356129 -0.4601027 -1.3306111 1426865_a_at0.8122276 1.7945751 0.6396786 1.0066485 -1.1534572 -1.1785119 -0.372929 -1.196251 1426876_at -0.7639628 -0.625443 -0.2487854 0.986126 0.360655 0.6513925 0.3597641 0.6351166 1426887_at 0.6200508 1.2210394 0.6796781 0.0489955 -0.1467998 -0.6611424 0.1646231 -0.6299992 1426892_at -0.6835468 -0.523641 -0.1949973 0.506738 0.439355 0.1999811 -0.0069127 0.2422044 1426904_s_at0.6507804 1.451891 0.3778107 0.5585628 -0.327631 -0.2388561 -0.2180328 -0.3177757 Diabetes Page 94 of 205

1426905_a_at 0.642092 1.5358961 0.3926108 0.8104525 -0.4225765 -0.3632833 -0.3040972 -0.3577738 1426911_at 1.5697881 2.5514545 1.9512943 1.1018064 -0.2690002 -0.0868363 -0.1396396 -0.2140877 1426914_at 0.8811504 1.3653975 0.6038587 0.043807 -0.4818234 -0.253172 -0.1915296 -0.2257525 1426930_at 0.2002317 0.9613797 -0.0907333 0.491586 -0.3203197 -0.267175 -0.055579 -0.1614652 1426934_at 0.3040043 0.9370339 -0.0350822 0.0550697 -0.2978512 -0.4578404 0.2267664 0.0229314 1426941_at 3.615138 6.377976 2.3967052 2.949751 -0.1444813 -0.1771779 1.4329122 2.0219111 1426960_a_at -0.03692 0.3542383 0.9347733 -0.0708005 0.0626602 -0.0892387 0.3515399 -0.233432 1426981_at -0.2261984 -0.881121 -0.2725389 0.7392712 0.5523466 0.2828167 0.7728806 0.9896819 1426998_at -0.0132177 -0.626543 -0.2691066 0.9378176 0.3366819 0.4170372 0.9266818 0.9842339 1427000_at 1.2815764 0.165771 0.1493698 -0.0436289 0.0586073 -0.1225606 -0.0136409 -1.01E-04 1427008_at 0.9587932 1.2279798 0.3834775 0.2275395 -0.1980811 -0.2578717 -0.0900266 0.0289547 1427018_at -0.0409046 2.5863867 0.0523669 0.7210846 0.2750399 0.2005072 0.9419627 -0.6937111 1427026_at -0.0558686 -0.065898 -0.0562336 0.3955089 0.0087521 0.0723729 1.1298245 1.935412 1427029_at -0.5929289 -0.815268 -0.4514597 1.2154317 0.5941445 0.890234 0.6062031 0.7040393 1427034_at 0.1067863 0.8952317 -0.1127631 -0.0280037 -0.1437525 -0.1028706 -0.0026978 -0.0898023 1427037_at -0.6813071 -0.525455 -0.5882071 0.6290841 0.1812545 0.087934 0.1905079 0.4054507 1427040_at -0.6577122 -0.622059 -0.1190128 0.6902075 0.4585968 0.8100039 0.383955 0.379995 1427046_at 0.7801812 1.4593287 0.3241866 0.2590845 -0.68546 -0.4441156 -0.2912515 -0.1212513 1427048_at 0.3328769 -0.619549 -0.2115028 0.6588311 0.313419 0.1245015 0.8336086 0.888849 1427063_at -0.1002399 1.2113134 -0.0138199 0.1465225 0.3446966 0.0091296 1.2878318 -0.2218892 1427077_a_at-0.3896772 0.5698197 -0.4455065 0.1333547 0.251778 0.1122973 0.5617352 0.0036532 1427095_at 0.8628131 1.4858423 0.7052198 0.4976621 -0.8779544 -1.2007658 -0.7706487 -0.5780354 1427100_at -0.3973529 -0.541272 -0.4328483 0.7091575 0.4918286 0.7100216 0.5341446 0.7396894 1427102_at -0.2087307 -0.006754 0.843195 0.0698071 0.0944769 0.0254471 -0.3630932 -0.4126722 1427122_at -0.2888792 -0.613134 -0.2986778 1.2838347 0.0457526 0.4774806 1.2120007 1.3523184 1427123_s_at-0.8630589 -0.693452 -0.5389161 0.4557428 -0.0075119 0.3352694 0.3557854 0.5640395 1427126_at 0.003454 0.4057717 -0.0905349 0.5571871 0.2709664 -0.529615 0.0254806 -0.0591908 1427133_s_at 0.945056 1.0277632 0.5795691 0.1700332 -0.1128939 -0.6607271 -0.282818 -0.8880364 1427161_at 0.4917911 1.1213274 -0.2077352 -0.1817563 0.0348138 -0.0498069 0.3370903 -0.6051507 1427167_at 0.6648407 0.0254303 0.2782912 -0.5502534 -0.2283708 -0.3491305 -0.3596953 -0.3071837 1427168_a_at-0.078377 -1.018218 -0.0514579 0.4977341 0.1500715 0.2116486 0.1329985 0.1286319 1427170_at -0.3812246 2.3972366 -0.1970552 0.1533794 0.8533615 0.5590591 1.1269401 -0.2068795 1427178_at 0.8223926 0.9719738 0.2207592 -0.1296136 -0.5307639 -0.8668163 -0.0446844 -0.2392101 1427191_at 0.0458455 -0.5301 -0.2046888 0.4293013 0.184276 0.194752 0.7183411 0.8857665 1427196_at 0.7230922 1.2949349 0.3282149 0.2955663 -0.4317482 -0.5134961 -0.0193866 -0.4904687 1427201_at -0.2650492 -0.704921 -0.3596273 1.0649886 0.5825289 0.6494597 0.4165932 0.561753 1427220_a_at 2.824537 3.820364 0.3292055 -0.222612 -0.034999 -0.3067293 0.4909912 -0.2587245 1427221_at 0.9541589 0.4252418 0.4630798 -0.3096837 0.0756058 -0.1814559 -0.007669 -0.2473123 1427222_a_at2.7374644 2.8907602 -0.1416955 -0.0511663 0.05677 0.0370149 -0.0793239 -0.021071 1427225_at -0.8551474 -0.355017 -0.1058371 0.5187225 0.2349037 0.4954472 0.105526 0.198314 1427226_at -0.3174046 -0.407189 -0.090376 0.8248048 0.4084598 0.5868063 0.5507555 0.5846313 1427228_at -0.77543 -0.913073 -0.2362206 0.5252719 0.324267 0.4843489 0.159229 0.211902 1427229_at 0.2325211 0.5987493 1.4580457 -0.1109505 -0.1993556 -0.1428674 0.1336587 0.0767981 1427231_at -0.3489432 -0.714581 -0.275207 0.7466154 0.2167417 0.4509488 0.2837606 0.4446558 1427239_at -0.2721516 0.4634458 -0.6981895 0.0517867 0.1045053 -0.2451048 0.8860498 0.0347746 1427242_at 0.1219675 4.2963824 -0.2620035 0.6621851 1.4458854 0.9091322 1.9527764 -0.2412913 1427247_at -0.1426197 -0.165219 -0.1585012 0.4147073 0.0272151 1.2432799 0.116383 0.0358593 1427252_at -0.1440278 2.3130841 -0.2859986 0.1528611 0.381012 0.0217972 1.0662347 -0.6497456 1427261_at 0.9359512 1.4830214 0.3410789 0.3772116 -0.5622951 -0.9791763 -0.3964674 -0.6286831 1427277_at 0.0447062 -0.911753 -0.2528876 0.1872273 0.399477 -0.1151207 0.8269795 0.7955625 1427284_a_at-0.4482929 -0.628853 0.4664538 -0.2150493 0.0638773 0.3949494 0.0920528 0.2900957 1427291_at -0.0987916 1.8943129 -0.1324058 0.0553733 0.6668699 0.0848767 1.0383146 -0.0987089 1427305_at 0.5269653 1.3935689 0.5419295 0.4993155 -0.3439108 -0.375272 -0.3501204 -0.320392 1427306_at -0.2267269 -0.500385 -0.5123352 0.5020595 0.3095512 0.5079228 0.3812226 0.4788826 1427320_at -0.9109982 -0.670428 -0.465596 0.4708896 -0.0163244 0.3057253 0.4053869 0.5682904 1427321_s_at0.1805502 0.2062924 0.4191066 -0.4477897 0.0309648 -0.2577949 -0.5057592 -0.6415675 1427324_at -0.0297103 -1.210094 -0.3471639 0.4864593 0.236038 0.1966604 0.478062 0.8398066 1427329_a_at-1.4849291 -1.673688 -0.6788423 0.4177761 0.4599039 1.2556505 0.1348565 0.313866 1427339_at 0.7797786 2.023932 -0.0871228 -0.1380537 -0.5263879 -0.8636578 -0.2130311 -0.7531953 1427346_at -0.4831549 1.5112733 -0.0852306 -0.0244267 0.4410276 0.256669 1.1156 -0.4283405 Page 95 of 205 Diabetes

1427351_s_at-1.6796854 -1.414014 -0.4701514 -0.0146093 0.5048119 1.2850306 0.0314636 0.1899951 1427352_at -0.2167467 -1.017113 1.2437564 0.8270841 0.444436 0.5885394 -0.15974 0.2203748 1427355_at 1.4092512 0.9767823 0.5176677 -0.3324547 -0.0251275 -0.4375891 -0.3364849 -0.2396286 1427357_at 0.9190686 0.0603672 -0.0074801 -0.5020373 -0.1162522 -0.1504238 -0.2498147 -0.073356 1427374_at -0.0763884 1.2402242 -0.0641583 -0.1010215 0.1704525 0.1827488 0.7202158 -0.1608168 1427386_at 0.716437 1.1962278 0.4214312 0.3086593 -0.5680744 -0.5793238 -0.4184958 -0.4625797 1427404_x_at0.0308108 -0.554949 -0.3926361 0.692173 0.3039022 0.4430159 0.5541614 0.6332248 1427421_at -0.023771 2.527628 0.033493 0.2480671 0.2898371 0.1283817 1.1358262 -0.2742455 1427425_at 0.6215 1.5788977 1.0105958 -0.6094604 -0.0774254 -0.2974941 -0.8617029 -0.3474986 1427427_at 0.0519391 1.0876845 0.3770169 0.1742294 -0.2646378 -0.3238394 -0.0458225 -0.3282736 1427430_at -0.0823041 0.7979208 -0.3072975 -0.0424888 0.1447454 -0.0981214 0.2470605 -0.1228024 1427447_a_at0.1221168 -0.233545 -0.1870973 0.5279088 0.2204239 0.2669748 0.817612 0.8129342 1427455_x_at-2.2286773 -1.764375 -0.7275696 -0.2322412 0.1779728 0.8591291 0.2859522 0.3149516 1427477_at 0.2221025 0.2133093 1.0903236 -0.1114502 -0.007994 -0.0349886 0.0619478 -0.1019917 1427482_a_at-0.2452079 -0.939472 0.1382006 0.5719614 0.3652987 0.2506299 0.8671961 1.1596535 1427492_at 0.0736064 0.1895255 1.2324921 0.0087303 -0.1043253 -0.0451995 -0.0841601 -0.015964 1427507_at -0.1285307 1.1949455 0.0829583 -0.0219474 0.2553772 0.1501955 0.3985505 -0.2620138 1427537_at 0.1568217 1.036267 0.3656117 0.0516746 -0.2303995 -0.6927524 -0.1237775 0.0221701 1427547_a_at0.2648008 1.1434442 0.2194166 -0.4392965 -0.3947912 -0.4431828 -0.6057559 -0.6802853 1427604_a_at-0.1976312 -0.369173 -0.4013269 1.0798321 0.3958612 0.5899593 0.919912 1.0807753 1427612_at 2.4505682 3.0024276 2.2605977 1.9870462 -0.1955564 0.171699 -0.1483249 -0.2212485 1427626_at -0.0071378 1.6005708 -0.1252688 0.3902321 0.076754 -0.0487536 -0.2251649 -0.0354902 1427660_x_at-2.0365393 -1.535867 -0.7257509 -0.1293721 0.0136679 0.5315878 0.2251263 0.2532463 1427682_a_at0.5039307 1.390248 0.4032338 -0.2778211 -0.7034408 -0.2919281 -0.655505 -0.1791061 1427683_at 0.5407419 1.3230847 0.3615966 -0.1936195 -0.8510876 -0.2956959 -0.7420809 -0.0613133 1427715_a_at0.0957363 3.732921 -0.4578008 0.8669369 0.8941792 0.9044695 1.5793921 -0.485665 1427735_a_at-2.303186 -1.92407 -0.2488246 0.9069181 1.1942068 0.2260859 -0.1727581 0.5297718 1427747_a_at1.2935736 1.6542623 0.5727835 -1.3312454 -1.073136 -1.4006306 0.1261621 -0.6214331 1427772_at 1.3560164 4.29727 -0.0682898 1.1212437 2.54E-04 -0.0742417 0.6801507 -0.1300538 1427775_at 1.1809831 3.1028783 0.577783 1.6970034 -0.1538149 -0.1990326 -0.3007314 -0.3823968 1427780_at 1.681059 4.354877 0.3739661 0.9004812 -0.0510701 -0.1056861 0.3535344 0.8967457 1427784_at 0.5336692 2.047527 0.0033264 0.4750733 0.0029225 -0.1362832 -0.0343005 -0.0531592 1427790_at -0.2584781 1.4140255 -0.1552566 0.0386093 0.3815236 0.266535 0.7909057 -0.1689569 1427797_s_at1.0715351 1.244573 0.4311836 0.2972636 -0.2394726 -0.3931285 0.2318813 -0.21935 1427820_at -0.3332399 0.4084258 0.4458455 0.0087838 -0.6228663 -0.5508983 0.2276171 0.2102346 1427866_x_at-0.2616317 -0.874073 0.1636891 -0.0758188 0.1647892 -0.025071 0.1462569 -0.1481136 1427878_at -1.2567611 -0.761757 -1.0056591 0.4854946 0.1384241 0.3237659 0.165657 -9.89E-04 1427893_a_at1.3342845 0.7380135 0.5505183 -0.2344613 -0.1397211 0.0198534 -0.2344192 -0.0976235 1427910_at 0.2514871 -0.139409 3.5425248 -0.1046772 0.401514 0.0491936 -0.3065755 -0.3347665 1427919_at -0.8102135 -1.521781 -0.723376 1.1706667 0.6917677 1.0135098 0.5284872 0.7139489 1427937_at -0.6246845 -0.513701 -0.3590143 0.3815527 0.3157639 0.390921 0.1402887 0.2622773 1427943_at -0.4000478 -0.7873 -0.1703157 0.3865867 0.2979048 0.368368 0.0784483 0.2159739 1427945_at 0.927057 0.841778 0.3579216 -0.2849698 -0.0908814 -0.4475869 0.0041989 0.068827 1427946_s_at0.7266586 0.6732307 0.3607948 -0.2812028 -0.135103 -0.4659454 0.0202595 -0.0021582 1427957_at 0.1860368 -0.716622 0.4740098 0.0585704 0.1411299 -0.0098646 -0.0890643 0.0242163 1427963_s_at1.1505064 1.4259297 2.187808 0.3553911 -0.4317885 -0.3918796 -0.309587 -0.4199468 1427964_at 0.782783 1.066726 0.4185582 0.3320634 -0.2177136 -0.2577121 -0.5109201 -0.4073787 1427975_at 1.194949 1.3649999 0.1133729 0.2860203 -0.1524892 -0.4550282 -0.1645424 -0.1470547 1427989_at -0.8178959 -0.260277 -0.6777254 0.3821404 0.1672208 0.3016925 0.639235 0.3087115 1428001_at -0.2741908 -1.31823 -0.3282367 0.3712006 0.518734 0.4405875 -0.0916781 0.3188073 1428004_at -0.6251519 -0.46955 -0.6447355 0.4659958 0.2737644 0.6830551 0.0611375 0.1425823 1428005_at -0.4473783 -0.684436 -0.5157213 0.72822 0.3500168 0.5938559 0.0941086 0.2180723 1428014_at -0.883099 -1.071449 -0.690547 0.7517071 0.9702641 0.8591879 0.1577199 0.2908484 1428021_at 0.5002736 0.1802394 0.1814019 -0.5745502 0.0698564 -0.1997762 -0.4572608 -0.1384146 1428036_at -0.3954938 -0.807873 -0.3931493 0.7979639 0.4441948 0.864832 0.4252687 0.7441028 1428057_a_at-0.6460402 -0.761023 0.1100323 0.1802864 0.1725283 0.2301025 0.3830913 0.4534464 1428058_at -0.6860435 -0.932838 0.0177666 0.1113572 0.0662086 0.2095392 0.3331782 0.4071611 1428067_at 0.0626267 -0.506921 -0.2127805 0.3489757 -0.089564 0.2486226 0.8424466 1.0821749 1428071_at 0.9341333 0.6025579 0.4659994 -0.2904902 -0.0556984 -0.3194509 -0.0454423 0.1385183 1428111_at 1.6705538 2.490274 1.2999638 1.1890788 -0.735167 -0.762602 -0.605846 -0.7668912 Diabetes Page 96 of 205

1428140_at -0.7117834 -0.787255 -0.3220842 0.4167323 0.4046869 0.5462033 0.0754509 0.1611773 1428160_at 0.8658915 -0.124779 0.2201109 -0.1496992 0.1176114 0.1141181 -0.240653 -0.0112205 1428189_at -0.2030407 0.7451447 -0.5285094 -0.0903466 0.1855818 0.208171 0.6201676 -0.0608535 1428209_at 0.6768996 2.3980706 -0.2533333 0.3119774 -1.2055904 -1.3531101 -0.6160997 -1.2311038 1428279_a_at-0.2022742 -0.726358 -0.1631001 0.5686641 0.3977228 0.3634462 0.2603871 0.3772977 1428301_at -0.6786553 0.4800854 0.2851234 -0.5568576 -0.1407435 0.1915154 0.1516156 -0.2974644 1428319_at -0.5029043 -0.810058 -0.2401719 0.7234936 0.385054 0.3040527 0.4715996 0.547224 1428333_at -0.0378902 -0.901702 -0.2295647 0.1035581 0.2058029 0.2291626 0.3413919 0.4890919 1428357_at -0.6007292 -0.817785 -0.2374842 0.1177611 0.1852989 0.2000942 0.1716112 0.3169235 1428455_at 0.3750221 -0.650432 0.1134459 0.6867433 0.092316 0.2210733 0.3410497 0.4350313 1428469_a_at0.1913281 0.7410311 -0.3274986 -0.1783972 0.1120382 -6.34E-04 0.9982584 -0.0983454 1428472_at -0.4302431 -0.677033 -0.3877864 0.6845608 0.2806489 0.1449679 0.343524 0.1680376 1428485_at 0.2037431 0.7820079 0.1216475 0.4451883 -0.2756975 -0.0049244 -0.4730239 -0.1657108 1428511_at 0.0338705 1.1375301 -0.4722451 0.2334137 0.0888944 0.0690096 0.9440301 -0.0351664 1428529_at 1.1829612 0.8036737 0.8171978 -0.6129704 -0.1612887 -0.5571261 -0.1885567 -0.0806281 1428572_at 0.6534352 1.1838257 0.2998838 0.4576778 -0.326808 -0.3859886 -0.1241045 -0.4886316 1428574_a_at-0.113457 2.795852 -0.2733818 0.6028309 0.5623319 0.670166 1.3517618 -0.5815771 1428580_at -0.5419595 -0.733936 -0.1829209 0.4513202 0.2992718 0.6588293 0.1437448 0.2674071 1428664_at 0.2533625 0.3606156 -1.22E-04 -0.0298508 0.0673173 -0.1481434 -0.018186 1.2951169 1428667_at -0.5678506 -0.763551 0.1283 0.3239331 0.4534687 0.7251059 -0.0894629 -0.1410297 1428669_at 0.2715217 0.0047033 -0.3202462 0.275578 -0.0739922 0.1039206 0.4058089 0.7342078 1428751_at 0.2093012 2.5152633 -0.0406879 -0.0184586 0.3405255 0.0833477 0.9590561 -0.8649076 1428781_at 0.8428311 -0.389365 1.5879717 0.1452065 0.396022 -0.1228846 -0.1613315 -0.7375546 1428835_at -1.0042467 -1.022384 -0.7468183 0.847219 0.3804887 0.4989137 0.4668446 0.6635121 1428842_a_at0.6647544 1.0243113 0.2462614 -0.0762343 -0.3754492 -0.4276508 -0.1742503 -0.4710436 1428942_at -0.3159745 0.2358253 0.1314876 0.3398385 0.0572477 0.2274775 -0.7231172 -0.8311036 1428988_at -0.2498481 0.6264989 -0.5682726 0.4505034 -0.1397895 -0.1366071 0.2717277 0.1760915 1428995_at -0.0723287 0.9051228 -0.1436245 -0.09374 0.1594711 0.0999344 0.6717267 -0.2030891 1429086_at 1.1238558 1.8178438 0.5746402 0.4525633 -1.2924289 -1.4473013 -0.6781443 -0.5853546 1429110_a_at-0.0516336 0.681809 -0.3316964 -0.1249661 0.1554399 0.0186011 0.4730387 -0.0980341 1429171_a_at0.2080778 0.8252934 -0.2708548 -0.1916559 0.0484661 0.0520622 0.3546755 -0.2008491 1429183_at -1.5750644 -1.258253 -0.8709252 0.4844961 0.2798437 0.3655287 0.3006805 0.4878763 1429212_a_at-0.0351374 0.9675195 -0.2946122 0.0619903 0.2092158 0.0453111 0.4493775 -0.25115 1429244_at 0.4658496 0.9152556 -0.0445566 0.0155902 -0.5888855 -0.2440969 -0.0726439 -0.2377547 1429246_a_at-0.7478596 -0.858519 -0.4006175 0.6298666 0.4922138 0.7064968 0.26056 0.633095 1429247_at -0.7575765 -0.142235 0.2657846 0.1268938 0.4225004 0.7042025 -0.1482666 0.3150407 1429270_a_at0.0599631 1.3769302 -0.286441 -0.1262088 -0.0708698 -0.0770429 0.4542929 -0.4216142 1429292_a_at-0.1018982 1.013048 0.403325 0.1721189 -0.3156331 -0.2039795 -0.2116176 -0.5401926 1429321_at 0.4912539 1.56669 0.123565 -0.2933726 -0.3220102 -0.2704458 -0.5173051 -0.1951733 1429349_at 0.367701 4.801456 -0.2556469 1.2423255 1.015896 1.0909864 2.0265636 -0.4713738 1429381_x_at-0.4126394 -0.394452 0.7482379 0.3945456 0.0876316 0.0751186 0.7108717 0.6604831 1429400_at 0.2383863 1.0620711 0.339623 0.1943245 -0.2126562 -0.1568275 -0.3022343 -0.2620743 1429457_at 0.0715456 -0.234395 2.3281727 0.1309409 0.0363745 0.0242887 -0.1685572 0.0356065 1429569_a_at0.0408605 1.46753 -0.2211268 0.1736808 0.1702602 0.0931418 0.9706748 -0.1884192 1429574_at 0.6575437 0.7199543 0.5330408 0.47633 -0.397944 -0.3198287 -0.4477366 -0.6893131 1429721_s_at-0.1490609 1.2085321 -0.1565722 -0.1322132 0.4342329 0.0864867 0.7127168 -0.1106854 1429752_x_at-0.0442849 1.2554284 -0.2003268 0.1196144 0.2384304 0.2056019 0.6489725 -0.1502522 1429768_at -0.5884197 -0.427864 -0.4637706 0.1271141 0.4199812 0.3680853 0.4873401 0.4473297 1429775_a_at-0.5002202 -0.761657 -0.473449 0.4548481 0.5227667 0.5263434 0.1688248 0.3330156 1429777_at -0.0882129 1.312465 -0.2247859 -0.0386474 0.3025831 0.1083184 0.66644 -0.4522743 1429830_a_at-0.7007246 -0.762402 -0.3647687 0.6965795 0.5571331 0.7269039 0.3522965 0.3942572 1429859_a_at0.0716434 1.0849552 -0.2937342 -0.0149274 0.2397846 0.1505724 0.4984856 -0.2239323 1429894_a_at-0.064073 0.6935457 -0.3335512 -0.1717396 -0.0418944 -0.0159725 0.1195978 -0.0854454 1429981_a_at-0.0378141 0.800275 -0.2681685 -0.0339549 0.0787564 -0.0097878 0.3664959 -0.0893307 1429982_at -0.0725473 1.4644858 -0.2443759 -0.1271234 0.1423087 0.0905583 1.0381833 -0.1987197 1430007_a_at-0.0177575 1.3478582 -0.1072048 0.3845036 0.0925132 0.2619546 0.7014187 -0.1695333 1430127_a_at0.2807305 -0.769183 -0.3271742 0.203692 0.0361549 0.2760937 0.0976222 0.3086961 1430167_a_at1.2399267 0.4456525 0.9066002 -0.9309661 -0.2967389 -0.9861612 0.1149195 -0.3389883 1430240_a_at-0.0495657 2.7015476 -0.2449364 0.4279795 0.7669286 0.2210366 1.4689322 -0.2355208 1430283_s_at0.0738156 1.2633401 -0.0599349 0.037033 0.125448 0.2091161 0.9271235 -0.1138018 Page 97 of 205 Diabetes

1430306_a_at0.4997076 0.9631698 1.0141748 0.4519103 -0.168664 -0.0752909 -0.2489344 -0.1969158 1430332_a_at-0.0582969 -0.486169 -0.4350793 0.4742467 0.3630702 0.6305947 -0.0327237 0.075363 1430523_s_at-1.0836074 -1.361494 -0.1053389 0.3798659 0.2894165 0.5197533 0.1395562 0.9343448 1430773_a_at0.0516408 1.0157822 -0.0032476 0.1799884 0.0984786 -0.0382145 0.6238127 -0.1400588 1430780_a_at0.8913622 0.0311347 0.0370895 -0.121016 0.010493 -0.2160923 0.0954819 0.3115335 1430811_a_at0.1846573 0.9404192 -0.2352048 -0.5381713 0.05465 0.0574021 0.3186801 -0.6628203 1430820_a_at0.1148891 0.8648713 -0.1107976 -0.1194 -0.1493007 -0.224359 -0.1246915 -0.4589768 1430838_x_at-0.1725872 0.527011 0.1138321 0.4546094 0.1208783 0.2834115 -0.6962435 -0.083749 1430970_a_at0.1067156 1.267404 -0.1456945 0.0114083 0.1011284 0.1544049 0.5123572 -0.2547166 1431028_a_at 0.812765 1.6649445 0.564716 0.1325858 -0.8187607 -0.9769758 -0.3058782 -0.6585927 1431099_at 0.4904232 0.8741503 0.1130736 -0.204464 -0.3698597 -0.4345591 -0.0115792 -0.1888008 1431119_at -0.9407198 0.0869863 -1.0728822 0.3589642 0.195993 0.3364294 0.6020582 0.0529734 1431166_at 0.5516342 0.5195477 0.4214679 -0.6530802 -0.3422842 -0.4042178 -0.3165307 -0.4305258 1431182_at -0.4823742 0.4754912 0.5562577 -0.1588838 0.4400308 -0.1828371 0.2404618 -0.089836 1431213_a_at0.7424069 1.1621163 0.2101128 0.2913418 -0.8553059 -0.7066469 -0.4727723 -0.7594703 1431214_at 0.9880383 1.4403697 0.5559559 0.0994728 -0.5118843 -0.7102378 -0.1155438 -0.2498695 1431231_at -0.4074668 -0.789982 -0.7037966 0.5292573 0.7222246 0.4182009 -0.107302 0.171642 1431415_a_at0.0329692 0.9920857 -0.0742972 0.0296879 0.1463337 -0.059903 0.4396833 -0.3775466 1431609_a_at-0.3231835 -1.098446 -0.3111098 0.3354216 0.1683998 0.1884647 0.3606491 0.4094054 1431644_a_at 0.020722 0.9234699 -0.3208187 -0.0718145 -0.0437711 -0.0121117 0.0927231 -0.5239596 1431701_a_at 0.161018 1.5214844 -0.439886 -1.0518177 -0.9694241 -1.2091577 -0.2400689 -1.1164626 1431734_a_at-0.8241011 0.1152904 -0.5257996 0.1382527 0.3278914 0.1851112 0.326162 0.0533403 1431737_at 0.075397 0.9081602 -0.2005719 -0.0855963 -0.1450231 -0.0997094 0.2664821 -0.207307 1431741_a_at-0.0364172 1.1362159 -0.1277728 0.0358655 0.3088457 0.1214681 0.8456529 -0.1044871 1431782_s_at0.1287117 1.3750894 -0.1858457 0.0809343 0.2167359 0.1033105 0.8787375 -0.184257 1431829_a_at0.0626427 -0.051717 -0.5324738 0.523972 -0.2599933 -0.1478702 0.4580495 0.574303 1431890_a_at-0.5001339 -0.741466 -0.4740387 0.5652759 0.3081946 0.6467488 0.7513803 0.7918308 1431893_a_at0.2293289 -0.044197 2.100072 -0.3814623 -0.0745945 -0.0130999 -0.1463531 0.1435664 1431920_a_at-0.1404209 -0.972881 -0.5346417 0.6148872 0.2104485 0.6185794 0.5111244 0.5125372 1432075_a_at0.0950878 1.8462329 -0.1088839 -0.0529656 0.511099 0.1332353 0.9089944 -0.3239964 1432103_a_at-0.2127233 1.6355526 -0.6305604 0.0812507 -0.816918 -0.9348704 -0.2058902 -1.294298 1432104_a_at-0.1329709 2.1533756 -0.1967521 0.078836 0.5369377 0.3158153 1.0047289 -0.372029 1432156_a_at0.0400709 1.7849767 -0.1600676 0.0140259 0.1226353 0.0488719 0.7322288 -0.591975 1432269_a_at-0.5386643 -0.39697 -0.2830093 0.5285804 0.4773893 0.7501018 0.1385009 0.4408375 1432301_a_at0.4112927 5.3366947 -0.1554526 1.4307668 1.1571373 1.1664778 2.3120058 -0.5518144 1432344_a_at-0.4268227 -0.965783 -0.3240051 0.3737297 0.3117079 0.2177519 0.1594391 0.186705 1432436_a_at-0.3579228 -0.609996 -0.2304466 0.6911149 0.5693625 0.6713206 0.4883806 0.4894543 1432478_a_at-0.0549588 -0.134744 -0.5213593 0.6147163 0.1761167 0.0458881 1.0551478 0.6643173 1432503_a_at0.3871339 4.8892756 -0.3415347 1.1699724 1.1503863 0.8255259 2.2373033 -0.8598263 1432558_a_at1.0969229 1.6762712 0.1235367 0.3503771 -0.7843404 -1.1508806 -0.5976699 -0.5292947 1432828_at 0.0687555 1.2539525 -0.2412024 -0.0219241 0.3132548 0.0946797 0.6314402 -0.2224657 1433460_at -0.3912745 -0.868967 -0.6507986 0.742866 0.3929327 0.5412895 0.5851903 0.8162939 1433471_at 0.1867902 2.0774012 -0.196838 0.5173457 -0.1478661 -0.0398514 0.1432991 0.3747964 1433479_at -0.0629315 1.2526677 -0.0726503 -0.141042 0.1106024 -0.0349554 0.5208586 -0.3022877 1433489_s_at 0.664037 0.7681844 0.3943968 -0.6839559 -0.3550652 -0.6600029 -0.2906051 -0.41537 1433490_s_at-0.4791474 -0.686794 -0.2948787 0.4540801 0.320302 0.6370829 0.3462035 0.534009 1433491_at -0.2513598 -0.505189 -0.5708396 0.3560653 0.2370258 0.4447014 0.1796416 0.3308581 1433493_at 0.5338334 -0.558097 0.0063938 0.4466052 0.1168497 0.0958032 0.4180365 0.8975234 1433504_at -9.42E-04 -0.777409 -0.2590773 0.6261601 0.2448883 0.5609478 0.6130622 1.0052353 1433509_s_at-0.4724493 0.0789392 -0.6507726 0.1226826 0.0266629 0.0670193 0.7417777 0.445333 1433575_at 0.8562501 1.0325963 0.2968285 -0.3661523 -0.2470183 -0.3183929 -0.2342698 -0.63366 1433579_at 0.7863553 1.689934 0.7310205 0.6833162 -2.0375283 -2.6279607 -0.9487955 -1.6546329 1433598_at 0.0677534 0.7072427 0.308059 -0.3984797 -0.321867 -0.2954952 -0.3431519 -0.3355695 1433605_at -0.0681074 -0.581333 -0.3925877 0.6531673 0.3102701 0.4215964 0.5955299 0.6663138 1433639_at 0.7598779 -0.107554 0.1083171 -0.4360189 -0.2131432 -0.1186981 0.2984883 0.3643446 1433674_a_at1.0449853 0.7216477 0.8846588 -0.493381 -0.2468727 -0.5160564 -0.1784515 -0.1057186 1433675_at 1.0438817 0.7897229 0.9149602 -0.3332934 -0.2399309 -0.4978056 -0.1764972 -0.0670296 1433683_at 1.3119318 2.1154518 0.9960368 0.6124814 -0.6361774 -0.7539144 -0.4139056 -0.2765438 1433691_at -0.4428525 -0.792709 -0.0880258 0.2703161 0.4792362 0.1935587 0.1118879 0.2522001 1433720_s_at0.7730486 0.5975239 0.4196651 -0.885633 -0.5686892 -1.4946789 -0.3465074 -0.4818471 Diabetes Page 98 of 205

1433750_at 0.7517762 0.9088402 0.3433079 -0.0079081 -0.4526772 -0.2717293 -0.307985 -0.3459171 1433783_at 0.7355512 -0.773739 0.2499605 -0.0616481 -0.0190242 -0.0400344 -0.1019754 0.3683454 1433844_a_at-0.6811465 -0.849714 -0.4435391 0.9183376 0.5294582 0.4691966 0.3282218 0.1543667 1433845_x_at-2.5714443 -2.210527 -1.4094582 1.5430307 0.7473913 0.9170216 0.5375168 0.3373381 1433855_at -0.7288311 -0.924933 -0.79794 1.2653227 0.8946348 1.2576959 0.3987837 0.4970379 1433883_at -0.6433411 -0.404602 -0.1791055 0.4212613 0.3564711 0.4626665 0.0901216 0.0437822 1433893_s_at0.2461302 1.5215428 -0.0166384 -0.2525013 0.171536 0.1021805 0.7222471 -0.142813 1433904_at 0.0748315 1.9478039 -0.4037669 0.0014117 0.143539 0.0071754 1.2122078 -0.1337641 1433906_at 0.8441913 -0.415178 0.3057329 0.1582778 0.1859274 -0.011008 -0.1325574 -0.0376134 1433966_x_at0.3777564 -0.063886 0.0755978 -0.6491346 -0.0928501 -0.4671303 -0.1849108 -0.0602229 1434025_at 0.6407315 0.2995025 0.3983678 -0.1626215 -0.357288 -0.9557846 -0.1646028 -0.6399269 1434087_at -0.7600608 -0.411428 -0.139931 0.2963047 0.3038906 0.5054161 0.0473471 0.0823927 1434099_at 0.8144759 0.3742222 0.3193979 -1.2040994 -0.5231822 -0.786239 0.2018099 0.2849962 1434100_x_at0.7200003 0.1971322 0.4061393 -1.1647708 -0.5214785 -0.6911321 0.1919888 0.290295 1434196_at 0.9896028 0.4267781 0.2276843 -0.2294862 0.1373333 -0.1340602 -0.0918988 0.064074 1434227_at 0.066362 -0.407673 2.0926707 0.4343813 0.0591561 0.0373233 0.7237847 0.6764458 1434256_s_at0.6655591 0.4361806 0.3570168 -0.1659088 -0.1529423 -0.1816765 -0.4883839 -0.3748578 1434273_at -0.4750646 -0.553932 -0.7656181 0.9039836 0.7937128 0.9153306 0.7209947 0.397374 1434279_at -0.715156 0.1123208 0.8904916 0.1167574 -0.1570421 0.1298173 -0.1068996 -0.1958634 1434280_at -0.6708179 0.1172019 0.8033847 0.0916336 -0.0765631 0.1503224 3.43E-05 -0.0919428 1434291_a_at-0.2494553 0.7986307 -0.4231346 0.2655206 0.1675921 0.1965504 0.4805425 -0.2644211 1434292_at -1.106951 -0.067122 0.3139083 -0.020658 0.2162312 0.4294766 0.222381 0.5497735 1434306_at 0.5119529 1.1597416 0.130038 -0.0699244 -0.3038718 -0.3187057 -0.0972433 -0.3166191 1434342_at -0.4131209 -0.319175 -0.5932795 1.0571628 0.5539028 1.053993 0.1581581 0.2557348 1434345_at 1.0592113 0.4672903 0.5463861 -0.2947612 0.2006474 -0.0960594 -0.0943286 -0.1439406 1434353_at -0.0797119 1.3152603 -0.3951737 -0.527859 -0.4835628 -0.4686886 0.6692759 -0.3714894 1434369_a_at-1.390646 -1.437834 -0.7194707 0.7858944 0.5864048 0.8350954 0.4413866 0.4715478 1434425_at 0.7692975 1.581466 0.2748558 0.024776 -0.1350974 -0.3428464 -7.33E-04 -0.3852785 1434436_at -0.7233726 -1.35546 -0.4033971 0.5088038 0.3303097 0.2336992 0.0210234 0.415151 1434437_x_at 0.243215 0.6099936 -0.0234532 -0.2897127 -0.5394271 -0.0670066 -0.3645628 -0.9389198 1434445_at 0.1822259 -0.134831 -0.3573387 0.5465455 -0.0816425 0.2344932 0.8775752 0.6641166 1434479_at 0.7558737 -0.327975 0.1922965 0.3708248 0.0125433 0.246698 0.0110537 -0.0246 1434484_at 0.6385038 -0.447885 0.2519114 0.265379 0.2655378 0.3722071 -0.723738 -0.2985385 1434502_x_at0.0319953 -0.55304 0.5966573 -0.1498108 0.0471951 -0.3441385 0.5306457 -0.1650817 1434528_at -0.9281125 1.351183 -0.8986192 0.0421269 0.633852 -0.1436404 0.6546224 -0.1123532 1434542_at 0.8820679 0.2746251 0.1912096 -0.0914993 0.0431156 -0.0773592 -0.1431036 0.262166 1434553_at 1.121168 0.697735 2.247963 -1.5412748 -0.6653947 -1.7224538 -0.4261338 -0.8784986 1434557_at -0.5943514 -0.693381 -0.2902789 1.1880007 0.5190981 0.8738213 0.7930997 1.1282669 1434606_at 0.7095921 1.4139446 0.6807917 0.3089566 -1.0193424 -1.1534941 -0.4461254 -0.9983177 1434637_x_at0.1434555 0.9485364 0.0069549 -0.0290656 -0.1802959 -0.1878454 -0.1547181 -0.3330994 1434644_at -0.9022222 -0.370958 -0.473838 0.3058004 0.1208119 0.1234984 -0.0569989 0.155715 1434651_a_at 1.080326 1.6721561 0.2948154 1.1493044 -0.6710321 -0.801751 -0.0474056 -0.6594784 1434714_at -0.2228342 0.7837477 -0.1832036 -0.177459 0.0378482 0.1279642 0.1786261 -0.2906626 1434773_a_at0.3696089 0.4776373 0.5625079 -0.5938916 -0.2057978 -0.4009325 -0.5085589 -0.5176503 1434776_at 0.2422955 -0.238167 -0.1175373 0.751235 0.3325712 0.1033475 1.0366176 1.0197912 1434813_x_at0.4360392 0.8882133 0.0140915 0.3484221 -0.1809502 -0.1836048 0.1998905 0.0435098 1434851_s_at0.5211047 0.7573694 0.2008097 0.1011677 -0.2653621 -0.3127158 -0.2900218 -0.2606959 1434853_x_at0.2336814 0.9413469 0.0441184 0.3101564 -0.3108233 -0.1912586 0.1051076 -0.1816232 1434877_at 0.3576361 1.2144772 -0.0617111 0.1156287 -0.2106232 -0.1118434 -0.1209253 -0.0114547 1434927_at -2.4942853 -1.750904 -1.2227154 1.7327266 0.8033436 1.3782488 0.4155861 0.5292622 1434937_at -0.998754 -0.34212 -0.4109399 0.4582453 -0.0192301 0.4079287 0.3338594 0.3704322 1434943_at -0.3296964 0.5183957 -0.5815481 -0.073889 -0.0113997 -0.2295692 0.5684528 -0.2527212 1434944_at -0.9129404 -1.272586 -0.6474299 0.7192216 0.2921073 0.7864137 0.4673198 0.5877336 1435064_a_at1.5289705 0.1409212 0.1629263 -0.1260558 -0.0796018 -0.1119195 -0.0445 -0.2076139 1435106_at -0.5234312 -0.668534 -0.4586128 0.7979326 0.3196019 0.600026 0.4226783 0.5058625 1435184_at -2.3529348 -1.936252 -0.6794763 0.3579407 0.1794481 0.485289 0.2701502 0.3610471 1435191_at -0.4622338 -0.979719 -0.4384533 0.3651838 0.2873978 0.4526874 0.1384292 0.5479279 1435216_a_at-0.0683328 3.4104383 -0.2808006 0.376874 0.4608619 0.3420399 1.3075479 -0.9691143 1435275_at 0.2081144 1.169076 -0.6049275 -0.2124772 0.0585313 -0.2059622 1.0152284 -0.2878361 1435321_at -0.7045397 -0.50943 -0.4278984 0.5875111 0.1803104 0.4571579 0.307024 0.2691097 Page 99 of 205 Diabetes

1435323_a_at0.8740943 1.3172197 0.1586665 0.1531229 -0.616018 -0.7920218 -0.3500967 -0.7070248 1435326_at -1.0638742 -1.167644 -0.5367429 0.6537752 0.2590807 0.8887209 0.3428536 0.5778545 1435327_at -1.064795 -1.094169 -0.4642661 0.585371 0.2657164 0.7478197 0.041625 0.3996385 1435335_a_at-0.0759608 -0.839391 -0.2351891 0.4269199 0.240633 0.4620897 0.3166173 0.5944249 1435382_at -0.4030821 -0.906844 -0.473239 0.5366464 0.2805918 0.5353785 0.4387817 0.6096538 1435383_x_at-0.3714092 -0.887604 -0.4486353 0.4961724 0.2754006 0.5505818 0.3758853 0.5324993 1435417_at 0.3740069 -0.444228 -0.3019829 0.0111883 -0.1713761 0.0827032 0.2968604 0.857279 1435493_at 1.2382277 1.6192617 1.4428562 -0.3092067 -1.618849 -2.131481 -0.5545907 -1.2055858 1435494_s_at1.2116873 1.5451002 1.3643417 -0.1951864 -1.6902053 -2.3328176 -0.4333912 -1.2729107 1435502_a_at0.0212561 2.4845164 -0.1669965 0.1679738 0.594095 0.3880076 1.3346142 -0.1985398 1435541_at -1.7664678 -1.210886 -0.5975288 0.7029109 0.6269644 0.764443 0.1136373 0.1313903 1435559_at 0.5391307 1.0585136 0.2684165 0.0588529 -0.3489403 -0.2437605 -0.2737851 -0.2327232 1435602_at 0.3676343 -0.086164 0.333755 -0.5042465 -0.0135374 -0.8967778 -0.1087577 -0.2121099 1435614_s_at0.0113366 0.9508202 -0.1331134 0.0886428 -0.2749626 -0.1646266 -0.0879895 0.0417577 1435680_a_at-0.1414522 -0.865213 -0.1754683 0.5434618 0.5713435 0.6037423 0.4472639 0.5501609 1435714_x_at-0.438203 -0.683735 -0.4061081 1.0553851 0.388545 0.6165093 0.7688457 0.9383783 1435783_at 0.6073073 1.42302 0.0983762 0.341861 -0.4304933 -0.4804542 -0.3083808 -0.3267331 1435792_at -1.2597005 -1.204354 -0.5072622 3.019834 1.2603986 3.3908134 0.5140412 1.8964542 1435798_a_at-0.0434585 1.0145025 -0.0593257 -0.0665984 0.0659923 -0.1053475 0.5030252 -0.0808048 1435833_at -1.1135681 -0.937882 -0.4587532 1.1133165 0.4763909 0.83089 0.5549809 0.8206093 1435860_at 0.7880329 0.067801 0.1405087 -0.1406658 -0.020303 -0.342617 0.5372703 0.7451973 1435870_at -0.1363101 -0.672839 0.0525913 0.0669808 0.3505312 0.2415329 0.0618941 0.2113962 1435950_at -0.3808372 -0.568609 -0.0729513 0.823875 0.4709312 0.1725937 0.3303431 0.3746573 1435981_at 0.7364378 0.9988704 0.2075664 0.0807207 -0.3337138 -0.5476047 -0.2627352 0.0363932 1435989_x_at1.1187971 1.196403 0.3812666 0.1790519 -0.5695246 -1.0363159 -0.6056277 -1.1878767 1436026_at 0.5218954 -0.160256 0.2174993 -0.4877214 -0.1019789 -0.2564241 0.0871172 0.2566913 1436030_at -0.4916525 -0.852576 -0.4634423 0.2849493 0.2587414 0.3203501 0.5683991 0.7394206 1436031_at -0.1026422 -0.744917 -0.4080643 0.3647952 0.1130283 0.1147957 0.5067756 0.595185 1436032_at 0.9988558 0.1248738 0.480917 -0.4601166 -0.0701088 -0.0682536 -0.4094296 0.0183732 1436058_at 0.5680938 -0.186325 0.6035769 -0.629694 -0.1922119 0.0141062 0.0299053 -0.3273468 1436188_a_at0.4384997 1.0678468 0.0818249 0.6968527 -0.2825007 -0.2474264 0.0257645 -0.3282425 1436244_a_at0.0764382 1.0124844 0.1047794 0.2433198 -0.3703067 -0.0174685 0.0426005 0.0644074 1436419_a_at-0.0075738 1.1437445 -0.0568752 -0.0496851 0.2014239 0.137214 0.812927 -0.0884059 1436448_a_at0.2321804 0.5030522 0.6612017 0.1574926 -0.4542723 -0.2138721 0.1286135 -0.3648284 1436479_a_at -0.20763 -0.602924 -0.1504602 0.4556346 0.5190665 0.6177939 0.1647714 0.3670565 1436512_at 0.4129109 0.9632036 0.0523374 0.3581233 -0.2902087 -0.2333086 -0.0966853 -0.3219118 1436737_a_at-0.9905105 -1.153453 -0.3549542 0.2562032 0.1218098 0.1673313 0.1161127 0.3004837 1436750_a_at-0.7470009 -1.027026 -0.3926034 0.4904928 0.3772515 0.3688566 0.1937685 0.1954842 1436766_at -0.5247514 0.4712899 0.54792 -0.6661744 -0.0892864 -0.0709633 -0.452137 -0.2363777 1436776_x_at0.7839116 0.6195862 0.0766081 0.7703416 -0.3673632 -0.2026554 -0.065392 -0.1941243 1436782_at 1.7306733 2.0481288 0.1934394 0.1479621 0.1482659 0.0281927 -0.0065145 0.0351397 1436853_a_at0.0051563 -1.062903 0.219449 -0.1492014 0.3301407 -0.0863452 0.488657 -0.1183796 1436863_at 0.1466017 2.39856 -0.2639575 0.122586 0.3409937 0.2730151 1.3890749 -0.212486 1436871_at 0.1247972 0.8162795 0.4443194 -0.524488 -0.2861449 -0.1566299 -0.3106623 -0.2503759 1436898_at -0.2706664 0.8650158 0.5301552 -0.5146151 -0.2407049 -0.2313032 -0.5020917 -0.2951422 1436990_s_at0.4918716 0.5308085 0.3558598 -1.1705766 -0.7265139 -1.6521324 -0.6653233 -0.7307708 1436993_x_at0.3351562 0.940901 0.0486856 -0.1079559 -0.428838 -0.5720455 0.0549679 -0.2286104 1437012_x_at-0.9164468 -0.282082 -0.0050426 0.2948093 0.2936514 0.5088106 -0.1338139 0.0855807 1437052_s_at0.0366104 1.3652728 -0.053628 -0.2510824 -0.0755678 -0.3140722 0.5888805 -0.4338404 1437054_x_at-0.9033282 4.057029 -1.1320634 0.6731358 -1.3403776 -0.3599107 0.108901 -3.9908438 1437061_at -0.5015903 0.1857436 -0.1602604 0.5634894 0.3305929 0.4730896 -0.1703615 0.2407799 1437062_s_at0.2061566 0.6123266 -0.0065511 -0.5269612 -0.0753222 -0.2381142 0.7759891 -0.3284808 1437110_at -0.603478 -0.135809 -0.0920465 0.4910588 0.0786036 0.2062178 -0.1112858 0.2136809 1437132_x_at-1.1324494 -0.884936 -0.4370904 0.4231372 0.3553808 0.5126759 0.1715186 0.1153771 1437195_x_at 0.599736 2.2945514 -0.0146859 -0.3941082 -0.1980174 -0.2975627 0.8082457 -0.0919401 1437226_x_at0.5101571 0.7971684 0.1122757 -0.0311639 -0.7121793 -0.6013252 0.0746091 -0.4158812 1437243_at -0.0280964 -0.699817 -0.3598051 0.4949408 0.2421176 0.2371791 0.3025516 0.6812126 1437343_x_at 0.411315 0.2935796 0.4339798 -0.6782355 -0.1683445 -0.2676439 -0.4045086 -0.1686118 1437396_at -0.480258 -0.551008 -0.3606663 0.5710981 0.3865979 -0.0571635 0.2967211 0.5064651 1437458_x_at0.2310529 1.4696429 0.14043 -0.0715261 -0.2350655 -0.36248 -0.0856266 -0.8046147 Diabetes Page 100 of 205

1437502_x_at0.6742945 0.7510147 0.5512531 -0.1274109 -0.3515406 -0.6303507 -0.0541973 -0.5489385 1437534_at -1.3679297 0.162481 0.8670089 0.1378186 -0.1510826 0.2121035 -0.0074368 -0.0800665 1437540_at 1.3122343 1.0723426 0.3106908 -0.1783052 -0.1834735 -0.4036962 -0.237799 -0.4049543 1437547_s_at0.1944708 -0.501514 -0.2591332 0.6235085 0.1845541 0.1215691 0.583244 0.7782823 1437621_x_at-0.772363 -1.046421 -0.5994186 0.4431577 0.3281864 0.5115891 0.1669353 0.5150706 1437644_at 1.0005839 -0.434788 0.8817272 -0.4667869 0.0149525 -0.8916076 0.2625326 0.3482733 1437672_at -0.0851297 -1.397985 -0.4281068 0.5545783 0.2246949 0.4904971 0.5380397 0.7458553 1437689_x_at0.2111685 1.4516287 0.0667152 0.045599 -0.279715 -0.4036625 -0.0555954 -0.840566 1437693_at 0.139385 1.6627443 -0.1815743 0.2310693 0.3525716 0.2324491 0.9961677 -0.2061115 1437751_at 0.3621182 0.120317 0.1324216 -0.6830657 -0.0912797 -0.6325809 0.2021637 0.144122 1437843_s_at 0.212251 0.8106515 0.2790771 -0.1377502 -0.2203922 -0.1209665 -0.2218854 -0.2252763 1437863_at -0.6599734 -0.973326 -0.0553652 0.2001975 0.6242317 0.3146853 0.036552 0.4512777 1437867_at -0.8077477 0.1354609 0.7978498 0.5180323 0.1395058 0.0917998 0.27339 0.1073777 1437917_at -0.8067911 0.1069899 0.2966471 -0.5214634 0.0948177 0.2153701 -0.4662762 -0.0482828 1437932_a_at1.2781854 1.2170374 1.0373391 -0.11954 -0.7737568 -1.0565269 -0.8605264 -0.2733536 1437974_a_at-0.2014933 0.7768276 -0.328 0.165215 0.0620097 0.1748465 0.6019354 -0.2122386 1437992_x_at0.7260623 0.4186561 0.2501304 -0.6449604 -0.2944159 -0.4411833 -0.5526778 -0.4488579 1438097_at 0.4067771 0.7053725 0.2381465 -0.2082713 -0.3374176 -0.6231707 -0.1365441 -0.5034664 1438133_a_at-0.8650255 -0.013804 -0.2906169 0.8999848 0.3781168 0.5460621 0.4965626 0.1335076 1438184_a_at-0.0904478 0.9353895 -0.0389026 -0.316525 0.2822339 -0.1224751 0.594745 0.1097792 1438211_s_at0.1631067 0.2306716 0.0425574 -0.3473795 -0.3651121 -0.2492819 1.8727226 1.664306 1438216_at 0.5546457 0.3308618 0.1597922 -0.5135489 -0.2638489 -0.3507968 -0.2237371 -0.1421442 1438244_at -0.7105 0.3363556 0.389733 -0.6288326 -0.0115676 0.029369 -0.4146573 0.0375306 1438385_s_at 0.785794 0.442816 0.2995145 -0.3159232 0.0534939 -0.1180658 -0.3604689 -0.073974 1438391_x_at0.8522341 0.3280106 0.5454593 -0.4803143 -0.1103025 -0.4690571 -0.0866737 0.0147985 1438403_s_at-0.8557766 0.4452236 0.5244699 0.0726175 0.0730242 0.0868658 -0.3876378 -0.0459716 1438616_x_at2.1659477 3.229086 0.1961997 -0.1106722 -0.0604202 -0.138961 0.2111384 -0.2831988 1438632_x_at-0.1858921 2.7016304 0.0217913 0.4134066 0.3540937 0.4614528 1.3657956 -0.3111518 1438642_at 0.2563093 1.3327047 -0.2593142 0.0814037 0.3222099 -0.0770155 1.2684864 -0.1655498 1438650_x_at0.6426463 0.3233628 0.2521396 -0.6566334 -0.2620108 -0.3904726 -0.5227575 -0.4484812 1438651_a_at0.8506181 -0.905798 0.17898 -0.3895509 -0.2881565 0.7543537 0.492878 0.3110005 1438654_x_at0.8555521 0.8111892 0.0611874 -0.5071302 -0.0736553 -0.5357133 0.1213433 -0.6014536 1438676_at 0.026351 -0.653682 0.3613373 -0.1033309 -0.0686548 0.6610445 -0.0101115 0.3901471 1438700_at -0.1177458 0.7641304 0.3591986 -0.276511 -0.243019 -0.0363374 -0.246473 -0.2664523 1438714_at -0.0723084 0.6848891 0.800313 -1.0165303 -0.2277746 -0.1098102 -0.9076724 -0.5201572 1438789_s_at-0.5648564 3.1688137 -0.6990266 0.6614325 1.0365616 0.6999122 1.0268903 -0.5908415 1438802_at -0.8047068 0.2617022 0.4441257 -0.4831891 -0.0368307 0.3037138 -0.4707902 -0.1206597 1438840_x_at0.9540906 0.4027531 0.3684909 -0.1548219 -0.0034987 -0.1263646 -0.1019052 0.0821796 1438841_s_at 1.467392 1.8240027 0.8282943 0.0417852 -1.101681 -1.5224437 -0.3141909 -0.9585614 1438856_x_at0.5330774 0.9744393 0.7984862 -0.0582825 -0.1962571 -0.176881 -0.2731125 -0.1019373 1438887_a_at0.3506661 1.006189 -0.0139699 -0.3496397 -0.2191538 -0.2522827 -0.0948138 -0.1160081 1438933_x_at-0.3515325 -1.005904 -0.306653 0.3509054 0.2049418 0.6600281 0.1076644 0.5510375 1438945_x_at0.7793405 0.3521655 0.2403839 -0.6248179 -0.2626551 -0.460117 -0.581899 -0.4577328 1438957_x_at0.6385932 0.5274565 0.497292 -0.3514867 -0.2071669 -0.3428196 -0.6674814 -0.5613477 1438968_x_at0.1550057 1.1326251 -0.072223 0.295805 -0.6751606 -0.5250994 -0.189833 -0.389876 1438973_x_at0.5356718 0.1583408 0.1572355 -0.54005 -0.1053721 -0.276065 -0.4633689 -0.2398213 1438980_x_at-2.0014095 -1.369242 -0.6874064 0.9244776 0.4562 1.0897762 0.2010231 0.647841 1438982_s_at0.4485499 0.6100715 -0.0657796 -0.0108643 -0.4810159 -0.3787361 -0.0761333 -0.3001892 1438990_x_at-0.3953947 4.5267944 -0.6030754 0.6172081 0.2959145 0.4240395 1.1747555 -1.8214077 1439036_a_at0.7943914 0.9895487 0.2361875 0.0240622 -0.4474731 -1.0313438 -0.1263421 -0.7344195 1439040_at 0.1611436 1.0322012 -0.1305897 0.0145365 0.2001254 0.0283141 0.4336809 -0.30041 1439148_a_at-0.1409439 -0.763847 -0.4826194 0.7467561 0.304049 0.4439157 0.5030475 0.8828691 1439200_x_at0.3484485 -0.066085 0.2678232 -0.3040938 -1.8667427 -0.1786387 -0.1117643 -0.2686281 1439251_at -0.7517453 -1.099496 -0.4540076 0.7145724 0.463489 0.7478144 0.4921738 0.7099155 1439255_s_at-0.605309 -0.714672 -0.163718 0.1355853 0.3816916 0.4953981 0.1716601 0.1437248 1439283_at -0.7693574 0.2580203 0.353883 -0.4615886 -0.294369 0.0788551 -0.7024803 -0.2361771 1439332_at 1.2667427 1.3917108 0.4719783 -1.0834363 -0.663105 -0.8098318 0.043907 0.3912288 1439377_x_at 0.514133 1.2959331 -0.0024996 -0.6807356 -0.0910238 -0.2262011 0.2457018 -0.8621127 1439379_x_at-0.9083365 3.7696562 -1.3165516 0.5713635 -1.5055608 -0.5658401 -0.1020811 -4.2416835 1439380_x_at0.4222932 0.1912925 0.7439003 -0.1275859 -0.0317678 0.1730616 -0.3787457 -0.2597256 Page 101 of 205 Diabetes

1439399_a_at1.1746957 0.756021 0.6107662 -0.6147971 -0.2068315 -0.7482687 -0.1502953 -0.2504896 1439465_x_at0.4506576 1.1910923 -0.1057699 -0.3882513 0.0361406 -0.1492024 0.3489154 -0.5108188 1439476_at 1.3834699 1.8899633 0.8049498 -0.0508647 -1.1405866 -1.5348499 -1.0594248 -0.9394676 1439995_at -1.3077183 -1.412081 -0.8887605 0.9929588 0.7384418 0.8721331 0.3314826 0.7167635 1441115_at -0.4376394 0.4223081 0.8517904 -1.290828 0.0684667 -0.3125921 -1.1737071 -0.8298524 1442028_at 1.4931312 1.3163792 0.0658884 -0.726563 -0.5677683 -0.8386242 -0.4838277 -0.2183189 1443874_at 0.2693589 0.9185326 0.0737672 0.107965 -0.1784443 -0.1594885 -0.1527379 -0.2688789 1443949_at -0.6819407 0.3632191 0.1563958 -0.7407889 -0.3729124 -0.1227839 -0.6867973 -0.2042764 1445689_at -0.7234019 0.0018859 0.3975798 -0.3522246 -0.1205507 0.2542966 -0.2078037 0.0205652 1446086_s_at0.0052276 -0.237873 -0.1386063 0.687608 0.1265323 0.2402227 0.6122975 0.9154723 1447997_s_at-0.0028475 1.060537 -0.0582172 -0.0552083 0.1048444 0.0140586 0.9382034 -0.0620019 1448024_at -2.6932096 -2.093797 -0.6478074 0.672297 0.5162327 0.8304253 0.4057242 0.4878082 1448029_at 0.2287643 0.7418565 0.1442864 0.0151932 -0.3518696 -0.5916876 -0.2161776 -0.4357484 1448105_at -0.4402441 3.6658418 -0.8087164 0.5521109 -0.3785407 0.0480261 0.5927946 -2.5071914 1448118_a_at-0.2207105 -0.736159 -0.1973085 0.7698069 0.458165 0.4934157 0.4696201 0.5181806 1448130_at -0.0333791 -0.014791 -0.6509476 -0.0704117 -0.2334232 -0.0744617 0.5078745 0.4652513 1448147_at 1.4844711 1.2455454 0.2534055 -0.0605361 -0.5406229 -0.4376545 -0.0704592 0.0805729 1448169_at 1.0907621 1.5901806 0.4799116 0.2381611 -1.1290913 -1.5174235 -0.8575497 -1.46692 1448171_at 0.1756054 0.8944438 -0.1724244 -0.0173295 0.0630531 -0.0625596 0.4131001 -0.2080935 1448182_a_at0.7664461 1.0857186 0.6724105 -0.217557 -0.272195 -0.4607048 -0.0587139 -0.5519053 1448205_at 0.6746597 0.1307639 0.1011812 -0.1385777 -0.0562679 0.2606941 -0.4193211 -0.2228777 1448211_at -0.693773 -0.652215 -0.7053831 0.4566031 0.3860975 0.3583927 0.4895045 0.5206865 1448249_at 0.0664859 -1.259633 -0.0655286 0.6494103 0.1858658 0.6487182 0.3430201 1.20353 1448250_at 0.528049 -0.688709 0.0288165 0.1320987 0.0510052 0.0759142 0.1600761 0.3314327 1448251_at 0.3834662 -0.797052 0.0342755 -0.0689976 -0.0619009 0.1064384 0.042857 0.0268426 1448254_at 0.5715127 0.4250588 0.4260317 0.0916817 -0.3464934 -0.6366463 0.6495773 -0.0974476 1448261_at 1.2655885 1.7810042 1.1537464 0.3818572 -2.5807886 -3.0460827 -1.4248333 -2.3243635 1448265_x_at1.0750655 1.0892621 0.3150748 -0.4710631 -0.6547273 -1.3299825 0.0164054 -0.0694906 1448280_at -0.4523478 -0.417518 -0.4983087 1.099509 0.3670239 1.0757073 0.5352156 0.7600891 1448286_at 0.9831841 0.5175741 0.5054867 -0.3845801 -0.0899273 -0.3893028 0.0332238 0.114213 1448296_x_at-0.2444592 2.2809398 -0.6527627 0.2806585 0.5014636 0.2751685 1.4268252 -0.0345987 1448299_at 0.5067699 1.6812851 0.8840058 0.7747767 -0.3001894 0.0437078 -0.1339393 0.9238758 1448303_at -0.3104236 0.1260905 -0.4882052 0.4196115 0.8215292 0.9000894 0.0801528 -0.1391716 1448321_at -0.832006 -1.217088 -0.3612759 0.8272319 0.3813334 0.3721684 0.7345393 0.8495 1448326_a_at0.7953733 0.2492526 0.2663651 -0.2467133 0.0613565 -0.0523176 0.1004313 -0.0629674 1448329_at 0.1322894 3.6933322 -0.241166 0.4899349 0.56988 0.6322115 1.6271648 -0.5619871 1448371_at 0.1793217 0.0297835 -0.2836638 -0.0251076 -0.0059773 -0.0494987 0.4915625 1.1401011 1448377_at 0.2613354 -0.124978 0.5734203 -0.0983219 -0.0306522 -0.3302187 0.0191034 -0.9828265 1448382_at 2.0943284 1.3911633 0.6294153 -0.5652852 -0.6482166 -0.473511 -0.0186958 0.0128272 1448390_a_at-0.6457362 -0.818343 -0.4109957 0.7096677 0.3148584 0.5251434 0.4333277 0.5380351 1448393_at 1.414352 2.1677685 0.5221854 0.8849778 -1.7949569 -2.384601 -1.0411206 -1.5321006 1448397_at 0.4648828 0.4122596 1.9404157 0.0137272 -0.0887624 -0.0744722 -0.0300442 0.1470657 1448421_s_at0.0891936 -0.732577 -0.0787947 0.391705 0.2728457 0.3824534 0.0224625 -0.0285692 1448426_at -0.4952617 -0.787862 -0.6104175 0.6623235 0.3202736 0.6238939 0.3328497 0.5387777 1448453_at -0.1778716 1.8489375 -0.0210046 -0.1113262 0.0792843 -0.1789186 1.3883919 -0.2232452 1448460_at -0.2295806 -0.678305 -0.0595891 0.2454834 0.3440041 0.1233908 0.2559166 0.2637313 1448469_at -0.2361648 -0.756778 -0.1504564 0.9814701 0.4940132 0.5256022 0.4039459 0.4043169 1448470_at 0.5916573 2.773398 -0.4694992 -0.7771401 -0.3596915 -0.4769631 0.2334612 -1.9828936 1448485_at 0.9481101 2.1983562 -0.2442943 -0.0234768 -0.6178915 -1.0833825 -0.4494327 -0.7832081 1448502_at -0.8872731 0.3403773 -0.7688836 -0.1050525 0.3013571 0.1033478 0.587169 0.3472258 1448507_at -0.4664104 0.4744437 -0.4519041 0.2021642 0.0885559 -0.170994 0.8284146 0.1102495 1448512_at 0.2408865 4.292366 -0.0273602 0.8908393 0.9321342 1.0317264 1.4577303 -0.5843029 1448538_a_at 8.26E-04 0.0451937 -0.2669458 0.4499836 0.2545777 -0.4080368 -0.040493 0.6571299 1448545_at -0.1370425 -0.655618 -0.3403714 0.4234872 0.3852053 0.3930803 0.3817956 0.3668804 1448550_at -0.6057017 -1.057961 -0.8326364 1.2353549 0.4292994 0.9525759 0.477169 0.6658481 1448559_at -0.4747529 -0.572856 -0.2281318 0.7699671 0.3880701 0.708996 0.755991 0.8001315 1448568_a_at-0.9070668 -0.395335 -0.143055 -0.029582 0.082073 0.2211792 0.3493601 0.3516626 1448573_a_at1.4779391 2.7107136 1.7074742 1.7344036 -2.9263492 -2.0974026 -1.8035756 -2.5935788 1448575_at -0.9600329 -0.808898 -0.426747 0.6464853 0.8669756 1.1646584 -0.1260676 0.3686651 1448576_at -0.7452349 -0.675191 -0.4979308 0.4845784 0.763556 1.1594074 -0.0688882 0.2676274 Diabetes Page 102 of 205

1448595_a_at1.5458775 0.8168609 0.2975591 -1.051938 -1.3498926 -1.8130634 -0.8350353 -1.7229967 1448603_at -0.3435848 0.7630627 -0.5102004 0.019794 0.2000341 0.0095642 0.4777609 0.123332 1448609_at 1.5911288 0.2001706 0.4956204 -0.4930272 -0.2029621 -0.3898115 0.1985862 0.1165183 1448626_at -0.5334365 0.0186028 0.553952 -0.888413 0.097998 0.2224938 -0.6563904 -0.1842047 1448627_s_at0.4703687 1.7732168 -0.1875786 -0.3578465 0.101326 0.1918237 0.3805355 -0.4813363 1448628_at -0.1823359 -0.704753 -0.4687805 0.2632473 0.3394719 0.2131415 -0.0698989 0.0241014 1448649_at -0.072402 -0.718561 -0.1832573 0.3136568 0.2866642 0.3690289 0.2133214 0.627348 1448672_a_at-0.1767869 -0.480845 -0.2928386 0.3695927 0.2114899 0.2893601 0.7729552 0.7780364 1448673_at 0.1208224 1.3898737 -0.1098958 0.1098325 0.2356309 0.1469998 0.7536295 -0.2747525 1448688_at 0.2450552 0.1207886 0.3697314 -0.7931581 -0.1333946 -0.5222424 -0.2360503 -0.4872618 1448690_at 1.1014094 2.138782 0.7491343 0.7591453 -2.3923097 -3.097403 -1.6865495 -2.3758879 1448696_at -0.5346186 -0.880497 0.0113173 0.1785765 0.2002874 0.1887817 0.3359995 0.3998359 1448710_at -0.15674 -0.670969 -0.1749533 0.6375701 0.4268734 0.4787741 -0.4283368 0.4607442 1448713_at -0.4235809 1.5785822 -0.3801082 0.2231839 0.2946842 0.3688626 0.8066996 -0.1806115 1448732_at -0.0661936 -0.821331 -0.3063088 0.6352019 0.580678 0.5098866 0.235645 0.3500513 1448740_at 0.1240916 1.2625151 -0.1376314 -0.0343936 0.0108299 -0.1523419 0.5673161 -0.28897 1448743_at -0.019341 0.5869061 -0.2579836 -0.200381 -0.4146677 -0.3680055 0.0580268 -0.2536233 1448749_at 0.0154465 -0.637802 0.2021189 -0.0512412 0.435922 0.3626842 -0.0687374 -0.1452834 1448752_at 0.571229 1.1948072 0.8446882 0.1638825 -0.5346022 -0.6877988 -0.2387883 -0.7116302 1448755_at -0.471581 -1.613626 -0.5674576 0.7214017 0.4621712 0.7992739 0.0948712 0.4388886 1448756_at 1.1378555 0.3248596 0.659214 -0.7380703 0.0207733 -0.3829199 0.120086 -0.4530249 1448783_at 1.8370433 0.7025831 0.3191019 -0.9390917 -0.0369091 -0.7543227 -0.33487 -0.6912222 1448792_a_at1.7656689 0.5527775 2.0986948 -1.8014946 -0.5331435 -1.503718 -1.0093511 -0.7192491 1448813_at 1.273264 0.2025636 0.3874642 -0.5203428 0.1806888 -0.2457505 -0.0860461 -0.3159056 1448852_at 1.6020195 2.645897 1.3788447 1.4827416 -0.5010626 -0.2754815 -0.3702425 -0.6060599 1448859_at -0.2861383 -0.142168 0.3560004 -0.1061447 -0.2908821 0.3222675 0.0583625 -0.7281669 1448871_at 0.844478 1.0849642 0.514637 0.2145708 -0.2232097 -0.4164887 -0.2116413 -0.2285762 1448873_at 1.0243888 1.9644824 0.6490943 0.2743497 -1.0145686 -1.2246327 -0.3365307 -1.1015812 1448876_at 0.1778613 -0.328495 -0.3938689 0.7258692 0.0577571 0.2181586 0.7424881 0.7633166 1448886_at 0.7239096 1.2726986 0.7220937 0.3268075 -0.2851411 -0.5069499 0.6332038 -0.1472933 1448889_at 0.827735 1.538315 0.6087946 0.8326685 -0.1944711 0.0427273 -0.1486394 -0.3789369 1448904_at 0.1575456 0.8158834 -0.0255461 0.3086963 -0.2400868 -0.0720432 -0.0714426 -0.1237545 1448906_at 1.4785072 1.9945503 -0.1137023 -0.1068776 -0.6839109 -1.2330524 -0.7606223 -1.0642251 1448926_at 0.555011 0.4767418 0.4007607 -0.5217962 -0.0042078 -0.3928798 -0.2080897 -0.089522 1448928_at 0.5961468 1.5392827 0.3571792 1.1444807 -0.7155467 -0.6551018 -0.0043529 -0.4516567 1448935_at -0.0715485 2.08984 -0.2382635 0.1348045 0.3073693 0.2706181 0.9185605 -0.334857 1448955_s_at-0.5229198 -0.879187 -0.8460349 1.7643163 0.778439 1.0577389 0.6314996 0.7823213 1448956_at 0.4125288 1.0417285 -0.3773741 -0.0490816 -1.0455921 -1.2605894 0.0214515 -0.6844991 1448962_at 0.7850089 0.3095453 0.8298205 -0.0926437 -0.2134831 -0.4676279 1.0049983 0.0150808 1448973_at 1.5576909 0.6921036 0.4018804 0.2729776 -0.0429401 -0.4758038 -0.2079248 -0.4249257 1448983_at 0.0982138 2.1123762 -0.1096727 0.3443878 0.4328114 0.4668887 1.0264367 -0.3012466 1449002_at -0.6206393 -1.334588 -0.6142671 0.9235292 0.3466207 0.4916593 1.422452 1.5402845 1449007_at 0.4282653 1.4850652 0.1984735 0.1302857 -0.2584606 -0.6553339 -0.3865061 -0.4981813 1449009_at -0.0672603 -0.363224 0.2515302 -0.4029918 0.1645807 0.6281387 0.1914609 0.609335 1449029_at 0.3311019 -0.369053 -0.2741718 0.9481816 0.3407399 0.1181874 0.8554847 1.1900144 1449031_at 0.5100021 1.8523333 0.7786456 -0.3615096 -0.1263364 -1.0580196 1.5928993 -0.8946858 1449033_at 0.2992915 -1.395165 -0.1118261 0.1970041 0.4655852 -0.1194203 0.4890639 0.2922312 1449035_at 0.294207 3.932487 -0.2534555 0.4215907 1.1918521 0.504896 1.815571 -0.5529971 1449036_at 1.0906572 1.4325116 0.3852167 0.0101945 -1.6220986 -1.2298908 -1.3181282 -1.5084573 1449040_a_at0.4236293 0.1691074 0.2591829 -0.7316246 -0.1620367 -1.0120833 -0.2232491 -0.2250172 1449054_a_at0.1663172 -0.39178 -0.1848246 0.5779617 0.173026 0.2300692 0.832009 0.8266819 1449059_a_at-0.6973684 -0.762391 -0.292635 0.3830719 0.4218535 0.4758553 0.1243874 0.2025601 1449060_at 0.0274941 1.9942489 -0.1944861 0.4221952 0.2986188 0.4151033 0.6754324 -0.3184543 1449065_at 1.3005399 1.2461429 1.4503798 -0.5312653 -1.0112048 -1.1641049 -0.4800989 -0.8423114 1449067_at -0.4798743 -0.547715 -0.266461 1.1577663 0.5647395 1.1590798 0.3971678 0.3824202 1449070_x_at-0.1452386 -0.974133 -0.2216599 0.1171055 0.1329147 0.1026369 0.5592391 0.6139008 1449074_at 0.1844141 4.062752 -0.2395929 0.5758376 0.9419509 0.5584466 1.9096848 -0.3792402 1449078_at 1.3367848 0.2830484 0.5115864 -0.5908382 -0.2836738 -0.7432898 0.0677071 -0.0754306 1449079_s_at1.0965972 0.3007166 0.412329 -0.3651023 -0.1794461 -0.434046 -0.052501 -0.0212634 1449091_at 0.9310595 1.4198866 0.7585304 0.5871944 -2.0641522 -2.5266666 -1.150693 -2.0303223 Page 103 of 205 Diabetes

1449094_at -0.503315 -0.138583 -0.1830483 0.5893154 0.1628725 0.5774826 0.4291013 0.4174995 1449103_at 0.0648975 2.501322 -0.0655135 0.0028865 0.6419863 -0.0198268 1.368893 -0.1172017 1449106_at 0.0932558 0.4298647 -0.1923521 0.1780272 -0.4328184 -0.8564556 0.2826471 -0.03545 1449109_at 0.5492218 0.0352547 0.3011706 -0.283663 -0.1643045 -0.3154415 -0.5119677 -0.2506682 1449124_at -0.6212578 -0.922367 -0.1858435 0.3102613 0.3105038 0.0592842 0.292182 0.2499517 1449130_at -0.6584735 -1.217986 -0.2275763 0.2871695 0.3014418 0.3715975 0.1199935 0.317268 1449131_s_at-0.6511562 -1.173487 -0.2246113 0.2613168 0.3520905 0.4389816 0.0716114 0.3662834 1449133_at 0.4680419 -0.001198 2.1185596 0.1320574 -0.0039514 -0.0323274 0.0049472 -0.2267964 1449153_at -1.9181055 -1.028478 -0.4701873 1.0000424 1.6327213 2.0735664 -0.189882 -0.0182452 1449166_at 0.6681777 0.2742883 1.0477949 0.1218283 -0.1018722 -0.0776319 -0.1568888 -0.0970132 1449168_a_at-0.6550441 -0.493415 -0.3297377 0.8689871 0.4740948 0.6085697 0.4013484 0.40977 1449170_at -0.1400638 1.9776398 0.2662991 0.1605663 0.0904459 -0.4128037 0.548029 -0.6768613 1449171_at 0.1378932 1.1051894 -0.2286315 -0.118114 0.0230365 0.1584912 0.6633201 -0.3683019 1449174_at 0.7109479 0.9372937 0.3033805 0.1959748 -0.2354212 -0.3154937 0.1344282 -0.1938773 1449177_at 0.01601 1.368968 -0.1345264 -0.0105615 0.261561 0.2533375 1.2597522 -0.0856155 1449178_at 0.4569397 0.2711444 0.7091183 -0.0943782 -0.0514928 -0.4228227 0.8485661 -0.0036982 1449183_at -0.8672891 -0.588173 -0.3332071 0.6946611 0.3686481 0.4929939 0.3205328 0.1300914 1449193_at -0.2989346 -0.137275 0.8732034 -0.2172365 0.0111934 0.0380839 -0.498813 -1.3184963 1449203_at 0.8163809 1.9996265 0.805666 0.2679253 -0.2822866 -0.1890376 -0.1764178 -0.3836214 1449205_at 0.0015811 0.9957721 -0.1177639 -0.0855615 0.0161016 -0.090818 0.6552923 -0.4406311 1449208_at -0.0660683 3.4049482 -0.1253962 0.3850378 0.8697372 0.5821596 1.2881956 -0.4650211 1449215_at 0.073249 0.6584808 -0.2536631 -0.4854059 -0.3210188 -0.327531 0.8862621 0.0062876 1449216_at -0.1441826 1.314074 -0.3760873 -0.1653497 -0.0549231 -0.0757711 0.7694166 -0.0381568 1449218_at -0.043339 -1.452366 -0.1458445 0.2633557 0.3725641 0.7120706 0.1611137 0.376152 1449219_at -1.6876203 -1.850994 -0.7954767 0.9410362 0.5148392 0.8386469 0.6650359 0.9970849 1449223_at -0.0543088 1.1253604 -0.1557872 0.0574293 0.081847 0.0282857 0.5917128 -0.3270598 1449227_at 0.615593 1.7355906 1.052201 1.1101365 -0.2059801 0.0696824 -0.294975 -0.1223127 1449229_a_at-1.0669183 -0.475137 -0.5922949 0.1039448 0.1850992 0.3045038 0.1940053 -0.0018988 1449247_at 0.0841688 3.1830788 -0.1846132 0.7620997 0.3627113 0.4271022 1.6245518 -0.4716091 1449253_at -0.1551493 1.5888666 -0.0618192 0.0126054 0.4436385 0.1263599 1.1775064 -0.1384397 1449254_at 0.9464752 -0.404726 -0.1184921 -0.033602 0.8476452 0.9993705 -0.5078066 -0.3909779 1449271_a_at0.5758041 0.8825408 0.4427801 0 -0.3657819 -0.3532969 -0.0885757 -0.1698472 1449276_at 0.0221667 1.2924515 -0.114467 0.0901532 0.2115746 0.0061661 0.9004629 -0.2053119 1449284_at -0.1207762 1.674407 -0.1173157 0.2196908 0.2976045 0.2458879 0.7832465 -0.1622609 1449285_at -0.0878382 3.9760308 -0.0187234 -0.190557 1.0680649 0.1914724 1.6685934 -0.3901287 1449293_a_at0.0513906 1.9198452 -0.1342716 0.328113 0.2031628 0.3941588 1.0875365 -0.3084457 1449303_at -0.3275335 -0.417315 -0.3062794 0.2640152 0.32237 0.754656 0.2287887 0.2185319 1449308_at -1.2482934 -0.88339 -0.793795 0.2889538 0.4024031 0.1570574 0.2916339 0.1564697 1449313_at 0.6542921 1.4534757 0.2054198 0.5334923 -0.1623017 -0.1748042 -0.1584543 -0.2221279 1449325_at 0.3661366 0.4635342 0.6371695 0.0713379 0.062108 -0.3591967 0.2609201 -0.3805337 1449328_at 0.0447121 -0.192676 1.1005116 -0.0859133 -0.0142814 0.2567605 0.0440288 0.0822821 1449332_at 0.2461579 3.8560982 -0.0885297 0.7307532 0.8736499 0.7906375 1.5177139 -0.2181985 1449350_at 0.5532448 0.2569125 0.2111018 -0.4588847 0.0657858 -0.3271324 0.6905 0.1258694 1449357_at 0.7626234 1.0914544 0.1868923 0.1954069 -0.5509664 -0.6358124 -0.1091208 -0.426871 1449374_at 0.7694191 0.6317878 0.2351387 -0.251766 -0.7008063 -0.862518 -0.8111675 -0.9391 1449376_at -0.0190835 -0.39667 -0.5192106 0.4119678 0.3131596 0.2740398 0.5940034 0.6143999 1449384_at -0.0132718 1.2049123 -0.2447044 0.1309574 0.1946423 0.2329312 0.5989099 -0.2955888 1449391_at 0.0118277 1.9381396 -0.1672654 0.1488338 0.318522 0.2245379 0.8653771 -0.4277649 1449395_at -0.0457469 1.5775234 -0.168241 0.1335762 0.4918851 0.1742647 0.8831325 -0.309121 1449396_at -0.7976701 -1.009783 -0.2707362 0.2099748 0.230308 0.2712725 0.2066523 0.2483333 1449398_at 0.8058665 1.8132899 0.6400511 0.7995725 -0.361023 -0.2987795 -0.285868 0.0505457 1449409_at 0.9645026 1.7163047 0.6768175 0.0880716 -0.5728416 -0.5999508 -0.8429661 -0.7502158 1449416_at -0.7765648 -0.766373 -0.2895969 0.441669 0.4254421 0.8875785 0.3075682 0.5665272 1449419_at -0.6202713 -0.783487 -0.4544733 2.0642838 1.1704255 1.958464 1.0525972 0.998638 1449427_at -0.119066 1.6831257 -0.1528992 0.4118717 0.1297508 0.327616 0.7114954 -0.2402732 1449433_at -0.1217878 -0.851779 -0.234136 0.7744174 0.4071189 0.5695111 -0.0747741 0.2939491 1449443_at -0.1946023 -1.210637 -0.3464427 0.3340488 0.2470537 0.4004641 0.1003857 0.4263945 1449456_a_at-0.2941041 -0.536794 -0.2085847 0.367162 0.3731697 0.0504424 0.7350763 0.3231413 1449458_at 0.8492649 1.4136684 0.120762 0.8089876 -0.2195062 -0.187167 -0.2584136 -0.1999617 1449467_at -0.2471633 1.7334572 -0.0026581 0.2346172 0.7135455 0.2769894 0.9378365 -0.2544762 Diabetes Page 104 of 205

1449469_at -0.1719685 -0.786265 -0.4831387 0.204968 0.2186264 -0.1540854 0.3114769 0.4703919 1449471_at -0.0200819 0.7209343 -0.3196353 0.0220394 0.0927445 -0.2015371 0.192883 -0.2422756 1449475_at 0.1476926 0.5958721 1.4531052 0.0039051 0.019988 -0.1042476 -0.1055334 -0.0178723 1449477_s_at 0.196699 0.3266397 -0.4638215 0.8212972 -0.2464518 0.0400949 0.1823443 0.2734459 1449478_at 1.5365872 0.1010035 -0.1588595 -1.9181871 -1.1314784 -1.6665382 -1.168769 -1.700478 1449484_at -0.4732006 -0.305735 -0.3403237 0.8702197 0.3491503 0.7625994 0.4684401 0.5487964 1449487_at -0.1493788 2.1552122 -0.2175856 0.2282484 0.4099593 0.4564869 0.7985427 -0.1399712 1449489_at 0.1559107 3.2992244 -0.2320088 0.8175616 0.7491048 0.8978432 1.359543 -0.2954392 1449494_at 0.6249297 2.0760655 1.1631117 1.2364281 -0.2474379 0.0138066 -0.1818707 -0.2218889 1449498_at 0.1142105 -0.184412 1.1527435 0.0143445 -0.2253017 0.4122929 -0.1927805 -0.5714318 1449502_at -0.3133055 1.8732995 -0.1531142 -5.20E-04 0.6118791 0.0868794 1.359806 -0.1391335 1449509_at -0.3244185 0.7402086 -0.4577447 0.1455889 0.0750744 0.1794519 0.2945857 -0.3124445 1449513_at 0.0430224 1.5595028 -0.2330757 0.2088051 0.4575366 0.2702389 0.7295187 -0.2872745 1449519_at -0.7920326 -0.865466 -0.711714 0.3101487 0.2098899 0.7321243 0.7479566 0.5232747 1449525_at -0.6780695 -0.52619 -0.1640922 0.6807599 0.3084351 0.1219973 0.2407842 0.1328219 1449534_at -0.5234958 -0.252248 -0.5934172 0.6672049 0.2041378 0.8441054 0.3767268 0.3337778 1449535_at -0.0209576 1.4311144 -0.1682012 0.1643536 0.1887742 0.2529224 0.895711 -0.3354293 1449541_x_at-0.0288085 3.548882 -0.2955008 0.2353795 0.6079429 0.400114 1.523373 -0.5135679 1449551_at -0.0852642 -0.874038 -0.3744465 0.6183193 0.3624846 0.3399458 0.5144488 0.8139043 1449561_at -0.1093832 0.9606122 -0.444057 -0.0219042 0.1453778 0.1213639 0.8063324 -0.0933369 1449570_at 1.0140985 0.8665029 0.3209776 -0.1923747 0.0360212 0.0019266 0.1002048 0.7317578 1449579_at 0.5980234 1.0531045 0.33854 0.0589762 -0.223546 -0.1395718 -0.1004818 -0.3338758 1449581_at 1.0628273 1.0810165 0.1392226 -0.0998533 -0.1822323 -0.2663705 0.0122479 0.5629908 1449623_at -0.021023 0.8663046 -0.2402396 -0.3035638 0.0617734 -0.0456557 0.5960407 -0.0212863 1449630_s_at0.4191499 0.3962438 0.0910044 -0.5851874 -0.287172 -0.3260338 0.0531645 -0.2782548 1449641_at 0.7358872 0.1747979 0.0414779 -0.1228309 0.0412892 -0.0438442 -0.2741014 -0.2598262 1449661_at 1.0447507 0.1860451 0.340412 -0.09127 -0.1982993 -0.3115087 0.0960264 0.1449229 1449670_x_at-0.7462665 -1.116037 -0.4305937 0.2038064 0.3145109 0.3273557 0.3545896 0.3666062 1449740_s_at 1.454412 1.9582986 0.939275 0.0184329 -1.2253339 -1.302542 -0.9964503 -0.7244694 1449770_x_at0.3337582 0.6984141 0.0428466 -0.0345676 -0.3355147 -0.3175432 -0.118571 0.0014133 1449799_s_at-1.5566821 -1.139962 -0.6805289 0.4579482 0.3806063 0.4670319 0.1050466 0.2747119 1449800_x_at0.1021242 2.564661 -0.0489223 -0.152401 0.2747383 0.0905909 0.9366229 -0.5236871 1449824_at 0.4632869 0.6863341 1.4114254 -0.2367268 -0.1544853 -0.5490333 -0.6351846 -1.2012182 1449831_at 0.1314741 2.755173 -0.1514155 0.3916026 0.3169616 0.3508549 1.385849 -0.5054947 1449832_at -0.1913629 0.8255152 0.3222138 -0.2071269 0.0968501 -0.0041251 1.1469136 -0.3510944 1449837_at -0.0225679 0.9485098 -0.0800302 -0.106808 0.1167091 -0.1175125 0.8277913 -0.0327772 1449862_a_at 0.546339 1.6001433 -0.262145 -0.0014884 0.396953 -0.0412256 0.3658695 -0.4983546 1449879_at 0.1237696 2.3192306 -0.168073 0.2787933 0.5392512 0.4731824 1.6622056 -0.1776501 1449892_at -0.1299386 1.7739275 -0.1933638 0.0493555 0.7467895 0.2371862 0.9816154 -0.1245488 1449893_a_at0.7573192 0.0954757 0.3106892 -0.3032103 0.0794886 -0.1501896 0.1259928 0.2250706 1449894_at 0.0798686 1.5345511 -0.2160934 -0.1055727 0.2392309 0.2035247 0.8074362 -0.2567026 1449896_at 0.4848708 1.1236717 -0.0016863 0.470031 -0.4143682 -0.4636448 -0.4322186 -0.870456 1449903_at -0.0405852 0.9545006 -0.0759206 4.58E-04 0.0240687 -0.0150964 0.5464463 -0.1895036 1449923_at -0.1007793 1.5279624 -0.2408519 0.1075847 0.2517624 0.1536489 0.9801342 -0.1548538 1449937_at -0.9670194 -0.48445 0.2639548 0.322546 0.3298782 0.3068578 -0.4068371 -0.2344707 1449945_at 0.364743 -0.245602 0.2355185 -0.7159388 -0.371966 -0.4504023 0.3026851 0.3423154 1449962_at -0.0204297 1.1666918 -0.0787598 -0.0794088 0.3724185 0.0736063 1.0233825 -0.0990771 1449967_at 0.5331196 1.6119218 0.3894982 0.2648892 -0.2685336 -0.4146036 -0.2082059 -0.4788908 1449974_at -0.1512291 2.4861472 -0.3539044 0.5317767 0.3974911 0.4117698 1.2531028 -0.5634861 1449983_a_at-0.4349608 -0.305831 -0.5200232 0.3245232 0.255994 0.5510222 0.2874456 0.1340818 1450009_at 2.015654 2.811226 2.9155574 1.336173 -0.6789874 -0.2414491 -0.4422541 -0.6278407 1450015_x_at0.5738074 1.016942 0.9590327 0.3360906 -0.1083591 -0.2487986 -0.1680554 -0.1948385 1450042_at -0.1778042 -0.57925 -0.379477 0.7204323 0.2595159 0.9354218 0.8310077 0.4505018 1450060_at 1.2846686 0.2797456 0.3034446 -0.2976005 -0.0664289 -0.0672827 -0.2248785 -0.2282257 1450061_at -0.6577137 -0.215449 -0.0274055 0.7464829 0.5596363 -0.1249758 -0.1732 0.2163474 1450076_at -0.0478599 1.0792689 -0.2372559 0.0306003 0.371692 0.0179734 0.6955171 -0.2153895 1450079_at 0.7191554 0.0297672 0.2850674 -0.3637726 -0.1428954 -0.2538094 0.1759305 -0.0978977 1450080_at -0.0758967 -0.771229 -0.7485964 0.4545546 0.2854567 0.2024487 0.0586945 0.0736291 1450093_s_at-0.1474762 -0.274436 -0.239264 0.9013925 0.3004564 0.391256 0.7959645 0.9725714 1450118_a_at0.0130447 -0.208352 -0.0793378 0.2000592 0.0820496 0.1186217 0.4795812 1.3414491 Page 105 of 205 Diabetes

1450122_at -0.2048281 -0.559337 -0.4316201 0.6183605 0.2954143 0.3926604 0.4988427 0.6205295 1450131_a_at0.0644138 1.0851313 -0.3433249 -0.4323006 -1.0275648 -1.1962478 -0.0790784 -1.3343493 1450154_at -0.3736088 -0.08626 -0.718167 0.7216718 -0.0198221 0.7132111 -0.0619707 0.4022969 1450185_a_at-2.2373774 -1.909164 -1.633286 0.2563219 0.4175223 0.463626 0.354269 0.5362134 1450188_s_at0.7029526 2.7495527 0.4319865 1.1465688 -0.4591967 -0.3347485 -0.3017443 -0.4984349 1450194_a_at1.1069313 1.1060226 0.5511172 0.320003 -0.257155 -0.1423243 -0.144375 -0.5535459 1450198_at -0.1062354 1.0924073 -0.2478949 0.0686369 0.3989788 0.2479837 0.643819 -0.0495524 1450206_at -0.2876676 -0.866644 -0.1810799 0.2056999 0.4198476 -0.0515822 0.1381849 0.3296231 1450209_at 0.3290175 0.9560025 0.05862 -0.0264456 -0.3163903 -0.0357988 -0.2660855 0.1054125 1450221_at -0.1605309 2.026471 -0.2353307 0.1676793 0.6181302 0.2595361 0.905174 -0.2344063 1450276_a_at0.5983428 0.4929293 0.6880058 -0.3462231 -0.0597781 -0.7999352 0.8774695 -0.16993 1450286_at -2.0881634 -1.836475 -0.5164528 0.7519598 0.7534208 0.9518173 0.4381863 0.6081922 1450292_a_at0.0061125 1.3835645 -0.1005341 -0.0670266 0.387246 0.0465272 1.3296596 -2.54E-04 1450295_s_at-0.2965779 -0.4761 -0.3745301 0.5131047 0.4693522 0.1896792 0.3473201 0.6569696 1450296_at 1.2630513 1.3347553 0.1616994 0.3802197 -0.1965799 0.0781811 0.1195724 1.5006281 1450344_a_at-1.2069248 -1.018074 -0.2964735 0.3507528 0.3939245 0.6500236 0.6961699 1.1268225 1450377_at -1.7188267 -1.264 -0.5481296 0.9635611 1.0590595 0.3202189 0.1527437 -0.261172 1450379_at 0.2281458 -0.637388 -0.3606756 0.5707326 0.4096094 0.0615639 0.1420207 0.277676 1450380_at -0.5086079 -1.020641 -0.6104866 0.5557861 0.3406631 0.5706655 0.2126242 0.2512652 1450387_s_at0.2008251 1.2727419 0.5832372 -0.0515609 -0.6872847 -0.9299046 -0.6360567 -0.7018457 1450389_s_at0.6285621 1.6559774 0.1692771 0.995451 -0.574393 -0.3010283 -0.209832 -0.4127394 1450391_a_at-0.4600713 -0.969726 -0.2345583 0.2946429 0.1229538 0.3179308 0.2609965 0.4150718 1450409_a_at-0.6464708 -0.962921 -0.4379771 0.8794713 0.4593836 0.6626498 0.3951184 0.502148 1450429_at 0.8873583 0.0480965 0.2654469 -0.3147354 0.0228448 -0.2381368 0.1739868 0.0613216 1450440_at 0.3263143 0.9582927 -0.082067 0.0574852 -0.0222108 0.0261974 -0.0144058 0.1954443 1450441_at 0.167253 3.2760224 -0.1341015 0.265744 0.5976567 0.4024395 1.3884172 -0.6162044 1450448_at 0.2897389 1.0183734 -0.1549847 0.357589 -0.0496623 -0.3013291 -0.4422525 -0.8398361 1450468_at -0.524163 -0.473505 -0.1041565 0.5942287 0.1701819 0.0439379 0.1949051 0.244809 1450469_at 0.1111636 2.096762 -0.1601497 0.4566233 0.4546849 0.3743022 0.9245768 -0.3443381 1450484_a_at0.6835126 -0.355506 0.1075262 -0.1976464 -0.065574 0.1209997 0.4540424 0.4819473 1450505_a_at0.4405705 0.6356763 0.3445928 -0.3474727 -0.5362107 -0.6591018 0.0068757 -0.2014039 1450533_a_at-0.0283529 -0.72089 -0.361361 0.2709765 0.2837098 0.1703893 0.5176147 0.8393993 1450552_at 0.0298028 1.0287051 -0.2089101 -0.0240788 0.1566127 0.1208015 0.3427862 -0.1869267 1450554_at 1.6839348 2.517295 2.0379746 2.0990195 -2.3400972 -2.141865 -1.6680163 -2.518085 1450562_at 2.301097 3.4746747 2.9126277 2.2594507 -0.9426142 -0.4144152 -0.6207451 -1.4699396 1450563_at -0.1822248 -0.832866 -0.0795139 0.253361 0.2573344 0.1808568 0.1322104 0.2066183 1450609_at 2.3963637 2.0100749 1.7218752 -0.0022833 0.104497 0.0285987 2.1138928 2.640249 1450611_at -0.6739453 -1.269365 -0.5200876 0.9697554 0.9284864 0.6671556 0.6313052 0.7909967 1450612_a_at0.1387651 0.9953593 -0.4367673 0.462182 -0.0723105 -0.0040122 0.2680941 0.4564986 1450624_at -0.1005948 2.2166662 -0.0011969 -0.1873837 0.4444607 -0.1582361 1.4171382 -0.0992993 1450636_s_at0.1935478 0.9878025 0.2816598 0.4688253 -0.2347692 -0.28079 -0.0859962 -0.2932696 1450646_at 1.4283407 0.8822925 0.6332434 -0.5783196 -0.5017511 -0.5509529 -0.5400378 -0.5034008 1450653_at -0.1108055 4.287248 -0.4054842 0.6177242 0.4913694 0.4876446 1.3282136 -1.5183711 1450658_at -0.6619411 -0.565848 -0.231261 0.5570998 0.4356979 0.739357 0.3496994 0.1982778 1450659_at 0.6346905 -0.055935 0.4486517 -0.2247841 0.0402509 -0.1111354 -0.4316436 -0.112041 1450663_at -1.35787 -1.052961 -0.2862327 1.1229434 0.7358443 0.7191166 -0.1085548 0.1498896 1450700_at -0.5451231 -0.091974 -0.1847005 0.0179138 0.0109976 0.4826939 0.6615763 -0.1490707 1450702_at -0.6311637 -1.320856 -0.3982873 0.6399984 0.4044756 0.9031372 -0.1126124 0.2569825 1450718_at 0.507679 -0.496518 0.0755889 0.2848549 0.1260044 -0.1715004 0.2646782 0.9521154 1450723_at 0.8275119 0.3596816 0.5189006 -0.9323523 -0.0475485 -0.6578957 0.6195887 -0.1580987 1450733_at -0.5314903 -0.578588 -0.170501 0.5200794 0.5337275 0.2903038 0.3207847 0.3942124 1450751_at -0.0824535 2.624745 -0.1691303 0.2422495 0.8660085 0.5123845 1.2617059 -0.1042329 1450752_at 0.0607594 1.9054595 -0.1752232 0.1425905 0.5162681 0.2274676 0.9471798 -0.1518629 1450761_s_at0.2179574 0.8138262 0.1118403 -0.0251873 -0.2466032 -0.3666159 0.1009134 -0.3174265 1450767_at -0.7853183 -0.818507 -0.5495049 0.5819423 0.410213 0.6104876 0.3780416 0.2281939 1450779_at 0.3162292 -0.19874 0.1771857 -0.0775034 0.1349803 0.4515269 -0.2827908 -0.5518953 1450782_at 0.6838 0.6923038 0.3081203 -0.109694 -0.3988244 -0.4040763 -0.2296335 -0.7228789 1450783_at 0.6661854 -0.10592 0.2519281 -0.5371883 -0.2212695 -0.1427879 -0.0478896 0.3408311 1450788_at 0.8892593 1.5866101 0.2611996 -0.1177825 -0.0364297 -0.0494481 -0.1375416 -0.0691282 1450789_at 0.4018902 0.8824829 -0.1362488 0.2990024 -0.1328412 -0.2982778 0.074818 -0.130198 Diabetes Page 106 of 205

1450790_at 2.021708 1.4180923 1.0132706 -0.092062 -0.296806 -0.2965083 -0.3101676 -0.4688771 1450793_at 0.0261732 0.8638765 -0.265772 -0.0573745 0.0390322 0.0232787 0.6728778 -0.1145816 1450826_a_at-0.3020819 0.0235069 1.9349458 0.2987828 0.1763861 1.1536105 -0.8540068 -0.9659756 1450828_at -1.2631056 -1.01852 -0.6547278 1.2991123 0.7492857 0.9686245 0.4479705 0.5704878 1450843_a_at-0.1103268 -1.016731 -0.4796197 0.8391619 0.4005743 0.470248 0.5252708 0.5420892 1450869_at -0.2735012 -0.577024 -0.1998165 0.5234494 0.5566744 0.5693544 0.3731512 0.3228383 1450882_s_at-0.4631479 -0.915833 -0.3396914 0.4406607 0.5690495 0.48864 0.2400235 0.3582748 1450886_at 0.5019045 4.393836 -0.1842514 1.0568254 1.1500635 0.9010517 1.9091654 -0.5496277 1450912_at -0.4905576 -0.577244 0.3377369 0.6241078 0.8557404 1.1696993 0.689178 -0.1645543 1450917_at 0.4426612 1.681746 0.4027634 1.3393469 -0.1374826 -0.0762446 -0.2231132 -0.1935035 1450920_at 0.5599462 1.3293786 -0.1904763 -0.3126149 0.0085224 -0.0472607 0.1390174 -1.033782 1450928_at 0.1845938 0.0433074 0.0855429 -0.9040413 -0.6965326 -0.676991 0.5037664 -0.3159099 1450933_at -0.6893766 -0.589371 -0.3857192 0.9443598 0.5280551 1.0550871 0.6619852 0.8497782 1450936_a_at0.5869638 1.7787752 0.6218517 0.760258 -0.4473162 -0.6414846 -0.1797249 -0.7071555 1450945_at -0.3326763 -0.676567 -0.1134908 0.4596975 0.5848137 0.4960371 0.2319781 0.3277753 1450956_at 0.6267365 0.9126434 0.1951921 0.4422362 -0.4974967 -0.3787532 -0.3697504 -0.2055694 1450962_at -0.0570699 2.9565682 -0.1807591 0.1900218 0.8972744 0.4768627 1.300001 -0.4057746 1450974_at -1.0911195 -0.776814 -0.4082978 0.9598198 0.511059 0.699239 0.6019621 0.6827784 1450976_at -0.5233052 -0.398057 -0.1223438 0.9971128 0.4313202 0.5502834 1.1128012 0.9108661 1450981_at -0.3028002 -0.663346 -0.2158737 0.886127 0.3476366 0.5520247 0.3855006 0.3266967 1450991_at 0.0806841 2.269084 -0.1345508 0.3458358 0.3837019 0.3009667 0.9662191 -0.2229404 1450995_at 0.4104345 0.7734765 -0.1171162 -0.3714171 -0.5898414 -1.0608623 -0.0757556 -1.1298724 1450999_a_at-0.0274439 2.9365754 -0.238587 0.5365734 0.6234481 0.580233 1.3302938 -0.3315325 1451001_at 0.0477535 3.5762591 -0.0467932 0.9201798 0.9535273 0.8940193 1.6269373 -0.12715 1451009_at -0.0109105 2.4649756 -0.2464669 0.3863168 0.5470681 0.4868122 1.1740494 -0.1485696 1451031_at -0.4470625 -0.994402 -0.3450362 0.6837769 0.2471123 0.5839571 0.1404923 0.1382011 1451041_at -0.6885111 -0.774044 -0.2930815 0.6005211 0.478731 0.6262148 0.3694077 0.3823493 1451047_at 1.8455126 0.8116028 0.8938727 -0.3147137 -0.3141998 -0.6032699 0.0488895 -0.0461291 1451054_at -0.4132297 -1.856641 -0.3005369 0.5121174 0.4854895 0.5712406 -0.0296701 0.381127 1451061_at 0.1409041 2.5758638 -0.3171318 0.3661375 0.4918051 0.2452094 1.3362442 -0.4509176 1451062_a_at-0.1708294 1.4341627 -0.2257955 0.2532551 0.395054 0.5565962 0.6805456 -0.214973 1451099_at -0.2787297 -0.919343 -0.4811754 0.7725129 0.3465757 0.5443752 0.6962745 0.7917767 1451100_a_at-0.3282979 1.3208902 -0.1684896 0.1159725 0.2703067 0.2325796 0.7494995 -0.2011415 1451103_at 0.5336609 1.0933964 -0.0932959 -0.2694988 -0.6835381 -0.5854168 -0.0721437 -0.3287598 1451105_at 0.092292 1.4749993 -0.3191253 0.2173798 -1.0045736 -0.9620112 0.5656654 -1.150123 1451122_at -0.0752862 0.0543556 1.9879854 -0.2093163 0.0277285 0.0260193 0.0819267 0.1139771 1451152_a_at0.7006316 0.8639588 0.3077707 -0.0554924 -0.4957171 -0.8297335 -0.2331279 -0.5935462 1451156_s_at-0.5872905 -1.024373 -0.6240884 0.3841963 0.2056536 0.5016251 0.2585014 0.6116321 1451169_at 0.0348743 -0.72527 -0.3907559 1.1185482 0.4290484 0.3644513 0.8202346 1.0032306 1451191_at 1.0386258 0.8439599 1.0163213 0.391525 -0.1908572 0.0283291 -0.2134341 -0.1552521 1451194_at 1.2124085 0.3833336 0.3713766 -0.4847157 0.0940078 -0.257811 -0.0798373 -0.3477434 1451203_at 0.9953685 0.8674921 0.2544906 0.1356599 -0.1692629 0.0494901 -0.1836162 -0.1931469 1451206_s_at-0.5469891 -0.577458 -0.1447299 0.3999991 0.4417845 0.4250286 -0.1227522 0.1665581 1451229_at -0.1060159 0.4330156 -0.7965128 0.5675557 -0.5066884 -0.4198529 0.2243403 0.1918065 1451236_at 0.6785541 1.5826817 0.270373 0.2269034 -0.5262237 -0.3700463 -0.1258082 -0.5362566 1451240_a_at0.9386954 0.6796775 0.4498854 -0.3640113 0.1158478 -0.3460041 -0.0977894 -0.1559032 1451257_at 0.1038493 1.6937363 -0.3932248 -0.2586567 0.1493654 0.045937 1.2158074 -0.1866317 1451261_s_at0.5025462 0.7948271 0.2227392 -0.2718005 -0.4377875 -0.1764705 -0.2103999 -0.3136463 1451274_at 0.1341353 -0.600111 -0.3195069 0.7805343 0.2518683 0.2736868 0.74506 0.7735348 1451285_at 0.2800579 0.5881264 0.3323433 -0.1086359 -0.594487 -0.5945391 0.1675838 -0.1949434 1451290_at -0.2353299 -0.55887 -0.3029573 0.8234305 0.3935526 0.4238848 0.6615632 0.6692762 1451308_at 0.8405491 0.4119698 1.3333741 -0.1040416 -0.0515258 -0.1034814 0.1610575 0.8087065 1451322_at -0.2012239 -0.993871 -0.2326517 0.1694818 0.1945746 0.3367287 0.0693544 0.2641589 1451323_at 0.6125696 0.9978808 0.2484531 -0.0370262 -0.3315503 -0.0603624 -0.2540576 -0.1626821 1451335_at 0.6801193 1.1952176 0.6824093 -0.7534413 -0.9636928 -1.1391076 -0.1991218 -0.8817838 1451339_at 0.5180756 0.8912641 0.072554 0.7212434 -0.22354 -0.3378081 0.20259 0.209981 1451342_at 1.220098 0.7468085 1.0847199 -0.2900286 -0.2620401 -0.4484666 -0.0048145 -0.4031016 1451347_at 0.2879618 -0.230254 -0.4485976 0.2208691 -0.1374309 -0.120044 0.4502578 0.6220291 1451348_at -0.8858635 -1.127327 -0.3516512 0.4969358 0.429586 0.6328249 0.1830654 0.1343495 1451363_a_at0.5589131 0.1295319 0.3175986 -0.6941226 0.001053 -0.5140532 -0.0189538 0.3063267 Page 107 of 205 Diabetes

1451374_x_at0.0380656 0.7931668 -0.289438 -0.0121529 0.0284166 0.0187551 0.474858 -0.2825623 1451375_at 1.2182919 1.8772979 1.0187442 0.7046223 -1.8234568 -1.7308098 -1.2720836 -1.4921693 1451407_at 0.9833192 1.7299374 0.6963791 -0.0045071 -0.6133429 -0.9495623 -0.4699508 -0.5250084 1451441_at 1.2822275 1.9873209 0.0048245 -0.1962886 0.1749825 -0.1676501 1.0440737 -0.2592673 1451461_a_at0.7131528 1.1425763 0.1118022 -0.3336568 -0.4205067 -0.5330417 -0.1082554 -0.0609371 1451499_at 1.0652484 0.9548861 0.4383503 -0.4789116 -0.4108391 -0.7993325 -0.2249791 -0.2441888 1451503_at -2.072166 -1.871968 -1.2554492 0.2344225 0.2354697 0.2987765 0.2768261 0.4277782 1451510_s_at0.0378569 -0.126212 1.8598368 -0.0122342 0.0662939 0.0122993 -0.1152366 0.0047495 1451527_at -0.4462049 -0.994917 -0.5849252 0.9317346 0.3520262 0.9590473 0.3514547 0.3823105 1451538_at 0.7881819 0.530221 0.4338986 -0.4128888 -0.293161 -0.2695927 -0.0123442 -0.1070263 1451547_at 1.6025634 0.6590365 0.4965816 -0.1777093 0.4028482 -0.0688485 0.2427028 0.0274771 1451555_at -0.4269066 -0.737537 -0.2020841 0.3850861 0.3375021 0.6628702 0.1404289 0.3210023 1451563_at -0.6003896 -0.955557 0.0840693 0.2993465 0.1717178 0.2872471 0.0627883 0.123505 1451588_at -0.6183422 -1.010169 -0.0373619 -0.136703 0.4147003 0.1406872 0.3834232 0.4668646 1451606_at 0.2008609 -0.96353 -0.2427514 0.2507258 0.0954638 0.4258089 0.8972454 1.2758516 1451611_at -0.327703 -0.877198 -0.2900248 0.1668859 0.1770231 0.2088139 0.1565778 0.3189745 1451612_at -0.2421261 0.7263401 0.6720253 -0.3206005 -0.3256116 0.0250894 -0.8710687 -0.2242349 1451625_a_at-0.229679 0.1165724 -0.6857648 0.1353045 -0.1644889 0.3076695 0.437926 0.3196634 1451626_x_at0.4512909 0.721292 0.0863029 0.2720618 -0.403098 -0.2425007 -0.3231289 -0.3503806 1451628_a_at0.6164259 1.3131175 0.3838564 0.0200315 -0.6979243 -0.9963235 -0.2548847 -0.6965186 1451650_at -0.109073 -0.570371 -0.3438718 0.4622605 0.4415116 0.0441115 0.5347093 0.8146596 1451651_at -0.2740345 -0.72197 0.2865161 0.2233861 0.3123465 0.745271 0.1480408 -0.1506883 1451660_a_at0.8957024 1.2509263 0.3568773 0.2222555 -0.5426137 -0.836475 -0.3231038 -0.3142074 1451661_at -0.0067688 2.7660112 -0.3051858 0.7562008 0.6237963 0.54635 1.2656232 -0.3218714 1451662_x_at-0.0947212 2.4314337 -0.3212529 0.6390789 0.4879932 0.636195 1.3077469 -0.3640898 1451675_a_at-0.2890246 -0.905808 -0.1041381 0.1160336 0.1042723 -0.1420785 0.6128898 0.0909956 1451679_at -0.4373603 -1.454283 -0.6784768 0.2050333 0.2525303 0.5779375 0.1589594 0.6800556 1451691_at 0.8258532 -0.177074 0.1098788 -0.0790852 -0.0872531 -0.0708307 0.3726972 0.1675843 1451701_x_at1.1888006 1.7970871 0.2692562 1.2263632 -0.852782 -0.9421663 -0.0614247 -0.6945712 1451718_at 0.4182333 0.4649521 -0.0348076 -0.6468451 -0.2747178 -0.550413 0.2072372 0.134645 1451733_at -0.4527901 -0.668678 -0.2890389 0.7789016 0.5880577 0.1515421 0.2766299 0.313589 1451740_at 0.7763456 0.8966175 0.2046571 -0.2341311 -0.5106367 -0.6058378 -0.4078492 -0.4734534 1451751_at 1.2782651 1.3338393 0.2932453 -0.8230817 -0.4668104 -0.6977629 0.1590489 0.4838503 1451764_at 0.6407538 0.8024998 0.2716485 0.1434286 -0.2956773 -0.2876632 -0.2469259 -0.3637866 1451771_at -0.1472346 -0.759227 -0.1114348 0.2571893 0.2739996 0.4408048 0.1701155 0.3003531 1451787_at 2.405139 1.7342929 1.0452527 -0.0990162 -0.1344478 -0.1954722 -0.2375461 -0.4159128 1451801_at -0.2806464 -0.338014 -0.3170134 2.2106495 0.5517358 3.0737624 0.3899318 0.3304119 1451803_a_at-0.4222548 -1.088067 -0.4270666 0.3637128 0.2990171 0.2469061 0.4099503 0.52296 1451804_a_at0.2901902 0.5569538 -0.2716237 0.0097225 -0.4624871 -0.3730539 0.0196541 -0.1049598 1451809_s_at1.1807716 0.5006589 0.8392578 -1.4489865 -0.613 -1.4749712 0.0957851 -0.5450155 1451827_a_at-0.7849529 -0.999771 -0.0332599 0.9110432 0.6943525 0.7227218 0.0881775 0.1018704 1451830_a_at-0.7402583 -0.57569 -0.1530552 0.7864509 0.5564438 1.0430865 0.2051813 0.3050823 1451839_a_at-0.7185973 -0.414086 -0.4111716 0.5126543 0.7951228 1.3369963 0.1825455 0.4734389 1451871_a_at-0.2790564 -0.834504 -0.0752504 0.2557049 0.4009243 0.0917444 -0.0562175 0.0347792 1451888_a_at-1.2794513 -1.429745 -0.5198288 0.2920656 0.4816004 0.782728 0.3708722 0.7310817 1451895_a_at-0.7193921 -1.140117 0.5976468 0.5007644 0.2185191 0.472197 0.1368259 0.3433662 1451897_a_at0.1665225 0.9750338 -0.2156371 0.1231046 0.144758 -0.1121891 0.4748928 -0.2022584 1451912_a_at-0.4591708 -1.174832 -0.3095968 1.0249524 0.5981962 0.7429811 1.0304184 1.1368634 1451932_a_at0.1007705 -0.687031 -0.2634987 0.9118457 0.4206797 0.4472064 0.9527397 0.89079 1451935_a_at0.3003776 1.0984151 -0.2128477 0.3860636 -0.6240633 -0.4696844 -0.0735699 -0.2710482 1451939_a_at0.8027529 0.116517 0.1380634 -0.2430649 -0.2490226 -0.1401406 -0.1052343 -0.0557229 1451940_x_at-0.0692924 -0.084226 -0.0603396 1.0884016 0.0460088 1.744928 0.0671843 0.1016818 1451946_a_at 0.088831 1.8630259 -0.1328255 0.2372525 0.1758422 0.0902389 1.0484076 -0.1533251 1451951_at -0.5657871 -0.596814 -0.2496673 0.0994363 0.4655575 0.5136908 0.295222 0.0315768 1451969_s_at-0.5748656 -0.91596 -0.1982055 0.2433138 0.2748152 0.5140063 0.2540658 0.368995 1451972_at -0.6499704 -0.200491 -0.3563422 0.1304174 0.1584398 0.3359061 0.5939897 0.4192718 1451976_s_at0.4239463 5.055639 -0.8032202 0.7682844 0.7203738 0.470749 2.0637484 -1.6257343 1452040_a_at0.3637606 1.2666953 -0.1355777 -0.4581537 0.0701255 0.0729253 0.50019 -0.5337434 1452071_at 0.8693023 0.6536949 0.2904733 -0.3107891 -0.1348886 -0.5512845 -0.2217665 -0.2287571 1452074_at -0.398078 -0.981149 -0.1413324 0.2873228 0.3839463 0.7556435 0.0693798 0.2794921 Diabetes Page 108 of 205

1452079_s_at0.1150512 1.1418433 -0.0898212 0.1276145 0.2538265 0.138094 0.5451844 -0.2810736 1452091_a_at-0.7148328 -0.489602 -0.2457233 0.4525852 0.315514 0.653059 -0.0129477 0.3354861 1452105_a_at0.0782003 -0.474692 -0.2751342 0.6386538 0.2604509 0.2916688 0.6446368 0.7662334 1452106_at 0.9590722 0.1823273 0.419441 -0.4016933 -0.2960412 -0.5883281 -0.4893435 -0.359721 1452107_s_at0.7571503 0.154711 0.3647162 -0.8500319 -0.5197166 -0.9208404 -1.1416998 -1.1561762 1452112_a_at0.1017214 1.6001797 -0.1919591 0.2185936 0.3706058 0.1983332 0.8256176 -0.0241952 1452114_s_at-0.2562971 -0.796124 -0.5282753 0.5362659 0.2496731 0.3579535 0.5893154 0.3184751 1452115_a_at-0.7027314 0.1017001 -0.5661528 -0.0360396 0.0216321 0.0514251 0.5033887 0.1444628 1452124_at 0.8805784 1.4733604 0.565079 -0.0012965 -1.3225292 -1.5129807 -0.6832746 -1.4793867 1452145_at -0.2911513 -0.297278 -0.0919881 0.7094965 0.3078983 0.4268694 0.6182931 0.573768 1452159_at 0.9268918 -0.128571 0.1422703 0.029808 0.0516397 -0.0956905 0.0391925 0.2959776 1452202_at -0.3186976 -0.619322 -0.2654901 0.8019247 0.0980772 0.6030308 0.4699427 0.5092509 1452203_at -0.2109649 -0.914472 0.1633759 -0.2776213 0.1543409 0.1190474 0.2696247 0.4835221 1452217_at -0.5463767 -0.562982 -0.1441655 0.5080328 0.245013 0.4410574 0.4625451 0.4257466 1452223_s_at-0.6277812 -0.932466 -0.4594913 0.6845679 0.4094198 0.5899466 0.3968522 0.4928052 1452227_at 1.1074853 0.831049 -0.104978 0.3844547 -0.1865267 -0.1480819 -0.4900891 -0.0962648 1452230_at 0.6230204 1.5013707 0.2438624 0.7316384 -0.3095793 -0.257988 -0.2115905 -0.1982047 1452240_at 0.0463661 0.8524864 0.0569758 0.6257823 -0.1887367 0.0100546 -0.2591373 -0.2771912 1452243_at -0.1544932 -0.335964 -0.2243247 1.3361533 0.4186574 1.2557154 0.1582708 0.8385463 1452257_at 0.2390666 0.786454 0.8311886 -0.2252541 -0.318779 -0.7101523 0.4383465 -0.6781063 1452264_at -0.4246402 -0.284057 -0.0480621 0.7250381 0.3235256 0.274124 0.9815499 0.9995384 1452280_at 0.0684851 -0.198151 -0.2912028 0.5013886 0.0681428 0.2906751 0.7383202 0.7161562 1452295_at -0.6375482 -0.902392 -0.3520098 1.2117081 0.52285 0.2617067 0.6530457 1.090353 1452298_a_at0.7894342 1.241993 0.1673634 -0.1165564 -0.6022174 -1.1330376 -0.2794317 -0.5726069 1452305_s_at0.1526847 1.4926176 -0.2661649 -0.0772922 0.2463118 0.0248624 0.5785978 -0.3425221 1452308_a_at0.3893988 -0.676106 -0.0465741 0.0985894 -0.2073042 -0.4508306 0.3010575 0.4810692 1452320_at 0.3896794 0.5365734 0.3178382 -0.0618694 -0.0413989 -0.5623694 -0.3851581 -0.8737605 1452333_at -0.5761447 -0.309554 -0.4496132 0.4239574 0.2133034 0.3431082 0.2172413 0.1599499 1452335_at -0.1053407 -0.817042 0.008233 -0.0610905 0.2839455 0.3218207 -0.0544532 0.2091271 1452338_s_at-0.3731973 -0.786286 -0.1655402 0.4189186 0.240958 0.1683281 0.1531935 0.2976659 1452354_at 0.7385726 0.6788961 0.1930761 -0.4173152 -0.2235767 -0.1664847 0.3144271 1.3734437 1452362_at -1.128797 -1.622741 -0.3400536 0.3754754 0.3498228 0.2396071 0.3474293 0.2964138 1452378_at -0.5857573 0.6913941 0.5799007 -0.0992389 -0.0547886 -0.1804133 -0.7335739 -0.3425361 1452387_a_at-0.5494998 -0.49528 -0.1706882 0.3698926 0.1146193 0.2891747 0.7521388 0.5562308 1452388_at -0.123067 0.5696895 -0.0683155 0.6172695 0.4030404 -0.5020446 -0.0523 -0.1170497 1452398_at -0.8443072 -0.857519 -0.6084006 0.6591129 0.4869553 0.7635357 0.3373829 0.4620129 1452404_at -0.4544498 -0.755267 -0.3950996 0.4794035 0.3942187 0.4468251 0.4773021 0.4238076 1452406_x_at0.2702322 0.062048 0.3186464 -0.2102313 -1.2094328 -0.2004919 -0.1028064 -0.3455486 1452407_at -0.221133 1.3520287 -0.6103367 0.2275906 0.1985451 0.2456766 0.8205693 -0.1485124 1452413_at -0.3486881 -0.370047 -0.0888983 0.5806639 0.282068 0.4924192 0.7608145 0.5610803 1452417_x_at-1.9607913 -1.565988 -0.726573 -0.0220904 0.0487144 0.5012299 0.2721354 0.2972597 1452418_at 0.6828914 0.610781 0.4210262 -0.2449293 0.0245293 -0.4705982 -0.5606791 -0.8676052 1452426_x_at 0.68367 1.1086628 0.6125505 0.2555041 -0.8424126 -0.473695 -0.343379 -0.469168 1452433_at -0.1385645 0.0259714 0.6147188 0.0338426 -0.048582 -0.0614723 -0.1977887 -0.4339458 1452436_at 0.0576832 -0.443128 -0.0482988 0.3178642 0.6314565 0.2968932 -0.296186 -0.434732 1452445_at -0.4232394 0.7484664 -0.174571 0.0416126 -0.0900111 0.0982966 -0.0476192 -0.4030164 1452463_x_at-1.1953884 -1.339595 -0.1365802 -0.2575245 0.1433077 0.7684574 0.3245357 0.2687235 1452473_at 0.564527 1.0057787 0.8108456 -0.2610512 -0.3263169 -0.8364685 0.2098923 -1.1991233 1452475_at 0.7922199 1.4820466 0.3697866 -0.0538173 -0.0477605 -0.2732329 0.0806597 0.7068674 1452493_s_at1.1760713 1.1645952 0.2328405 0.0316954 -0.4825059 -0.6215874 -0.1987186 -0.2476599 1452500_at -0.6069624 0.440809 0.3662528 -0.5556436 -0.2687164 -0.1944662 -0.5242207 -0.0822817 1452514_a_at-0.0161355 0.0413849 -0.0525126 -0.1735025 -0.0404174 -0.3296403 0.4585567 0.8075957 1452546_x_at2.7098188 3.5380492 2.8145504 2.7089624 -0.9502825 -0.3946753 -0.6892772 -0.8804913 1452565_x_at0.6847491 0.8478828 0.2675393 0.1850033 -0.6046209 -0.5812949 -0.3834055 0.1699581 1452583_s_at-0.618207 -1.313365 -0.3157661 0.1576858 0.1683838 0.2938353 0.1550268 0.3380521 1452598_at 0.643482 0.5221058 0.0544143 -0.669076 -0.2889172 -0.1885727 -0.023574 -0.3666714 1452602_a_at-0.0172892 2.3290768 -0.2564619 0.5599237 0.4732626 0.5582913 1.0785726 -0.204965 1452614_at 1.5629923 2.3756871 0.6364607 1.2401314 -1.8565279 -1.4411867 -1.2114015 -0.3976097 1452646_at -1.9347644 -1.517799 -0.7250366 0.5417633 0.2756716 0.3728262 0.0168626 0.3805421 1452651_a_at-1.1979703 -1.6963 -0.5313585 0.0239625 0.1988577 0.259638 0.22973 0.6521714 Page 109 of 205 Diabetes

1452654_at -0.8865714 -1.051837 -0.6951833 0.779891 0.6973693 0.8002908 0.6073353 0.7428505 1452655_at -0.4402508 -1.047344 -0.7471845 1.017971 0.5864488 0.8083087 0.5608983 0.8950295 1452656_at -0.7462091 -1.14019 -0.6142522 1.1763029 0.9118273 0.9245167 0.9542411 1.2713771 1452666_a_at-0.079561 -0.733447 -0.19654 0.8133216 0.3115846 0.5641896 0.8255264 0.9509022 1452703_at -0.4687543 -0.88975 -0.1212525 0.1768146 0.1720482 0.1585394 0.1999162 0.2984762 1452731_x_at-0.7004204 0.4624757 0.1584934 -0.4589524 -0.2314778 0.1524136 0.2346336 -0.3850552 1452732_at 0.1412685 -0.029891 1.8613725 0.0232217 0.0737845 -0.1211772 -0.1027414 -0.0473725 1452754_at 0.126092 0.9662714 -0.1843329 -0.1317854 -0.0679407 -0.2434866 -0.0561047 -0.3211184 1452768_at 0.3444698 -0.346005 -0.254575 0.5401158 0.1627554 0.0759937 0.6066119 0.7531996 1452799_at -0.8792635 -0.599186 -0.5441554 0.1297836 0.0764097 0.2055098 -0.0026983 0.1964064 1452829_at 1.3974983 2.0006948 0.4410825 1.5072937 -0.8928779 -0.898954 -0.3456432 0.103535 1452830_s_at1.1842275 2.1255634 0.5438799 1.2369013 -1.0550244 -0.9705569 -0.7040469 -0.2863556 1452864_at -0.4155271 -0.483402 -0.13862 0.0938749 0.1641419 0.2038816 0.6147922 0.9001846 1452913_at 0.3841916 0.0634574 0.2728267 -0.3876982 -0.0941082 -0.3992445 0.6644268 -0.1534917 1452919_a_at0.4004834 0.9199591 -0.1931207 -0.3393722 -0.3865244 -0.4767996 0.2384453 -0.343626 1453026_at 0.100672 1.7743058 -0.1917757 -0.0163302 0.2835295 0.2458135 0.6922617 -0.157913 1453092_at 0.1288642 -0.369109 1.7257656 0.1413436 0.0419366 0.0330192 -0.0674936 -0.1384001 1453107_s_at0.0807328 0.8353308 -0.2874456 0.0165197 -0.0445601 0.0673437 0.6808789 -0.2002426 1453112_a_at 0.219457 2.629397 -0.2160354 0.5107057 0.8074198 0.6362554 1.369453 -0.4209341 1453265_at -0.1075076 2.577264 -0.129282 0.2062051 0.9554714 0.4694352 1.0316925 -0.3425752 1453317_a_at-0.0260799 0.5160028 -0.6457284 0.0543101 -0.2750219 -0.3215033 0.5509427 0.2201948 1453360_a_at-0.3303162 0.5005989 -0.5263505 0.2498331 0.0524467 0.5098043 0.3916864 -0.1516229 1453571_at -1.0338168 -0.983221 -0.3441751 0.2628694 0.2524838 0.4866856 -0.026557 -0.0991634 1453677_a_at0.4711506 0.8351119 -0.0588324 0.0213363 -0.2373061 -0.4216404 -0.1725607 -0.2372443 1453678_at -0.1520692 0.4950835 0.0966139 0.5578296 0.2301436 0.1323822 -0.5773442 -0.0044158 1453724_a_at0.1121976 -0.918068 -0.4409401 0.6448474 0.2855192 0.436343 -0.113197 0.0158339 1453744_a_at -0.32543 -0.762184 -0.4158535 0.5779996 0.3335512 0.349128 0.537452 0.6696806 1453836_a_at-0.1195965 -1.147378 -0.3453758 0.2672963 0.0927496 0.2440239 0.1540883 0.3105694 1453851_a_at0.6476831 0.8801382 0.5753384 0.0053139 -0.016053 -0.4303072 -0.6452907 -0.3194078 1453881_x_at-0.1306598 1.2670417 -0.1147139 0.1480196 0.2079649 0.0476748 0.4257584 -0.3685627 1453901_at -0.1188265 2.4111195 -0.0308255 0.199723 0.5019128 0.0757801 1.210699 -0.20024 1453962_at -0.1096025 1.0792859 -0.2995904 0.1706579 0.366734 0.0525544 0.457765 -0.0664228 1454090_at -0.0579194 -0.029758 1.1108909 0.0597479 0.0030522 0.1806928 -0.1760548 -0.0128653 1454138_a_at-0.0582494 1.5181876 -0.1415547 -0.0080935 0.5828728 0.0823619 1.2573792 -0.0820008 1454152_a_at0.0914373 1.1660169 -0.0574299 -0.0351441 0.1459469 0.0280206 0.9884429 -0.2444588 1454231_a_at0.0647435 2.4484668 -0.1998419 0.0915406 -0.0264912 0.2460671 1.1115688 -0.7167358 1454613_at -0.2202146 -0.696887 -0.3765667 0.6025095 0.5203682 0.3319601 0.2440637 0.2755814 1454621_s_at0.5451317 -0.46589 0.0099521 0.2410235 -8.71E-04 0.0082953 0.1264852 0.6718702 1454622_at 0.8406116 2.4412756 -0.4952633 -0.0468791 -0.0211102 -0.8310865 1.1015862 -0.2403452 1454623_at -0.6806953 -0.774363 -0.5064225 1.0991001 0.5964581 0.7843446 0.3977 0.5752554 1454638_a_at1.5111076 1.5588448 0.8938984 -1.0019262 -0.2790059 -1.31652 -0.8464416 -0.9146913 1454681_at 1.0860868 2.0381374 1.0273452 0.5835936 -1.615551 -1.7902133 -0.7997478 -1.0066441 1454703_x_at0.7216456 0.9094485 0.5484473 -0.7953394 -0.1345325 -0.3852899 -0.0560786 -0.29846 1454712_at 0.6549025 0.9901397 0.3881621 -0.281013 0.028161 -0.3066868 -0.3878422 -0.2810914 1454713_s_at0.6382692 0.1304348 0.2535332 -0.3877742 -0.0170711 -0.3964296 -0.0888704 -0.2968356 1454714_x_at-0.7941787 -1.057019 -0.6765494 0.4403577 0.3124651 0.4686981 0.1780408 0.4965153 1454737_at -3.2722943 -2.595455 -1.8404145 1.4782596 0.6707109 0.7554043 0.4658863 0.3378878 1454803_a_at0.0238755 0.8885112 -0.0454534 0.2161758 -0.3168864 -0.1721214 -0.058742 -0.0020297 1454849_x_at0.2632053 1.4819503 0.0530756 -0.0177817 -0.3218229 -0.3599644 -0.1117551 -0.9638548 1454904_at -0.618047 0.1759275 0.7792521 0.1665976 -0.0810232 0.1143477 -0.0570407 -0.0815396 1454905_at 0.2501552 0.6870525 0.3880317 -0.4932098 -0.0954336 -0.6866392 -0.5998017 -0.7565785 1455039_a_at0.1454372 0.9397194 0.0211008 -0.0562062 -0.1835062 -0.1592682 -0.1712122 -0.2995825 1455099_at -0.8302932 -0.661424 -0.3547591 0.7626777 0.5958465 0.9013718 0.4595791 0.6862267 1455167_at -0.0436997 1.5741463 -0.2192206 -0.0795667 0.216247 0.0052279 0.774766 -0.3701568 1455180_at 0.4235803 1.146208 0.0996047 0.5590422 -0.5443419 -0.2464011 -0.2816852 -0.2905666 1455182_at -0.3797109 -0.728686 -0.1483758 0.2779613 0.4945522 0.3586651 -0.1574621 0.3911168 1455290_at -0.563604 -0.982866 -0.3407549 0.2477799 0.2697284 0.3966743 0.2809358 0.4562416 1455291_s_at-0.5498145 -0.820564 -0.3149021 0.1879692 0.2001843 0.3800219 0.2620452 0.3309714 1455343_at -0.6421491 -0.456621 -0.4476458 1.2703712 0.6942779 1.3352597 0.5741256 0.619282 1455423_at 2.7777543 2.2015991 1.5828176 0.4545319 -0.1019106 -0.3507256 0.8450403 -0.3995428 Diabetes Page 110 of 205

1455447_at -1.3954812 -1.151808 -1.1007292 0.8456867 0.5328821 1.0752614 0.7730672 1.2809118 1455477_s_at0.5620921 1.7935641 0.2950966 0.318553 -0.6340534 -0.8354608 -0.6288731 -1.2869133 1455482_at 0.1285338 -0.547721 -0.2799306 0.9949412 0.2393394 0.3770676 0.7963104 0.756574 1455490_at 1.1962372 0.2358717 0.2045476 -0.2723596 -0.0595691 -0.0997707 -0.1227298 0.0127087 1455494_at 1.6840384 0.2708316 0.6997962 0.1106029 -0.0562069 0.0099987 -0.3933309 -0.5634003 1455530_at -0.3536011 -0.488091 0.3454932 0.3713853 0.2201109 1.0348853 0.2504061 -0.0666348 1455582_at -0.2889582 -0.663937 -0.2650089 0.9437609 0.2953369 0.9272135 0.7502225 0.7245544 1455626_at 0.7155379 0.4161382 1.4136066 -0.9997678 -0.5896776 -0.9475806 0.0055497 -0.4656868 1455642_a_at-1.0116484 -1.287129 -0.5769219 0.8710032 0.6277626 0.8913057 0.6043307 0.6440811 1455653_at -0.1446054 -0.1043 -0.1843309 0.84324 0.1822791 -0.0128658 0.5195058 0.8268779 1455792_x_at-0.2928903 -0.828462 -0.3041205 0.3655815 0.3280664 0.6341957 0.3334103 0.4903043 1455796_x_at-0.3993244 -0.951806 -0.4101111 0.7096248 0.3974821 1.0347888 0.3188486 0.5345879 1455802_x_at0.2516902 1.5523853 -0.0477182 0.1803091 -0.1040867 -0.0041276 0.1098485 0.0138531 1455804_x_at-0.6625656 -0.829804 -0.2303338 0.3442726 0.302854 0.3276821 0.0885849 0.2027146 1455808_at 0.3257986 5.05923 -0.2134078 0.9702811 1.0577176 1.0656484 1.9376997 -1.0490353 1455831_at -0.466961 0.7387891 0.3893707 -0.5155492 -0.3677424 -0.2604343 -0.3205166 -0.3204028 1455869_at 0.7271295 1.2321172 0.4782641 0.1767016 -0.6127197 -0.4407036 -0.5931292 -0.8658829 1455892_x_at0.4990859 0.8715825 0.2763856 0.2933402 -0.7945059 -0.8273056 -0.1286303 -0.3296309 1455896_a_at1.0715016 2.0006948 0.5516515 0.5467567 -1.5259535 -1.5972844 -1.0603558 -0.8866614 1455898_x_at-0.0778363 1.3218322 0.0025086 -0.3860097 -0.0859916 -0.2666362 0.5018041 -0.4742826 1455899_x_at-0.2225593 0.3221741 0.7939839 -0.340517 -0.1354317 0.1109548 0.1064078 -0.0926468 1455901_at -0.1214652 -0.726321 0.0172157 0.2790151 0.2767752 0.077968 0.1363071 0.152236 1455904_at 0.32513 0.7928963 0.7863097 -0.5553231 0.0049992 -0.303114 -0.3618774 -0.3479044 1455918_at 0.2146478 -0.431551 0.11097 -0.2786741 0.3600857 -0.4240282 0.3698374 0.6282282 1455936_a_at-0.4668019 -0.57955 -0.3009915 0.5789928 0.4021856 0.3124979 -0.1608187 0.1973467 1455965_at -0.4405022 0.1224092 0.3067274 -0.4732885 0.1768103 0.0296825 -0.8355815 -1.0785893 1455991_at 1.3557594 0.9659534 0.8024159 -0.2872591 0.1068314 -0.138311 -0.0373653 -0.0643447 1456069_at -1.0067148 -0.933761 -0.8032225 0.7119243 0.7803739 0.8372289 1.1198869 1.2891313 1456101_at 0.026574 1.5267851 -0.0401809 -0.0306596 0.2822592 0.118115 0.9744546 -0.1148033 1456120_at -1.0315349 -0.215755 0.1555265 0.0888066 0.1508114 0.2223461 -0.1150351 -0.1297868 1456124_x_at2.5945797 4.081499 0.133424 -0.423938 -0.1085911 -0.3181903 0.451083 -0.2606454 1456133_x_at-0.4788268 -0.624994 -0.2710614 0.7300525 0.4582424 0.4898499 0.5319917 0.5564079 1456169_at 0.9044169 0.2920339 0.1951231 -0.2434168 -0.0259503 -0.0429968 -0.1687408 0.0941366 1456174_x_at-0.8016276 -0.191976 0.1129649 0.0789871 0.2444399 0.2981815 0.3885365 0.0670484 1456188_at 1.153625 1.6143186 -0.0820895 -0.0537092 -0.0384374 0.0020843 0.0078607 0.0856218 1456195_x_at-0.6678019 -0.639054 -0.2128778 0.5636058 0.4343058 0.5476049 0.3036963 0.3038848 1456377_x_at-0.2261984 0.8370524 -0.4544404 -0.0858665 -0.0083666 0.249704 0.5743437 -0.0973368 1456395_at 0.4119973 0.187542 0.2184254 -0.8684557 -0.2383067 -0.6987854 0.2372502 0.1903065 1456442_at -0.1265597 -0.516241 -0.3236958 0.8453419 0.1364712 0.6147412 0.6906168 1.046082 1456471_x_at-0.700439 -1.051393 -0.6272039 0.3885231 0.2668692 0.4258537 0.1590421 0.4415802 1456481_at 0.0722942 0.7338388 -0.0985749 -0.4485657 -0.2729774 -0.3751498 0.0964483 -0.4203754 1456495_s_at 0.438895 0.6618463 0.4623584 -0.0945923 -0.3630672 -0.5050752 -0.1819294 -0.6401325 1456515_s_at-0.0166327 3.794955 -0.5407304 0.7842326 0.6164895 0.6489295 1.5906833 -0.7686746 1456543_at 0.6675336 0.8689457 -0.3413987 0.2770422 -0.1791183 -0.3403389 0.6095309 0.3252831 1456584_x_at-0.6112764 -1.052488 -0.523339 0.6033077 0.3828278 0.5349531 0.1932748 0.5589688 1456601_x_at-0.0040258 -0.992403 -0.5996158 0.6507263 0.0888353 0.3654562 0.3510402 0.2963603 1456647_a_at-0.0535261 1.2867868 -0.0862213 0.0748717 0.1910628 0.3065367 0.7310388 -0.1359128 1456716_s_at-0.1107293 -0.789836 -0.489637 0.4881907 0.2415001 0.343811 0.3293072 0.6119483 1459211_at -0.1194011 -0.382194 -0.1287057 0.5694182 0.4134376 0.3881439 0.6657637 1.0987326 1459546_s_at 0.615648 2.9277663 0.6630869 1.2505376 -0.3612695 -0.0879071 -0.3810738 -0.4799487 1459894_at -0.4088261 -0.344127 -0.4945214 0.3629084 0.1906538 0.5778357 -0.023091 -0.0057672 1459994_x_at-1.1816888 -1.033031 -0.9023059 2.2509022 0.7323192 2.607845 0.7115852 0.923814 1460042_at 0.0744615 -0.085299 1.0698404 -0.0785565 -0.0346669 0.1705578 -0.2315428 -0.1973767 1460173_at -0.0248313 -0.523197 -0.2961075 0.600358 0.234227 0.4265722 0.7620904 0.7691549 1460187_at 1.2159927 -0.29217 0.1050572 0.3348143 -0.0484745 -0.2380928 0.7287991 0.3715477 1460190_at 0.6030791 1.1517282 0.5686128 0.3911212 -0.2623221 -0.5435926 -0.2258182 -0.3077509 1460197_a_at-0.5671113 -0.673282 -0.1968195 0.1069107 0.0436604 0.3738222 0.4529165 0.5745503 1460214_at 1.5228348 1.2891235 2.9508586 -0.125643 0.9824279 -0.1951951 1.8573838 -0.0943925 1460218_at 0.5301313 0.9247906 1.0737967 0.7910166 -1.4076523 -0.8701885 -0.7534971 -1.5477787 1460223_a_at-0.0021716 -0.897416 -0.5368513 0.888073 0.2508715 0.4011924 0.8064744 1.1230907 Page 111 of 205 Diabetes

1460229_at 0.0220737 2.639296 -0.1610011 0.1299577 0.5796302 0.2675493 1.3619972 -0.3236068 1460230_at -0.1658711 0.5057789 0.2739581 0.6048129 -0.0612994 -0.167973 -0.6183732 -0.1702952 1460232_s_at-0.0437685 0.6340119 0.0237189 0.0130152 -0.044165 0.0234085 0.9778646 -0.0483422 1460259_s_at1.1130443 1.1564407 0.405097 -0.4765389 -1.2331785 -1.3866689 -0.241557 -0.941806 1460292_a_at0.4417745 1.4415227 0.4413105 0.2945521 -0.8094888 -0.8169596 -0.2532606 -0.8183036 1460302_at -1.7960062 -1.420058 -0.7164629 0.9377832 0.9295044 0.4464592 0.3143358 -0.0838366 1460316_at 0.8779306 -0.234028 0.0334811 0.2752686 -0.0913338 -0.0937716 0.2139781 0.7267157 1460336_at 0.4106977 0.2855429 0.144063 -0.8502386 -0.3159077 -0.8031623 0.2025374 0.2086657 1460337_at -0.3552663 -0.775106 -0.1858254 0.2156816 0.2929638 0.6057915 0.0680602 0.3007997 1460340_at 0.014396 2.3249598 0.0269105 -0.0892928 0.6515552 0.2246359 1.2251555 -0.2348293 1460347_at 0.4782218 0.1216795 1.5433956 0.2877762 0.0618279 -0.0640385 -0.2979108 -0.2473718 1460351_at -0.1228468 -0.724931 -0.3222237 0.7032824 0.397868 0.4176823 0.5299006 0.6079776 1460360_at -0.329983 1.415617 -0.2600429 0.1517758 0.4033411 0.2521595 0.7644885 -0.1334225 1460372_at -0.8493092 -1.14582 -0.5897468 0.9888492 0.6343969 1.0104059 0.0275356 0.4147614 1460374_at -0.2113228 3.1401038 -0.2129468 -0.0474885 0.6920238 0.1252118 1.0885258 -1.1052424 1460378_a_at-0.0778874 0.6948288 -0.3107759 -0.1219378 -0.2080623 -0.0134305 -0.1875342 -0.4199462 1460398_at -0.7766016 -0.484674 -0.4130876 0.7422614 0.2975002 0.4810694 0.3392725 0.5525904 1460416_s_at-0.3726072 -0.204826 -0.1752778 1.0015328 0.4581878 1.5640727 0.1817033 0.6483305 1460417_at -0.5400084 0.5853168 0.5169256 -0.4877853 0.1995384 -0.0155061 -0.601473 -0.1120146 1460427_a_at1.7656574 1.6082709 1.0434837 0.1034997 0.0063596 -0.0032043 0.8442734 2.0088542 1460460_a_at0.1473075 0.7459936 -0.5370377 -0.1760922 0.0047521 -0.1411539 0.6557899 -0.2319729 1460512_a_at-0.0653705 1.101079 -0.2045652 0.1275944 0.3899528 0.0502714 0.7559693 -0.2075756 1460569_x_at1.0472244 1.8233715 0.38675 0.9980292 -1.025968 -1.1332382 -0.1707902 -0.932048 1460592_at -0.4127584 -0.900671 -0.2703641 0.159863 0.1760729 0.3436628 0.1775621 0.3997933 1460629_at -1.4234558 -1.857076 -0.6521983 0.6971707 0.522621 0.4054655 0.6950798 0.7369518 1460684_at 0.7308335 0.6229345 0.4183273 0.2669218 -0.1434475 -0.2524505 -0.3213565 -0.1402435 1460692_at 0.0452006 -0.244089 -0.4549747 0.5015659 -0.1833805 0.0047163 0.6859849 0.6214476 1460696_at -0.2156005 -0.789954 -0.3452025 0.5816145 0.2989464 0.4966928 0.4205742 0.5779082 1460723_at 0.5973462 0.3313669 0.5825775 -0.1183581 0.0031305 -0.0658985 -0.5346208 -0.2052021 1419871_at -0.4801759 -0.748555 -0.0892364 0.2810934 0.6436812 0.2274475 -0.010694 0.3415062 1420310_at -0.5736982 -0.168973 0.6930684 0.9190648 0.4983101 0.5282913 0.5595546 0.0923196 1428142_at 0.1883458 0.1562611 -0.1351272 0.2836506 -0.0973942 0.1663095 0.623899 0.9972007 1428167_a_at0.6077151 0.3908984 0.0634253 -0.6228471 -0.4969289 -0.5177857 -0.229342 -0.4807328 1428183_at -0.7229925 -0.450879 -0.1966813 0.6621413 0.4559187 0.3858078 0.1270696 0.200508 1428190_at 0.2797353 -0.682279 -0.4215758 0.3505335 0.0736458 0.1505909 0.4845702 0.7257354 1428223_at 0.8949765 1.4037471 1.0032461 -0.3026183 -0.0317911 -0.4689629 0.378338 0.6006258 1428260_at -0.5692061 0.3268598 -0.8831654 0.1417337 -0.0988091 0.2590684 0.51986 -0.197762 1428271_at -0.0887897 -0.788981 -0.328959 0.7499709 0.35387 0.5094788 0.7090368 1.013431 1428284_at 0.0351871 0.8165922 -0.1729144 -0.2534864 -0.2501454 -0.1570579 0.4072162 -0.2733113 1428352_at -0.0425632 0.5352674 0.0087951 0.6757994 0.2247203 0.2250329 -0.3781395 0.3321578 1428356_at -0.0325037 1.2404454 -0.2240052 0.2495799 0.0736357 0.2711674 0.8417654 -0.2419144 1428373_at 0.710036 1.4415761 0.2669593 0.3902907 -0.6921367 -0.4873306 -0.4245728 -0.5867028 1428382_at -0.0609522 -0.444441 -0.1535237 0.8026195 0.3125328 0.4215807 0.9149005 0.9640363 1428391_at -0.2710758 -0.306218 -0.5060281 0.5403051 0.1150591 0.4538476 0.9560683 0.6732798 1428393_at 0.1924778 0.2919712 0.8945297 -0.2757485 -0.0983363 -0.2174954 0.4196561 -0.2443631 1428433_at -0.5078688 -1.006832 -0.4070787 0.5342593 0.3161333 0.5127251 0.120526 0.4312655 1428447_at -0.6968521 -0.794774 -0.6546104 0.7936859 0.3728639 0.6736991 0.5594688 0.7003387 1428460_at -0.0139868 0.4616256 0.3857458 0.5469637 -0.1206047 -0.1572136 -0.7291768 -0.2586519 1428471_at -0.7652278 -0.88154 -0.2409675 0.2530828 0.1257204 0.1329124 0.1629108 0.2469635 1428486_at 0.2603725 4.7232203 -0.4483779 0.6912572 0.7135696 0.640451 1.6593574 -1.2574252 1428518_at -0.0582174 0.9963479 -0.3428137 0.2016037 0.0291336 -0.0176053 0.5417878 -0.2056098 1428541_at -0.2393928 -0.786331 -0.3253273 0.2366388 0.2251626 0.5191149 0.2351263 0.6037352 1428547_at 1.0717778 0.787689 0.3865805 -0.4561548 -0.5254146 -1.0295078 -0.2119649 -0.8745182 1428549_at -0.5236492 -0.962747 -0.6679803 0.6869702 0.3784372 0.5679601 0.4190254 0.4112352 1428613_at 0.56533 0.8580649 -0.1148096 0.5770135 -0.160257 -7.39E-04 -0.0159572 0.2555342 1428614_at 0.5395489 1.0762944 0.0061597 0.503386 -0.2074106 -0.1111197 -0.3166644 0.0564841 1428622_at -0.9715071 -1.111275 -0.3203511 0.3550544 0.3158714 0.5102619 -0.0457824 -0.0401503 1428628_at 0.2099979 1.8641762 -0.0756242 0.4329712 0.1719389 0.1836344 0.8954247 -0.2930565 1428650_at -0.450356 -0.566403 -0.1782291 0.7023859 0.3869196 0.5195837 0.632651 0.5482728 1428659_at 0.0510925 1.8758249 -0.0481693 0.0166025 0.1456282 -0.1003469 1.0121967 -0.3457104 Diabetes Page 112 of 205

1428665_at -0.039095 1.6446216 -0.2992808 3.22E-05 0.3348386 0.1419934 0.7966917 -0.2524548 1428680_at 0.1333104 0.9402958 0.0073392 0.2316287 -0.6486823 -0.2132582 -0.1605275 -0.2345028 1428685_at -0.0205389 3.0881958 -0.319512 0.3476305 0.665144 0.5896502 1.4417849 -0.6082061 1428703_at -0.0168899 2.202755 -0.1766933 -0.0036173 0.4629121 0.1421969 0.810219 -0.2966 1428705_at 1.0064662 0.946116 -0.103587 -0.1312115 0.1208286 -0.1663899 0.4414105 -0.3265254 1428719_at -0.7069533 -1.120717 0.2436432 0.379808 0.6871184 1.0940235 0.8973594 -0.5237691 1428720_s_at-0.7972194 -1.028172 0.0236906 0.1102071 0.4777768 0.8932269 0.4926424 -0.7256149 1428732_at 0.0480554 0.7505778 -0.3910992 -0.2134986 -0.0633339 -0.4233664 0.5266099 -0.00219 1428743_at 0.5370212 0.6296072 -0.1430413 0.0780046 -0.419282 -0.467884 0.0594471 -0.1557078 1428744_s_at0.5118953 0.9386276 0.006795 0.1229165 -0.4454557 -0.3428301 -0.0340103 -0.374938 1428774_at 0.0060699 -0.793177 -0.1645944 0.5588293 0.2630644 0.3919202 0.2513157 0.4147711 1428795_at -0.2610872 -0.898988 -0.2091982 0.211287 0.3495783 0.2673487 -0.0297422 0.3352712 1428804_at 0.6620519 1.5585226 0.4998026 0.6317325 -0.9780949 -0.5804202 -0.7242969 -0.969158 1428807_at -0.0965177 2.9507785 -0.1605209 0.0812432 0.623952 0.3710305 1.6132056 -0.4968922 1428809_at 0.5217743 -0.586699 -0.3670834 0.1925135 -0.1405711 0.1218189 0.6537145 0.5399396 1428812_at 0.4567916 2.0947895 -0.0546471 -0.1434345 -0.0094198 -0.2405362 1.2571845 -0.7089734 1428815_at -0.0167074 2.6251562 -0.1044229 0.1758194 0.61405 0.4658954 1.2183498 -0.3309232 1428821_at 0.8799236 -0.052974 0.0379686 -0.2660751 -0.0964378 0.117569 0.190327 0.6835941 1428834_at 0.3648593 -0.208507 0.1535127 -0.2826083 -0.011187 -0.4955619 0.9788752 0.8375918 1428837_at 1.057689 1.6043522 0.5723373 0.3216541 -0.7157168 -0.812667 -0.2507006 -1.0612403 1428841_at -0.0255009 1.1619192 -0.2051731 0.1919131 0.1777746 0.1206476 0.5384712 -0.3358172 1428851_at -1.1740582 -0.787 -0.1517975 0.3164964 0.4254658 0.3843411 -0.0025854 0.044906 1428896_at 1.0533355 0.6177349 0.4146378 -0.0566638 -0.3111609 -0.6071739 0.3362568 0.0147495 1428897_at -0.4222322 -0.771845 -0.3600336 0.734776 0.5820011 0.9893139 0.3717486 0.2886362 1428899_at -1.3452756 -1.685813 -0.7847149 0.641747 0.3007736 0.7009827 0.49657 0.7555399 1428926_at 0.9225178 0.9387052 0.7366446 -0.4239848 -0.1572881 -0.3855937 -0.2078635 -0.0760047 1428934_at 0.0958248 3.280525 -0.4867204 0.2566559 0.3911454 0.1801058 1.2599858 -1.011464 1428960_at 0.6970393 1.9040076 -0.0328641 -0.36062 0.2045406 -0.2195693 0.8043062 -0.7452059 1428962_at 0.184126 2.3710933 -0.0842966 0.1705983 0.4721686 0.3701298 0.8765822 -0.3276273 1428965_at 0.2311043 3.8626542 -0.1325999 0.6988758 0.9088651 0.9118288 1.8506622 -0.0815867 1428972_at 0.0357205 0.854002 -0.1905272 -0.1606047 -0.0808522 -0.2129792 0.5715411 -0.1784245 1428973_s_at0.1773443 0.9081981 -0.1289048 -0.275187 -0.060518 -0.1385889 0.5046382 -0.2740583 1428984_a_at0.5076234 1.7500882 -0.0284176 -0.4291796 0.4511789 -0.0980496 0.853711 -0.5455192 1428987_at 1.1800439 1.2430315 -0.4987323 -0.9425852 -0.3969067 -0.6149681 0.1021538 -1.2400337 1429013_at 0.7144601 1.9227495 0.7379248 1.0456114 -0.7364078 -0.6178497 -0.5643436 -0.7761868 1429028_at -0.391531 -0.877458 -0.0540068 0.0860314 0.3304543 0.171283 0.019269 0.0912657 1429029_at -0.3824192 0.3274064 -0.7081796 -0.1271203 -0.050129 -0.244285 0.2464994 -0.1499152 1429032_at -0.0050209 1.1883184 -0.1645012 0.1690567 0.1901039 -0.0311654 0.4954348 -0.3373369 1429037_at 0.1601823 3.401204 -0.1795151 0.6317271 0.551047 0.181039 1.3681313 -0.8099461 1429060_at -0.0802641 0.9259627 0.8022246 -0.6930704 -0.3753101 -0.2026543 -0.4548842 -0.2943904 1429074_at 0.1697186 1.2571366 -0.1439451 -0.1688161 0.2221777 0.055848 0.8894836 -0.3223389 1429102_at 0.0921885 2.4199827 -0.111316 0.2597985 0.6443199 0.4677379 1.1040945 -0.2081335 1429106_at -0.4538313 -0.573967 -0.3372043 0.603797 0.4818537 0.5762758 0.2500803 0.0216057 1429111_at -0.8719363 -0.502051 -0.7313461 0.532948 0.0710602 0.3110697 0.4240742 0.3210147 1429129_at -0.0165181 1.1868957 -0.1987449 -0.048224 0.1302075 0.1531174 0.6627644 -0.230611 1429130_at 0.1333685 1.3090065 -0.110862 0.0306389 0.1509367 -8.67E-04 0.6904146 -0.5427149 1429135_at -3.5973225 -3.250253 -2.232351 1.1081562 0.7203175 1.2625668 0.6270583 0.8269103 1429142_at 0.0581248 2.6477652 -0.4288291 0.4267817 -0.0060633 0.2772752 0.8774189 -1.0465075 1429143_at -0.0114603 1.5457201 -0.5107802 -0.0108712 0.2751541 0.0738923 0.7381126 -0.3431029 1429146_at -1.049164 -0.414957 -0.5973473 0.2272453 0.1751972 0.272678 0.3911734 0.3989452 1429154_at 1.4532278 2.5238729 1.2239842 1.8684571 -1.0024247 -0.7031378 -0.6836801 -0.9267316 1429169_at -0.8046724 0.1616333 0.1704212 0.2490602 0.3847421 -0.0155505 -0.5191696 0.3882527 1429195_at -0.6091168 -0.623764 0.01828 0.4526429 0.2934528 0.3256735 0.6955373 0.7007497 1429196_at -0.884329 -0.879241 -0.3221594 0.5504446 0.6713944 0.8158314 0.0386062 0.3827437 1429197_s_at-0.5640636 -0.793799 -0.2155592 0.599062 0.6627121 0.7942495 0.2472388 0.4625025 1429209_at -0.5766687 -0.76169 -0.5510972 0.712244 0.1748212 0.4443291 0.7657759 0.6058967 1429228_at 0.1294093 1.5166954 -0.624475 0.0528445 0.2820357 0.0377857 0.7218285 -0.3041364 1429231_at -0.065262 1.0128392 -0.0415291 -0.0834432 0.0568083 0.0220821 0.8078535 -0.1332181 1429254_at -0.1733007 1.5130206 -0.8683267 0.1606112 0.1146315 0.3332084 0.9746454 -0.3244842 1429262_at 0.9497215 0.3490114 0.5634661 -1.221308 -0.5828325 -1.6415241 -0.2843483 -0.0264322 Page 113 of 205 Diabetes

1429263_at -0.1902699 1.3008668 -0.0992782 0.0112346 0.309229 0.0943711 0.6893103 -0.2676427 1429268_at 0.3346512 4.002809 -0.0898337 1.2628903 0.7854928 0.898382 1.8790852 -0.471615 1429273_at -0.1299686 0.1519361 0.3587239 -0.7092438 -0.0711887 -0.6389232 -0.5346244 -0.781107 1429297_at 0.2682352 0.8935109 0.1597062 0.4593244 -0.1658119 0.0389414 -0.1697797 -0.1386733 1429298_at 0.6042086 0.9345508 -0.0053324 0.2282503 -0.2927757 0.0384038 -0.5453243 -0.7306131 1429323_at 0.0160754 1.3095315 -0.120729 0.1335652 0.3569388 0.2042764 0.9106584 -0.2719312 1429324_at -0.0845293 2.9175658 -0.1343168 0.1063547 0.6821572 0.4246496 1.5403386 -0.4300898 1429332_at -0.9105651 0.3582339 -0.072098 -0.1263123 0.0559999 -0.0339808 -0.2152573 0.1109942 1429333_at 0.0075749 2.8613582 -0.1584952 0.4396927 0.7990531 0.5797025 1.1226403 -0.2139077 1429340_at 0.1447489 3.4411376 -0.3450935 0.6869118 0.7333995 0.6079857 1.7317866 -0.2093479 1429346_a_at0.0491339 0.8566036 -0.1859155 -0.0866685 0.084126 -0.091007 0.8083382 -0.1295687 1429350_at 0.1649195 3.6732469 -0.4374588 0.1498284 0.5173791 0.0937732 1.4281565 -0.7464712 1429353_a_at0.2941293 3.7890413 -0.1347026 0.2194454 0.7726747 0.6043266 1.6800383 -0.5661454 1429355_at -0.0900284 1.1366777 -0.057354 0.0046356 0.0058192 -0.003752 0.4946855 -0.2612869 1429365_at -0.1563034 1.6476603 -0.1219693 0.1378763 0.2651702 0.0690756 0.7824526 -0.4828617 1429366_at 0.6295397 3.2619424 -0.1651259 -0.2181569 0.7997782 0.0793008 1.1084634 -0.9015173 1429374_at 0.1987125 4.450716 -0.306222 0.8573971 0.8256405 1.081258 1.8952948 -0.4210143 1429387_at -0.5165148 -0.443488 -0.0655206 1.3747182 0.7613244 0.9566296 0.4990768 0.3236227 1429390_at 0.6917338 1.1470866 0.2824656 0.558178 -0.3081475 -0.2276278 0.1358295 -0.1192794 1429397_a_at0.0013314 3.006598 -0.0915179 0.8759192 0.7201867 0.8597947 1.5926617 -0.1576468 1429399_at 0.5269892 0.3765669 0.357851 -1.0857744 -0.0887112 -0.9854286 -0.9871747 -1.3352038 1429406_at 0.0035164 2.3254333 -0.0846543 0.0963252 0.5958409 0.2831865 1.2004242 -0.3345218 1429408_at 0.1326205 2.615654 -0.3017179 0.4421884 0.7037067 0.4112105 1.1037118 -0.359866 1429409_at 0.1314387 4.1151853 -0.3254869 0.2755076 0.9616783 0.6909823 1.9884981 -0.3507661 1429413_at 0.2775028 0.8959706 0.09873 0.3455472 -0.1425755 -0.221953 -0.1348259 -0.0850496 1429419_at 0.2039335 1.5485333 -0.180059 -0.1265879 0.2204236 0.0645511 0.6199603 -0.3377722 1429424_at -0.0574612 2.6033542 -0.1234283 0.1716651 0.2042681 0.3888267 1.1169237 -0.3949205 1429445_at 0.1066179 1.5971437 -0.1153777 0.1305728 0.3257741 0.1675043 0.8952921 -0.1406609 1429449_at -0.6922828 1.1393454 -0.5002483 0.5551248 0.3068549 0.0597862 0.9725784 -0.1716283 1429450_at -1.4216928 -0.090719 -1.1961265 0.3183365 0.301869 0.3459315 0.5794945 0.1665754 1429460_at 0.8337288 0.2632631 0.9402237 -0.0497789 0.0501444 -0.241136 0.1909413 -0.2619022 1429465_at 0.2376036 4.263764 -0.226116 0.8453304 1.1814674 0.8326193 1.5479542 -0.5007001 1429467_s_at0.8350368 1.2803018 0.2618589 -0.2743862 -1.1125069 -1.3466145 -0.6479915 -1.3866495 1429470_at 0.1607391 1.6786702 -0.1518193 -0.0658301 0.1801656 0.0730593 1.022724 -0.2011965 1429471_at 0.673607 2.4600587 -0.2650437 0.110373 0.3742009 0.2549138 0.8952243 -0.8401267 1429478_at 0.1414183 0.7412973 0.0829166 -0.2536786 -0.6267004 -0.1070742 -0.2287288 -0.4165724 1429480_at 0.2193426 2.2397356 -0.2315177 0.2026799 0.5234296 0.4233105 1.1530062 -0.2040222 1429482_at 0.0676289 1.8332818 -0.0597594 0.264837 0.5790967 0.2379508 0.9917348 -0.1096276 1429506_at -0.2538463 -0.065085 -0.3457618 0.4211133 0.0595282 0.44907 0.4656954 0.7044797 1429509_at 0.2793661 -0.382081 -0.15777 0.9025459 0.3409925 0.2366979 0.7653009 0.8552952 1429510_at 0.5211233 0.1795969 0.1526898 -0.3872554 -0.2031548 -0.1820744 0.6135728 0.4826497 1429511_at -0.1447204 1.2835414 -0.1227657 -0.149914 0.1316189 -0.0534104 0.9459837 0.0276928 1429512_at -0.0350552 2.6330962 -0.1390604 0.2272534 0.4738026 0.365161 1.1648151 -0.2624365 1429513_at 0.1184871 4.2486935 -0.0696808 0.8794749 0.8757951 0.9349197 1.8294001 -0.3915412 1429522_at -0.2259899 1.5166142 -0.5755891 -0.1068566 0.2311721 0.2955173 0.9278894 -0.0513643 1429524_at -0.2249337 -0.696217 -0.0633925 0.4249146 0.3223724 0.9532427 0.0907386 0.0203846 1429542_at -0.0892322 1.5858259 -0.0137089 0.622648 0.2206059 -0.0244931 0.8617179 -0.3950789 1429546_at 0.1321363 1.2912842 -0.3673628 -0.0949221 0.1789827 0.0232002 0.7660324 -0.2247463 1429547_at 0.0295684 1.5451134 -0.0446109 0.0867021 0.3676346 0.1387714 0.7681616 -0.209419 1429551_at 0.1306958 1.1690867 -0.4378694 -0.2021949 -0.3535723 -0.5692489 0.1952545 -0.6257094 1429552_at 0.4786936 1.9978708 -0.0106902 -0.2903733 0.0507872 -0.4134812 0.8990994 -0.5503388 1429571_a_at-1.5966127 0.2364696 -1.5901827 0.4195571 0.5129665 0.5508843 0.7054524 0.1995899 1429572_at -0.0779437 1.7686952 0.0524244 0.0872583 0.4648869 0.2060575 1.0393571 -0.1665236 1429573_at 0.0179765 1.6584798 -0.1489356 0.1581712 -0.3182159 -0.875851 0.2102626 -0.4333172 1429576_at 2.12E-04 1.8776743 -0.1111125 0.3427649 0.5571865 0.1841497 1.1157646 -0.2663926 1429577_at 0.0322208 2.2421305 -0.1785338 0.4208267 0.3801495 0.1440464 0.9825209 -0.6236894 1429578_at -0.1486162 1.4889042 -0.1968144 0.2283194 0.1691624 0.2557488 0.7736066 -0.2683633 1429605_at 0.0619662 0.9582726 -0.1169578 -0.0154073 0.3159975 0.0522844 0.5518368 -0.1463192 1429609_at 0.0581006 1.431716 -0.2766984 -0.0747683 0.1290151 0.1776602 0.5200067 -0.2137381 1429611_at 0.0531093 3.3074799 -0.0880822 0.556021 0.637873 0.5895726 1.4106859 -0.707324 Diabetes Page 114 of 205

1429635_at -0.0960286 0.7324225 -0.2692618 0.0267372 0.1858066 0.1490839 0.4409227 -0.1154493 1429636_at 0.2603542 3.9048767 -0.1764082 0.7667394 0.9723495 0.9081162 1.9438477 -0.3706051 1429640_at 0.2931899 2.456532 -0.0563742 0.0189378 0.6929652 0.5918624 1.6539931 -0.2697545 1429642_at 0.6512895 1.3144785 0.0837013 -0.6691756 -0.2346471 -0.3604675 0.2573608 -0.5957778 1429647_at 1.0198653 0.5386621 0.0736302 -0.1520761 -0.004345 -0.1148653 0.3400776 -0.2395612 1429662_at -0.1373377 2.261291 -0.0926052 -0.1098495 0.4576421 0.2413263 0.8808244 -0.3244947 1429666_at -0.0434781 1.9643732 -0.0854585 0.1268206 0.270391 0.4347266 0.9377734 -0.2013874 1429674_at -0.3905394 0.9299957 -0.3747803 0.0853634 0.452035 0.1529976 0.7927634 -0.0100519 1429675_at -0.0693978 2.1512296 -0.1073988 0.2130038 0.6043339 0.2710994 1.395805 -0.0692786 1429676_at -0.4921765 -0.429816 -0.2560058 0.4483385 0.1125496 0.8246094 0.2219508 0.2435835 1429682_at -0.2583883 2.445036 -0.4832467 0.0117018 -0.0514724 -0.0401467 0.718051 -1.4253944 1429687_at -0.0179431 2.9630914 -0.152406 0.2670094 0.7882834 0.336131 1.44708 -0.4628345 1429695_at -0.0694206 1.101097 -0.3565501 0.0237012 0.286872 0.3634776 0.6071649 -0.1651238 1429697_at 0.0547682 2.3222694 -0.2069849 0.2426293 0.4003156 0.4699178 1.010529 -0.2167096 1429700_at 0.628345 1.07833 -0.0485162 -0.1042261 -0.357671 -0.3435997 -0.2542926 -0.5641723 1429701_at -0.3185266 1.3351729 -0.1215553 0.0596198 0.1346741 -0.0528837 0.9746194 -0.0275201 1429706_at 0.0891796 3.333024 -0.2165712 0.521736 0.8915275 0.7521153 1.5026668 -0.5789033 1429712_at -0.4345443 -0.800375 -0.387403 0.382771 0.2466869 0.3813257 0.3785388 0.3383083 1429734_at -0.3160358 1.1695788 -0.053909 -0.0639267 0.1311441 0.1868841 0.7953372 -0.4362325 1429737_a_at0.5611253 0.512284 0.3888822 -0.5674043 0.1399685 -0.7647661 -0.3416545 -0.4544007 1429744_at -0.0684841 3.8345149 -0.6541243 0.9591546 0.5814998 0.8198616 1.4284506 -0.868444 1429746_at -0.2461356 2.4048147 -0.2695435 0.3045175 0.7974309 0.5007215 1.360881 -0.3183406 1429747_at -0.2929342 3.394367 -0.4552401 0.4523444 0.281484 0.5296019 0.9908474 -1.3496543 1429751_at -0.0378677 0.9773432 -0.1003922 -0.0659945 0.2192359 0.0173589 0.8704966 -0.0122426 1429754_a_at0.3080326 3.1318111 -0.1641239 0.493947 0.5643525 0.4968511 1.7318863 -0.2743386 1429757_at -0.0272315 1.8793173 -0.1117224 -0.0192274 0.6133921 0.2288898 0.9733791 -0.2964675 1429767_at 0.3972807 0.3711171 0.385731 -0.562036 -0.0736311 -0.6206731 -0.161163 -0.0610782 1429781_s_at0.1865696 1.6851985 -0.0394516 -0.2378392 0.2006541 -0.2268573 1.0236205 -0.2809431 1429788_at 0.0175087 1.1275984 -0.0895626 -0.0154564 0.0965645 0.1785998 0.4381104 -0.2774915 1429795_at -0.0760953 1.4259402 -0.2285285 0.1525097 0.3604198 0.2922582 0.661644 -0.3638302 1429803_at 0.201297 2.533154 -0.1707954 0.4471805 0.501345 0.4382996 1.0875176 -0.3421906 1429807_at 0.0901526 2.383605 -0.2559356 0.3902224 0.6743512 0.4486057 1.3048733 -0.1731819 1429810_at -0.6963022 0.3192132 0.2909217 -0.1299052 -0.0682253 0.1176782 -0.2368074 -0.0037011 1429815_at 0.2597105 1.7937012 -0.1459397 0.0576446 0.4835437 0.2291226 1.1463872 -0.1604241 1429816_at 0.0181499 1.2053971 -0.1429884 -0.0919502 0.327583 0.087252 0.8946726 -0.4052912 1429824_at -0.3398061 0.4626901 -0.3857073 0.0300701 0.2503591 0.082048 0.8255045 0.0360859 1429825_at 0.0243214 2.1406884 -0.3391784 0.2247295 0.7761468 0.3403674 1.1472017 -0.1887697 1429827_at 0.0220412 1.7555027 -0.1615222 0.0428236 0.3904789 0.2696924 0.9711146 -0.1577571 1429828_at 0.1521583 2.9848704 -0.2530189 0.7078121 0.5910999 0.6646419 1.340494 -0.2136877 1429829_at 1.3480439 1.876849 -0.0652747 0.1813955 0.0198636 9.00E-04 -0.0589287 0.0424228 1429838_at -0.1129139 1.7628272 -0.0044672 0.1040599 0.28927 0.3700507 1.1174374 -0.2528347 1429842_at 0.0953833 1.8543236 -0.2716086 -0.3079016 0.1621103 -0.0979503 0.8771583 -0.43465 1429851_at 0.1675118 2.5245395 -0.2642932 0.1824865 0.5632788 0.2738432 0.8109608 -0.4834259 1429852_at -0.2441543 0.3554108 -0.4932151 -0.0124321 -0.0096312 0.1912371 0.89853 0.3300355 1429853_at -0.055997 2.3452659 -0.0990732 0.4451084 0.5117324 0.6465716 1.2044667 -0.4197415 1429854_at -0.136685 0.9387778 -0.0079429 0.0937709 0.4197754 0.1185772 0.6303293 -0.1006191 1429855_at 0.1534306 2.660086 -0.0984274 0.435614 0.3747054 0.4104394 1.536622 -0.151935 1429857_at 0.9555136 1.1430224 0.2486515 0.4096594 -0.3585674 -0.3334718 -0.0418231 -0.2711468 1429858_at 0.0780479 2.024035 -0.0820472 0.1903724 0.538259 0.2600143 1.3877004 -0.1020251 1429868_at -0.102271 2.152542 -0.1511767 0.1782398 0.6683517 0.2252257 1.1452665 -0.2279654 1429875_at -0.0510934 0.5280691 -0.0127017 0.032846 0.0778332 0.1269245 0.9701824 -0.0547255 1429877_at -0.4105804 0.8933332 -0.8098589 -0.3608921 -0.0333703 0.2068465 0.7195997 -0.1122909 1429886_at -0.0681175 1.6907085 -0.3438542 0.2857962 0.1836169 0.1047385 0.9692953 -0.041471 1429896_at 0.7425996 0.9985158 0.338102 0.2392027 -0.5784779 -0.3537768 -0.1776951 -0.3793956 1429900_at -0.8655626 0.5974565 0.4674401 -0.6868906 0.0146971 0.0403654 -0.7204459 -0.223883 1429909_at -0.2969651 -0.635604 -0.1555436 0.1570699 0.2172377 0.2976627 0.7303435 0.8840839 1429912_at -0.0760362 1.0876516 -0.2041293 0.0670579 0.4167294 0.2168288 0.5482103 -0.1600758 1429923_x_at-0.0119824 2.8608356 -0.4683622 0.5527549 0.2510372 0.2957968 1.2830647 -0.6004995 1429928_at -0.1595337 1.3855958 -0.1902212 1.54E-04 0.2812759 0.1276057 0.6581278 -0.3811598 1429930_at 0.125713 1.3748064 -0.1636446 -0.2223959 0.2393036 0.1139618 0.4663936 -0.2956168 Page 115 of 205 Diabetes

1429935_at 1.0351117 2.7588346 0.669578 0.5700524 -0.8043463 -0.5379192 -0.2775189 -0.5728343 1429936_at 0.2751594 0.6914572 -0.3186989 -0.1367106 -0.1852034 -0.2283971 0.426863 -0.2604006 1429952_at -0.101675 1.2672427 -0.1466924 0.0386741 0.0183741 0.1617518 0.8388505 -0.3935303 1429961_at -0.1705641 1.2269456 -0.5344902 0.1364234 0.0742429 0.0342283 0.8490842 0.0850541 1429970_at 0.0684958 1.5449901 -0.3139224 -0.0708122 0.4043993 0.1956226 0.5435551 -0.340835 1429971_at -0.2824048 -0.606633 -0.0987539 0.4338403 0.4616391 0.4028049 0.2146866 0.2749386 1429973_at 0.0219294 2.198275 -0.149168 0.2145519 0.628385 0.2637765 1.2915102 -0.2061869 1429975_at -0.0894945 1.0620412 -0.1058454 0.107909 0.4420838 0.1769306 0.693159 -0.2234674 1429989_at -0.0021418 1.4815242 -0.0629309 0.1924179 0.1745867 0.296596 0.9763926 -0.1665039 1429993_s_at-0.540238 0.4965085 0.4381386 -0.1232083 -0.0505485 -0.02935 0.7517514 -0.4712161 1430001_at -0.0835298 0.8574151 -0.1415364 0.0799785 0.4766208 0.0549253 0.9874005 -0.1720327 1430002_at -0.0261885 2.8401487 -0.0808003 0.3962033 0.426059 0.5990506 1.1564466 -0.344525 1430004_s_at-0.0158585 1.5320145 -0.1977034 -0.0027266 0.1400172 0.1720043 0.9517368 -0.2300623 1430009_at -0.0244575 2.4072137 -0.2330773 0.2731205 0.8846283 0.3600595 1.0038588 -0.338771 1430016_at -0.1738236 1.1086304 -0.1705299 -0.0673949 0.2676126 0.1358435 0.5249111 -0.1439869 1430023_at 0.0959277 1.2522469 -0.2916154 -0.1108258 -0.0780885 -0.2177861 0.5128906 -0.055573 1430044_at -0.0071286 1.4016234 -0.1007751 -0.0824933 0.151087 0.0138024 0.6154941 -0.1659079 1430049_at 0.1151758 1.7147316 -0.1609817 0.2436456 0.4566064 0.1829741 1.0830158 -0.0509588 1430057_s_at-0.4261726 1.0405583 -0.7185718 0.1896477 0.1978969 0.2196249 0.782952 -0.1095308 1430063_at -0.0634236 2.0326958 -0.3192463 0.2896817 0.0746331 -0.0055096 0.6456278 -0.9053499 1430072_at -0.2350757 1.1271219 -0.1911103 0.1250076 0.0372919 0.1560017 0.8719518 -0.2415362 1430082_at -0.2697861 1.7842838 -0.091424 0.3821993 0.3260391 0.3158788 0.4910344 -0.6285821 1430091_at -0.2241016 1.5334232 -0.0398971 -0.1229408 0.4750449 0.1347203 0.4846985 -0.4495616 1430096_at 0.3489605 1.6561509 0.2964726 0.2119086 -0.2353085 -0.2548972 -0.3408097 -0.2673936 1430102_at -0.0795316 1.7015414 -0.0489166 -0.0221963 0.4493371 0.2810778 0.6306502 -0.3050234 1430106_at -0.0525895 1.0997772 -0.247654 0.0758116 0.114025 0.2049522 0.7158875 -0.0531234 1430107_at 1.3474803 2.4676225 2.1374702 1.4737551 -1.7443899 -1.2348325 -0.5826311 -2.002752 1430121_at 0.0525994 2.6896052 -0.116844 0.3941822 0.4448528 0.3666192 1.1012646 -0.2343458 1430135_at 0.9265972 1.8122939 0.7921882 0.4670465 -0.4770407 -0.5924804 -0.2838331 -0.4613811 1430140_at 0.1860835 2.420354 -0.0286248 0.3675516 0.7522711 0.413474 1.3020562 -0.0574741 1430143_at 0.7012545 1.9374888 0.3917359 0.3709965 -1.8230598 -1.991793 -1.2345814 -2.2231193 1430165_at -1.0593871 -0.006644 0.1673534 0.062326 -0.4436905 -0.0362003 0.1272461 0.0950163 1430169_at 0.0630516 1.3355364 -0.1424512 0.229521 -0.1205652 -0.3101959 0.2248976 -0.7026016 1430181_at -0.1427779 2.0155966 -0.2647315 0.5562117 0.35701 0.4018428 1.1064587 -0.4155079 1430182_a_at-0.1105365 1.3691748 -0.1699339 0.0431445 0.1927528 0.0130553 0.8575578 -0.2244868 1430186_at 2.2165504 3.8403704 3.0699916 3.1218257 -0.6483363 0.0924323 -0.449839 -0.7483353 1430209_at 0.1842198 2.2602062 -0.2120681 0.3671173 0.7726706 0.5331212 1.051689 -0.2980622 1430214_a_at0.5468301 0.9422286 0.4354978 -1.0041058 -3.93E-05 -0.6301569 -0.2426276 -0.4213843 1430215_at 0.8849711 0.8259947 0.2947556 -0.5232782 0.1370213 -0.3616242 0.239251 -0.1554817 1430217_at 0.5256281 1.1325905 0.2624991 0.2078664 -0.0845307 -0.2644227 0.5227922 -0.3625375 1430232_at 0.183996 1.1830941 0.0372566 -0.0576506 -0.2307184 -0.2896162 0.1581945 -0.2905057 1430235_at -0.2220326 0.9280114 -0.0379084 0.1463943 0.2456079 0.0673538 0.5994272 -0.1375386 1430281_at 0.0171133 1.7119619 -0.3163184 0.1750214 0.536989 0.2960209 1.3909992 -0.1832733 1430314_at -0.1821876 1.8794231 -0.3299431 0.213277 0.1462796 0.3483706 0.7940209 -0.1463896 1430331_at 0.184836 1.7711084 -0.0365372 0.2502765 -0.2055829 -0.2457872 0.1865596 -0.3236025 1430342_at -0.0376042 1.0869024 -0.0543153 0.0593727 0.131213 0.0939012 0.8057651 -0.2418624 1430351_at 0.2150205 2.9153357 -0.2593335 0.8678746 0.5903994 0.4992597 1.2248596 -0.498071 1430352_at -0.7900047 0.3667774 0.4731717 -1.0400786 0.0201094 0.3098943 -0.7633842 -0.019608 1430362_at -0.7465766 0.3702517 0.5701796 -0.9247243 -0.1904822 0.1925103 -0.6795341 0.1264722 1430364_at -0.0303214 1.1203765 -0.1451123 -0.0828497 0.105993 0.0540732 0.9622505 -0.2081571 1430368_s_at-0.5011139 2.483713 -0.8269545 0.5092101 0.3194724 0.2964786 1.1898745 -0.2942461 1430376_at -0.0436745 0.8666638 -0.3188877 -0.119416 0.1812084 0.2670639 0.2160296 -0.1549153 1430379_at -0.7355156 -0.134876 0.3842691 -0.0673587 -0.1018891 0.4063283 0.0482923 0.5381436 1430392_at -0.715667 0.1042032 0.7560936 -0.7838919 0.4185943 0.2259495 -0.6846412 -0.107416 1430404_at -0.474089 0.6507587 0.3620143 -0.2034545 0.1388919 0.1386748 -0.581373 -0.1732171 1430422_at 0.0061302 1.5781809 -0.1100634 0.1335433 0.1747554 0.3548954 0.705904 -0.2997614 1430441_at -0.5084775 1.1868558 0.29361 -0.0911946 0.1434075 -0.1433603 0.7223347 -0.4302117 1430467_at -0.1464988 1.4648392 -0.1610094 -0.110455 0.4477681 0.1167699 0.6081086 -0.281067 1430520_at -0.7926594 -0.544512 -0.3989598 0.4977374 0.5289871 0.5647528 0.3136896 0.2026151 1430524_at 0.0475841 0.8939595 -0.0708368 0.3894782 0.1155214 0.1190855 1.0504824 -0.164814 Diabetes Page 116 of 205

1430535_at -0.9141319 -0.721358 -0.4891467 0.5516501 0.3850552 0.7154152 0.2549852 0.3096034 1430550_at 0.270349 0.0852833 0.9800146 0.0460632 -0.1942663 -0.0074361 -0.23382 -0.135631 1430551_s_at0.0147061 -0.07154 1.0289879 0.049194 -0.0416113 -0.0104576 -0.0273323 -0.0408243 1430567_at 1.1486108 3.9975216 2.4255247 0.6184847 -0.4644325 -0.2033739 0.3337657 0.0946502 1430574_at 0.1968939 1.7708597 -0.2888684 -0.0430369 0.1965705 -0.0492934 0.8043801 -0.6703704 1430584_s_at0.2084055 -0.050848 0.3626018 -1.2072926 -0.2347088 -0.3229105 0.2611729 0.5676241 1430596_s_at-1.4382143 -1.213801 -0.6491599 0.8656926 0.688358 1.0007706 0.5744435 0.3003883 1430602_at -0.0339202 1.6056944 -0.0596453 0.0950919 0.1586247 0.1583759 0.9835214 -0.1621817 1430622_at -0.6525382 0.5765382 0.2750323 -0.3168423 -0.117896 0.2824003 -0.5471746 -0.2138799 1430640_a_at-0.9801853 -1.610943 -0.5708332 0.2277012 0.4017553 0.4064859 -0.0315978 0.3513781 1430644_at 0.0097684 1.0247924 -0.1536638 0.0880041 0.0258491 -0.0161673 0.4197191 -0.3174659 1430674_at -0.0856876 2.7878046 -0.0456538 0.3991828 0.2283418 0.5221635 1.1271659 -0.1315131 1430684_s_at-0.0035448 1.0498182 -0.0860944 -0.0694863 0.2024602 0.1541088 0.4342134 -0.1667587 1430693_at 0.0363864 0.0372131 1.5821382 -0.0357664 0.0096707 0.0810099 -0.2308876 -0.0521522 1430707_s_at-0.0850441 1.0525944 -0.2237816 0.1605096 0.2221143 0.2104212 0.6559591 -0.1552883 1430742_a_at-0.1513783 1.1299251 -0.193579 0.0653701 0.1131264 0.1619633 0.7173812 -0.1339952 1430755_at -0.0368842 1.3446584 -0.0478646 -0.1593418 0.2525635 0.1601145 0.786859 -0.1833757 1430760_a_at0.0668557 1.6077626 -0.1020727 0.1039827 0.3101534 0.2795337 0.908642 -0.1839877 1430762_at 0.8113502 1.9878573 -0.0114113 -0.2566736 0.198044 -0.125675 0.8219166 -0.5851531 1430781_at 0.7503274 0.8070399 0.0974385 -0.4819603 -0.0561848 -0.3379874 0.2453179 -0.4248033 1430834_at -0.7032126 -0.529749 -0.313923 0.8547761 1.0472808 -0.1967616 0.1863683 0.1920546 1430840_at 0.1988725 2.462551 -0.2451111 0.3591545 0.4904364 0.3392623 1.4593216 -0.245426 1430847_a_at0.1726182 1.6816614 -0.1699854 0.0415432 0.4310269 0.0683126 0.9665691 -0.2923913 1430871_at -0.5035598 0.1548442 0.5837294 -0.2330775 -0.0265734 0.4101991 -0.272902 0.3596114 1430892_at -0.0878603 1.1798977 -0.1587589 0.2764688 0.1575644 0.2342407 0.7303271 -0.2304319 1430896_s_at0.6867735 0.0701678 0.0837829 -0.4047513 -0.0063295 0.0222546 -0.0162834 0.0287542 1430928_at -1.0505637 0.1198435 0.3517667 0.2367039 0.1432452 0.7630278 -0.4348636 0.0484551 1430965_at 0.086656 0.8056555 0.4375314 -0.0208507 -0.2505487 -0.2490307 -0.2140371 -0.3157147 1430997_at -0.9014446 -0.427981 -0.2177775 -0.2007759 0.2794097 0.159773 0.2070165 0.1873581 1431029_at 0.4062208 1.4442222 -0.1858624 -0.2144582 -0.0649824 -0.2616594 0.3127984 -0.3609362 1431080_at -0.0859387 2.3064291 -0.1752698 0.0013942 0.35824 0.3267734 1.0420699 -0.3371678 1431104_at -0.088693 1.5007857 -0.2396867 0.0223839 0.5991871 0.3263455 0.6422186 -0.1592991 1431109_at -1.2341591 -1.549105 -0.3606737 0.2352738 0.373728 0.4987937 0.3187006 0.5824774 1431150_at -0.0965543 1.4171345 -0.3303006 0.1168096 0.1800859 0.1194061 0.8829352 -0.4769807 1431157_at -2.95E-04 1.368762 -0.1378529 -0.0801827 0.2683421 -0.0238671 0.9885347 -0.2357047 1431173_at -0.537559 -0.017155 0.3376217 -0.5847502 0.1720465 0.4330013 -0.1467168 0.0467135 1431175_at 0.5940342 1.5239043 0.4318938 0.1823375 -0.3622902 -0.5709996 -0.4180638 -0.2087806 1431184_a_at0.3083935 3.5716999 -0.1125944 0.7143927 0.8279568 0.9030574 1.4872597 -0.3574794 1431204_at 0.1471076 1.4490681 -0.2033984 -0.0383937 0.2803729 0.1054055 0.9676617 -0.1643655 1431220_at 0.9750962 0.2270285 0.3416276 -0.2535734 0.0505151 -0.2279629 -0.2377424 0.1786475 1431251_at -0.1606398 -0.691408 -0.1856651 0.7502444 0.3324323 0.6972274 0.5503276 0.7222185 1431315_at 0.3174738 1.1781588 -0.3418448 0.1052969 -0.1053627 -0.1920203 0.6578028 -0.1701344 1431360_s_at-0.0401889 0.8187263 -0.0606232 0.1344943 -0.2158447 -0.3538441 0.0860399 -0.3741986 1431384_at 0.1626989 1.6471932 -0.2111657 0.3503096 0.2379746 0.0462936 0.9391888 -0.3280889 1431403_a_at0.1824099 1.2737807 0.2739681 0.3164518 -0.5180094 -0.3587483 -0.3737826 -0.3450117 1431444_at 3.842205 5.840412 0.8536886 5.216076 0.0736755 -0.2781858 -0.2844339 -0.301591 1431449_at -0.0647093 1.4191098 -0.1776775 -0.0313027 0.3576581 0.2073373 1.1818825 -0.0136975 1431450_at -0.0117273 0.8808805 0.0596097 -0.0995641 0.2287089 0.0101092 0.982059 -0.1663117 1431463_at 0.0819144 1.3148115 -0.181258 0.0014547 0.2081651 0.1651478 0.5526483 -0.1338947 1431466_at 0.0178387 1.1972073 -0.2896007 0.1669776 0.2547808 0.1638616 0.8728714 -0.1643117 1431468_at 1.0729043 2.542657 1.1002729 0.9959786 -1.3596786 -1.1116934 -1.0497171 -0.0877002 1431511_at 2.3379207 2.1121178 1.6777022 -0.0496538 0.0544319 -0.07893 1.678945 2.4808314 1431515_at -0.0570983 2.3589077 -0.0532765 0.2287635 0.4698213 0.3571585 1.2214144 -0.1498438 1431528_at -0.586129 0.3884873 0.4872285 -0.4587655 -0.1026531 -0.0060798 -0.3959328 -0.1325467 1431573_at 0.0479239 1.442151 -0.1086384 0.2522404 0.360968 0.297824 0.9231051 -0.1157544 1431648_at -0.1588147 0.1972599 -0.14271 -0.1933878 0.0682468 0.0521984 0.8809838 0.3591841 1431673_at -0.1124111 2.2077286 -0.0281701 0.4551609 0.340405 0.4773334 0.8768517 -0.2913226 1431708_a_at-0.1089028 0.8255431 0.4102469 -0.7473354 -0.2065417 0.0701964 -0.488815 -0.3951955 1431751_a_at1.0183142 1.4294637 0.3068203 0.616823 -0.3179283 -0.2667894 -0.1675019 -0.3713132 1431754_at 0.0031409 1.0987921 -0.2599797 -0.1163174 0.346129 0.166267 1.0708586 -0.2038507 Page 117 of 205 Diabetes

1431780_at 0.5447663 1.1864252 0.0251078 -0.4541574 0.1378197 -0.0529382 0.6230895 -0.5798361 1431789_s_at0.6399093 -0.014152 0.2936926 -0.0894117 0.0582747 0.0064901 -0.5043818 -0.2938557 1431798_a_at-0.1044245 -0.669668 -0.3236047 0.7851417 0.337329 0.4517143 0.8821497 1.0314131 1431806_at -1.0142112 -1.160691 -0.1901457 -0.118331 0.2961775 0.1767492 0.4019671 0.4216305 1431839_a_at0.0122486 1.192551 -0.1114405 0.1152322 0.2767322 0.0544563 0.6686273 -0.1363176 1431849_at -0.0515373 0.9129355 -0.1454492 0.0160615 0.1959434 0.0631865 0.5283213 -0.1893848 1431871_at 0.0988525 2.366548 -0.1208233 -0.0016953 0.4501642 0.2587938 1.0040929 -0.2232079 1431904_at -0.9484576 0.3772777 -0.7947453 0.0605674 0.2818399 0.4012853 0.4505275 0.0773896 1431905_s_at-1.0993793 0.2428477 -0.688594 0.0968187 0.2421986 0.3175781 0.4225601 0.1111023 1431911_at -0.0056611 1.4666426 -0.098134 -0.0779333 0.2541986 0.2256076 0.8795319 -0.2946544 1431967_at -0.0206589 1.4625341 -0.0884128 -0.0180942 0.3935947 0.1161989 1.107151 -0.1794221 1431972_a_at-0.754308 -0.182765 -0.6681907 0.2730455 0.2219385 0.3819124 0.2288596 -0.0617991 1431993_a_at0.2042607 2.5909176 -0.1801223 0.5116048 0.5746797 0.4844299 1.0123614 -0.4022303 1432039_a_at-0.0122528 0.838007 -0.2510024 -0.0092547 0.0955415 0.0696753 0.5745313 -0.0983497 1432088_at 0.6986377 1.2888222 0.258695 0.4277914 -0.3329251 -0.2969461 0.0222433 -0.4131138 1432121_a_at-0.1094864 0.6230339 -0.4346564 0.005163 0.0355276 0.0782814 0.6922296 -0.020306 1432122_at -0.0779187 1.2386057 -0.4951991 0.0629776 0.131833 0.0302043 0.6040627 -0.0635603 1432135_s_at-0.0620692 0.9231141 -0.077837 0.0485806 0.2123417 0.0198507 0.9520947 -0.0994808 1432186_at 0.2487155 2.8169556 -0.2256136 0.3196654 0.4848409 0.4411421 1.2959156 -0.3574418 1432201_a_at-0.0715723 1.0372031 -0.1104758 0.0808659 0.317849 0.0551713 0.8528202 -0.3041984 1432203_at -0.0660725 1.289845 -0.0995809 0.0406302 0.0290485 0.1478469 0.6454701 -0.2477342 1432214_at 0.243891 3.1826096 -0.1079355 0.6740899 0.8016445 0.689176 1.7721658 -0.3734241 1432216_s_at-0.7049531 -0.423191 -0.2904768 0.4386044 0.3114312 0.2908712 0.1971226 0.4654961 1432308_at 0.0752187 1.467269 -0.1517906 0.4816957 0.2647541 0.323721 0.978014 -0.2500612 1432321_at 0.0588567 2.6226907 -0.2059364 0.1562104 0.5190488 0.3194225 1.1483123 -0.3965058 1432333_a_at-0.0656719 1.0209678 -0.2196107 -0.0091517 0.110761 0.1044111 0.6459114 -0.1961786 1432352_at -0.739511 0.4130392 0.2173082 -0.2410035 -0.0509654 0.1786484 -0.4537983 0.1817934 1432355_at 0.2924093 0.8057603 0.2032548 -0.0249655 -0.3895126 -0.4685681 0.1218979 -0.0969507 1432361_a_at0.0613006 0.6783539 -0.393297 -0.0675368 0.077289 0.0182261 0.6856648 -0.0660721 1432375_a_at-0.1732267 2.428831 -0.8526995 0.1345999 -0.1902447 -0.155814 0.6339192 -0.9286979 1432386_a_at0.1131132 2.3576508 -0.1965727 0.0840709 0.4792976 0.2214766 0.7723176 -0.266201 1432401_a_at-0.0559739 2.0526245 -0.2059801 -0.1028452 0.4052259 0.0881497 1.1945921 -0.6087718 1432404_at -0.4018985 2.3386264 -0.5658236 0.2181647 0.6640792 0.5334727 1.2286159 -0.4794304 1432406_at 2.5138416 3.6763086 2.25325 3.9525256 -1.5428166 -0.8041938 -0.8865345 -1.4353905 1432437_at -0.139909 1.4338056 -0.0900694 0.0980132 0.3034515 0.1143664 0.8161686 -0.2433364 1432443_at 0.129988 2.3922663 -0.522511 0.3953037 0.2185375 0.3957512 1.1501746 -0.3761802 1432464_a_at 0.388889 0.8716624 -0.0636781 0.0556099 -0.787474 -0.4733807 0.0820308 0.0253313 1432468_at 2.2707896 1.9172286 1.4896073 -0.0182347 0.0232541 -0.0230513 1.7113591 2.6117663 1432481_a_at-0.1468811 0.8965647 -0.090512 0.0259218 0.3027625 0.0917064 0.7316734 -0.1198892 1432482_at -0.0219271 2.5795972 -0.2392969 0.3670524 1.0447323 0.5215548 1.3513414 -0.2747521 1432505_at -0.0167755 1.709048 -0.233056 0.2825365 0.2962786 0.2329346 1.0534182 -0.1537376 1432513_a_at0.3824599 1.7090162 -0.2919946 -0.5073383 0.1655826 -0.0850925 0.3914223 -0.8489811 1432522_s_at-0.0028971 1.170184 -0.1338284 0.0356848 0.129133 0.2106375 0.6495716 -0.1518119 1432527_at -0.0537491 1.0846393 -0.1271113 0.0444837 0.3153747 0.0537844 0.6921331 -0.1629643 1432531_at 1.7635479 1.3607291 1.2153943 0.0855525 0.1026362 0.0518439 1.1781856 2.0907283 1432536_at -0.0688952 0.9058688 -0.2927455 -0.0112135 0.0885709 0.1574779 0.7055114 -0.2354434 1432545_at -0.7331758 -1.005415 -0.3370678 0.6148794 0.3659016 0.6407313 0.055267 0.6576181 1432550_at 0.030823 1.1192218 -0.1009338 0.141535 0.3329414 0.1476017 0.5327246 -0.1403731 1432556_a_at0.9559176 1.3280793 0.0126909 -0.3760812 -0.0325088 -0.2771696 0.0774797 -0.7279172 1432562_at 0.2114034 -0.747579 0.0033815 0.0458922 0.3664646 0.0773848 0.2107642 0.5025559 1432566_at 0.0447973 2.1158786 -0.4530219 0.30933 0.3028447 0.2376096 1.1575681 -0.0840069 1432568_at 0.2652451 1.0225241 -0.1806076 0.2627854 -0.2585646 -0.1805475 0.1541063 -0.3868173 1432750_at 0.3966876 0.8493799 0.2568362 -0.6851382 -0.3758357 -0.3825766 0.2896633 -0.4947696 1432757_at -0.9857152 0.1023306 0.244606 -0.6423757 -0.0916792 0.2385709 -0.4692164 -0.1913579 1432833_at -0.1185764 0.9102665 -0.0429934 -0.2520605 0.0705822 0.0662761 0.5430477 -0.0794989 1432944_at -0.0496267 -0.281371 0.2960532 0.0218833 -0.074899 0.1300051 -0.0812864 1.2929918 1433326_at 0.0216634 0.8826578 -0.1507236 0.2054889 0.2261386 0.0033818 0.3798173 -0.0726264 1433345_s_at-0.3324103 0.7213117 -0.1592885 0.1158044 0.1212787 0.21084 0.4853838 -0.180405 1433525_at 0.8688951 -0.167593 0.2955611 -0.3874948 -0.1975474 0.0010128 0.3320462 0.0465849 1433529_at -0.3844576 -0.710581 -0.2847256 0.8458748 0.3589753 0.4435078 0.5068817 0.4921292 Diabetes Page 118 of 205

1433536_at -0.748392 -0.731641 -0.7602429 0.8753221 0.5918618 0.8379637 0.1967111 0.4126612 1433638_s_at 0.466322 0.8885608 0.2147889 -0.0754457 -0.1883973 -0.3052212 -0.0045471 -0.1045574 1433681_x_at0.2162815 0.8464353 0.3514831 0.1786926 -0.2716198 -0.1246841 -0.499646 -0.201637 1433696_at -0.5803225 -0.393793 -0.7409327 0.7632031 0.1333366 0.6676022 0.1066659 0.4094817 1433707_at 0.4723626 0.9225323 0.1470587 -0.7196829 -0.2088708 -0.4784408 0.4042864 -0.2637423 1433716_x_at-0.1699456 -0.627154 -0.7641877 0.4064374 -0.0580035 0.393467 0.4552123 0.4129548 1433734_at -0.1585188 -0.815835 -0.3542432 0.660131 0.306423 0.5198788 0.1748753 0.52403 1433735_a_at1.1230145 1.4021878 0.389379 0.3674512 -0.5262125 -0.5440699 -0.595376 -0.3590546 1433768_at -0.9257821 -1.06799 -0.1995425 0.5831084 0.5120182 0.6342384 -0.0393883 0.0912244 1433791_at -0.8413883 -0.773757 -0.6970723 0.434144 0.3391112 0.7396692 0.2725994 0.2305048 1433819_s_at0.4570551 0.7036758 0.7961271 -0.115658 -0.3701095 -0.2767657 -0.1127721 -0.1934606 1433847_at -0.30478 -0.229763 -0.3449405 0.3985684 0.1210515 0.5787275 0.6410572 1.0126632 1433891_at -0.7178357 -0.456753 -0.2117851 0.3892283 0.1480442 0.1516083 0.0495195 0.0672423 1433915_s_at-0.3539733 -0.32037 -0.0617077 0.7781291 0.382449 0.6919152 0.4270054 0.5255048 1433969_at -0.1113813 0.0812827 -0.4826998 0.3838005 -0.2032971 0.794062 -0.0694706 -0.3341834 1433977_at 1.2155834 0.9347998 0.2480997 -0.1263281 -0.1146944 -0.1605597 0.1448037 0.8785475 1433992_at 0.2483391 0.5694594 0.0454689 -0.0568607 -0.4807251 0.2350431 -0.5865466 -1.0360426 1434028_at 1.3685778 2.398909 0.6240411 1.0738614 -0.6394027 -0.5708906 -0.6117895 -0.6041924 1434031_at 0.1450114 0.9619036 -0.0043902 0.0259216 -0.1979857 -0.1489513 -0.1780674 -0.0215507 1434046_at -0.783262 1.2504355 0.0226557 -0.0423746 0.09619 0.0551806 0.7623418 -0.4935969 1434051_s_at-0.5389242 -0.898066 -0.4286096 0.7643142 0.4139152 0.8074666 0.5938637 1.0029088 1434067_at -0.2630359 -0.770464 0.1270232 0.2120314 0.2354414 0.2972513 -0.0078503 0.0746673 1434073_at 0.5086798 1.7402468 0.1267601 0.7082923 -0.6837192 -0.6769408 0.0173812 -0.7164488 1434096_at 0.943187 0.7466083 0.4803009 -0.5286408 -0.2267071 -0.606541 -0.2914715 -0.2758564 1434126_at -0.4105837 -0.823412 -0.1722045 0.2771168 0.3160278 0.3484446 0.0576785 0.3203545 1434129_s_at-0.7244413 -1.212784 -0.0493085 0.5000148 0.5357637 0.4605133 0.5462742 0.9666621 1434130_at -0.6137335 -1.470514 -0.4287876 0.4062433 0.5019965 0.3533067 0.3246559 0.8704583 1434188_at -0.6008401 -0.937597 -0.2867116 0.2046814 0.1832829 -0.2337433 0.2312133 0.5448239 1434201_at -0.1998775 -0.63759 -0.1072712 0.3746686 0.3909437 0.3519272 0.681412 0.5092723 1434202_a_at0.3070099 0.8156114 0.6405819 0.0605354 -0.0194481 0.0242844 -0.5998036 -0.4015328 1434221_at -0.1502354 -0.285383 -0.116752 0.7200217 0.2940865 0.4103147 0.6693928 0.9936252 1434223_at -0.0200379 0.6434505 -0.2701072 -0.4847856 -0.131598 -0.322307 0.5855101 0.1061573 1434240_at -0.0717963 1.5480204 -0.1245294 0.0358955 0.3402382 0.1620425 0.8388019 -0.2399222 1434247_at 0.0947684 3.4503434 -0.3104758 0.5953221 0.6726596 0.5967233 1.4910704 -0.4838994 1434259_at 0.2046018 2.8492005 -0.1894285 0.0547369 0.5850991 0.2653481 1.3550647 -0.3266958 1434264_at -0.3718871 -0.71112 -0.5832976 0.6048238 0.2021441 0.6535046 0.7565742 0.961261 1434265_s_at-0.4806863 -0.612003 -0.5167079 0.4162521 0.1488729 0.4951627 0.3542436 0.664022 1434274_at -1.0959811 -0.349801 -0.4357667 0.510426 0.0624706 0.4907518 0.4609191 0.5510142 1434298_at -0.1124334 -1.078056 -0.0600339 0.2527075 0.0764219 0.0909794 0.378576 0.3059511 1434307_at 0.9043479 1.5562084 0.5123696 0.57126 -0.3745344 -0.2937177 -0.4931347 -0.2393983 1434362_at 0.1199284 0.9627035 0.9454026 0.0574827 -0.195766 -0.0061156 -0.2869457 -0.6360744 1434368_at 0.1456872 3.797199 -0.271893 0.4556434 0.9959246 0.3816984 1.5170857 -0.3313426 1434376_at -0.4189968 -0.550748 -0.0101635 0.6810312 0.6012079 0.7893642 0.009395 0.3064372 1434404_at 0.4158279 0.822592 0.0289397 0.2746358 -0.3867489 -0.4713025 -0.367613 -0.1786224 1434411_at 0.2182797 -0.302333 -0.2977762 1.319025 0.4015879 0.8509753 -0.3534237 -0.1087379 1434414_at 0.559858 1.450904 0.6789306 0.7452936 -0.5672986 -0.2372836 -0.3283423 -0.4161949 1434428_at 0.0243169 1.378088 0.0956848 -0.0130436 -0.5415661 -0.4925417 0.2150065 -0.3356207 1434447_at 0.4657741 -0.183111 0.202045 -0.5548739 -0.09835 -0.1771479 0.0871201 0.310757 1434458_at 0.5849659 0.1927236 0.3074918 -0.5036016 -0.0860729 -0.2437753 0.3446746 0.0628948 1434504_at -0.3274034 -0.613272 -0.1242052 0.7190788 0.3371447 1.0565822 0.6753457 0.6805628 1434530_at -1.0979302 -1.537685 -0.6028559 0.4417672 0.1668659 0.5744684 0.2431558 0.5480719 1434534_at 0.0455104 0.0255565 1.7004524 -0.0031757 0.0381127 -0.0263254 0.047859 0.0352558 1434572_at -0.3979285 -1.156064 -0.4014585 1.1177354 0.4016023 1.3120155 0.5560682 1.0121297 1434581_at -1.1179286 -0.955481 -0.4047353 0.774488 0.3616415 0.5274458 0.7661502 0.4661039 1434582_at -0.0453653 0.8052479 -0.2400946 0.6613021 -0.1164666 0.2735889 -0.1991988 -0.1027128 1434632_at -0.1342977 -0.881734 -0.4213189 0.2809656 0.173551 0.6155956 0.971474 0.9746087 1434639_at -0.667395 -0.446084 -0.5625714 0.9530504 0.2211947 0.3868552 0.802875 0.6900285 1434645_at 0.2462378 2.652833 -0.1588 -0.0409496 0.1721241 -0.3794664 1.3888874 -0.5924301 1434662_at 0.748687 1.442344 0.5585797 0.6882191 -0.5996265 -0.371895 -0.5902872 -0.3299319 1434678_at 0.7287413 1.7249734 0.1045576 0.5082393 -0.7784008 -0.3153134 -0.4892726 -0.3997011 Page 119 of 205 Diabetes

1434708_at -0.6328826 -0.707274 -0.1642573 0.7092581 0.496047 0.4550482 -0.0182187 0.3056409 1434725_at 0.049385 1.0993032 -0.1546217 -0.4948862 -0.1262111 -0.3008683 0.7271824 -0.3518647 1434726_at -0.09603 1.9687557 -0.043347 -0.0981957 0.0863812 0.0924946 1.0333525 -0.3580327 1434754_at -0.5696881 -0.428579 -0.2207792 0.7226729 0.3723761 0.5628641 0.1497936 0.3775183 1434756_at -0.7776604 -0.907922 -0.2812133 0.5039063 0.2733475 0.6192688 0.7232927 0.7682536 1434797_at -0.505712 -0.437695 -0.1855424 0.6508045 0.3769995 0.708329 0.3709777 0.4729528 1434798_at -0.2350785 0.1155089 -0.3482226 0.4518027 0.7077959 1.0365245 -0.5277287 -0.2504571 1434800_at 0.5091074 0.8981637 0.5727254 0.872817 -0.1290154 -0.1035023 -0.2285813 -0.1710789 1434810_a_at0.1622391 2.3824146 -0.1342295 0.1060691 0.386072 0.0483819 1.2217512 -0.4066927 1434811_at 0.0577222 0.9346775 -0.1473724 0.211807 0.0192218 0.0908404 0.2971934 -0.2203357 1434848_at -0.1814916 -0.915785 -0.5031871 0.8672452 0.5945989 0.3331698 0.679888 0.8862607 1434864_at -0.3006151 -0.583175 -0.289761 0.2768915 0.4198778 0.5967981 0.1682742 0.3045179 1434909_at 0.8114183 1.307601 0.1736472 -0.2072005 -0.3098136 -0.4050791 -0.1648367 -0.8141847 1435008_at 0.5564773 0.4149294 0.4687724 -0.2947974 -0.2462513 -0.4766892 -0.6477591 -0.5424871 1435009_at 0.2838135 0.0737639 0.1266162 -0.2205305 -0.0853552 -0.1406588 -0.7493067 -0.6226323 1435033_at 0.4469953 1.2437321 0.4432991 0.6140449 -0.2253445 -0.1195116 -0.1920926 -0.3344299 1435036_at 1.0562708 2.2632601 0.93711 0.9098496 -0.3624144 -0.376081 -0.4996565 -0.2916861 1435050_at 0.8222433 2.028472 0.7249579 0.4059823 -0.586468 -0.5775725 -0.2859894 0.1813645 1435052_at -0.0078849 1.0434933 -0.0688984 -0.1654084 0.0954894 0.0808368 0.5211139 -0.2405451 1435084_at 0.6580281 0.3209255 0.3603053 -0.8642263 -0.0736002 -0.9349755 -0.7703902 -1.1263161 1435095_at 0.1155852 1.2572343 0.2281936 -0.0229822 -0.1398659 -0.1615568 -0.0785503 -0.1990411 1435171_at 0.4932712 0.209681 0.1777877 -0.6372066 -0.2685708 -0.3581485 -0.5962572 -0.2465038 1435190_at 0.0058725 0.0201364 1.4526525 -0.208198 -0.1205398 -0.0618929 -0.0401727 0.0016418 1435196_at -0.3276415 -0.517094 -0.0932817 0.6266117 0.1946219 0.2395535 0.674935 0.7052533 1435197_at 1.0880744 1.6050109 0.578534 0.5345018 -2.087019 -2.1595266 -1.0287684 -1.661636 1435207_at 0.2639546 0.1024375 0.1706631 -0.8377616 -0.3457982 -0.6310178 0.4988044 0.0521151 1435212_at 0.3896276 0.8799979 0.0119032 0.1387544 -0.2765237 -0.1576634 0.0850514 -0.3312437 1435264_at -0.6212668 -0.980534 -0.5396485 1.1601839 0.6223562 0.8383564 0.6324266 0.8039401 1435305_at -0.6786188 -0.422106 -0.2275537 1.2855811 0.949988 0.8569077 0.7575595 0.9163926 1435314_at -0.2484832 -0.607388 -0.2852979 3.1864107 1.8345197 3.4795773 0.1807727 1.0102075 1435343_at -0.9121646 -0.846093 -0.4323607 0.2208719 0.2066464 0.4402191 0.2479102 0.5544484 1435351_at 0.4830664 0.8039229 0.1404542 -0.32025 -0.8222499 -0.6199664 -0.0965285 -0.6491502 1435354_at -2.768078 -2.004818 -1.7686267 0.3150215 0.3054375 0.3439671 0.219312 0.3024756 1435365_at 0.2319648 3.95294 -0.4937211 0.5677521 0.6365498 0.5001699 1.5500637 -0.7399423 1435378_at 0.2093774 -0.019293 -0.147391 -0.1820464 0.0386258 -0.4473681 1.1020155 0.8600327 1435399_at -0.9921504 -0.368672 0.1285472 -0.312851 0.3165855 -0.1400323 0.5923734 0.224082 1435410_at -0.0428374 0.9007765 -0.0962757 0.0221751 0.0694071 0.1210578 1.0183657 -0.2168752 1435412_at -0.1510383 1.7118418 -0.3502326 0.197361 0.4381684 0.2875522 0.7312512 -0.1719764 1435426_s_at-0.3844049 -0.2796 -0.3274776 0.4031267 0.3578472 0.7969518 0.1387043 0.4203719 1435435_at 1.1989635 0.9982728 0.202181 -0.3286423 -0.3181165 -0.1058799 0.1738997 1.0877168 1435484_at -0.9120081 -0.60192 -0.2182214 0.2535276 0.032239 0.1572445 0.0149565 0.3264376 1435499_at -0.0305336 1.2751043 -0.1221988 2.38E-07 0.005636 0.0124806 0.6347286 -0.3594514 1435500_at 0.882967 0.7153783 0.2125973 -0.1225808 -0.0458094 -0.0155496 0.0676966 0.8526484 1435606_at 0.5073655 2.2111454 -0.1093636 0.6106658 -0.0941242 -0.0887888 -0.1092372 -0.3285464 1435645_at -0.1748393 -0.986129 -0.1680508 0.2622576 0.0531803 0.5598158 0.0043497 0.363795 1435649_at -1.5198501 -0.89587 -0.5918864 0.8098154 0.5767855 0.7594477 0.4129632 0.6415593 1435653_at 0.4475133 1.0905883 0.3142242 0.1219235 -0.2765675 -0.2612696 -0.3701191 -0.0981182 1435658_at 0.8862057 0.0748162 0.1168594 -0.1862783 -0.1717592 -0.2961103 0.0915861 0.2109461 1435670_at 1.3231497 2.877853 1.3829238 2.2098172 -0.6262495 -0.4489263 -0.2398475 -0.8226004 1435673_at 0.69398 1.3159397 0.2482028 -0.0098984 -0.706664 -0.2304239 -0.1846747 0.0372734 1435678_at 0.8569706 1.0358324 0.4680663 0.297343 -1.1367266 -1.3086386 -0.5812147 -0.8897514 1435688_at 0.8724836 0.0320373 0.2563329 -0.1573961 0.0983135 -0.1398266 0.0245457 -0.1920497 1435691_at -0.2516154 -0.722404 -0.5228703 0.2360232 0.2187818 0.4485833 0.363966 0.5283793 1435700_at -0.5215409 -0.680326 -0.4646536 0.7667198 0.3257624 0.6456455 0.8079276 0.8638704 1435705_at -0.3520048 0.7698685 -0.4568061 0.0197306 -0.0461742 0.123192 0.2094547 -0.4488038 1435724_at -0.2471066 1.3738973 -0.0644754 -1.60E-04 0.2676401 0.2484809 0.9148876 -0.0405049 1435741_at 0.9692466 1.3926082 0.2563309 0.7266619 -0.3596913 -0.4037184 0.0091286 -0.3415057 1435743_at 0.5975808 1.5740126 0.1029718 -0.153353 -0.7464533 -0.6364542 -0.0606112 -0.5238627 1435796_at -0.4601208 -0.400572 -0.5178731 0.6482711 0.1895041 0.8680978 0.9824591 1.2761974 1435819_at 0.550191 1.4551758 0.6887521 -0.0464671 -0.3638027 -0.2057821 -0.3071833 -0.3752813 Diabetes Page 120 of 205

1435842_at 1.1950264 -0.273958 0.310712 -0.3689163 -0.1187273 -0.171501 0.7011703 1.2557367 1435849_at -0.4079645 -0.496912 -0.2503506 0.8547981 0.5310304 0.6918216 0.2143 0.5776157 1435910_at -1.85547 -1.628155 -0.6739972 0.5564504 0.3106596 0.6803585 0.3361743 0.5008685 1435917_at 0.6569576 0.7310882 -0.09175 -0.0773935 -0.7681766 -0.1909595 -0.1047305 0.2340482 1435983_at -0.0228803 0.8412125 -0.2165536 -0.046792 0.1281858 0.1080756 0.7433205 -0.1068546 1435987_x_at-0.287992 -1.030891 -0.120958 0.2967081 0.3206343 0.4048681 0.6472947 0.8398781 1435999_at -0.8054348 0.0359033 0.7222109 1.264091 -5.33869 -5.7900114 -4.2647424 -5.655779 1436039_at -0.2771248 -0.909692 0.1530194 0.4718897 0.3639329 0.5396377 0.1618433 0.1068905 1436040_at 0.7580349 0.4688277 0.5023627 -0.174758 -0.1472836 -0.5374403 -0.1620884 0.0041622 1436075_at -3.4061465 -2.641517 -2.2763262 2.263898 1.5101166 2.3604882 1.3785744 1.5939627 1436098_at -0.6821113 -1.016486 -0.1439104 0.0839534 0.4010485 0.2258659 0.2550802 0.5159738 1436103_at 0.3751054 0.9994891 0.092806 0.131423 -0.251581 -0.2655038 -0.229029 -0.0386222 1436104_a_at0.2402782 0.7100724 -0.046978 0.4511294 -0.3465088 -0.3421164 -0.0124558 -0.4622275 1436105_at 0.7264936 1.129664 -0.0943043 0.4148836 -0.2953672 -0.2607417 -0.0780738 -0.5549345 1436109_at 1.1243588 -0.002211 0.2597635 -0.5605981 0.0119309 -0.1661324 0.0578353 0.4783267 1436111_at 2.171874 0.5150423 0.682835 -0.5393124 -0.2564273 -0.6788752 -0.1198411 -0.4776629 1436115_at 1.8359108 2.391407 0.0627387 0.3766785 -0.6285991 -0.5851985 -0.2596701 0.1015745 1436126_at 0.1597496 1.0377073 -0.0111485 0.1194148 0.1847626 0.1019703 0.7337831 -0.3127159 1436130_s_at-0.1147492 1.2755314 -0.0417854 -0.0806024 0.3111473 0.1667221 0.513844 -0.3928013 1436168_at -0.6807954 -1.361343 -0.6220849 0.7185891 0.6432594 1.4091192 0.369212 0.7299569 1436169_at -0.6383305 -1.215897 -0.7156192 0.9180682 0.65903 1.3217151 0.5026932 0.9527807 1436177_at -0.5490389 -0.416444 -0.1988449 0.700644 0.3887311 0.9635958 0.3579315 0.2015365 1436189_at -0.0571076 -0.409037 -0.3774116 0.4214954 0.1878396 0.6772482 0.470739 0.5627672 1436202_at -0.3866198 1.0180936 0.49032 -0.358963 -0.1464657 -0.0686078 -0.2798629 -0.0590529 1436203_a_at-0.3342478 -0.916975 -0.1935835 0.2125444 0.2482077 0.1729166 0.3483229 0.5430959 1436204_at -0.2622774 -0.841392 -0.1826153 0.1250353 0.2435543 0.2042296 0.3116671 0.4736557 1436215_at 0.2849069 0.2067061 0.7010262 -0.1854706 -0.1953386 -0.2033661 -0.2095985 -0.3164975 1436223_at 0.6662433 0.6815559 0.7085484 -0.4998906 -0.3857726 -0.4350211 0.1333706 0.1314122 1436237_at 0.8174391 0.261576 0.3167447 -0.2116414 0.107929 -0.1516187 0.1565107 -0.1050908 1436240_at -0.7870245 0.5513909 0.3711114 -0.4915242 -0.0726189 -0.054278 -0.5879421 -0.1912368 1436260_at -1.1739752 -0.925459 -0.8885413 1.5702546 1.0475712 1.7014515 0.9029255 0.7640875 1436279_at 0.4492046 1.7310493 0.0659744 -0.2484223 -0.2327241 -0.3111007 0.228212 -0.2046022 1436285_at 0.3664488 2.1158173 -0.2354875 -0.3373846 0.2620648 -0.1708466 0.9116005 -0.4693058 1436288_at 0.0619178 1.582736 0.1180023 -0.0214164 0.1760207 -0.0247425 0.6847709 -0.5428703 1436294_at -1.5048342 -0.551931 -1.0358878 0.7509897 0.4353911 0.3341083 0.3044345 0.1774046 1436296_x_at0.2148948 0.809809 -0.2325863 -0.0215344 -0.0240291 -0.1678143 1.1125102 -0.1957701 1436317_at 0.3277477 1.0366946 0.4902297 0.4400079 -0.527926 -0.3507074 -0.395844 -0.3870424 1436329_at -0.0308778 -0.016919 1.4440659 -0.3125391 -0.0762212 0.2161024 0.5827317 -9.41E-04 1436332_at -0.2895873 -0.842955 -0.526029 0.1743829 0.2086211 0.2132748 0.5151329 0.410653 1436356_at -0.6535486 -0.761983 -0.0477579 0.3695064 0.1279813 0.3655115 0.0700901 -0.048197 1436398_at 0.3260252 0.9856471 0.2450545 -0.1774094 -0.2770359 -0.1524136 -0.2507342 0.4359802 1436408_at -0.4784277 -0.037766 -0.5420061 0.9119096 0.0990395 0.4012873 0.641538 1.0303866 1436410_at 0.0706548 0.9251386 -0.1850353 0.0375319 -0.2905269 -0.1776012 0.1421305 -0.2928523 1436413_at 1.1241933 1.5386057 0.5390742 0.2394235 -0.4846442 -0.5301639 -0.0197244 -0.2556426 1436433_at -0.0910069 1.9828498 -0.1525984 0.2139363 0.2095683 0.2172088 0.7959692 -0.288397 1436439_at -0.0846936 1.194808 -0.1896015 0.173208 0.5237925 0.0959996 1.0621926 -0.025723 1436450_at 0.6278333 1.2762885 1.0659071 -0.4685857 -0.5228821 -0.8797092 0.343305 -0.6640937 1436460_at -0.0204827 0.8989862 -0.0089684 -0.3599355 0.038914 -0.0255876 0.6505105 -0.2271854 1436496_at -0.0107905 2.4302316 -0.0599546 0.0400883 0.4123405 0.3135528 0.7585185 -0.4451045 1436503_at 1.0947778 2.3440595 0.6037453 0.5532043 -0.569551 -0.3766769 -0.3578714 -0.0496136 1436507_at -0.9329491 -0.936095 -0.3283818 0.8087392 0.5438484 0.3815699 0.1892061 0.5545006 1436532_at -0.6444355 -0.411761 -0.5921661 0.4807582 -0.1797244 1.0291564 0.1765744 -0.08523 1436551_at -0.1542288 -0.780816 -0.1425496 0.3730347 0.3601278 0.145266 0.3702416 0.5050805 1436555_at 0.5216789 0.4746777 0.1417471 -0.5755987 -0.4832357 -0.3581376 0.2100283 -0.3776177 1436556_at 0.7029978 1.0166795 0.1198376 -0.0885346 -0.0206463 -0.2948612 -0.1217443 -0.2291416 1436569_at -0.4076972 -0.257119 -0.3794242 0.8181515 0.567815 0.8351008 0.3448464 0.4473314 1436576_at -0.2134193 0.2675901 0.166083 0.3016343 -0.3698074 0.7306196 -0.0548037 0.0219479 1436593_at 0.5717849 1.949415 -0.1664496 -0.2919742 0.2715638 0.178882 0.9079281 -0.490878 1436600_at 0.9421896 2.5961552 0.8380941 1.1618767 -1.8778293 -1.8809998 -0.8023124 -2.0520706 1436617_at 0.0167329 1.2732456 -0.2205639 0.0326328 0.2630835 0.0808041 0.8106645 -0.1708536 Page 121 of 205 Diabetes

1436627_at 0.675047 -0.003711 0.4325737 -0.4107566 -0.2335219 -0.1335629 0.3416344 0.0356245 1436631_at -0.6236368 0.5172917 0.5009371 -0.5523763 -0.0569219 0.1776721 -0.7998064 -0.1420352 1436656_at 1.4571474 2.1179204 0.5910478 0.8912461 -0.7366118 -0.6434213 -0.2059143 0.4178801 1436675_at 0.4250891 0.8544745 -0.0573897 -0.1792984 0.0308622 -0.070021 0.8327116 -0.0944239 1436683_at -0.0589079 1.1367669 -0.2643171 -0.0735594 0.2783391 -0.0015286 0.7313537 0.0695009 1436702_at 0.5533861 -0.928092 -0.2784702 0.313549 0.2209207 0.0634919 0.9845737 1.5249134 1436742_a_at0.7666314 -0.369688 0.1397961 -0.290431 -0.0171645 0.0905159 0.4741766 0.7549822 1436751_at 0.3887798 0.9329501 0.5948614 0.6289153 -0.336114 -0.5077701 0.1078434 -0.6413404 1436755_at -0.7120686 -0.740123 -0.4477413 0.5952473 0.2647719 0.2996973 0.4187523 0.5140355 1436795_at 0.7048297 0.5090561 0.4219921 -0.458447 -0.0634745 -0.3423492 -0.0290976 0.062823 1436796_at 0.4532162 0.8123778 0.4349167 -0.2615709 -0.3096865 -0.4808692 -0.1383222 -0.0627829 1436825_a_at2.1648998 2.555611 -0.0013195 -0.0357294 0.0267784 -0.0840013 0.00816 -0.0399933 1436827_at 0.6455585 1.2166432 0.3756039 0.0894942 -0.3965684 -0.5004121 -0.2321167 -0.1567167 1436829_at -0.7594067 -0.491133 -0.4610549 0.722827 0.0852193 0.3556563 0.2873581 0.524684 1436831_at 0.2196404 0.8696007 -0.1824305 -0.152967 0.179946 -0.0517398 1.0475814 -0.1704176 1436837_at 0.5383944 5.3707 -0.3223847 0.902688 1.2202078 0.8798465 2.1861174 -0.8505438 1436847_s_at 0.19352 0.8589858 -0.4753945 -0.2209537 -0.0019106 0.060994 -0.0120088 -0.525274 1436858_at -0.0405046 -0.575839 -0.2403771 0.4275565 0.6666505 0.407237 0.2160403 0.1001603 1436868_at -0.1343415 -0.568796 -0.0808378 0.729152 0.2329737 0.6023204 1.0592762 1.0666746 1436869_at 0.895898 2.0528383 1.0105714 0.9584627 -1.1125616 -0.9997677 -0.7439825 -1.1731018 1436876_at -0.065694 -0.392887 -0.1874732 -0.0083485 0.1283667 0.091863 0.6164497 0.9191237 1436903_at 0.0727157 2.3993998 -0.1123015 0.4470131 0.5214699 0.2625041 1.5844535 -0.3082469 1436911_at 0.6896265 1.4048315 0.4920661 0.6581502 -0.5697371 -0.4630448 -0.3576433 -0.3562597 1436931_at -0.0431208 1.3791902 -0.1565998 0.0046028 0.2825533 0.0894765 0.9516254 -0.16318 1436933_at -0.77755 0.3515735 0.2317162 -0.291884 -0.1223299 -0.0535771 -0.55466 -0.2382353 1436941_at 0.5535702 1.6539814 0.3741679 0.7510707 -0.8391916 -0.4793935 0.2180107 -0.917896 1436942_at 0.4731095 0.3959726 0.0550982 -0.5389044 -0.4830108 -0.5079817 0.0139864 0.0208578 1436948_a_at0.2972363 0.5730463 0.1560006 -0.9516039 -0.4378867 -0.5039493 0.3753797 -0.2894336 1436961_at -0.5211818 -0.80716 -0.2467021 0.7713924 0.4268671 0.6907977 0.4540661 0.9585783 1436969_at 0.0048618 2.6607175 -0.1737394 0.0710082 0.448226 0.2505718 1.2194837 -0.0689162 1436975_at 0.1137334 1.9358189 -0.0704256 0.1319718 0.4177858 0.2364133 1.0610036 -0.3926719 1436987_at 0.6218545 1.1502932 0.1116596 0.0542202 -0.0684441 -0.2786892 0.0351048 -0.119209 1436999_at -0.4419038 -0.70732 -0.2090039 0.5602026 0.3959684 0.592024 0.4375715 0.5396414 1437010_a_at-0.2956488 3.2762785 -0.8401113 0.765022 -0.2561186 0.1142648 0.7545824 -1.7531227 1437011_x_at-0.3867312 2.9727955 -0.6690192 0.5547657 -0.0023527 -0.1240015 0.5431278 -2.0918562 1437030_at -0.0157307 0.88381 -0.1535418 -0.1695128 0.2213801 0.1008966 0.5526964 -0.3256615 1437038_x_at-0.0933682 1.9163561 -0.1686471 0.3168266 0.1686232 0.3638095 0.9900343 -0.3616544 1437071_at 0.2702371 0.8352076 0.0519786 0.1855815 -0.3484276 -0.0693541 -0.0701981 -0.2999633 1437085_at 0.7110816 1.0454618 0.0343413 0.0151093 -0.3347449 -0.5514193 -0.4138726 -0.3331145 1437090_at -0.1196426 1.3875995 -0.1294233 0.0986819 0.3896332 0.2303076 0.6187999 -0.0342043 1437092_at 0.0407599 3.646994 -0.1570545 0.4716396 0.6918384 0.7508799 1.3781481 -0.1727455 1437096_at 0.2915687 2.5953107 -0.1558833 0.0102949 0.5232598 0.0224041 1.1203434 -0.3113836 1437098_x_at0.1370814 3.5838609 -0.3050535 0.3739264 0.8048319 0.5597654 1.5035009 -0.4646333 1437119_at 0.3378165 0.776814 0.1226559 0.0768871 -0.2755421 -0.3442102 -0.1161617 -0.0513884 1437135_at -0.0302099 1.4453127 -0.0745245 -0.114886 0.1600425 0.2538295 0.934443 -0.0717589 1437140_at -0.1256689 2.635696 -0.238629 0.3564227 0.612927 0.6368995 0.9547784 -0.2876557 1437191_at 0.114707 2.3266063 0.0030577 0.4096162 0.5470217 0.5051274 0.9823577 -0.2273375 1437197_at 0.2714496 0.635478 0.1465597 -0.1468337 -0.5964974 -0.0646493 -0.1818989 -0.6124137 1437201_at -0.4899075 -0.860219 -0.0891925 0.1218233 0.2362079 0.2609738 0.4474584 0.6330733 1437228_at -0.0822389 1.5481554 -0.1525722 0.0333831 0.1383999 0.2672108 0.5491015 -0.3344363 1437229_at -0.1267873 0.9797391 -0.150646 -0.0343382 0.3385851 0.1544833 0.7302079 -0.2884626 1437249_at 0.5441364 1.1653098 0.1964172 0.3033512 -0.1317997 -0.2293774 -0.151433 0.2662958 1437250_at 0.3226658 -0.241574 0.7824982 0.0059016 -0.1347244 -0.2368308 0.0591083 0.3082523 1437251_at -0.0577818 2.1403894 -0.1269041 0.1793034 0.5918881 0.2904152 0.9071924 -0.2998802 1437259_at 0.2759316 0.8767166 -0.1143331 0.0837307 -0.1281067 -0.1262448 -0.0571475 -0.0840691 1437264_at -0.0289115 2.9739025 -0.2158465 0.3838182 0.8528237 0.743342 1.1640583 -0.260756 1437266_at 8.11E-04 2.9020696 -0.1315551 0.6766446 0.5715691 0.4280655 1.2285947 -0.4457054 1437272_at 0.1767854 2.7293987 -0.1221302 0.1440468 0.5511812 0.2157826 1.5414758 -0.1957841 1437273_at -0.3694773 -1.06076 -0.4838374 0.8161578 0.5960471 0.6289197 0.5774811 0.3142384 1437291_at 0.0523641 -0.647349 -0.247177 -0.0559268 0.1816647 0.175161 0.8767934 0.9087427 Diabetes Page 122 of 205

1437312_at 1.3787713 1.9366742 0.733822 0.5623369 -0.9334323 -1.1882074 -0.4294809 -0.8998691 1437321_at -1.5661091 1.0346622 -1.2501435 0.7797115 0.0924398 1.0515753 0.4271804 -0.6094162 1437376_at 0.2209815 3.2048697 -0.4133655 0.4939818 0.8081883 0.6552736 1.4540828 -0.2179785 1437384_at -0.1668977 1.1695937 -0.0873405 0.1104791 0.3590114 0.1088727 0.6394413 -0.1709492 1437403_at 0.3797214 1.0346097 0.2662725 0.1553042 -0.4180338 -0.367597 -0.4189949 -0.5226892 1437412_at 0.1471262 1.1916968 -0.1464541 0.1015022 0.1431849 -0.0625258 0.6091415 -0.2894635 1437416_at -0.3541285 -1.022509 0.0164666 0.5273814 0.4382288 0.0657845 0.0769768 0.3676364 1437417_s_at-0.0846193 -0.882144 -0.2864698 1.4439805 0.4119874 0.5470787 1.0826443 1.2098712 1437418_at 0.8253537 1.2321877 0.2213973 -0.3087485 -0.1904076 -0.4190118 -0.1433167 0.0499276 1437433_at 0.5058978 -0.621607 0.4850564 -0.3479624 0.1464806 -0.7183353 0.047012 0.2541866 1437435_at -0.1171357 1.1790528 -0.0568236 0.0048348 0.2230763 0.2227909 0.5863093 -0.4534938 1437464_at -0.0349711 1.5889126 -0.10059 -0.2153077 0.2021465 0.032002 0.702202 -0.2630569 1437535_at 0.219211 3.1449437 -0.1289085 0.0467286 0.5999042 0.4876264 1.3807503 -0.2804558 1437549_at -0.0122678 1.0709186 -0.3556659 -0.1088884 0.1508652 -0.1659154 0.4210051 -0.5709932 1437576_at -0.3556155 0.6569305 0.4585697 -0.2754982 0.0949654 -0.1008544 -0.365657 -0.1834254 1437578_at 1.3807125 0.7920936 0.7675573 0.0911047 -0.2370327 -0.1231907 -0.1958977 -0.1102997 1437580_s_at-0.1103002 0.8400639 -0.2522985 0.206636 0.0860162 0.1194851 0.6202533 -0.2574419 1437584_at -0.7140456 0.2807264 0.4245682 -0.2196455 -0.1876273 0.1254737 -0.6834498 0.075535 1437596_at 0.1477366 2.3545475 -0.1123887 0.0605283 0.3543983 0.1452019 1.1705546 -0.7602776 1437602_at -0.0658419 2.1786199 -0.0670047 0.2771399 0.0959242 0.2342669 1.1832274 -0.2197954 1437609_at 0.165864 2.003609 -0.1651769 -0.0370896 0.3633543 0.2341975 1.0340743 -0.3073746 1437623_x_at0.7738333 0.1055583 0.3236263 -0.3355708 -0.0462974 -0.2316411 -0.5366694 -0.3303627 1437627_at -0.1941791 1.849349 -0.3884928 0.2944412 0.2341063 0.1394988 1.0182604 -0.1084264 1437650_at -0.8249143 -0.350377 -0.0886784 0.3538821 0.3843948 0.1716825 -0.0710762 0.1133224 1437659_at 0.0123956 1.7582217 -0.0999144 0.0170702 0.4392446 0.1796095 1.2999051 -0.1889153 1437662_at 0.0293119 -0.794444 -0.0279169 -0.2929945 0.3638185 0.1532745 0.3275143 0.3948385 1437664_at 0.4380759 0.8995515 0.3097576 0.1581862 -0.1597553 -0.1647135 -0.1852679 -0.0803067 1437668_at 0.9794418 0.0215831 0.3608925 -0.2206048 -0.1883627 -0.0694029 -0.0840844 0.0097645 1437673_at 0.6125361 -0.401981 -0.0176008 0.3379724 0.1520752 0.1809768 0.9811876 1.208377 1437676_at -0.7941296 0.1945413 0.3086639 -0.3907163 -0.2372764 -0.0641679 -0.3925559 -0.1920698 1437678_at 0.0057675 1.8989259 -0.1103325 -0.0903127 0.4664279 0.0266839 1.319803 -0.0534312 1437698_at 0.8536139 1.1537501 0.1859884 0.125875 -0.0444574 -0.2949374 -0.2460078 -0.0950494 1437710_x_at0.0204278 3.1594276 -0.28091 0.2488232 0.189441 0.4203804 1.0748682 -0.7865939 1437760_at 0.5013801 1.636328 -0.3144876 0.2459695 -0.2511161 -0.0035626 0.0243497 0.2609655 1437766_at -0.4315916 -0.599083 -0.3814331 0.4271605 0.4364511 0.2298368 0.4878693 0.7930334 1437792_at 0.0124656 2.0723581 -0.248104 0.506283 0.6925017 0.5649694 0.8937513 -0.0803183 1437833_at -0.6486455 0.2819495 0.3237207 -1.0701723 -0.005646 -0.110558 0.1298416 -0.0796126 1437870_at 1.5888934 1.7527034 0.6805658 0.2971453 -0.0219713 -0.0440024 0.1631142 1.295448 1437923_at -0.5607877 0.5846221 0.3516791 -0.2058783 -0.083869 -0.0669546 -0.4147765 -0.3031718 1437929_at -0.1181774 -0.219929 -0.2580667 0.6662705 0.0425023 0.1027392 0.8353181 0.7905107 1437950_at -0.1811763 -0.748854 -0.592038 0.2561448 0.2185881 0.2678216 0.3621615 0.4666863 1437955_at -0.084561 1.0837638 -0.104974 0.1008809 0.229865 0.2604381 0.6664122 0.0180902 1437962_at -0.1402657 1.0069625 -0.1571955 -0.0839384 0.1718387 0.0477016 0.2766838 -0.2019385 1437983_at 0.5784175 0.1019185 0.0106361 -0.4966291 -0.0762733 -0.195426 -0.2571229 -0.1087157 1437988_x_at0.2250184 3.8780534 -0.1292899 0.8007751 1.0848248 1.0873617 1.765839 -0.3406525 1438018_at 0.2653506 1.5289073 0.2282057 0.0280418 -0.967652 -1.1202123 -0.2944903 -0.6989355 1438038_at -0.3511806 -0.880967 -0.2821093 0.4737005 0.3409886 0.3177374 0.209602 0.4146029 1438041_at -1.0213543 -0.579357 -0.3396158 0.6206141 0.4648144 1.1011267 0.4377969 0.608456 1438052_at -0.8279318 -0.384396 0.3775582 0.1151512 0.1428089 0.5958659 -0.1109575 0.27175 1438055_at 1.4485123 1.243438 0.7705334 -0.5533946 -0.3949518 -0.8824617 -0.0151567 -0.5554934 1438061_at -0.3892571 -0.398689 -0.1235795 0.7183604 0.4227279 0.3777188 0.043543 0.1894468 1438065_at 0.1557357 1.3339299 0.6072235 -0.1203957 -0.5459209 -0.4608133 -0.3331477 -0.1765719 1438068_at 0.5664779 -0.493142 0.0764811 -0.084609 0.1356329 -0.1613045 0.1593081 0.4375277 1438086_at 0.5351427 0.9348191 0.7061495 0.5699818 -0.1925485 -0.052501 -0.3646913 -0.2445259 1438104_at -0.0721643 0.6446576 0.2576464 -0.265101 -0.3960609 -0.177396 -0.4598373 -0.1017329 1438122_at 0.013393 1.5053058 -0.0299768 -0.1311147 0.2017616 -0.0817596 1.011532 0.0242817 1438130_at -0.8837189 -0.13767 0.5266366 -0.3472717 0.1722633 0.1575255 -0.459768 0.014135 1438142_s_at0.4701088 0.5643443 0.1235499 -0.6815946 -0.087232 -0.1073266 -0.0063376 -0.4812223 1438158_at 0.1459697 1.5864735 -0.0954072 0.0094017 0.3515395 0.1866229 0.802527 -0.1974119 1438160_x_at0.6986393 1.5888338 0.3010665 0.0425458 -0.4993285 -0.3060575 -0.3020406 -0.0235831 Page 123 of 205 Diabetes

1438162_x_at0.0939977 2.3091707 -0.3150216 1.37E-04 0.5173913 0.1535592 1.5163609 -0.2973986 1438175_x_at0.0671812 1.2105379 0.479521 0.6471089 -0.2397656 -0.109847 -0.2018939 -0.1081534 1438237_at -0.6362553 0.0563763 0.4235854 0.0878968 0.048632 0.0087132 0.3218932 -0.1155898 1438253_at 0.0509133 -0.837439 -0.3199939 0.6039033 0.3472776 0.1249115 0.7255818 0.674187 1438284_at 0.1182705 1.1848989 0.4685366 0.2452757 -0.1985067 -0.2185727 -0.2704128 0.0256206 1438288_x_at-0.2963994 -1.06171 -0.1295979 0.1359115 0.1861527 0.2339523 0.3220561 0.5593326 1438298_a_at0.0353652 2.0357015 -0.3172194 0.2749784 0.2498682 0.2182688 1.0799617 -0.4911286 1438306_at 0.8183659 1.4021986 0.299014 0.5814378 -0.8815328 -0.8509902 -0.3949175 -0.4845816 1438309_at 0.3756089 -0.620903 0.4794982 -0.0893602 0.1712681 -0.0937012 0.1067944 0.4662638 1438350_at 1.1145349 0.841527 0.2765842 -0.6357899 -0.2609133 -0.9705 -0.3570808 0.0042966 1438356_x_at-0.0357082 2.1249719 -0.0330346 0.0387478 0.2760216 0.3459038 1.0296665 -0.1979768 1438378_at -0.4098438 1.6344234 -1.0149903 0.0979934 0.2476485 -0.0353098 1.0800208 0.0795759 1438384_at 0.0252969 3.334631 -0.1193302 0.5036773 0.657638 0.7098841 1.2718451 -0.2087832 1438396_at 0.3001598 0.9319288 0.3958008 0.4333682 -0.1160931 -0.044144 -0.1372385 -0.0355392 1438399_at -0.0911425 -0.318071 -0.0579643 0.6504324 0.2116019 1.0827419 0.1543102 0.0860616 1438405_at 0.3182193 -0.282053 0.0790554 -0.4145727 -0.1830868 -0.3047531 0.6692122 0.5577264 1438408_at 1.0014088 0.9744115 0.4826448 0.0522778 -0.270739 -0.3430804 -0.3128532 -0.4995273 1438411_at 0.5781641 -1.803596 -0.5131525 0.0531764 0.047342 0.4233715 1.0769386 1.3451132 1438417_at -0.287622 0.916854 -0.639577 0.1332543 -0.0425325 0.0065267 0.7691959 -0.0599079 1438428_at -0.679477 -0.474682 -0.4012326 0.5188463 0.1861081 0.5700811 0.3430627 0.3045104 1438431_at -0.4355018 -1.059582 -0.2200058 0.0129633 0.2465403 0.1527798 0.2345349 0.2874962 1438444_at 2.0727954 3.164167 2.8893206 2.7842138 -2.8495927 -1.8849157 -2.1981175 -1.9051179 1438448_at -0.0765908 -0.298614 -0.0774375 0.8275616 0.128758 0.925533 0.1489491 0.1138088 1438450_at 0.0150667 1.7727216 -0.2308742 -0.0116434 0.2616094 0.2850464 1.0688362 -0.3542703 1438452_at 0.4793019 1.0779235 0.8596939 -0.3591754 -0.1097123 -0.1659862 -0.2216932 -0.2572107 1438466_at 0.2534716 2.347999 -0.317867 -0.1371076 0.4154402 0.1445305 0.8984469 -0.6488412 1438493_at -0.0316775 1.108802 -0.1710839 0.1105535 0.1827531 0.0724128 0.6725985 -0.1969113 1438496_a_at-0.2661983 0.6167605 0.1078516 -0.1678212 -0.4790138 -0.4543266 0.0786956 0.2070748 1438512_at 3.2930326 5.368515 3.3690715 5.6897287 -0.7351295 -0.0722823 -0.8232508 -1.0415229 1438528_at -0.382277 0.6246153 0.313766 -0.2534308 -0.1208542 -0.0566398 -0.3380062 -0.0574428 1438531_at 0.776724 0.2306736 0.8016086 -0.2652518 -0.0849882 -0.3760763 0.3445988 -0.1480479 1438538_at -0.428234 0.9122685 0.3007547 -0.306715 -0.2671606 -0.1897696 -0.4626028 -0.0805456 1438569_at -0.0057797 1.7704892 0.0034236 -0.13428 0.2840792 0.1167827 1.3519411 -0.3359115 1438577_at -0.658438 -0.863863 -0.4152967 0.7833438 0.2390487 0.6090171 0.4436404 0.6943113 1438586_at 0.3085676 2.539862 -0.0813698 0.9980645 -0.252583 -0.2732517 0.0197376 -0.2080798 1438590_at -0.7057025 0.0538909 0.3666444 0.0168672 0.260303 0.7634696 -0.3123488 -0.0780215 1438604_at -0.2057596 1.7133408 -0.2302661 0.3665624 0.0982719 0.1598183 0.8322102 -0.4995766 1438607_at 0.004748 1.0028538 -0.1828835 -0.0286186 0.211848 0.0984648 0.6593726 -0.1615253 1438618_at 0.2489862 3.6533885 -0.1965955 0.4404517 0.9696537 0.8646453 1.5925001 -0.2542806 1438664_at -0.9803853 -1.711426 -0.5134835 0.450181 0.4043497 0.3970875 0.2148116 0.483614 1438707_at 1.4485484 2.4106617 1.5549091 1.0093772 -0.5501617 -0.3318895 -0.7027406 -0.351359 1438734_at -0.0043101 -1.302015 -0.5731101 0.3501132 0.0123561 0.3001671 0.7853869 1.3560795 1438745_at -0.052111 1.1776202 -0.1858203 -0.0549767 0.0988058 -0.0177085 0.4901541 -0.1275272 1438756_at -1.6872524 -0.881503 -1.3535984 0.7500649 0.4211647 0.4130358 0.2330586 0.3014828 1438763_at 0.0808145 1.0958191 -0.2239953 -0.0404956 0.1547624 -0.0262415 0.5328856 -0.2075596 1438774_s_at-0.6909276 -0.473796 -0.4742175 0.398639 0.2042682 0.2245617 0.1401243 0.1539257 1438783_at -0.9214271 -0.361711 0.0788703 -0.1592147 0.3361321 0.1831658 0.2014828 0.2946145 1438791_at 0.286065 2.5769725 -0.1695755 0.4746411 0.4821568 0.3160984 1.4265499 -0.3048798 1438796_at 1.7527788 1.5226772 0.796779 -0.2322917 -0.1359642 -0.8548117 -1.1382798 -0.992219 1438816_at -0.5246002 0.6792764 0.5665486 -0.5745418 -0.3132792 -0.2753342 -0.3723442 -0.2255198 1438820_at -0.2609016 2.3889542 -0.3939903 0.2421467 0.7375227 0.4524678 1.2043004 -0.3335715 1438822_at 0.3188036 1.5651666 0.0883467 -0.2581163 -0.3307988 -0.6136971 -0.4177092 -0.5283537 1438862_at -0.3914524 0.1798807 0.5829586 -0.1955159 -0.0171764 0.3514992 -0.7469609 -0.5173929 1438870_at -0.327247 -1.108816 -0.1212585 0.6009274 0.3303962 0.3822088 0.60461 0.2158149 1438871_at -0.6339443 0.5808344 0.4885862 -0.6882963 -0.1061353 0.0458536 -0.3742789 -0.175625 1438882_at -0.8403716 0.1035274 0.3343022 -0.598944 -0.2122115 0.1880736 -0.2164563 -0.2323807 1438944_at 0.0233001 1.6967199 -0.2521858 0.4171319 0.4972212 0.3550041 0.92295 -0.4050919 1438967_x_at-1.4556209 0.1687889 -1.3667086 0.3299303 0.2853004 0.3333803 0.6785336 0.0942179 1438972_x_at0.4718858 0.1364002 0.2070072 -0.8526115 -0.2566805 -0.3095767 0.3739592 0.3041417 1438994_at 0.0441299 2.2373037 -0.1799129 0.3210275 0.8824948 0.4926879 1.1148509 -0.1468207 Diabetes Page 124 of 205

1438996_at -0.0629946 1.5463004 -0.2393733 0.179193 0.3032349 0.2290291 0.9985287 -0.0815217 1439000_at -0.1333456 1.409135 -0.2647287 0.2196009 0.1720701 0.2116868 0.6446962 -0.1585774 1439003_s_at0.0748166 2.7821698 -0.1938127 0.2770484 0.6089817 0.4508824 1.3166295 -0.3079163 1439015_at 0.8998942 2.497395 0.5191531 0.6792884 -0.5753796 -0.5929211 -0.0760862 0.0105205 1439026_at 0.871604 1.48898 0.051126 0.0856836 -0.286243 -0.2800516 -0.1542114 0.0193104 1439029_at 0.8811381 -0.059228 0.1406721 -0.0926487 0.250703 -0.1422985 -0.1434139 0.2832204 1439066_at 1.0310205 -0.078532 0.8893472 -0.568547 -0.1232796 -0.2673462 0.5102935 0.14686 1439093_at -0.611346 -0.722347 -0.6421099 0.4644868 0.3916337 0.397879 0.3893827 0.0693951 1439134_s_at0.4752694 0.9680284 -0.1201454 0.0856013 -0.2538147 -0.3114317 0.145783 -0.1983169 1439140_at -0.1120857 1.377015 -0.3425057 -0.2943401 0.1281284 -6.03E-04 1.000017 -0.251531 1439143_at -0.3129165 -0.766742 -0.3555375 0.4358635 0.3750433 0.4841714 0.1810257 0.4609717 1439149_s_at-0.2654684 3.3695092 -0.9579564 0.0476279 -0.4536505 -0.2769586 0.2752778 -2.3102448 1439163_at -0.471221 0.264133 0.1158719 0.5664673 0.2281176 0.3051642 -0.4774551 0.2058125 1439173_at 0.2627463 1.4162548 0.1889391 -1.19E-07 -0.1579105 -0.2161007 0.0652936 -0.2951546 1439190_at -0.1207074 1.06775 -0.2489371 -0.0246415 0.0326221 0.0439834 0.4330505 -0.2547568 1439220_at 0.154125 0.9650545 0.2666843 8.69E-04 -0.248368 -0.3073753 -0.3283452 -0.3606251 1439222_at -0.0514948 1.9415011 -0.2450265 0.3304646 0.5438926 0.3162856 1.1938587 -0.3677686 1439277_at -0.2059813 1.2404014 -0.07126 -0.119242 -0.0037224 -0.0098258 0.7397406 -0.2066967 1439281_at -0.0717121 1.4456699 -0.1169146 -0.368065 0.0882832 0.0315282 0.9331636 -0.1595882 1439298_at -0.5385326 0.2127481 0.4646843 -0.1694925 0.0028426 0.0765527 -0.3342808 -0.0964397 1439299_at -0.8638779 -0.097598 0.1383303 0.2092795 0.1821306 0.4362857 -0.276919 0.1961722 1439301_at -0.2048203 0.3655012 0.5437441 -0.6611486 -0.1204784 -0.0491246 -0.4665392 -0.4610507 1439316_at -0.5212406 0.574096 0.4281244 -0.4547381 -0.2027288 -0.1877729 -0.3670155 -0.1423529 1439335_at 0.0057288 1.7048869 -0.2310649 0.3027558 0.3084261 0.1205101 0.8442955 -0.1604844 1439342_at -0.7470357 0.2444679 0.346023 -0.3003016 0.1249961 0.1264428 -0.6235662 -0.0550791 1439353_x_at0.4151586 0.0420175 1.1240276 -0.1581029 -0.0169793 -0.1694782 -0.0606407 0.01004 1439402_at 0.0859421 1.1747389 -0.0961971 0.059376 0.1199468 0.0213027 0.7509584 -0.0870194 1439446_at 0.0758723 2.2836218 -0.1970766 0.2636762 0.4772744 0.4609774 1.1941351 -0.0478714 1439473_at 0.4476095 1.5307013 0.2977673 0.5633359 -0.2183524 -0.1299616 -0.2522853 -0.3844477 1439484_at -0.9374565 -0.695488 -0.4300649 0.8016176 0.5465468 1.1257257 0.5376679 0.7624471 1439514_at -0.1322277 -0.662219 -0.2387949 0.705467 0.2586058 0.6032565 0.7869212 1.0373169 1439525_at -0.0047227 2.5000367 -0.2315701 0.1115971 0.5847925 0.2701959 1.0953265 -0.3654337 1439528_at 0.0805062 -0.118655 4.6241674 0.0284348 -0.0224376 0.0158771 0.0228564 0.0180957 1439533_at -0.150375 1.4026093 0.0086653 0.0489635 0.0484787 0.1182681 0.2620715 -0.465047 1439537_at -0.7839841 0.5065451 0.3689828 -0.4850302 -0.0124561 0.0175966 -0.561711 -0.107331 1439555_at -0.9741122 -0.1434 -0.1428169 0.7085764 0.2046465 0.0103125 -0.1503995 0.0250195 1439556_at 0.3786119 1.6911732 0.5114694 0.3589497 -0.4276749 -0.2497315 -0.1646617 -0.3598328 1439560_x_at1.2246871 1.6396512 0.2356569 0.0792043 -0.621618 -0.838005 -0.5325046 -0.5927466 1439564_at -0.007166 2.3690553 -0.1790398 0.6162212 0.5323241 0.5937805 1.0917603 -0.2733975 1439566_at -0.6001794 -0.369901 0.0111136 0.6039226 1.0195059 -0.3071103 0.05427 -0.0212584 1439568_at 0.4411436 1.4919455 0.1430713 -0.6675584 -0.9981303 -1.2942904 -0.8505559 -1.13869 1439575_at 0.4065988 1.8206215 -0.0852087 -0.174607 0.3818339 0.1179558 0.8685546 -0.4394578 1439586_at -0.1838002 0.679644 0.2359397 -0.7165468 -0.3617688 -0.1351353 -0.4171338 -0.038009 1439606_at -0.087798 -0.025535 -0.5379987 0.4078805 0.2937616 0.0359808 0.9467785 0.5204792 1439613_at 0.0513034 1.5370198 -0.0636326 0.0921602 0.3503888 0.2381553 0.7637566 -0.1826027 1439626_at -0.5811181 0.250176 0.5448096 -0.2059331 -0.0446567 0.1385206 -0.4018593 -0.0258508 1439643_at -0.776481 0.3697856 0.3993708 -0.4705336 -0.2142619 -0.0883632 -0.4215827 -0.1620059 1439652_at -0.651777 0.3725098 0.3195549 -0.6962695 -0.0992141 0.0389813 -0.4812497 -0.2008387 1439653_at -0.1199177 1.7129736 -0.127607 0.0691878 0.2677902 0.1317098 0.9296905 -0.1377972 1439665_at 0.9069519 -0.545758 0.4362572 -0.2522147 0.1532074 -0.062818 0.2115366 0.2697775 1439675_at 0.5228567 -0.254633 0.1220729 0.1806147 -0.0726472 -0.0493872 0.6773769 1.1887177 1439686_at -0.7458689 0.0073748 0.3713126 -0.2908044 0.2845308 0.4329123 -0.5733444 -0.0619802 1439687_at -0.6055139 0.5377187 0.33201 -0.3309329 -0.1785689 -0.1190167 -0.2131944 0.0298087 1439689_at -0.3970624 -0.830532 -0.3549444 0.4884749 0.3070275 0.6739616 0.1946745 0.7504811 1439695_a_at0.1469133 0.9582168 -0.1016712 -0.3216348 -0.1960283 -0.1161472 0.2050308 -0.2754533 1439758_at -0.6944583 -0.370109 -0.603204 0.319149 0.347472 0.3642712 0.3918486 0.2612858 1439777_at -0.7276493 -0.76842 -0.345754 0.2791729 0.3888229 0.4201721 0.2777662 0.3836718 1439795_at 0.9745762 0.8548355 0.437094 -1.0334492 -0.3812599 -1.1000054 -0.4190591 -0.1037671 1439800_at -0.5074143 0.2489326 0.5181844 -0.3665853 0.2395396 0.1747734 -0.5110688 -0.1856624 1439801_at -0.1226524 1.5014371 0.0075796 -0.0324844 0.1953886 0.0774537 0.8744309 -0.2641838 Page 125 of 205 Diabetes

1439805_at -0.0460243 0.7441316 0.3744758 -0.7080929 -0.2776544 -0.1151751 -0.4223533 -0.317194 1439808_at 0.5964561 -0.009865 -0.2169687 0.1864519 -0.3173992 0.0988048 0.3338793 0.9018109 1439827_at 1.0708039 0.1929934 0.5534427 -0.3101206 0.0596107 0.0413387 -0.4796197 -0.3445025 1439831_at 0.6343671 -0.105012 0.8900064 -0.6224096 -0.263405 0.222629 -0.0939304 0.1774467 1439834_at -0.1847107 -0.997791 -0.3505838 0.1913977 0.1102905 0.376881 0.0424747 0.2869457 1439835_x_at-0.5895418 -1.183911 -0.3077537 0.5233202 0.5064982 0.2126605 0.1881099 0.4293703 1439836_at 0.4584354 1.1120629 0.4405906 0.1959614 -0.148775 0.0138396 -0.1679737 -0.2339022 1439840_at -0.3828621 0.6456045 0.4678992 -0.4320247 -0.3004222 -0.3232738 -0.3032607 -0.0758197 1439885_at -0.255838 -0.837922 -0.1074007 0.1291604 0.3446991 0.1052942 0.8887618 0.9686356 1439928_at -1.125669 0.0346094 0.2588875 0.0034037 0.0575316 0.5050774 -0.3500176 0.3273935 1439944_at -0.8301621 0.0635105 -0.7793068 0.3256486 0.2464195 0.0594562 0.6888507 0.3944988 1439945_at -0.3818865 -0.777194 -0.2048557 0.083452 0.2337566 0.1058933 0.3511543 0.5556746 1439948_at -0.1031237 0.8495342 0.2507156 -0.1936629 -0.3647075 0.0720068 -0.3597759 -0.2386026 1439970_at -0.6615574 0.2526801 0.3524779 0.0773187 0.0539054 0.1673618 -0.2915227 0.0116673 1439972_at -0.2639433 0.9158282 0.1272719 -0.0855632 -0.2712223 -0.1499476 -0.2592573 -0.1155645 1439975_at 1.0407529 2.188667 0.4488989 0.1752243 -0.7225092 -0.3927524 -0.2232202 0.3375429 1439977_at -0.2403907 0.8856536 -0.0140443 -0.0296699 0.157424 0.159463 0.8038144 -0.2862485 1439985_at 0.0157186 1.3707342 -0.1993715 0.0931633 0.0992984 0.143988 0.9429399 -0.2641034 1439989_at -0.1727383 0.7748065 0.111113 -0.2450063 -0.2599162 -0.1649672 -0.2808441 0.0485652 1440007_at 1.1589218 0.6229714 0.2118071 -0.5552387 -0.2163279 -0.2939301 0.1281304 0.1227512 1440011_at -0.7775495 0.1626504 0.3979713 -0.1695871 0.0268186 0.3162293 -0.2096211 0.2951609 1440013_at -0.5309783 0.6167644 0.3649572 -0.4301722 -0.1338685 -0.0260517 -0.5943562 -0.0342423 1440028_at -0.5567346 0.3565294 0.5659568 -0.5940385 0.2851712 0.1599079 -0.2441443 -0.2545549 1440037_at -0.712937 0.3951013 0.5685958 -0.668962 0.093257 0.0198058 -0.4419467 -0.1897213 1440051_at -0.4966571 0.3623357 0.5105329 -0.4070911 -0.2258754 0.1682085 -0.5480146 -0.1740019 1440055_at -0.5203921 0.921664 0.2924163 -0.1917584 -0.1252683 -0.2430883 -0.140261 -0.1933166 1440058_at -0.7672628 0.2261063 -0.5258634 0.1670065 0.2561012 0.1793614 0.4637469 -0.3924538 1440085_at -0.100789 -0.611298 -0.2824807 0.2151747 0.4767829 0.574488 0.131842 0.0817218 1440092_at -0.6687594 0.1222001 0.375258 -0.3700266 -0.0097253 0.2359268 -0.6073208 0.1118752 1440095_at -0.7169335 0.2984994 0.3343973 -0.5989399 -0.3718844 -0.158138 -0.419981 0.0034701 1440146_at -0.9997014 -0.711874 -0.2360363 0.0264645 0.1491389 0.1187072 0.1819717 0.2672008 1440153_at -0.331959 -0.64114 -0.0950589 0.6644392 0.4702548 0.6616899 0.2700618 0.3120655 1440162_x_at0.4315361 0.9521376 0.4311014 0.0738978 -0.1175492 -0.1169691 -0.1300443 -0.0830318 1440163_at -0.7225527 0.5012239 0.3505908 -0.3148837 -0.0097664 0.0743808 -0.3769369 -0.0823433 1440172_s_at-1.5839523 1.9164568 -1.8857758 0.1187897 0.6326608 0.2448879 1.2573029 -0.005643 1440183_x_at-0.335261 0.6851051 0.5023211 -0.414237 -0.1057956 0.0077229 -0.3937159 -0.2273625 1440186_s_at0.1194016 -0.069451 3.0307863 0.0915773 0.0849883 0.0523924 -0.11549 0.0155722 1440200_at 0.6276484 1.2360374 0.3455263 0.6948769 -0.1661699 -0.3031279 -0.4075781 -0.3185886 1440219_at -0.1864171 0.7823998 0.2334874 -0.3506208 -0.3314491 -0.1360956 -0.496387 -0.0688829 1440220_at 0.7183604 1.3136413 0.4335141 0.4178658 -0.1835258 -0.3473775 -0.1810114 -0.2746682 1440227_at -0.9711109 -0.447952 -0.317993 0.2529392 0.0497079 0.1689482 -0.0322523 0.3328587 1440267_at 0.3255403 0.9435149 0.7450113 -0.561857 -0.2684757 -0.1063947 -0.1637354 -0.053706 1440270_at 0.9453473 1.7241894 0.1878644 0.3381329 -0.1147467 -0.1025946 -0.1738413 0.0766191 1440273_at 0.9589143 1.2168868 0.29329 -0.163902 -0.2030409 3.40E-04 0.0137714 0.4034284 1440284_at 0.0298678 0.9550914 -0.0151873 0.3561721 -0.5278249 -0.0104939 -0.3556849 -0.499461 1440293_at -0.418693 -0.257739 -0.2814421 0.7052763 0.5484398 0.614273 0.3719974 0.3837682 1440296_at -0.0335056 1.00385 -0.1470889 -0.1602489 0.0784612 0.0917464 0.6833679 -0.0206462 1440311_at -1.4228079 -0.270816 0.517755 -0.6994476 0.1348927 0.5902821 -0.0112441 0.3708979 1440319_at 0.1192812 2.0585802 -0.0814975 0.017342 0.2981662 0.2735263 1.2754768 -0.0849598 1440339_at 1.1404316 3.5182328 0.8048089 2.1581593 -0.4921952 -0.3150692 -0.3394054 -0.6377561 1440342_at 0.5015447 -0.527453 0.2478752 -0.428822 -0.914887 -0.1115524 0.6131017 -0.2156164 1440344_at 0.5027084 2.0064502 0.5276204 -0.1672003 -0.2828145 -0.3984197 -0.4653196 0.12807 1440351_at -0.7022278 0.2097691 0.39324 -0.1485653 0.1194974 0.196453 -0.3972937 0.0979315 1440365_at -0.8728927 0.0447414 0.2763872 -0.1394284 0.4149783 -0.0325653 -0.3762926 0.1617338 1440371_at 1.5080538 2.586738 0.7413397 0.8556309 -0.2424533 -0.1882951 0.0815301 0.9139898 1440372_at -0.6789625 0.3216683 0.2349771 -0.4684668 -0.392948 -0.1052246 -0.7573783 -0.0644471 1440373_at -0.3674635 0.6599429 0.3344134 -0.604197 -0.1407372 -0.1237415 -0.4535939 -0.2100498 1440374_at -0.198612 1.1598659 0.0648882 -0.0100597 0.0032387 0.058677 0.9141656 -0.2275194 1440382_at 0.0382805 1.6945646 -0.0942501 0.0957694 0.5161693 0.3561638 0.8068888 -0.1729252 1440397_at -0.4790717 -0.544043 -0.2005959 0.5394735 0.6409102 0.3280177 0.3338567 0.4634223 Diabetes Page 126 of 205

1440410_at 0.0579875 2.6642923 -0.113736 0.185604 0.5876745 0.4071896 1.0317231 -0.1850997 1440415_at 0.1779707 1.1289543 -0.0224229 0.0377445 -0.1284491 0.013253 -0.114402 -0.0205889 1440419_at 1.2269156 3.6085334 -0.1734415 1.272924 -0.3122383 -0.0037206 0.1471711 -0.0894647 1440443_at 0.2118933 1.1175431 0.853737 -0.2331154 0.2164096 -0.0979191 -0.3509844 -0.1679654 1440469_at 0.2543975 3.1115754 -0.1556912 0.345135 0.7450913 0.5426715 1.2141434 -0.5591391 1440472_at 0.0406076 1.7191532 -0.1841369 0.2170345 0.26231 0.2295882 0.9061892 -0.2634634 1440491_at 0.1234525 0.4234766 0.4332449 -0.64255 0.0239018 -0.5819407 -0.6279523 0.5750621 1440513_at -0.3690752 0.792174 0.7634794 -0.7943196 -0.0559006 0.0454632 -0.7959721 -0.3232694 1440518_at 0.009756 1.6835697 -0.0731944 0.1314372 0.3031537 0.122076 0.9035118 -0.3147272 1440521_x_at-0.0357505 1.0506146 -0.0576503 0.0111337 0.0920266 0.0319899 0.8674455 -0.1802804 1440527_at -0.1062241 -0.642923 -0.1988264 0.7507975 0.4158214 0.2627431 0.6403373 0.8426878 1440531_at 1.0833932 2.4246569 0.2811364 -0.0728545 -0.5077421 -0.5033962 0.3079038 0.2677611 1440565_at -0.3222681 0.7829461 0.3210573 -0.2489202 -0.2285159 -0.0892921 -0.5254642 0.0265899 1440573_at -0.5070189 0.5388862 0.4885815 -0.3393512 -0.1062514 -0.0890617 -0.4259418 -0.3634863 1440587_at -0.1522684 1.0208378 0.2164184 -0.0820775 -0.3335534 -0.0867256 -0.2756284 0.0243443 1440600_at -0.1456081 1.0423815 -0.2110025 0.1251538 -0.0046898 0.2030244 0.4035449 -0.2295051 1440608_at 0.4627084 0.0620377 0.2878742 -0.6412964 -0.2038533 -0.5811509 0.0505617 0.1268072 1440645_at 0.4597687 1.8399736 0.7311096 1.1598103 -0.5754868 -0.2411789 -0.6122351 -0.5439005 1440649_at -1.5041993 -0.915767 -0.2816613 0.2244146 0.3339058 0.7278277 -0.0151412 0.3532297 1440662_at -0.6891801 -0.037443 0.3532007 -0.7048149 -0.10244 0.2804597 -0.0629007 -0.0888125 1440671_at -0.6846273 0.393777 0.3115796 0.0959218 0.0494006 0.1296419 -0.3827661 -0.1740394 1440672_at -0.1163285 1.5266069 -0.0653025 0.0206237 0.2422135 0.0342072 1.1133927 -0.3935398 1440739_at -0.0798342 -0.538804 -0.0730393 0.2257071 0.4697978 0.7026513 0.3425347 0.1356842 1440767_at 1.5856926 3.5689712 0.7405673 0.9355755 -0.0471515 -0.0581542 0.9247589 1.4699169 1440768_x_at0.0969503 2.472505 -0.106107 0.2818004 0.6222472 0.3188589 1.0220187 -0.303526 1440790_x_at-0.8541418 -0.148252 0.3133985 0.1795888 0.2290718 0.6071798 -0.4309184 0.3662585 1440796_at 0.1756504 1.7509854 -0.1088692 0.0177732 0.340875 0.2124901 1.0752991 -0.1873067 1440815_x_at-0.3161045 2.058329 0.2627341 -0.2042475 -0.489894 -0.2032928 0.723911 -1.4067239 1440820_x_at0.2955984 4.734914 -0.1600217 1.277813 1.2608488 1.1479886 1.8732 -0.3850322 1440821_x_at-0.5717641 2.1818519 -0.7434527 -0.0498478 -0.7767233 -0.8525031 -4.50E-04 -2.1878564 1440837_at -0.4756079 -0.888064 0.0903995 0.7467885 0.5022649 1.0330371 0.3193671 -0.0183026 1440840_at -0.3185245 -0.777643 -0.2610096 0.2022898 0.2467463 0.5107063 0.3378393 0.8569539 1440849_at -1.4879935 -1.236811 -0.6971496 0.031333 0.3123756 0.4727701 0.0824817 0.2474238 1440852_at -0.0040506 -0.038132 4.159013 0.0066381 0.0022731 0.0427513 -0.0288627 -0.0058931 1440884_s_at-1.1676704 -1.370631 -0.4249716 0.6412725 0.4186718 0.6043224 0.1640186 0.3511263 1440888_at -1.6228312 -1.167958 -1.3849556 1.2094145 0.1408579 1.1301811 0.435325 0.8047889 1440910_at 1.0946904 2.0906487 0.0946717 -0.1415978 -0.7124711 -0.7541491 -0.1701328 -0.2094946 1440954_at -0.5673857 0.3006605 0.515844 -0.6537106 0.0728887 0.1086174 -0.3317396 -0.0280735 1440957_at 3.0309181 4.4215536 0.3382082 2.6109376 -0.7615008 -0.815941 -0.4532566 -0.020402 1440966_at -0.8655164 0.3675306 0.3604654 -0.1056495 0.229207 0.1926935 -0.3063523 0.3182101 1440977_at -0.7510938 0.1675735 0.4233325 -0.1413369 0.2415858 0.305916 -0.4492788 -0.1858368 1440980_at -0.0193467 0.9911562 0.122352 -0.0624812 -0.1163492 -0.093409 -0.2272936 -0.2069228 1441000_at 0.1898306 1.3975174 0.3715937 0.7055869 -0.2267238 -0.0514529 -0.2368368 -0.4552902 1441010_at -0.2165729 -0.737073 -0.4080687 0.3503623 0.2304574 0.6330838 0.3463028 0.4584433 1441038_at -0.8469815 -0.164234 0.3632679 -0.1953871 0.3735933 0.3189055 -0.2269862 0.0535097 1441058_at -0.9088048 0.1239357 0.3595389 -0.5928998 -0.1520671 0.2757421 -0.5058422 -0.038252 1441094_at 0.2952349 1.0334278 0.4329543 0.6329939 -0.3266498 0.0851926 -0.447048 -0.4089994 1441096_at -0.9757752 -1.385665 -0.4134789 0.839036 0.4656517 0.3700514 0.9884825 1.183464 1441098_at -0.2801983 -0.344452 -0.059092 0.1449385 0.2008062 0.5589672 0.6855919 1.032987 1441150_x_at0.8231397 0.3766749 0.4430983 -0.0030131 0.0499846 -0.4741823 -0.1429733 -0.5971496 1441153_at -1.0511 -0.308792 0.4338779 0.023057 0.3130145 0.4152014 -0.0419528 0.6255023 1441165_s_at0.3076419 -0.301046 0.2706071 -0.3353226 0.2849854 -0.6070808 0.3774897 0.4633175 1441187_at -0.0062265 1.2120159 0.0841387 0.1251426 -0.1064062 -0.1112286 0.7942588 -0.0420623 1441206_at -2.8389435 -1.8979 -1.073081 1.425127 0.917734 1.2949903 0.6713473 0.7952306 1441213_at 1.07458 1.8527734 0.282878 0.369123 -0.7900493 -0.815646 -0.3189344 -0.6025721 1441218_at 0.9690386 0.9395661 0.1141033 -0.3636208 0.0995017 -0.3100432 0.3807879 -0.2784459 1441231_at -0.1892263 0.9332509 0.6687075 -1.1135519 -0.3751575 -0.4498848 -0.7430732 -0.2930996 1441241_at -0.1948973 -0.904506 -0.0533503 0.1753962 0.1895144 0.4267157 0.642149 0.8418353 1441242_at -0.1912148 0.8928043 0.2973764 -0.3289793 -0.1352219 -0.0807664 -0.0100598 -0.1701137 1441249_at 0.1325816 2.7712264 -0.1566557 0.300674 0.5674635 0.5770761 1.5197978 -0.296196 Page 127 of 205 Diabetes

1441266_at -0.6386204 0.4681246 0.414695 -0.6312523 -0.1608582 0.0729937 -0.6118663 -0.1913888 1441269_at 0.0652821 1.9967803 -0.1656808 0.3230693 0.0950154 0.1131306 1.0472988 -0.1370625 1441317_x_at-0.1121708 1.0801073 -0.2041249 0.2094901 -0.3806039 -0.2698827 0.2650919 -0.2728756 1441328_at -0.5554589 0.4705173 0.627875 -0.3171816 0.0547094 0.0931732 -0.4944557 -0.1760039 1441333_at -0.6559709 -0.117405 0.4214149 0.1477623 0.0411747 0.1658661 -0.0662251 0.4801588 1441386_at -0.592827 0.0364399 0.4497006 -0.4504378 -0.0081388 0.3220351 -0.5710328 -0.0663033 1441389_at -1.3814254 -1.017812 -0.5133698 0.5590339 0.3741619 0.7316498 0.2761641 0.2470862 1441413_at 0.6300637 0.7654911 1.0444521 -0.512284 0.1249111 -0.2733016 -0.6302945 -0.018164 1441435_at -0.3285172 0.6720576 0.5473608 -0.4433398 -0.0192363 0.0397409 -0.5120049 -0.0145961 1441441_at 0.2119604 1.7795434 0.2941942 0.4945633 -0.4364876 -0.0041435 -0.3080343 -0.0104005 1441444_at -0.938122 0.2047247 0.2753482 -0.1962588 0.223539 0.2686247 -0.1728934 0.0647554 1441481_at 0.1078904 0.9516702 0.0290759 0.2191076 -0.1139768 -0.0760936 -0.0575212 -0.3085289 1441507_at -1.3279823 -0.023948 0.3427433 -0.0132661 -0.0762093 0.4677304 -0.4890595 0.192783 1441531_at -0.7884308 0.2109445 0.4462066 -0.5542643 -0.0932505 0.3450665 -0.6263608 -0.0782153 1441556_at -0.5390436 0.446139 0.4983558 -0.5059958 -0.0657352 0.0543099 -0.4176838 -0.2335129 1441559_at -2.5934744 -2.494876 -1.4596336 1.2317057 0.660504 1.650066 0.502058 1.1176609 1441560_at 0.0620843 1.4518815 -0.042771 0.2354515 0.2843784 0.1496133 0.8683662 -0.3553146 1441584_at -0.9742783 0.1392068 0.553493 -0.5731583 -0.106841 0.3878136 -0.4292852 -0.0789981 1441589_at 0.0426879 0.9490671 0.0706335 -0.1787611 -0.2687809 0.1170251 -0.414534 0.0549377 1441598_at -0.0673698 -0.801192 -0.1699115 0.3955863 0.2015303 0.3719641 0.590779 0.6281421 1441624_at 0.3151919 1.2789502 0.5991967 -0.3660202 -0.4536977 -0.1522233 -0.2879834 -0.2641759 1441627_at -0.6764046 -0.044961 0.3346846 -0.277936 0.0658066 0.3904114 0.0752873 0.4634994 1441643_at -0.5397985 0.3479166 0.653142 -0.098206 -0.0306874 -0.0304289 -0.2699235 0.2145159 1441651_at -0.171513 1.0683209 -0.3374111 0.1801881 0.1658864 0.3382106 0.5987068 -0.1128085 1441655_at -0.0432389 2.8517642 -0.0787472 0.1946163 0.8453972 0.3137444 1.243183 -0.2169217 1441667_s_at-0.2314785 -0.534486 -0.4137552 0.8275325 0.3430577 0.7659076 0.441524 0.897442 1441708_at 0.9569134 0.0915888 0.4675708 -0.1107273 0.0560659 -0.1121523 -0.1269383 -0.0899879 1441752_at -0.2457925 -0.751232 0.1254207 -0.1627741 0.4759417 0.1399969 0.3115185 0.5950955 1441765_at 0.7085989 1.2416786 0.2189914 0.0392716 -0.7428826 -0.531896 -0.0825785 -0.3352108 1441773_at -0.1074203 1.2586943 -0.1919814 0.2705069 0.1660513 0.1515934 0.6137522 -0.1667031 1441779_at -0.7425146 0.2267568 0.3676801 -0.614295 -0.1457366 0.2513882 -0.5881541 -0.3160181 1441799_at -0.6780348 0.5488408 0.3506131 0.0445466 -0.236163 -0.4526571 -1.2926283 0.3091046 1441807_s_at0.0778284 1.2982157 -0.0298346 -0.1900773 -0.1693227 -0.0863716 0.2968202 -0.2400818 1441822_at 0.1861181 1.0788028 -0.3176726 -0.2726479 -0.0760223 -0.1707672 0.3317777 -0.1511812 1441823_at -0.6561127 0.4204962 0.6620554 -0.370774 0.2535309 0.2922956 -0.8607011 -0.4177516 1441824_at 0.6867604 0.9932083 0.0348302 0.1443982 -0.2284581 -0.2478785 -0.2759062 -0.2113136 1441836_x_at0.2409977 4.459077 -0.3792707 0.7640104 0.837377 0.7713797 1.5194317 -0.9085762 1441848_at -0.4888363 0.626145 0.5029564 -0.4652472 -0.1355538 0.1204224 -0.6578097 -0.3860127 1441861_at -0.1220959 1.6163328 -0.2022204 -0.0846369 0.2363647 0.0957788 0.6830821 -0.18202 1441867_x_at0.1858574 0.7699236 -0.2446407 -0.1576247 0.0748999 -0.0196992 0.5068343 -0.1585137 1441869_x_at-0.5471526 0.4733332 0.2763698 -0.0424476 -0.4501329 -0.2710112 -0.403216 0.0038209 1441881_x_at-0.6270111 -0.928247 -0.2488117 0.2940283 0.1434689 0.1751423 0.5099013 0.4994103 1441886_at 0.2564274 1.6434324 -0.1763026 -0.1766825 -0.0041801 -0.0602799 0.8296521 -0.204905 1441893_at -0.0427872 1.0704391 -0.0893579 0.0925657 0.1963239 0.1361024 0.7348079 -0.0645737 1441916_s_at0.0753772 2.9710584 -0.1442591 0.3758311 0.7658566 0.705495 1.3976299 -0.1452006 1441938_x_at-0.2752568 -0.384645 -0.0982989 0.4886444 0.6796988 0.190083 0.2298033 0.2467513 1441941_x_at0.6629003 1.1401502 0.6360262 0.1953096 -0.2023923 -0.1320179 -0.1657948 -0.046043 1441950_s_at-0.0503423 0.6695408 -0.3984743 0.342407 0.0316376 -0.0090021 0.3633574 -0.2650172 1441954_s_at0.0799689 4.5656285 -0.2957698 1.0584338 0.5187149 0.7965993 1.5171667 -1.2656884 1441960_x_at-0.3176971 0.7035052 -0.4908887 0.175674 0.3013396 0.3171438 0.6036463 -0.0474099 1441965_at 0.1883817 3.344035 -0.0090786 0.4871242 0.7610766 0.6215573 1.8525547 -0.1524732 1441971_at 0.8307953 0.5761206 0.4122101 -0.1948731 -0.2065894 -0.2049703 -0.0133147 -0.2884383 1441975_at 0.8064739 1.3116149 0.2791208 -0.3712485 -0.7923554 -0.8182259 -0.8552319 -0.9141167 1441977_at -0.5360937 0.1147447 0.6854153 -0.6805897 0.0163616 0.2064428 -0.1777468 0.1944583 1441978_at 1.4144583 1.6614556 -0.0748339 1.1405773 -0.0243202 -0.0939268 -0.1539428 0.0832485 1441985_at 0.0499062 2.9014564 -0.1819457 0.2643836 0.7324473 0.3695251 1.7316427 -0.1708295 1442013_at -0.0687719 1.1728683 -0.1660351 -0.0938358 -0.0794462 -0.2456416 0.5873086 -0.1513634 1442014_at -0.5687137 0.5566527 0.5017026 -0.2150438 0.054472 0.2025526 -0.2271012 -0.055923 1442058_s_at-0.0189013 1.4127482 -0.3565658 -0.2785611 0.1752029 -0.2099784 0.6090595 -0.3505313 1442072_at -0.4330775 -0.349198 -0.2244813 0.5264728 0.3229166 0.8316461 0.6623246 0.5434632 Diabetes Page 128 of 205

1442074_at -0.690064 -0.439444 0.5864245 -0.1484251 0.3708463 0.4918828 -0.2232367 -0.3486632 1442097_at 0.546553 0.7779037 -0.0718929 0.4442655 -0.2990653 -0.1176261 -0.2190936 -0.0910161 1442109_at -0.3570329 0.7823621 0.6160123 -0.3983505 0.0956007 -0.0333842 -0.1747489 -0.0947374 1442113_at 0.0184141 0.9460557 -0.0973489 -0.0441582 0.0374963 0.0304822 0.9078161 -0.0493715 1442138_at 0.3110563 1.611209 0.0419237 0.0625157 0.2653674 0.0853104 1.0757005 -0.1862868 1442191_at -0.2182252 0.7787341 0.765784 -0.3694301 0.1234823 -0.3330344 -0.1252054 0.1005376 1442223_at 0.1992054 1.1355528 0.3702096 -0.2085209 -0.5121714 -0.3902018 -0.4613904 -0.37492 1442233_at -0.515856 -0.129474 0.5029728 -0.4039269 0.0611341 0.4129821 -0.0099457 -0.0136685 1442275_at -0.0461502 2.3396878 -0.3384284 0.1832376 0.6165671 0.4170945 0.9439376 -0.4444496 1442277_at -0.0244724 1.3613225 0.4436368 -0.1178324 -0.2528833 -0.1334362 -0.2158206 -0.3777199 1442285_at -0.0422745 0.9041237 0.355881 0.0010407 -0.1595209 -0.1095598 -0.2395161 -0.2447224 1442294_at -0.9196694 -1.469151 -0.3350058 0.2324071 0.1816595 0.2641892 0.4538784 0.6130047 1442340_x_at-1.6960651 0.1480624 0.0918449 -0.3511729 0.4361843 0.3251742 -0.1260104 -0.4605919 1442347_at 0.2207601 1.2471755 -0.124633 0.029783 -0.0851095 -0.1128808 0.6032364 -0.2761259 1442368_at -0.2232807 -0.723484 -0.2993274 0.4172807 0.3978415 0.4113894 0.5057459 0.6128619 1442406_at 0.5158339 1.2915611 0.8751804 -0.3004839 -0.0068689 -0.1688188 -0.500919 -0.1425536 1442427_at -0.630653 0.3843985 0.2915674 -0.0322719 -0.0744036 0.0910687 -0.4947597 0.0368077 1442430_at -0.1787342 0.962178 -0.0513238 0.0832081 0.2862596 0.1928669 0.509347 -0.3158883 1442435_at -0.5380874 0.5794824 0.5794269 -0.3122244 -0.1553363 -0.0444865 -0.3962566 -0.1755991 1442445_at -0.8459998 0.5658636 0.5819986 -0.688122 -0.2200507 0.3708821 -0.350749 -0.159609 1442467_at 0.3592747 0.9988715 0.1606023 0.0035477 -0.1041245 -0.2514556 -0.204971 -0.0592378 1442473_at -0.6605253 0.4401809 0.4312288 -0.5533307 -0.5738723 0.0635204 -0.8464632 -0.1096129 1442514_a_at0.7907776 1.0038892 0.3139255 -0.117528 -0.3029386 -0.1798168 -0.2610842 0.1741656 1442537_at -0.5309705 -0.711916 -0.6751704 0.428438 0.2133443 0.3364185 0.3416944 0.6647218 1442542_at -0.6246454 -0.662415 -0.4642317 0.7926223 0.1952798 0.7107463 0.5980274 0.6240088 1442549_at 0.4118805 1.572129 0.131747 0.4733415 -0.3455618 -0.0081198 -0.3365372 -0.2656307 1442560_at -0.58766 0.1864288 0.488882 -0.7020762 -0.3286753 0.1722527 -0.1692543 -0.160569 1442564_at 0.8518217 2.5995698 1.1082625 0.8324544 -0.3395615 -0.0573791 -0.3119146 -0.3079867 1442580_at -1.1073334 -0.525435 0.1315539 0.0207632 0.2844648 0.7035147 0.1955689 0.8420496 1442609_at -0.9195197 0.0349857 0.5430348 -0.2827857 0.1172571 0.2846616 0.0444113 0.3619064 1442633_at 1.0542903 1.7481595 0.6799523 0.7132559 -0.5056582 -0.4840359 -0.5472977 -0.5850039 1442645_at 1.4649786 2.9835308 1.5953064 2.2734814 -0.2579151 -0.084396 -0.2949117 -0.4415968 1442676_at -0.6742187 -1.041013 -0.166839 0.4896507 0.4861942 0.7393764 0.1631036 0.144829 1442680_at 0.2618079 1.120883 0.3240215 0.1090796 -0.2005286 -0.157003 -0.1220231 -0.2188819 1442698_at 0.0266459 -0.577416 0.4689877 0.0770922 0.4350947 0.3668951 -0.2102943 -0.0430395 1442700_at -1.1517627 0.1755365 0.5927726 -0.7857645 -0.1891845 0.1438965 -0.028818 -0.4451431 1442704_at -0.6463137 0.3303766 0.4504989 -0.5100145 -0.4328972 0.006048 -0.4556613 0.0205913 1442710_at -0.7518697 0.3662469 0.4148459 -0.4453478 -0.2222162 0.0545584 -0.0853272 -0.249279 1442775_at -0.8265027 0.1450987 0.177256 -0.1928251 0.2210192 0.3416314 -0.1312223 0.2923853 1442797_x_at0.2886943 4.7435975 -0.4589003 0.4412841 0.9359355 0.5289523 1.7100116 -1.0261465 1442886_at -0.6405067 0.4606948 0.2285875 -0.164623 -0.1625707 -0.1195396 -0.3273468 -0.0757362 1442902_at -0.0243751 2.5102112 -0.5042473 0.4849551 0.3964529 0.3598968 1.4368982 -0.1905856 1442903_at -0.7433981 0.2489791 0.5089754 -0.1560135 -0.1988709 0.2476511 -0.3365282 0.2315685 1442917_at -0.2879171 -0.729549 -0.3720477 0.8174512 0.3946377 0.9706056 0.3202424 0.4224669 1442945_at -0.2846345 1.0268502 0.0719139 -0.1370901 -0.0384657 0.0315208 -0.3750521 -0.2132185 1442992_at -0.4464696 0.6602002 0.4765192 -1.0029094 -0.2998572 -0.2559684 -0.9632766 -0.2750182 1443018_at 0.5059991 1.9184947 0.6618799 0.4195306 -0.3692003 -0.2258471 -0.0727847 -0.2701041 1443075_at 0.1343111 0.3486987 0.6177537 -0.7446737 -0.1808059 -0.3861273 0.2573298 -0.0289865 1443082_at 0.2950198 0.8013349 0.5053411 0.298161 -0.2667399 -0.0953601 -0.1374547 -0.1174933 1443088_at -1.1723475 0.2290214 0.2738563 -0.4918151 -0.1994803 0.2467643 -0.4759237 -0.1517422 1443122_at 0.4992895 1.2466636 0.7374915 0.5978849 -0.1785455 -0.1049658 -0.3617007 -0.3292426 1443138_at 0.1270204 1.1288646 0.3946978 -0.5421758 -0.6727189 -0.4312073 -0.2893208 -0.2468694 1443147_at 1.6442251 0.589308 0.1647466 -0.1995156 -0.127071 -0.2563409 -0.0973937 -0.0183942 1443166_at 0.0064052 1.2357773 0.2422835 -0.0318267 -0.2929799 -0.0893297 -0.3972438 -0.1924764 1443167_at -0.1172797 0.8160083 0.2634157 -0.3148258 -0.201807 -0.1192006 -0.4144143 -0.079806 1443219_at -1.1185111 -1.186652 -0.3056788 0.5529156 0.4595583 0.7179745 0.077151 0.3363966 1443221_at 0.1247985 0.7517234 0.6834555 -0.962554 -0.1407147 -0.5909244 0.1724803 -0.3289412 1443225_at 0.1657877 -0.793491 0.3716333 0.0192266 0.1945856 -0.2662438 0.1623694 0.4488729 1443231_at -0.722284 0.2972904 0.4278269 -0.5728173 -0.0516002 0.3204451 -0.6303952 -0.1248415 1443257_at -0.4977454 0.2311574 0.5581425 -0.178345 0.1977974 0.1971159 -0.3990173 -0.1298199 Page 129 of 205 Diabetes

1443322_at 1.0778763 2.3091764 0.7370706 1.5601754 -0.626327 -0.468885 -0.6721008 -0.4480381 1443335_at -0.5898492 0.1981719 0.5607194 -0.1393879 0.2749797 0.2711434 -0.2949559 0.3124719 1443337_at -0.0312797 1.0817707 0.2725704 -0.1729839 -0.029406 -0.1919707 0.1130905 -0.32348 1443378_s_at-0.0580462 1.1113216 -0.1630404 0.0842919 0.2199568 0.0941018 0.7143572 -0.0150657 1443400_at -0.6382631 0.2805704 0.4062868 -0.2855752 -0.0640725 0.0694536 -0.3431091 -0.0921222 1443437_at -0.8300344 0.0881445 -0.5817312 0.3886399 0.2943082 0.2899574 0.6602194 0.5052469 1443489_at -0.857111 0.3446626 0.1732655 -0.5068321 -0.3139464 -0.0511997 -0.4727689 0.0572794 1443509_at 0.2369183 0.9746935 0.6052119 0.0774008 -0.1869183 -0.1155187 -0.1850775 -0.1530659 1443533_at -0.5046668 0.5551351 0.3710616 -0.5897088 -0.1198607 0.0855536 -0.5085416 -0.0580812 1443534_at -0.8405613 -0.202755 0.2296522 -0.0125813 0.0769985 0.3770104 -0.0756076 0.2797352 1443536_at 0.6284843 1.8881248 0.0225905 0.3978815 -0.2615234 -0.1016315 -0.188549 0.0723163 1443577_at -0.1091063 1.8907598 -0.2995939 0.0353822 0.4535514 0.3092932 0.8062826 -0.2129498 1443579_s_at-1.0416248 -1.151334 -0.407475 0.2695913 0.297905 0.5094309 -0.0470711 -0.0232693 1443620_at -0.3235688 -0.338462 -0.6702619 0.2386556 0.0368294 0.1431701 0.0168846 0.3920598 1443630_at -0.640901 0.2806684 0.3920593 -0.7035716 -0.2924283 0.1904374 -0.6606868 -0.2355655 1443635_at -0.1678497 2.2143931 -0.1788663 0.3136003 0.6129177 0.3044655 1.3421451 -0.3241285 1443661_at -0.0237244 0.9193246 -0.1185809 -0.0097716 0.1450073 -0.0059203 0.2947625 -0.119601 1443673_x_at0.1959581 1.352705 0.5703447 -0.3027263 -0.511788 -0.3775105 -0.5135263 -0.5916424 1443714_at -0.2968874 -0.806268 -0.3934147 0.5129881 0.3018695 0.3717904 0.0280644 0.4247452 1443783_x_at-0.2026445 -0.67283 0.5317316 0.3913167 0.1446716 0.5775202 0.1034017 0.137931 1443827_x_at-0.9429954 -0.947511 -0.5562884 0.8100791 0.6295518 0.5638599 0.8740861 1.4555899 1443831_s_at0.0384663 1.0947809 -0.1959993 -0.1998696 0.3656382 0.0361216 0.5841245 -0.3407758 1443838_x_at0.7480872 1.1427662 0.8554399 -0.0858662 -0.6020668 -1.0316241 0.0817253 -0.5497378 1443847_x_at-0.4796768 -0.101739 -0.6104173 0.6622145 0.2077348 0.3888943 0.146788 0.1878827 1443875_at -0.0232161 2.7480664 -0.1364033 0.157449 0.5149725 0.3532408 1.4690895 -0.5752645 1443889_at -0.3696138 -0.894284 -0.4378727 1.053905 0.2123794 1.5373732 0.1988459 0.4123834 1443905_at -0.4174722 0.7197294 0.5484029 -0.824976 -0.0776109 -0.1007851 -0.6109102 -0.1461651 1443906_at -0.097319 -0.836915 -0.30518 0.5190444 0.4159699 0.2419734 0.1222666 0.1501195 1443921_at -0.5412952 0.247365 -0.5410099 0.4816923 -0.166174 0.3699511 0.0811151 -0.0738128 1443939_at -0.4812052 -0.96904 -0.3451688 0.4444218 0.3106085 0.8593316 0.5974258 0.7581328 1443983_at -1.2894592 -0.185798 0.5662301 -0.6892529 0.0383375 0.5128954 0.0030546 0.3511566 1444010_at -0.0231248 1.6057119 -0.1286956 0.022207 -0.0325303 0.1136641 0.7436584 -0.469988 1444017_at -0.833686 0.2305067 0.2635864 -0.4935265 -0.1526812 0.1226414 -0.6768074 0.0274552 1444045_at -0.8587831 -0.157516 0.4497589 -0.3448815 0.0879432 0.4235665 -0.2582049 0.3157274 1444054_at 0.4662511 -0.614555 0.066675 -0.0976877 0.1217656 0.1407608 0.4330204 0.6094906 1444088_at -0.4777857 -0.41383 -0.1387477 0.8301125 0.433166 0.3946433 0.3914696 0.3928062 1444122_at -0.1952545 2.8041782 -0.2813706 0.007808 0.6986725 0.4094926 1.3380908 -0.0559315 1444139_at 1.3572761 1.6253244 0.5719022 -0.7056925 -0.5409161 -0.671921 0.0453486 0.4629076 1444161_at -0.5875603 -0.74697 -0.0814095 0.2296028 0.212297 0.6656736 0.2956092 1.0718713 1444176_at -0.3546518 2.45E-04 -0.4113945 0.4311273 0.8694371 1.0854489 -0.926133 -0.2129896 1444198_at 0.3171692 1.709659 -0.0915915 -0.8556202 -0.744072 -1.0240101 -0.434641 -0.9363508 1444270_at 1.1501716 0.1976338 0.6576735 -0.1145486 0.0740593 -0.1571913 -0.0463185 -0.1325306 1444349_at -0.69659 0.5275111 0.5039393 -1.0068457 -0.3723908 -0.1391223 -0.6436405 -0.3016636 1444361_at 0.1700394 1.2726549 0.1158351 -0.1458879 -0.4021029 -0.0391416 -0.2677105 -0.1208337 1444396_at -1.1231347 -0.19205 0.2487855 0.056669 0.4500186 0.8364226 -0.093883 0.1124044 1444399_at -0.1428088 -0.712359 0.5390605 -0.3318355 0.3657837 0.0559775 0.3044591 0.3718778 1444427_at 1.1129442 2.2576613 0.3312455 0.2704151 -0.0121754 -0.1535564 0.0797124 0.8117868 1444472_at -0.7581301 0.2704332 0.5072234 -0.6547947 -0.117437 -0.2864914 -0.593016 0.0073284 1444480_at -1.1933627 -1.26676 -0.7826963 1.1691153 0.7861384 1.5488653 0.7951136 1.0799044 1444517_at 0.7935392 0.5131987 0.0346733 -0.557889 -0.2022016 -0.3203751 0.2503271 -0.233216 1444525_at -0.903446 0.2866151 0.6746335 -0.3656678 -0.0060254 0.4235748 -0.6704941 0.0686046 1444537_at -1.3474308 -0.80528 -0.3757711 0.9110584 0.6848091 0.5318276 0.4615879 0.7088893 1444540_at 0.537181 1.4439871 0.2565352 -0.1772728 -0.2091787 -0.3140613 -0.5139467 -0.227109 1444564_at 1.2253225 1.2421243 0.520709 -0.1022761 -0.5276035 -0.3561949 -0.5142347 -0.2822827 1444574_at -0.6902432 0.2223278 0.352492 -0.0743825 -0.0786418 0.0615685 -0.2404962 0.0087763 1444583_at -0.0263878 0.827379 0.4916468 -0.1491592 -0.2495136 -0.0156332 -0.1275481 -0.1742028 1444605_at -0.0059907 1.2439232 -0.3310298 0.0524999 0.3748027 0.1523204 0.8248263 -0.0419946 1444614_x_at0.5252969 0.7769214 -0.0730057 -0.2597287 0.1181314 -0.2056422 0.8913048 -0.3086863 1444636_at 0.023254 1.125823 -0.0841008 -0.001392 -0.0887368 0.1151995 0.6349725 -0.1453495 1444651_at -0.4355737 0.5892463 0.3776223 -0.455416 -0.0613398 0.0038565 -0.2996647 -0.1820984 Diabetes Page 130 of 205

1444658_at 1.948536 2.215626 0.9838929 0.2624836 -0.0846969 -0.0897252 1.1454386 2.13857 1444668_at -0.8116561 1.0037045 0.1204934 0.0015817 0.1432084 0.0994853 0.9514907 -0.4013742 1444712_at 0.0034713 2.2236552 -0.07888 0.0190198 0.4903846 0.1823387 1.15938 -0.3297468 1444740_at 0.0811838 2.5627594 0.3839985 0.1627328 0.6023623 0.049947 1.3559417 -0.464207 1444780_at -0.02502 0.8932529 0.1991485 -0.0326924 -0.1822859 -0.0388687 -0.131799 -0.1161606 1444786_at -1.3187602 -1.306345 -0.5389295 0.6288121 0.2046967 0.5877045 0.6355367 0.6529827 1444790_at 0.5352008 1.8778017 0.21189 -0.2464826 -0.1756724 -0.4566161 0.6304973 -0.2282681 1444811_at -0.4509249 0.5926242 0.4674375 -0.3037922 -0.2517289 -0.2088829 -0.335591 -0.1432403 1444946_at 0.9408243 0.0472075 0.3126653 -0.4457235 -0.084548 -0.322988 -0.1907177 -0.2593082 1444982_at -0.5647428 0.2418844 0.5026513 -0.6184857 -0.1096668 0.0439779 -0.549449 -0.072066 1445001_at 0.4174756 0.6492461 0.7918708 -0.5451071 -0.4191051 -0.2858488 -0.1287162 0.4207215 1445025_at -0.6863234 0.1539277 0.4538931 -0.29267 0.147629 -0.0106381 -0.5651005 0.3540267 1445031_at 0.119363 0.9778442 0.3784194 -0.1912713 -0.2774094 -0.0714607 -0.3112319 -0.0112573 1445062_at 0.2589662 0.9515481 0.0399262 0.016547 -0.2396303 -0.1412452 -0.1550214 0.0391034 1445148_at 0.0066065 1.2260207 0.442611 -0.1371918 -0.4367179 -0.1486507 -0.6251904 -0.1488884 1445173_at 0.0874525 0.681096 -0.4138104 -0.2262979 -0.0088863 -0.2207872 0.5294282 -0.0860837 1445194_at 1.0825485 1.500469 0.0825425 0.1000409 -0.2458656 -0.2293789 -0.0471977 0.4678133 1445204_at -1.0782819 -0.11389 0.4557731 -0.0544746 -0.0850938 0.2351232 -0.5246541 0.2408018 1445224_at 0.0101238 1.3822937 0.3067145 0.7531581 -0.1312899 -0.1170549 -0.2349985 -0.1442645 1445247_at 0.2602687 0.9749646 0.1915739 0.246793 -0.1547359 -0.1321231 -0.2314339 -0.121093 1445268_at -2.7901592 -2.170897 -1.2676198 2.2379298 1.3988383 2.055845 1.2191744 1.4313036 1445279_at -0.6166916 -0.644897 -0.1012331 0.4678638 0.9692119 0.281279 -0.4065572 0.2729637 1445307_at -0.4597428 0.913967 0.5202419 -0.1166601 -0.3834595 -0.1341873 -0.6390964 -0.088511 1445322_x_at-0.5379534 0.5900862 0.3530037 -0.1980953 -0.2487758 -0.0245914 -0.29188 -0.0925217 1445328_at 0.7716596 0.4222792 0.2369585 -0.2603781 -0.1077083 -0.2804934 -0.0841667 -0.5234887 1445329_at 0.1086078 1.1893057 0.4850464 -0.4997597 -0.1702816 -0.1923606 -0.4405855 -0.4581442 1445340_at -0.7895078 0.4936934 0.2325845 -0.144695 0.0067739 0.4907875 -0.0626979 -0.0408454 1445404_at -0.0442292 0.9172767 -0.1550717 -0.0932982 0.131206 0.1279879 0.6204214 -0.1599361 1445414_at 0.7983763 1.4160295 0.2700617 0.5104182 -0.1947124 -0.1287537 -0.118214 -0.1212788 1445441_at -0.3130744 1.0751393 -0.1013184 -0.0930189 0.2963936 0.2619339 0.7412867 -0.5019519 1445443_at 0.421416 0.6642087 0.5086533 -0.6035259 -0.3484666 -0.4093372 -0.2898221 0.1459691 1445534_at -0.5494614 0.6811999 0.6503704 -0.4480829 -0.0708287 0.1458601 -0.3135761 -0.4254168 1445539_at -0.5706447 -0.549944 -0.2325734 0.5034881 0.2204908 0.658828 0.0289264 0.2169948 1445543_at 0.0695121 0.5260063 0.4613397 -0.2877924 -0.4993534 -0.0037201 -0.1922596 -0.0192806 1445546_at -1.2260929 -1.282967 -0.2773162 0.3870032 0.3045312 0.6585175 0.4232429 0.6633301 1445555_at 0.1429907 1.1582105 0.0721997 0.027894 -0.2167532 -0.1024877 -0.0966929 -0.0266927 1445565_at -0.7232366 -0.92157 -0.6880907 0.9377191 0.9507677 0.7777017 0.0121557 0.3251189 1445574_at 0.5440856 -0.492476 0.0954678 -0.704278 -0.2158747 -0.317014 0.6387914 0.8215901 1445576_at 0.5151249 1.0465226 -0.077416 -0.4684508 -0.068292 -0.2323342 0.3861855 -0.5037249 1445579_at 0.6348628 0.4350132 0.3594383 -0.4946697 -0.075118 -0.1383912 -0.1381715 0.2532438 1445623_at -0.0997876 1.7338624 0.0184577 0.0901904 0.363512 0.0332832 1.1394833 -0.1670408 1445626_at -0.7791345 0.1838064 0.2324878 0.1808331 0.1517198 0.7881717 -0.4460939 -0.2433737 1445641_at 0.2818533 1.3932039 0.2564445 0.0199099 -0.3215995 -0.2588102 -0.3043032 0.0138386 1445642_at -0.0708196 2.0073133 -0.1127211 0.3012755 0.4528384 0.2577051 0.7445989 -0.2060566 1445661_at 0.0871308 1.1373814 -0.1379985 0.1054244 0.2995132 0.1520036 0.6534883 -0.1740063 1445669_at -1.0004021 -0.826319 -0.3829794 0.5237963 0.223895 0.207216 0.4364805 0.4166835 1445672_at -0.2289594 0.9609845 -0.1349276 0.0353239 0.039889 0.2507013 -0.0746282 -0.0813704 1445679_at 1.1394223 2.825283 1.1000198 2.0584764 -0.203448 0.0231434 -0.3303692 -0.3009074 1445804_at 0.4088826 0.604907 0.0928171 0.2879577 0.0593258 0.0314674 0.3437917 1.2841886 1445827_at -0.0682495 0.7269106 0.1926457 -0.089833 -0.2972302 0.0938486 -0.4050547 -0.0455807 1445882_at -0.438997 -0.889352 0.0391432 0.24263 0.4590293 0.7233656 0.0354959 0.0567897 1445898_at -0.1487376 -0.561565 -0.1827807 0.5243723 0.4708733 0.271682 0.1828338 0.3345656 1445930_at 0.9378877 0.3765261 0.3644145 -0.2621282 -0.1297447 -0.1961598 -0.0130046 -0.075719 1446001_at -0.3790513 0.8813521 0.4766041 -0.843437 -0.4013015 -0.1605349 -0.4921096 -0.405635 1446017_at -0.8513309 0.1256878 1.0607986 0.7703316 0.0894322 0.2468185 0.0502594 -0.080719 1446069_at -0.566097 -0.110619 0.4773645 -0.1762829 0.0216995 0.5942831 -0.5279548 0.1739316 1446074_at -0.2970417 -0.711234 -0.365518 0.5758128 0.2395808 0.7319028 0.0774767 0.1866239 1446075_at 0.7365501 1.2079172 0.3764737 0.1660283 -0.4456892 -0.4907894 -0.4867837 -0.3740877 1446174_at 3.2676802 4.9824786 3.955908 3.7426295 -0.4164574 0.4453484 -0.5022261 -0.6525004 1446417_at -1.0164677 -0.086203 0.1064079 0.0492253 0.0630101 0.2883987 0.0110793 0.1951075 Page 131 of 205 Diabetes

1446424_at 0.2917411 1.1218686 -0.0374717 -0.2559395 0.1549143 -0.0200301 0.5753945 -0.3015417 1446481_at -0.4949458 0.0155367 0.5223643 -0.2967904 0.0046258 0.5050832 -0.4568534 0.2254701 1446582_at -0.5703131 -1.053629 -0.1612939 0.5528736 0.4634243 0.8509476 0.1708527 0.4461339 1446656_at 0.6464361 0.2456838 0.8449416 -0.4799771 -0.1915516 -0.1907134 0.0157768 0.1870941 1446661_at -0.2035565 0.1610293 1.1196508 0.2743774 0.1300865 0.1863916 0.0291632 -0.104404 1446669_at -0.7979568 0.1604288 0.7423408 -0.7793522 -0.0765154 0.2150085 -0.4023741 0.2015362 1446670_at -0.9028541 0.0376972 0.306098 -0.4429619 -0.0695121 -0.0519935 -0.5286374 -0.0287468 1446772_at 0.1064668 0.3999219 0.4514465 -0.9296708 -0.0830857 -0.3706227 -0.0539425 -0.2515481 1446860_at -0.7734729 0.1216168 0.5069538 -0.395941 -0.0824388 0.1028523 -0.6311067 -0.2186375 1446972_at -0.8143069 0.3463409 0.4305654 -0.3013091 -0.0682958 0.3191989 -0.5226405 0.0320843 1447044_at -0.3826027 0.0951117 0.6995059 0.0394416 0.0322119 0.0682135 -0.1153336 -0.0454642 1447059_at -0.3294784 0.3799715 1.0383558 0.9149692 0.3364407 0.5166841 0.5864887 0.2511292 1447096_at -0.5469801 0.3598839 0.5897225 -0.6612268 0.1237725 0.1201979 -0.5039063 -0.0632655 1447147_at -0.6380582 0.372622 0.6983967 -0.6875308 0.2135615 0.1876891 -0.2715182 -0.3119942 1447150_at -0.7714369 0.3884831 0.059027 -0.1398897 -0.0790655 0.4029192 0.2542616 0.1692891 1447174_at -0.0375021 0.8978806 0.2419756 0.0908866 -0.3604896 0.0049419 -0.5328698 -0.1995387 1447242_at -0.5851966 0.5752665 0.558473 -0.2044358 -0.0162394 0.1333352 -0.3893555 -0.4088432 1447322_at -0.7486277 -0.061724 0.3191268 -1.36E-05 0.1621338 0.2620044 -0.2282581 0.2796135 1447329_at -0.8363236 0.1412922 1.1824195 0.5787516 0.0683314 0.3167959 0.0592953 -0.2498339 1447340_at -0.705129 -0.921282 -0.2322607 0.4167323 0.6118808 0.585249 0.1764201 0.2669565 1447352_at -0.0564949 0.923811 -0.1383539 0.0158584 0.0755237 -0.0552123 0.9034242 -0.0469399 1447395_at 1.9197679 4.373856 0.080884 1.7777491 -0.2078202 -0.1176024 0.1115143 0.4564835 1447408_at -0.730456 0.4092431 0.3821669 -0.5457864 -0.2650494 -0.0983774 -0.3453535 -0.0547736 1447410_at -0.3760091 0.7004664 0.1852167 0.0833064 -0.0383713 0.0205199 0.7552685 -0.2172315 1447411_at -0.4377545 0.8723629 0.2813383 -0.4145401 -0.031302 -0.0879581 0.0518608 0.0284074 1447439_at 0.1500293 1.106521 -0.1578022 0.0031419 0.0671875 0.0520444 0.7474003 -0.2013311 1447495_at 0.1758682 1.5706227 -0.2001892 0.303021 0.0203635 -0.0214095 0.9966502 -0.2374741 1447500_at -0.3513317 -0.430054 -0.4369862 1.0014055 0.1109722 0.9917107 0.3297011 0.462052 1447520_at -0.8527316 -1.118293 -0.3639075 1.1331127 0.9236603 1.1518546 0.1366876 0.4978185 1447527_at -0.9523578 0.262946 0.3795395 -0.5300455 0.2319008 0.1650904 -0.7938792 -0.1715902 1447534_at -0.1390193 1.259939 0.1337651 -0.154784 0.1744296 0.0011115 0.7211084 -0.2351579 1447541_s_at0.0414083 1.3695999 -0.350421 -0.2423184 -0.0263825 -0.0818213 0.7587895 -0.2401571 1447542_at -0.0099598 1.9537029 -0.0957289 0.1541957 0.5925177 0.4185276 1.0283996 -0.105219 1447544_at -0.1612004 -0.807218 -0.3182082 0.125345 0.2570531 0.3303789 0.3658015 0.5733309 1447550_at -0.9372325 -0.704637 -0.8125227 1.01032 0.6493734 1.2127668 0.5480697 0.6057989 1447691_x_at-0.2013881 0.8594544 0.8370565 -0.2393384 0.0749403 0.077505 -0.4065673 -0.3198476 1447706_at -0.6052452 0.4604842 0.4017261 -0.6617189 -0.3757373 -0.1624532 -0.1893533 -0.2125883 1447711_x_at0.0886695 1.0955454 -0.1377839 0.168046 -0.0993238 -0.0687908 0.0059187 -0.0964939 1447725_at 0.9712063 0.5359429 -0.3104409 -0.6619239 -0.2400568 -0.6209523 -0.0609797 0.0029763 1447799_x_at0.0054411 1.8940343 -0.0849164 0.1096257 0.6504635 0.3998106 0.5102562 -0.0191595 1447807_s_at0.5967735 1.2927554 0.8572043 -0.02527 -0.289432 -0.5463222 -0.2810815 -0.6204941 1447808_s_at0.5813853 1.6544241 0.3191189 -0.5586872 -0.5663025 -0.6803489 -0.041201 -0.3258791 1447830_s_at1.8797758 1.2754083 0.9649588 -0.260242 0.3323423 -0.5215281 -0.6167081 -0.5072039 1447862_x_at-1.0678754 -0.879455 -0.1045342 1.2081156 0.8063288 0.6956705 0.1640348 0.2960526 1447878_s_at-0.6183984 -0.880918 -0.2457895 0.367733 0.2504738 0.3945826 0.3080721 0.4277846 1447885_x_at-0.6703423 -0.736851 -0.2607358 0.6880941 0.622954 0.452313 0.0613416 -0.0861332 1447886_at 0.4851917 1.0054958 0.1748976 -0.1175778 -0.7385827 -0.9447016 -0.1469437 -0.7156761 1447918_x_at-0.4284713 -0.814748 0.3304526 0.0709109 0.5322189 0.8877894 0.4134523 -0.3387737 1447936_at 0.8279438 0.8015907 0.724575 -0.3660903 -0.265963 -0.4374058 -0.1443173 -0.097237 1448025_at -0.348923 -0.054106 0.2187004 0.2154615 -0.0428293 0.6484393 -0.1446012 -0.4569909 1452794_x_at0.0440996 3.960271 -0.2046639 0.2335372 0.8179984 0.3548994 1.9195304 -0.4147814 1452802_at 0.1297743 3.147667 -0.2612306 0.8794811 0.7063197 0.5792801 1.5126028 -0.5443832 1452804_at 0.2962529 2.7061846 -0.350094 0.4365051 0.7466133 0.3869875 1.1062232 -0.450992 1452805_at 0.201243 1.2077516 -0.1741825 0.0387962 0.0749197 -0.0692121 0.3587183 -0.2519468 1452815_at -0.6049924 -0.92782 -0.2940242 0.3596091 0.4519687 0.3974879 0.0482882 0.5043812 1452842_at 0.3070685 3.421793 -0.314906 0.6438289 0.4664972 0.3815287 1.4249215 -0.9530981 1452855_at -0.2115154 1.8391021 0.0103234 0.0342481 0.4956949 0.1050654 1.1341146 -0.2644841 1452861_at 0.528259 0.9719541 0.0710527 0.0629997 -0.773651 -0.8838526 -0.2393524 -0.8628653 1452863_at 0.1200236 2.3872585 -0.247048 0.4024735 0.4726896 0.4497379 1.0255901 -0.3782958 1452865_at -0.127429 2.3062668 -0.0816383 0.2541015 0.4872139 0.515257 0.7736304 -0.4163618 Diabetes Page 132 of 205

1452879_at -1.9788784 -1.667163 -0.7248957 1.2861395 0.7138796 1.0057516 0.4962235 0.7149334 1452892_at 0.1870289 2.9468288 0.0195804 0.0211514 0.549973 0.2023368 1.4238304 -0.5942171 1452904_at -0.054127 2.7916937 -0.2130585 0.3535152 -0.232307 0.0331841 0.5375072 -1.354777 1452912_at 0.1716954 0.8349887 -0.3160117 -0.0680137 0.2170485 0.1333557 0.4194092 -0.111747 1452914_at 0.8139714 0.044276 0.3481491 -0.2193852 -0.0418276 -0.0976546 0.1633012 0.3506735 1452934_at 0.6403233 1.9411947 0.1439024 0.9101718 -0.9074653 -0.818256 -0.7068895 -1.1496663 1452936_at -0.8350103 -0.898089 -0.512834 1.8649504 0.8132064 1.4098055 1.9169325 2.0855203 1452967_at 0.2600564 2.5378833 -0.3295162 0.2739255 0.4627961 0.3510317 1.1210442 -0.3590647 1453012_at -0.4155215 -0.745778 -0.2474234 1.3136425 0.754575 1.3186076 0.2272725 0.5045152 1453046_at 0.0150201 2.5568824 -0.135301 0.1296616 0.3467548 0.2627955 1.439044 -0.0856773 1453049_at -0.7077415 0.8504789 -0.9113051 0.1850121 0.1375446 0.1235905 0.7636247 0.0578725 1453054_at -0.2305548 1.1950215 -0.2691162 0.231844 0.4093197 0.2819589 0.4956222 -0.0946085 1453085_at -0.496209 0.9484594 1.0020664 1.1007228 -4.053991 -4.6596513 -2.9224434 -5.425119 1453121_at 0.2448913 1.4742312 -0.2495263 -0.0261836 0.4413598 -0.1006004 0.9040583 -0.4201662 1453133_at -0.0575591 2.472841 -0.0389962 -0.0477886 0.6435145 0.1540897 1.4710544 -0.1325139 1453137_at -0.301833 1.109235 -0.1298658 -0.0113704 0.2409573 0.1706741 0.4621924 -0.4123494 1453142_at 0.1339865 2.4912958 -0.0907861 0.4287405 0.3306109 0.4889197 1.1565953 -0.2135563 1453143_at 0.5733722 2.8519611 1.1732873 1.5190711 -2.5477252 -2.22255 -1.1964449 -3.4307988 1453152_at -0.2893558 -0.894506 -0.3494289 0.7283468 0.3274363 0.8364183 0.2678793 0.3372839 1453154_at -0.0711588 1.7634315 -0.1351823 0.0322542 0.4549578 0.0872832 1.2060853 -0.107549 1453157_at 0.0994041 1.8204238 -0.124164 0.1745315 0.3801282 0.4268704 0.8107665 -0.1660921 1453159_at -0.3347286 1.7508215 -0.7947516 -0.0107393 0.3286011 0.1665897 1.0542408 -0.2546834 1453167_at 0.0851142 2.1388934 -0.2271066 0.4212489 0.4510383 0.2925733 1.1121057 -0.2958636 1453168_at -0.0111127 0.7320784 -0.3841215 -0.151624 -0.0777786 -0.1691477 0.3586607 0.0053072 1453176_a_at0.2724214 2.1163187 -0.2145996 0.0723865 0.3921184 0.1995575 0.9253842 -0.266083 1453178_at -0.0022871 1.9216508 -0.0497701 0.0855755 0.4217582 0.2721224 1.2096261 -0.0980713 1453180_at 0.1564384 2.084375 -0.1803348 0.0089111 0.2371078 0.0485827 0.9720122 -0.1401801 1453203_at 0.1061701 3.1851835 0.0105268 0.3948371 0.8425662 0.537447 1.4518145 -0.5605333 1453205_at 0.0518824 1.0098727 -0.0259228 0.0436021 0.1484621 0.1158824 1.0285358 -0.2125331 1453211_at -0.2476028 1.744274 -0.3325469 0 0.282602 0.0020399 1.2043182 0.032457 1453213_at 0.1758257 1.6460332 -0.2300092 -0.1451056 0.5120711 0.1836339 0.9086046 -0.2356203 1453215_at 2.0681286 1.8151829 1.2964976 -0.0834138 -0.0220844 0.0237341 1.4138006 2.3945372 1453217_at 0.0940598 3.2380958 -0.1782642 0.7994969 1.2297169 0.7078372 1.7127471 -0.467137 1453220_at -0.0488727 1.4371638 0.0569447 0.2615035 0.0199327 -0.007508 -0.0125006 -0.0644312 1453232_at 0.0741468 1.2289559 -0.2467457 -0.1579466 -0.1081756 -0.0171016 0.5375206 -0.183214 1453233_s_at0.0787082 1.3776977 -0.2768587 -0.2211726 -0.0332228 -0.1195007 0.3961959 -0.3616382 1453235_at -0.1657931 0.926048 -0.1953344 0.2439935 0.2325261 0.2722533 0.6131719 -0.2847886 1453240_a_at-0.7901049 -0.624231 -0.3207166 0.3549633 0.3394876 0.5080692 0.1545534 0.075064 1453250_at -0.0062479 2.2948527 -0.2188783 0.3575631 0.5074154 0.4494661 1.1909642 -0.3077597 1453254_at 0.0665505 1.8461528 -0.1058523 0.2419958 0.3328316 0.2222136 0.9591844 -0.1717911 1453255_at 1.1815369 0.6946433 -3.82E-04 -0.3856752 -0.3607617 -0.3833655 0.117197 0.1440236 1453262_at -0.6604674 -0.825368 -0.7765385 0.7867546 0.3972154 0.8949944 0.6418034 0.6802344 1453264_at 0.8314887 1.2473607 0.5597322 0.0397918 -0.4397824 -0.5982046 -0.3014078 -0.5518227 1453274_at 0.1001788 0.869235 -0.2291049 -0.0061903 0.1936063 -0.027105 0.1612223 -0.172173 1453293_a_at0.1197474 1.8075279 -0.2640078 0.1137004 -0.0150117 -0.0639237 0.8102401 -0.7520433 1453310_at 0.7682062 0.7421701 0.014591 -0.5479934 -0.2584589 -0.6293974 0.1739871 -0.5440373 1453316_at -0.4562661 0.8273294 -0.5266131 0.4227362 0.2914353 0.007762 0.3286074 -0.3726234 1453320_at 0.6122116 1.6448525 -0.2435291 -0.3810842 0.1033766 -0.2385153 0.5135124 -0.5923073 1453332_at 0.7480973 0.2427994 0.5279883 -0.3508635 -0.2343237 -0.3689316 -0.1698661 -0.240692 1453335_a_at-0.0782015 2.1630578 -0.4676775 0.2771695 0.1654589 0.2576339 1.0699358 -0.6049631 1453341_a_at0.0302578 0.8188249 -0.2248772 0.0378892 0.0242343 0.1604038 0.4569844 -0.3215067 1453344_at 0.608438 0.7274631 0.6019356 -0.5200958 -0.2346686 -0.6907594 -0.3201523 -0.2306916 1453346_at -0.1208509 2.3439648 -0.1673052 0.3633046 0.5996915 0.4129267 1.2183903 -0.2015306 1453347_at -0.1650838 1.8276844 -0.0667132 0.2050679 0.6395564 0.3205166 1.2478642 -0.1437229 1453352_at 0.8749722 1.6742172 0.8939903 0.2840869 -0.6377737 -0.5100954 -0.8385472 -0.137276 1453353_at 0.076526 1.5687282 -0.1222444 -0.1720724 0.2705345 0.1218932 1.067908 -0.2115619 1453377_at -0.6936688 -0.848121 -0.3676423 0.2828679 0.2807906 0.4470977 0.6760256 0.4563166 1453407_at 0.0684514 1.9696529 -0.2082284 0.2847672 0.5349313 0.3999476 0.8951189 -0.1831087 1453425_at 0.1918125 1.3811332 -0.0873256 -0.0219772 0.2174303 0.1040113 0.9116926 -0.1249935 1453429_at -0.2434491 1.8359838 0.0686995 -0.2566738 0.4489842 0.1954379 0.5337162 -0.4467049 Page 133 of 205 Diabetes

1453432_at 0.4441481 1.6658602 -0.0107977 -0.0093 0.1837147 -9.88E-04 0.8886839 -0.5303355 1453434_at -0.3482627 -0.670035 -0.2629614 0.3406997 0.4803871 0.5649823 0.1493902 0.3229108 1453440_at -0.057711 1.5117196 -0.1837697 0.1431186 0.26972 0.244647 0.7787283 -0.3578741 1453447_at -0.0131185 1.1746657 -0.2275391 -0.0690126 0.0959582 0.1467565 0.3900468 -0.2526347 1453449_at -0.031415 1.5368395 -0.088304 0.1082981 0.3037759 0.1516661 1.2622031 -0.2586525 1453463_at -0.035638 0.9865682 0.0188675 0.0220809 0.0885318 0.2005355 0.7050158 -0.2859348 1453479_at -0.0744425 0.8840331 -0.1961244 -0.0185711 -0.0625856 -0.0442423 0.2890692 -0.1517461 1453481_at -0.4168475 -0.772315 -0.4619367 0.8394766 0.6760535 0.657279 0.6582796 0.8520468 1453483_at 0.0051067 1.3746032 -0.076978 0.0624161 0.2159571 0.1739651 0.7641732 -0.2178981 1453484_at -0.0431231 3.4396076 -0.16657 0.428963 0.7452129 0.5842701 1.5336064 -0.374562 1453487_at -0.3755142 -0.663199 0.0015848 0.043983 0.4109108 0.367523 0.0560281 0.2942451 1453503_at 2.8372226 4.631046 0.4193773 2.2318845 -0.5565156 -0.4854897 0.1285179 0.1470072 1453510_s_at-0.0216674 0.6392666 -0.4409148 -0.1261804 -0.0021166 0.0757633 0.4385794 -0.0692032 1453536_at -0.0653253 1.045575 -0.1087827 -0.067519 0.0117874 0.0230538 0.5465897 -0.1776953 1453546_at 0.096951 1.5190719 -0.3053626 0.2027698 0.29889 0.1924446 0.7557845 -0.313715 1453558_at 0.8541745 1.9114192 -0.3291051 -0.2677333 0.1214543 -0.2329352 0.4279611 -0.7616887 1453568_at 0.6931338 1.3878565 0.8312707 0.575191 -0.7854995 -0.4696115 -0.7401545 0.2345656 1453582_at 0.0802199 1.2803234 0.239327 -0.1719804 -0.4626243 -0.371306 -0.4263732 -0.4255309 1453588_at 0.0260628 -0.185304 0.347369 -1.2361169 -0.2068428 -0.2575897 0.3197947 0.6506742 1453592_at -1.3485829 -2.113287 -1.0075552 1.0707946 0.6998375 1.2186458 0.5559718 1.1268183 1453593_at -1.7976943 -1.421148 -0.8550115 0.86764 0.6032368 1.0473235 0.5747512 0.3605464 1453598_at -0.4788375 -0.323859 -0.0686014 0.4957304 0.2760825 0.9666578 -0.0520719 0.406593 1453605_s_at-0.1331731 0.7602258 -0.3396932 0.0458064 0.22772 0.0677781 0.2273013 -0.3902341 1453607_at -0.1197776 1.917414 -0.6201853 0.2369127 -0.1769841 -0.2504631 0.3882678 -0.7211692 1453622_s_at-0.6092676 -0.827994 -0.638992 0.6986909 0.4672514 0.5484071 0.8142991 0.9227721 1453670_at 0.0030968 0.6519625 -0.3482287 -0.1690226 0.0107322 0.2337508 0.4351047 -0.3517057 1453707_at -0.600917 -0.664578 -0.0956526 0.7255631 0.4082528 0.5078925 1.2429208 0.9856989 1453708_a_at-0.2956923 1.9180602 -0.6496068 0.1582148 0.4552351 0.379677 1.1047169 -0.0779688 1453766_a_at0.0286452 1.3678782 -0.0956414 0.0784957 0.0207523 0.0287599 1.0896133 -0.1913962 1453793_at -0.1096293 1.1014148 -0.1497371 -0.0445013 0.2144459 0.010151 0.6871808 -0.2584554 1453838_at -0.1846219 0.876156 -0.022136 0.1340885 0.1455633 0.0871977 0.3493415 -0.4150237 1453879_at 0.0717552 3.2261405 -0.3135639 0.8145905 0.4880902 0.4811491 1.1313835 -0.8696487 1453880_s_at-0.0123482 2.7262976 -0.2083409 0.129329 0.6864044 0.1827803 1.3099011 -0.1023498 1453935_a_at-0.0681588 1.129096 -0.2129662 -0.0187761 0.248505 0.0986897 0.888728 -0.2314769 1453955_a_at-0.0586145 1.1758703 -0.0886856 0.081169 0.2875274 0.2174132 0.8368122 -0.0831517 1454000_s_at0.1869886 1.7968292 -0.285738 0.1158733 0.3800176 -0.0462328 0.9323227 -0.1730607 1454010_a_at0.0618992 2.0381274 -0.1660259 0.305979 0.5629114 0.2995334 1.1234745 -0.1354462 1454033_at -0.1373882 1.1980039 -0.1844336 0.3484883 0.48199 0.2861726 0.6846225 -0.1133536 1454089_at -0.0491809 1.3785208 -0.1777183 -0.1006144 0.3370263 0.1931825 0.7754505 -0.3027396 1454124_at -0.0545119 0.9335774 -0.1110138 -0.0940657 0.1955167 -0.0609565 0.6518108 -0.3601576 1454158_at -0.6741656 -0.361537 -0.2528455 0.3466234 0.1860088 0.0970417 0.1971461 0.4073512 1454192_at -0.0322372 0.9448615 -0.194903 -0.0696856 0.2390325 0.0937235 0.632453 -0.0721827 1454202_a_at0.1261587 2.670344 -0.1580116 0.4385046 0.6977564 0.5697513 1.3163183 -0.2276688 1454203_at -0.1004546 2.9682655 -0.2619657 0.3626988 0.7305864 0.4452193 1.0876375 -0.4667014 1454254_s_at1.1180841 0.5514103 0.9209126 -0.1776552 -0.0302759 -0.4000916 -0.3267604 -0.556358 1454266_at -0.0305491 0.9607233 -0.0443234 0.2275798 0.2018175 0.2699703 0.6082836 -0.1863877 1454295_at -0.4391395 0.5660895 0.3951104 -0.2740529 -0.0721131 -0.017852 -0.5995784 0.1104457 1454617_at -0.6528778 -0.154169 0.0934155 0.3885307 0.5400534 0.2989498 -0.2248414 -0.240113 1454625_at 0.6384114 1.090834 -0.0381356 -0.1141179 -0.2232032 -0.1477372 0.0599073 0.2435913 1454649_at 0.726233 0.740236 0.8063592 0.2078314 -0.3910956 -0.1655789 -0.209877 0.1058086 1454702_at -0.3532299 1.2637397 -0.2865266 0.0034182 0.3902198 0.4196854 0.6265636 -0.1174343 1454709_at 0.938 1.3813188 0.3366752 0.4488769 -0.4056827 -0.3770687 -0.5743898 -0.2232936 1454710_at -0.2525734 2.9950955 -1.1111515 0.9007542 -0.1591795 -0.5619344 0.9965264 -1.0947901 1454717_at -0.1327953 -0.477126 -0.2510912 0.7882023 0.2633103 0.4121575 0.6882451 0.7660923 1454752_at 1.2142662 1.4428375 0.7803309 0.5876491 -0.4049531 -0.4900533 -0.0890303 -0.4842435 1454762_at 0.4479863 1.6759235 0.4596868 0.1539633 -0.1371898 -0.1416903 -0.263103 -0.1999078 1454788_at 0.8458388 1.3993114 0.1690295 0.4340572 -0.3475513 -0.2568347 -0.0189859 -0.1612441 1454800_at -0.3043536 0.7589865 -0.6680762 0.0854578 0.2429276 0.0804687 0.7953679 -0.1053848 1454806_at -0.4816461 -0.722036 -0.0695269 0.8019414 0.5835851 0.9420328 -0.0907555 0.163703 1454819_at 0.1180469 0.9480643 0.2085874 0.150203 -0.2650398 -0.1055433 -0.1748692 -0.1970213 Diabetes Page 134 of 205

1454847_at -0.6485708 -0.915486 -0.2127599 0.3071141 0.2624182 0.2995291 0.302165 0.6705878 1454866_s_at0.8832408 0.3192836 -0.1844821 -0.7343869 -0.3176765 -0.8509536 0.2302501 -0.1752408 1454900_s_at-1.0768256 -0.38427 -0.3793838 0.2932038 -0.0330746 0.3577456 0.2225517 0.2523375 1454918_at -0.0374372 -0.12147 1.3269603 -0.1425815 0.0416542 0.0733662 -0.1186895 0.0199318 1454919_at 0.8060138 0.4609397 0.4906418 -0.3689718 -0.1545487 -0.192038 -0.0869109 -0.0736996 1454926_at 0.0742351 2.1618586 0.1209793 0.1276002 0.3075098 0.0539357 1.0726126 -0.3087708 1454966_at 0.7011976 0.4764222 0.0912141 -0.3132868 -0.2918788 -0.7022284 -0.0170201 -0.2868439 1454991_at 0.2708328 0.9161966 -0.0075514 -0.0797434 -0.0918848 -0.2652468 -0.179554 -0.2500016 1454995_at 0.6306322 1.0001502 0.1288226 0.2284122 -0.4314531 -0.2279332 -0.5269087 -0.6894361 1455025_at -1.0520129 -1.329151 -1.3552818 0.733552 0.4256395 0.9301693 0.2705294 0.6265767 1455074_at 0.8166152 0.046495 0.3236014 -0.3730886 -0.0478841 -0.1757809 -0.1617452 -0.2625166 1455085_at 0.2268584 2.3293233 -0.8260435 -0.5227792 -0.2398114 -0.5468878 0.6003761 -1.0304352 1455114_at 0.516361 1.2760181 -0.0960418 0.5131719 -0.1831568 -0.2759045 -0.1198635 0.2595531 1455120_at 0.9255214 1.9384472 0.7309425 0.9533925 -0.4539675 -0.1814201 -0.2789513 -0.1050425 1455146_at 0.3845029 0.9921296 0.2084508 -0.288924 -0.4128031 -0.3466302 0.028366 -0.4585099 1455160_at -0.0930221 0.2138073 0.143945 -0.9181314 -0.4716859 -0.2214485 0.0931492 0.1211411 1455162_at 0.3608978 0.9363959 -0.0489274 -0.3507762 -0.3878874 -0.4905399 -0.0228618 -0.5917619 1455185_s_at-0.506662 0.0318168 -0.5629019 0.7107501 0.250666 0.4030264 -0.0379003 -0.1642313 1455218_at 0.3558585 1.220765 0.3856714 -0.4530332 -0.0814598 -0.2628554 0.297801 -0.274237 1455225_at 0.9832437 1.1030521 0.2825558 0.0112679 0.0359514 -0.0304688 0.126217 1.1928982 1455238_at 0.390969 2.0610824 0.713817 0.7650321 -2.0467327 -2.1382346 -0.7892532 -2.051315 1455251_at -0.7835331 -0.779661 -0.333091 0.6075969 0.6163387 0.8335869 0.0543448 0.3383122 1455256_at 0.360618 1.0003157 -0.1310074 0.1693945 -0.4208632 -0.4009147 0.0064678 -0.4981159 1455266_at 0.4571149 0.9076963 0.999869 -0.3976488 0.3557398 -0.3579997 1.2239218 -0.3648777 1455274_at -0.2155457 0.5107276 -0.0683582 -0.0523992 0.4947675 -7.92E-04 0.823144 -0.1305696 1455296_at -0.3567348 -0.924587 -0.2619841 0.615293 0.2480238 0.1752703 0.3032475 0.2874791 1455297_at 0.9382352 1.5509615 -0.0149951 -0.0516975 -0.1578418 -0.3353137 -0.0350928 0.346182 1455299_at -1.8688012 -1.458796 -0.7468827 1.1819224 0.8609585 1.1566808 0.6223138 0.5230732 1455301_at 0.2532243 0.9205004 0.0989825 -0.3917747 -0.228874 -0.468558 0.2502273 -0.1737725 1455400_at 0.3136444 0.2267879 -0.2709018 0.3084045 -0.2320125 0.2497051 -0.7143286 -0.4365903 1455418_at 0.5127022 0.5605643 0.5060959 -0.5453813 -0.1138596 -0.1537662 0.042978 0.1229359 1455419_at 0.9473939 1.1399904 0.3994827 -0.1476567 -0.4892755 -0.5085017 -0.309062 -0.0973112 1455425_at 0.8434565 0.3943589 0.3051733 -0.3546795 -0.3677881 -0.2903667 0.2604256 -0.1628852 1455426_at 0.555879 -0.124094 0.4063427 -0.0323012 -0.1730524 -0.6005405 0.7974539 0.0125567 1455428_at -0.4455177 -0.801064 -0.2970761 0.4552705 0.1732367 0.4467946 0.9929943 1.0264658 1455436_at -0.477464 -0.555273 -0.660622 1.102593 0.6509692 1.0028532 0.4298793 0.8165457 1455450_at 0.1195347 0.6609583 0.0108985 0.1663876 -0.3437766 -0.10196 -0.1540844 -0.1940357 1455451_at 0.8334712 1.1195462 0.1170667 -0.5051071 -0.3228605 -0.3425728 0.2838961 -0.3765653 1455452_x_at0.8141718 1.3477489 0.1081353 -0.6604297 -0.389571 -0.5213736 0.0329272 -0.5703597 1455454_at 2.500083 3.6297765 2.5579834 1.8658931 -0.9843319 -0.5923803 -0.9016426 -0.9319919 1455498_at -0.434249 0.036624 -0.1860731 1.8252914 0.496856 2.3562458 -0.4067708 -0.1476979 1455506_at 1.1701599 0.7012175 0.5565243 -0.2778814 -0.0909689 -0.1131175 -0.2571508 -0.1827451 1455508_at 0.40799 0.8968656 0.0890329 0.3419876 -0.2898441 -0.2291811 -0.0866254 0.0255343 1455541_a_at-0.758551 0.422008 -0.6407478 -0.0875468 0.0252023 0.1504282 0.6357431 0.2117087 1455557_at 0.6068505 0.9273807 0.3396438 0.5788055 -0.2280278 -0.1925433 -0.2090997 -0.176258 1455561_at 0.8903394 0.7468164 -0.0317166 -0.243798 -0.0978374 0.0372759 -0.3652678 0.2527518 1455577_at 1.0808754 0.5064178 0.5748596 -0.8547845 -0.0331854 -0.2930599 -0.2541738 -0.5701668 1455607_at 1.1647424 0.3438145 0.5897923 -0.2907693 -0.3046864 -0.5010953 0.1502539 -0.0767573 1455608_at 0.0684825 0.8485682 -0.1544013 -0.1530521 -0.1055785 -0.2926678 0.2777162 -0.1593674 1455622_at -0.1337225 -0.283921 -0.3628633 1.0268867 0.4634452 0.4842474 0.843863 0.8655985 1455629_at 1.1250284 0.3923833 0.7946396 -0.5783711 -0.055597 -0.7765653 0.0787875 0.0167054 1455663_at 0.0607274 -0.784211 -0.4878418 0.2176273 0.0803578 0.4284433 0.8279703 0.7364583 1455679_at -0.5601654 -1.679478 0.1941048 -0.0676856 0.3905025 0.1892663 0.3599866 0.5426281 1455697_at -0.4119657 -0.438082 -0.2357261 0.7101917 0.3787277 0.8358723 0.4041095 0.3586429 1455718_at 0.056432 3.4563925 -0.1059279 0.6527374 0.851382 0.6962801 1.4243917 -0.4370457 1455721_at 0.7035953 1.8160543 0.2573208 0.0864503 -0.9278954 -0.846859 -0.5436711 -0.6895331 1455724_at 0.358449 0.9492559 -0.0274465 0.3096581 -0.2110083 -0.0844261 -0.0761315 0.1179889 1455735_at 0.371963 0.0837832 0.0830215 0.72258 -0.4184836 -0.3469645 -0.3217425 -0.4830512 1455773_at -0.7314725 0.7447561 0.7352719 -0.5783389 -0.1478812 0.0589194 -0.5387735 -0.2661621 1455793_at -0.4749744 -0.774526 -0.2947134 0.508563 0.3612022 0.5214863 0.3766146 0.4433231 Page 135 of 205 Diabetes

1455795_at -0.4363613 -0.853273 -0.1838183 0.6869721 0.2649357 0.6195309 0.3391104 0.3634666 1455837_at 0.0172287 3.2213607 -0.1650844 0.4535255 0.5575789 0.4615678 1.1909609 -0.4121315 1455843_at 0.6221072 1.0454627 0.0865181 0.0092652 -0.4415164 -0.0207663 0.0941129 0.084966 1455849_at -0.2964819 -0.469082 -0.1346297 0.6080132 0.6077946 0.3541988 0.1268164 0.151974 1455859_at 0.2574484 2.452188 -0.012615 -0.2390301 0.5217788 0.043707 1.2172527 -0.6436793 1455870_at -0.7579072 -0.5698 -0.2170184 0.6761093 0.413748 0.5798042 0.2195931 0.2473272 1455882_x_at-0.3598197 -0.449499 -0.399891 0.3795629 0.2051427 0.1207894 0.8915744 0.8001153 1455891_at -0.0383405 2.5501153 -0.1393696 0.0719478 0.6561694 0.3228117 1.3109243 -0.241267 1455902_x_at-0.1365956 -1.295724 -0.3656858 0.0950439 0.0441273 0.2604752 0.2489921 0.6130727 1455909_at 2.0132337 3.007708 0.9337697 1.4006726 -0.3347073 -0.0258252 -0.3663046 -0.2416112 1455921_at 0.1158269 3.5739245 -0.0220556 3.43E-04 0.8694221 0.5195471 1.6427828 -0.3357563 1455925_at -0.3803672 -0.522092 -0.3902222 0.4754407 0.1436187 0.5051764 0.5238368 0.6995342 1455947_at 0.1090018 3.3217244 -0.1997404 0.2785759 0.8253605 0.4781657 1.5681996 -0.3447255 1455967_at -1.0534337 -0.240628 0.4519174 -0.4912219 0.1175482 0.473436 0.0691697 0.413669 1455983_at -0.0273895 1.0864639 -0.025745 0.0955844 0.0113147 0.0026322 0.323284 -0.4557395 1455993_at -1.388444 -1.829669 -0.6924107 0.3873386 0.2547552 0.6059998 0.354805 0.7475061 1455995_at 0.5471754 1.6279006 0.4336929 0.4466043 -0.4189188 -0.2538372 0.0051067 0.2996565 1456022_at -0.6446114 -1.348256 -0.7080987 0.8300371 0.3724669 0.6419943 0.404973 0.7176183 1456035_at -0.9296539 2.5308814 -1.1794605 0.9800627 -0.5193145 -0.3771968 0.7055205 -0.2711207 1456051_at 1.090434 0.5078502 0.8696047 -0.4456632 -0.032333 -0.7168373 0.1406609 -0.0361384 1456052_at -0.2155143 1.4402175 -0.3485546 0.114939 0.2233774 0.1897843 1.1056128 -0.1487826 1456073_s_at0.0943485 -0.030096 1.3649782 -0.0225675 -0.0563036 -0.0284357 -0.0687688 0.0273245 1456076_at -0.0980179 3.9160495 -0.178423 -0.0236342 0.915181 -0.0592003 1.6445249 -0.4055556 1456114_at -0.1695226 0.8484241 -0.3448751 -0.035048 -0.3874975 -0.1774234 0.0652016 -0.3741288 1456147_at 0.3816053 1.0926789 0.2971846 -0.3294735 -0.048933 0.0244877 -0.1447523 0.5514131 1456156_at 1.0621355 0.445135 0.3324026 -0.3850794 -0.2402619 -0.1821483 0.1741433 0.1703633 1456159_at -0.721481 0.3756094 0.3982945 -0.1816063 -0.0410218 0.1578358 -0.3749922 0.1181148 1456165_at -0.1010584 0.6807762 0.2913077 -0.2147194 0.04536 0.0110593 1.1873891 0.0688822 1456192_x_at0.1382463 1.9396126 -0.1204807 0.1498339 0.1640759 0.2622714 0.5832016 -0.5081959 1456208_at -0.3801003 0.6592112 0.0041624 -0.1099474 0.2323918 0.0384906 0.7322249 -0.1933182 1456224_x_at0.0472671 2.7123187 -0.1607452 0.093504 0.3867383 0.2392563 1.3778524 -0.4780245 1456229_at 0.7751032 0.9140261 0.2286179 -0.5824432 -0.4998182 -0.5338947 -0.2279746 -0.3134691 1456230_at -0.2768139 0.8749834 -0.2726872 0.1499498 0.0493759 0.2514605 0.587728 -0.225699 1456258_at 1.0246114 1.6163085 0.4524275 0.3753068 -0.8795705 -1.3287961 -0.0383116 -1.2231127 1456297_at 0.4329431 0.7911459 0.5186525 0.8845792 -0.2461157 -0.1404404 -0.3123814 -0.3277257 1456328_at -0.8615044 -0.951524 -0.0685961 0.3726704 0.3603188 0.6013112 0.3126663 0.1640078 1456366_at 0.0129271 2.9578073 -0.062077 0.4717377 0.7869555 0.5682485 1.6410083 -0.1329502 1456368_at 0.0575424 3.0142183 -0.1463883 0.4686296 0.8788503 0.7270365 1.2072734 -0.1936367 1456392_at 0.059085 -0.809999 -0.1343632 0.0488791 0.2937435 -0.1137425 0.1925532 0.4770842 1456404_at -1.2163396 -0.811097 -0.3889387 0.5621595 0.4043549 0.7712673 0.3947023 0.1794736 1456409_at -0.6031227 -0.788622 -0.0628243 0.8864026 0.2687025 0.5426533 0.8759155 1.2112045 1456440_s_at0.7702997 1.0363474 0.3073622 -0.2918491 -0.0089089 -0.0432534 -0.1502331 0.5632193 1456445_at 0.0791804 1.6187671 -0.2246246 -0.0126839 0.1690644 0.200325 0.5229109 -0.7331602 1456446_at -0.7714223 0.0367947 0.3179581 -0.1546695 0.1474389 0.3991621 -0.4898039 -0.1283199 1456475_s_at-0.8899066 -1.463737 -0.4475062 0.3645225 0.2966231 0.3795288 0.1302764 0.2551037 1456480_at -0.618289 -0.837393 -0.281615 0.6321883 0.4444536 0.60089 0.6271146 0.8319613 1456498_at -0.592526 -0.56584 0.0710233 0.5958362 0.3852244 0.5498766 0.0235691 0.407811 1456539_at 0.0350428 -0.28847 1.192883 0.0118051 0.0670138 0.2385499 -0.1262115 -0.0021051 1456549_at -0.0191253 0.9335581 -0.1152406 0.2842921 0.1422888 0.0294796 0.4226782 -0.1808813 1456555_at -0.1477556 2.0355613 -0.1156671 -0.0447879 0.4636781 0.2031763 0.685846 -0.6356297 1456557_at 0.1678032 2.88581 -0.07025 -0.0062387 0.4534868 0.3066178 0.8964067 -0.3078876 1456563_at -0.9824629 -0.892019 -0.1912592 0.7314892 0.340649 0.103261 0.2975887 0.3887221 1456589_x_at 0.132609 1.9850947 -0.0780317 0.3711419 0.4499947 0.3908666 0.9701851 -0.2445706 1456591_x_at0.1923084 5.135009 -0.4437559 0.9170952 0.7040246 0.9183711 1.7379789 -1.2620734 1456611_at 0.3357656 0.1356568 0.4124889 -0.5349026 0.0527199 -0.7898939 -0.0777833 0.1781476 1456621_at 0.2432795 0.0296602 0.41219 -0.6482184 0.1206651 -1.1803045 -0.3383884 -0.1026246 1456631_at 0.8289428 0.9719889 -0.1261371 -0.1876764 -0.1602646 -0.4171068 0.3629688 0.2909505 1456633_at 0.9900763 1.8519228 0.3517653 0.5305731 -0.3807899 -0.3993396 -0.4855708 -0.175355 1456653_a_at0.3928949 1.2384 0.5064271 0.7175214 -0.3712955 -0.2408094 -0.2250587 -0.3449777 1456659_at -0.4953584 0.6139208 0.3045695 -0.5518255 -0.226018 0.0756009 -0.5302823 -0.0764821 Diabetes Page 136 of 205

1456690_at -0.0701104 2.093486 -0.2017278 0.3863039 0.4152162 0.410912 1.2095839 -0.2231393 1456715_at -1.0624752 0.1802157 0.0192657 -0.275167 0.0310505 0.310335 0.2178712 0.1595081 1456718_at 0.4020288 0.0505514 1.1540899 -0.192101 -0.0674461 -0.0775859 -0.0980784 0.0178395 1456722_at -0.2974324 -0.581181 -0.0820179 0.1518631 0.1927176 0.202663 0.857825 0.6970059 1456735_x_at 0.583298 1.240658 0.2918469 0.7645633 -0.6482306 -0.4479938 0.2573389 -0.2478285 1456779_a_at 0.43624 -0.003873 -0.1036015 -0.0070205 -0.1944548 -0.4053136 0.8250429 0.6241775 1456802_at 0.0284327 3.0175822 -0.1292085 0.5233311 0.5959409 0.6173064 1.3030968 -0.3855988 1456804_at 3.4336052 5.9236116 -0.012305 3.4161406 -0.2750172 -0.4453749 0.4410676 0.207485 1456812_at -0.2908909 -1.51853 -0.2885473 0.256835 0.3775049 0.5144991 0.0321058 0.2982661 1456823_at 0.4215897 1.488555 -0.4488367 -0.5614636 -0.7008733 -0.7712018 0.1143174 -1.615335 1456837_at 0.8809193 0.6596905 0.3326778 -0.272661 0.0492055 -0.1276249 -0.2092676 -0.1505264 1456842_at 0.0382977 1.2594106 -0.0281192 -0.0128453 0.2436773 0.0337271 0.8807779 -0.1793589 1456844_at 0.9461826 0.2995384 0.1693445 -0.6330668 -0.3798516 -0.3297535 -0.3343846 -0.0088879 1456857_at 0.5801127 1.5646882 0.2465267 0.7231927 -0.7416416 -0.3971654 -0.1212503 -0.3240905 1456884_at 0.6261002 0.0541207 0.1205099 -0.6529524 -0.2471204 -0.5225347 0.0916747 0.0442905 1456887_at -1.1657243 -0.85073 -0.1458337 0.6800566 0.6133583 0.259967 0.6224575 0.8636211 1456907_at -0.9029138 -1.029957 0.0643358 0.0184274 0.4039967 0.2758589 0.5506713 0.5148581 1456908_at 0.2714218 1.0342848 0.6091033 0.4110999 -0.491922 -0.1988831 -0.2006796 -0.2664639 1456923_at 0.5482988 1.8545874 0.1242171 -0.0489832 -0.1777749 -0.2546538 -0.169064 0.0486407 1456936_at 1.1875485 0.2508652 0.2982554 -0.3046824 -0.1359581 -0.2521079 0.2452099 0.1732335 1456942_x_at-0.175275 1.1508139 -0.2333643 -0.069571 0.2773614 0.0116345 0.7108333 -0.0870895 1456960_at -0.3168171 0.8494402 0.3024863 -0.3773751 -0.2151307 -0.227477 -0.2157923 0.2182061 1456978_s_at0.2116951 1.4093283 -0.102798 -0.3427608 0.174353 0.0633777 0.6815555 -0.248491 1456986_at -0.7162139 0.0546143 0.5546655 0.3156188 0.323261 0.152843 -0.5334242 0.1194277 1457011_at -0.7744675 -0.351243 0.0778176 -0.3674643 0.3324201 0.1980246 0.4014117 0.668339 1457021_x_at-1.777506 0.2893693 -1.340885 0.3365612 0.365956 0.363542 0.7262745 0.0779325 1457025_at 0.0379239 -0.056172 1.110986 -7.21E-04 -0.0564115 0.0038409 -0.1398382 -0.0155687 1457031_at -0.8387078 -1.18191 -0.4855099 0.2241077 0.3379322 0.4841538 0.4110012 0.7318201 1457057_at 0.1425614 2.3741553 -0.14408 0.2966461 0.3158454 0.3982543 0.9998989 -0.5601108 1457077_at 0.5664032 1.4270551 0.2546455 0.3205231 -0.1903451 -0.2048084 -0.0514481 0.4645484 1457091_at 0.0134952 2.7756166 -0.0570051 0.2407067 0.6767124 0.4808783 1.2965928 -0.3291962 1457102_at 1.5655906 1.1798507 1.4952464 -0.4092445 -0.1824891 -0.2044542 -1.979777 -0.9385133 1457111_at -0.7179395 0.2779679 0.3577592 -0.3581314 -0.1797299 -0.056298 -0.4363181 -0.0667588 1457117_at 0.8313428 0.8760198 0.5775133 -0.9683218 -0.6386312 -0.7845639 -0.3056499 -0.6464682 1457118_at 0.747623 1.0613852 0.2638699 -0.3003349 -0.0686968 -0.176765 0.3850257 0.7963829 1457123_at -0.7207986 -0.933239 -0.0938343 0.3995476 0.8050947 0.0309482 0.4322688 0.8652636 1457127_at 0.2261728 0.8312155 0.6960177 0.5980663 -4.996268 -5.434386 -3.346714 -3.2963812 1457133_at -0.3986663 -0.342242 -0.1184869 0.885531 0.1572417 0.5190569 0.102231 0.1424564 1457156_at 0.2516681 -1.012681 0.0198389 -0.2614279 0.2727678 -0.0367736 0.3196629 0.9769263 1457157_at 0.7199279 0.8429015 0.2981414 0.0735431 -0.1944395 -0.3352217 0.0068103 -0.2751308 1457161_at -0.2610257 1.0166357 0.4295372 -0.332053 -0.1367452 -0.1361055 -0.5299082 -0.3551963 1457218_at 0.222193 0.9945232 0.2912552 -0.308424 -0.3180045 -0.3106695 -0.1885565 -0.4880837 1457227_at 0.6137127 0.0543035 0.267465 -0.7037487 -0.2473979 -0.1870661 0.1466889 0.308139 1457273_at 0.7258332 0.5556797 0.8540242 -0.1924831 -0.3259705 -0.3831951 -0.118927 -0.4066025 1457275_at 0.2423476 0.3043152 0.6294175 -0.2636883 -0.1567287 -0.389286 0.4029218 -0.2684412 1457287_at -0.5399741 -0.68418 -0.2646798 0.4273312 0.3270901 0.7941693 0.2689467 0.3984022 1457297_at -0.2808007 0.7762928 0.0947164 -0.2801335 -0.3282599 -0.0055293 -0.5305907 -0.102359 1457307_at 0.4184538 -0.712246 -0.178806 -0.1266024 0.3728766 0.0548052 0.5062531 -0.080417 1457313_at -0.0499775 1.232876 0.5006185 0.3423338 -0.3766738 -0.0388432 -0.0743198 -0.045836 1457349_at -0.1966659 1.4405886 -0.3417752 -0.1281679 0.2511512 0.0568968 1.037624 -0.3765465 1457359_at -0.5923148 -0.409812 -0.0826026 0.7444258 0.1933171 0.4790391 0.2495143 0.525386 1457374_at -0.0650501 1.0690482 0.1968253 -0.1162832 -0.3135843 0.0178703 -0.4904655 -0.1633638 1457397_at -0.7934374 -0.792918 -0.7867158 1.1949506 0.4904076 0.8847677 1.1003822 1.5360655 1457404_at -0.4345249 0.579471 0.2331229 -0.3315706 0.0980051 -0.0436039 0.0511371 0.0726055 1457415_a_at-0.007076 1.2749956 -0.1654812 -0.0389892 0.1457645 0.0827478 1.1824714 0.2025782 1457418_at -0.1873562 1.7937008 -0.0267154 0.0674017 0.1917612 0.2150129 1.0800666 -0.2780528 1457423_at -0.3388082 -0.439995 -0.5423594 0.5369809 0.5491031 0.2931958 0.7302821 0.2286981 1457435_x_at0.5137781 2.5696607 0.9650885 1.9160247 -0.3335281 -0.1133184 -0.480335 -0.367423 1457438_at 0.975737 1.3165182 0.6271137 0.0609801 -0.1755033 -0.0282125 -0.8615338 -0.5135868 1457446_at -0.0488513 -0.171108 -0.2729011 0.7671332 -0.0969214 0.0258945 0.6162645 0.839052 Page 137 of 205 Diabetes

1457453_at -0.0180378 1.5688299 0.0159732 0.2046323 0.3869987 0.0894009 0.8246539 -0.3025805 1457470_at -0.7178705 0.2394948 0.549576 -0.2469964 0.041412 0.2505202 -0.5344914 -0.1320292 1457479_at -0.2855564 0.7895668 0.3347055 -0.5008409 -0.0778735 -0.0935825 -0.0633828 -0.1668002 1457483_at -0.223244 1.3045986 0.4743872 0.0560718 -0.0704423 0.0482228 -0.2851982 -0.3356034 1457504_at 0.4881742 1.4959661 0.250846 0.5540891 -0.2518822 -0.2895066 -0.2416081 -0.2031479 1457508_at -0.5644586 0.478294 0.5677112 -0.3444424 -0.1150285 0.1156588 -0.3300635 -0.1956706 1457515_at -0.643284 0.5078855 0.3457148 0.0430253 0.042296 0.2861547 -0.6708868 -0.2533557 1457545_at 0.5127764 1.1971776 0.4141123 0.4474542 -0.381283 -0.1283536 -0.1707599 -0.3194555 1457559_at -0.659985 0.3903605 0.3372847 -0.2203927 -0.1339153 -0.1122772 -0.3021803 0.0140276 1457586_at -0.6052526 -0.001719 0.5884961 -0.6737468 -0.2340446 0.0788332 -0.1846302 0.2525857 1457625_s_at-0.6718502 -0.372994 -0.5247603 0.5252132 0.4397532 0.2818323 0.3643899 -0.0678013 1457627_x_at-0.0718478 2.2016926 -0.2235069 0.0574527 0.6217774 0.314078 0.80147 -0.3293563 1457644_s_at-0.4710337 0.5639083 0.1999129 -0.1158516 -0.0137143 0.292368 0.2374816 -0.0641963 1457648_x_at-0.3501208 -0.416723 -0.4836822 0.08956 0.5490152 0.3585812 0.6843977 0.9702786 1457659_x_at-0.0174183 1.3221619 -0.1297435 0.349766 -0.0222063 0.0186671 0.313231 -0.321651 1457693_a_at0.6444519 1.7470657 0.1049973 -0.3393467 0.1216996 0.0265001 0.7938661 -0.6055515 1457697_at 0.0771861 1.0920671 -0.1086445 -0.2439323 0.115166 0.2034915 0.6149012 -0.0894721 1457743_at -0.2794626 -0.815994 -0.3209182 0.0624173 0.1664991 0.2602862 0.9254026 1.2929124 1457766_at 1.1807033 2.7420325 1.0639875 1.7915294 -2.470706 -2.077633 -1.2962718 -2.1168349 1457777_at 0.1461892 -0.051277 1.3108633 0.1550633 0.1155848 0.0809143 -0.0605219 -0.0764875 1457779_at -0.9427342 -1.136527 -0.5526551 0.8274801 0.490609 0.9584935 0.6293066 0.6153469 1457799_at -0.1355158 -0.868134 -0.1979069 0.1141174 0.3822145 0.1894472 0.3272673 0.3830495 1457823_at -1.6028261 0.1204857 0.1180294 -0.4353945 0.4111328 0.3069474 -0.1241156 -0.489277 1457829_at -0.0663207 1.6718901 -0.1240939 -0.0469692 0.4748153 0.1768003 0.9270714 -0.1853101 1457851_at -0.7127098 0.3323252 0.1004719 -0.2033489 0.062866 -0.0423102 -0.2525484 -0.0696112 1457869_at -0.1101556 0.1656945 -0.5788733 0.3776772 -0.0320829 0.472019 0.0629217 0.3067112 1457878_at -0.3887937 -0.658926 -0.060594 0.8457971 0.3987657 0.8616263 0.0789658 0.468442 1457884_at -0.0109574 0.7998343 0.0905248 0.4523499 -0.2363335 -0.1427784 -0.3910777 -0.3865736 1457896_at 0.1907678 0.8886539 0.3052503 -0.0850976 -0.1947304 -0.1505547 -0.2706009 -0.0353634 1457913_at -0.5170783 0.500733 0.3365589 -0.279573 -0.0732781 0.0743515 -0.3973691 -0.1363885 1457928_at 0.0881637 2.1198168 -0.05153 0.4267151 0.3932849 0.4395057 1.1771927 -0.3938142 1458024_at -0.5257295 -0.541851 -0.228256 0.6523025 0.3648835 0.7122914 0.2765345 0.581351 1458045_at -0.8010991 -0.49466 0.2671907 -0.2340169 0.1734963 0.7106951 0.0089855 0.8656921 1458069_at -0.795766 0.2804713 0.1411636 -0.1952715 -0.0795166 0.2374418 -0.4389849 0.1290636 1458075_at -1.0040088 -0.211567 0.3207336 -0.0403209 0.500892 0.6377424 -0.0574765 0.4649533 1458089_at -0.5680969 0.6067437 0.2381632 0.053385 -0.1885766 -0.2651637 -1.1303258 0.3090471 1458099_at -0.9126761 0.0273489 0.1668121 -0.4850302 -0.0153144 0.0258776 -0.2122885 0.1568014 1458104_a_at1.9687274 0.4589635 0.3679676 -0.735935 -0.2102986 -0.6100553 -0.1934193 -0.6150438 1458111_at 0.2236525 0.7155311 0.2352318 -0.0060709 -0.3423459 -0.1314088 -0.1489598 -0.1392055 1458121_at -0.7727369 -0.23869 0.227504 -0.2023029 0.0940461 0.4610333 -0.092498 0.2198798 1458135_at 0.07725 1.2551311 0.6915265 0.0547767 -0.3019098 0.0595717 -0.2406411 -0.2363884 1458156_at -0.0920284 0.7714361 0.3836839 -0.4505053 -0.2365452 -0.1619779 -0.452268 0.0499495 1458176_at -0.1972274 0.2283758 0.0285943 -0.6632135 -0.2491951 0.0319016 0.6170597 0.7863863 1458205_at -0.4366977 1.0635312 0.4284207 -0.5116258 -0.0418389 0.1286945 -0.2132176 -0.1223826 1458218_s_at-0.9909759 -0.806724 -0.5168233 0.8315043 0.5827616 1.0553967 0.5848923 0.6707414 1458236_at -0.6738317 -0.447386 -0.052601 0.5741618 0.5140066 0.1712728 -0.0335841 0.095215 1458263_at -0.79567 0.2570553 0.4593551 -0.4682105 0.0059381 0.0522426 -0.6487732 -0.1749174 1458268_s_at0.9854975 0.1008759 -0.1078117 0.5394492 0.0029293 -0.3207553 -0.5042836 -0.4696129 1458271_at 0.0337324 1.0058389 0.0225283 0.144303 -0.0690716 -0.0689344 -0.0568625 0.0111895 1458296_at -0.8201457 0.2660515 0.5312927 -0.2555518 -0.1443591 0.2089872 -0.4442773 0.4025401 1458320_at -0.3475072 2.3430924 0.0741882 0.4999365 -0.2138089 -0.318751 0.2800891 -1.1457795 1458331_x_at2.5692482 3.789815 2.9484491 3.5798674 -1.2567502 -0.515515 -0.9905593 -1.4847845 1458341_x_at0.6403889 0.1690059 0.0536482 -0.3814809 -0.0852027 -0.1883938 -0.0460488 -0.1327899 1458376_at -0.7001475 0.3581617 0.3557761 -0.2678816 0.0973192 0.3332276 -0.5532329 0.104225 1458382_a_at-0.7049868 -0.275518 0.5163091 0.4690282 0.1486893 0.3151612 0.1811031 -0.0875203 1458385_at -0.5132785 -0.334067 -0.3376688 0.5258517 0.3915286 0.3869063 0.2396293 -0.0400413 1458388_at 0.0199054 1.9922413 -0.0828823 0.2608609 0.516726 0.2362855 1.3707525 -0.282933 1458398_at -0.1723064 1.4109122 -0.151728 0.1439083 0.2269288 0.2645241 0.4423262 -0.416368 1458399_at -0.5397192 -0.691827 -0.2723317 0.7303402 0.4369788 0.7058641 0.5205326 0.6508578 1458409_at -0.1184605 0.9575211 0.327714 -0.1891189 -0.2472204 0.0783589 -0.9166191 -0.9095054 Diabetes Page 138 of 205

1458426_at -0.7763704 0.0347255 0.3573241 -0.5619083 0.0912157 0.0640889 -0.2042645 -0.0751378 1458440_at -0.357169 -0.714615 -0.3405037 0.9851198 0.3991838 1.0869063 0.4457336 0.3468501 1458460_at -0.9254862 0.0985867 0.1807481 0.0916092 -0.1564342 0.2658936 -0.4634678 0.2220856 1458478_at 0.4772351 1.9572552 0.3206248 0.2914794 -0.1060504 -0.0909373 0.1532083 0.5467701 1458481_at -0.0596204 1.1691579 -0.2271906 -0.0763631 0.1102576 0.1763213 0.6921597 -0.2964791 1458496_at 0.0955402 1.361536 0.3243294 0.1818893 -0.3038259 -0.1723994 -0.3412455 -0.23267 1458525_at -0.7463268 0.3552668 0.5554794 -0.313632 0.1743165 0.1006779 -0.084199 -0.0535982 1458543_at -0.3246253 0.1285389 0.8990077 0.2861013 0.1467041 0.1809914 0.0250923 -0.2394138 1458548_at 0.5575209 0.9578457 -0.1554871 -0.0798677 -0.363607 -0.3667473 0.318814 -0.3628979 1458575_at 0.2865311 0.7771246 0.4077832 -0.3407178 -0.3360091 -0.2561767 -0.372105 -0.2954532 1458578_at -0.6617745 -0.170492 0.3951769 -0.2356165 -0.0062459 0.3737396 -0.0357625 0.59828 1458591_at 0.7951555 1.4591742 0.1130458 0.0804062 -0.5959944 -0.6501323 -0.2714407 0.1015778 1458601_at -0.5082607 0.2678415 0.6685251 -0.5308471 -0.2495855 0.1526084 -0.6379039 0.0679266 1458622_at -0.6417224 -0.605768 -0.1667792 1.6498394 1.2210037 1.1440551 0.9169846 0.9596207 1458644_at -0.12664 1.139817 0.150605 -0.7442389 -0.1189518 -0.3427015 0.4852336 -0.143074 1458700_at -0.6974992 0.5858152 0.3918051 -0.0612774 0.0769431 0.3375088 -0.2425873 0.0691069 1458746_at -0.782217 -0.179884 0.3904488 -0.4510887 0.1172443 0.4484847 -0.2631537 0.176448 1458768_at 0.3297727 1.0991716 0.3816438 -0.1847618 -0.2453655 -0.2590419 -0.3006382 -0.4722284 1458832_at -1.0902437 -1.168196 0.454896 0.6322956 0.820511 0.3142367 -0.0242097 0.4489668 1458871_at -0.0504189 -0.089672 1.08284 0.0829736 -0.0248207 0.0070608 -0.0118371 0.0236636 1458884_at 0.0034701 0.7295716 0.3328009 -0.1242487 -0.3381808 0.0438606 -0.5201726 -0.200752 1458912_at -0.6119763 0.4804974 0.2543417 -0.3109162 -0.2458327 -0.0871641 -0.5692473 -0.0765705 1459009_at -0.9749941 -0.388751 0.5388134 0.0474863 0.3739881 0.5000793 -0.0362027 0.7642266 1459098_at -0.8399158 0.0580913 0.4687556 -0.2326248 0.3400511 0.4908134 -0.2502046 0.3181669 1459170_at -0.5942186 0.1791067 0.4193851 -0.0976071 0.0173249 0.0950842 -0.478734 0.4122259 1459253_at -1.1409267 0.0474724 0.1448773 -0.2997119 0.6956415 0.3859706 -0.8523672 -0.4800173 1459293_at -1.2761681 -0.168848 0.1701983 -0.0393813 1.217545 -0.0597392 -0.899533 -0.1946583 1459299_at 1.1155311 1.721802 0.2375481 0.4866293 -1.3175691 -1.2684481 -0.7281134 -0.395811 1459322_at -0.0078169 0.8912728 0.349115 -0.1426754 -0.3754372 -0.2690154 -0.0375778 -0.1453745 1459338_at -0.2176657 1.0072206 0.2946395 -0.4612811 -0.4670528 -0.3416365 -0.5505676 -0.0036802 1459348_at -0.6855254 -0.093539 0.731267 -0.7078664 -0.0443047 0.1952892 -0.2163646 0.2618249 1459358_at -0.7912648 0.1570574 0.022561 0.1141877 0.3207964 0.9176075 0.3284181 0.4943069 1459393_at 0.1903585 1.0116585 0.1567309 0.4085083 -0.1412081 -0.2112379 -0.1340489 -0.2285667 1459448_at -0.2306732 0.028668 -0.7879365 0.4056714 -0.0294846 0.300837 -0.0290294 -0.0119425 1459537_at -0.954991 0.0073465 0.163006 -0.1864252 -0.2293739 0.0614118 -0.2504354 0.767813 1459557_at -1.2298795 0.2131678 0.7694557 -0.0448279 0.4190466 0.0699827 -1.0335783 0.1036851 1459595_at -0.8220111 0.1401016 0.456202 -0.6763053 -0.0312509 0.4132152 -0.3770758 0.1687352 1459632_at -1.218725 0.3667306 0.4715333 -0.3579674 0.0403072 0.5461537 -0.4823448 0.1120782 1459661_at 2.4421134 0.9073103 0.6551979 -1.122915 -0.4377337 -1.2048198 -0.3399217 -0.9711576 1459695_at -0.5960009 0.4127706 0.2714875 -0.5252786 -0.2058899 -0.1095288 -0.1809747 0.0286338 1459713_s_at0.3649159 0.2869492 0.1248097 -0.708097 -0.3153942 -0.6296976 0.2017543 -0.4422458 1459759_s_at0.0806974 3.0534663 -0.3598695 0.3033743 0.738142 0.4491752 0.9719732 -0.556438 1459813_at -0.4807433 0.6294286 -0.5367891 0.1640267 -0.0886983 0.0020498 0.2847289 -0.0552279 1459815_at -0.2125785 1.2094569 -0.1223776 -0.2240357 -0.1612498 -0.2723176 0.2989717 -0.6886334 1459850_x_at0.0922866 0.1822696 -0.5045126 0.833617 0.1931924 0.6278138 -0.0949612 0.2760363 1459858_x_at-0.8449423 -0.917914 -0.6517475 0.9600267 0.5717861 1.1861433 0.8163397 1.1008645 1459865_x_at1.8997138 2.913935 1.942317 2.4821124 -0.544817 -0.1950726 -0.5854715 -0.8086684 1459875_x_at-0.2332373 0.711144 -0.4768412 0.2536335 0.2666799 0.3309306 0.6154895 -0.0843248 1459877_x_at0.2442129 0.596446 0.3919928 -0.6457114 -0.2351992 -0.547431 -0.6485338 -0.7694553 1459910_at -0.6994388 0.0395378 -0.5520283 0.2070403 0.27847 0.167167 0.3145069 0.0485401 1459948_at -1.0571736 -1.024329 0.579797 0.2304349 0.6991146 0.3731524 -0.1881895 0.5066487 1459961_a_at-0.3245808 0.7541188 0.6056281 -0.674295 -0.1125349 -0.1483626 -0.357913 -0.4107475 1459995_at 0.406722 4.2119017 -0.1255031 0.9106197 0.8636826 0.9390594 1.6874689 -0.4111296 1460027_at 0.0944912 1.5154754 -0.1150155 0.1675392 0.6768655 0.1482624 1.1141776 -0.1136154 1460036_at 1.8320053 3.3957832 0.3806777 0.8145428 -0.5936839 -0.5442578 -0.0407763 0.1605746 1460049_s_at0.9657974 0.367348 0.8425498 -0.6509051 -0.8133959 -1.136182 0.0787822 -0.9785624 1460056_at -0.014552 1.1656538 0.438746 -0.3133991 -0.3316231 -0.1575402 -0.2689576 -0.2740935 1460084_at -0.1715726 0.0602287 0.5109782 0.8417931 -0.185374 0.4638866 -0.0786131 0.3640007 1460117_at 0.1674752 0.9859468 -0.0073123 -0.0315652 -0.1610286 -0.2718401 -0.069252 -0.0691425 1460459_at -0.0994817 1.6773964 -0.1710695 -0.2781506 -0.1043616 -0.0047019 0.7384849 -0.9126859 Page 139 of 205 Diabetes

1460461_at -0.079012 1.8725828 -0.2880548 0.2653354 0.4246527 0.3722625 0.8994734 -0.1181388 1460467_at 0.0617276 0.9612337 -0.1593702 -0.1980457 0.1539375 -0.0582555 0.6429626 -0.2012951 1460470_at -0.0199412 -0.138494 1.7299975 0.2643466 0.2385709 0.5259738 -0.3315476 -0.049986 1460489_at 0.0167463 2.279646 -0.1336162 0.1685904 0.280425 0.0942527 1.2774217 -0.0663395 1460497_a_at0.0971073 2.211022 -0.2140916 0.3370447 0.3783355 0.3683457 1.549709 -0.1208901 1460517_at 0.723372 1.7841107 0.6313003 0.8302255 -0.5844332 -0.6622635 -0.4721583 -0.7076924 1460553_at -0.0825176 2.4927852 -0.381447 0.3437982 0.6032913 0.4796391 1.3909696 -0.1376925 1460570_at 0.2695913 1.0930558 0.0406177 -0.2027164 0.0062812 -0.2095872 0.8790891 -0.2310119 1460573_at 0.1540718 0.9016295 0.0793252 -0.1443205 -0.1284435 -0.3699144 -0.0191511 -0.2300549 1460593_at 0.8350983 1.3337946 0.1588842 0.1046078 -0.2607172 -0.2455308 -0.3869432 -0.0850423 1460601_at -0.472296 -0.468434 -0.1844555 0.6434131 0.3663174 0.5527614 0.3472849 0.6770802 1460602_at -0.5772972 -0.772136 -0.0444002 0.1498661 0.2759924 0.1104877 0.2776534 0.3395564 1460607_at 0.8967658 0.347371 0.2682204 -0.1181271 -8.18E-04 -0.1358187 0.1192687 -0.063718 1460608_at -0.0258902 1.2240995 0.4077253 0.8340277 -0.1193323 0.0509589 -0.0839314 -0.1944629 1460616_at 1.0020949 1.391096 0.6295139 0.3671966 -0.0994282 -0.0840741 0.0447486 1.1883687 1460618_x_at0.3948581 5.133424 -0.2893875 0.6768295 1.1516123 0.9172218 2.0524094 -0.8559027 Diabetes Page 140 of 205

[CR Old Adipo-H363Y](normalized)Gene SymbolEntrez Gene Gene Title Representative Public ID Psph 100678 phosphoserine phosphatase NM_133900 Aldh3a2 11671 aldehyde dehydrogenase family 3, subfamilyNM_007437 A2 Gja1 14609 gap junction protein, alpha 1 M63801 Uhrf1 18140 ubiquitin-like, containing PHD and RINGBB702754 finger domains, 1 Anxa6 11749 annexin A6 NM_013472 Scd2 20250 stearoyl-Coenzyme A desaturase 2 BG060909 Scd2 20250 stearoyl-Coenzyme A desaturase 2 BG060909 Agtr2 11609 angiotensin II receptor, type 2 NM_007429 Ldhc 16833 lactate dehydrogenase C NM_013580 Ldhc 16833 lactate dehydrogenase C NM_013580 Emb 13723 embigin BG064842 Emb 13723 embigin BG064842 Plod3 26433 procollagen-lysine, 2-oxoglutarate 5-dioxygenaseNM_011962 3 Stip1 20867 stress-induced phosphoprotein 1 NM_016737 Ndn 17984 necdin NM_010882 Tnp1 21958 transition protein 1 NM_009407 Atp9a 11981 ATPase, class II, type 9A NM_015731 Bcar3 29815 breast cancer anti-estrogen resistance 3NM_013867 Spink3 20730 serine peptidase inhibitor, Kazal type 3 NM_009258 Cpe 12876 carboxypeptidase E BC010197 Pebp1 23980 phosphatidylethanolamine binding proteinNM_018858 1 Prm1 19118 protamine 1 K02926 Slc2a4 20528 solute carrier family 2 (facilitated glucoseAB008453 transporter), member 4 Slc2a4 20528 solute carrier family 2 (facilitated glucoseAB008453 transporter), member 4 Kap 16483 kidney androgen regulated protein NM_010594 Marcks 17118 myristoylated alanine rich protein kinaseAW546141 C substrate Isyna1 71780 myo-inositol 1-phosphate synthase A1 NM_023627 Sqle 20775 squalene epoxidase NM_009270 Cldn11 18417 claudin 11 NM_008770 Fabp5 16592 fatty acid binding protein 5, epidermal BC002008 Fabp3 14077 fatty acid binding protein 3, muscle andNM_010174 heart Cd24a 12484 CD24a antigen NM_009846 Cyr61 16007 cysteine rich protein 61 NM_010516 Lipf 67717 lipase, gastric NM_026334 Nasp 50927 nuclear autoantigenic sperm protein (histone-binding)BB493242 Nasp 50927 nuclear autoantigenic sperm protein (histone-binding)BB493242 Gldc 104174 glycine decarboxylase NM_138595 Ccnb1///Gm5593268697///434175cyclin B1///predicted gene 5593 NM_007629 Mtap4 17758 microtubule-associated protein 4 BB000894 Cd83 12522 CD83 antigen NM_009856 Fkbp5 14229 FK506 binding protein 5 U16959 Errfi1 74155 ERBB receptor feedback inhibitor 1 NM_133753 Prnp 19122 prion protein BE630020 Hmgb3 15354 high mobility group box 3 NM_008253 Serpinf1 20317 serine (or cysteine) peptidase inhibitor, NM_011340clade F, member 1 Gpd1 14555 glycerol-3-phosphate dehydrogenase 1 BC019391(soluble) Vac14 234729 Vac14 homolog (S. cerevisiae) NM_138588 Mpzl2 14012 myelin protein zero-like 2 BC015076 Ass1 11898 argininosuccinate synthetase 1 NM_007494 Klhl13 67455 kelch-like 13 (Drosophila) NM_026167 Btg2 12227 B cell translocation gene 2, anti-proliferativeNM_007570 Perp 64058 PERP, TP53 apoptosis effector NM_022032 Plod1 18822 procollagen-lysine, 2-oxoglutarate 5-dioxygenaseNM_011122 1 Shcbp1 20419 Shc SH2-domain binding protein 1 NM_011369 Tuba3a///Tuba3b22144///22147tubulin, alpha 3A///tubulin, alpha 3B NM_009446 Slc27a2 26458 solute carrier family 27 (fatty acid transporter),BC013442 member 2 Prelp 116847 proline arginine-rich end leucine-rich repeatNM_054077 Prelp 116847 proline arginine-rich end leucine-rich repeatNM_054077 Crisp1 11571 cysteine-rich secretory protein 1 NM_009638 Page 141 of 205 Diabetes

Cirbp 12696 cold inducible RNA binding protein NM_007705 Mcam 84004 melanoma cell adhesion molecule NM_023061 Fkbp4///LOC100048743100048743///14228FK506 binding protein 4///peptidyl-prolylBB456860 cis-trans isomerase FKBP4-like Apod 11815 apolipoprotein D NM_007470 Pcx 18563 pyruvate carboxylase NM_008797 Pea15a 18611 phosphoprotein enriched in astrocytes 15AAI323543 Pea15a 18611 phosphoprotein enriched in astrocytes 15AAI323543 Pafah1b3 18476 platelet-activating factor acetylhydrolase,NM_008776 isoform 1b, subunit 3 Elovl2 54326 elongation of very long chain fatty acidsNM_019423 (FEN1/Elo2, SUR4/Elo3, yeast)-like 2 Acta2 11475 actin, alpha 2, smooth muscle, aorta NM_007392 Cryab 12955 crystallin, alpha B NM_009964 Tmed6 66269 transmembrane emp24 protein transportNM_025458 domain containing 6 Nr4a1 15370 nuclear receptor subfamily 4, group A, memberNM_010444 1 Emp1 13730 epithelial membrane protein 1 U25633 Mum1 68114 melanoma associated antigen (mutated)NM_023431 1 Slc35b4 58246 solute carrier family 35, member B4 BB320416 Sox7 20680 SRY-box containing gene 7 NM_011446 Epcam 17075 epithelial cell adhesion molecule BC005618 Slc44a4 70129 solute carrier family 44, member 4 BC010808 Cyp1b1 13078 cytochrome P450, family 1, subfamily b,BI251808 polypeptide 1 Cyp1b1 13078 cytochrome P450, family 1, subfamily b,BI251808 polypeptide 1 Spint1 20732 serine protease inhibitor, Kunitz type 1 NM_016907 Id3 15903 inhibitor of DNA binding 3 NM_008321 Slc2a5 56485 solute carrier family 2 (facilitated glucoseNM_019741 transporter), member 5 Kcne1l 66240 potassium voltage-gated channel, Isk-relatedNM_021487 family, member 1-like, pseudogene Znhit2 29805 zinc finger, HIT domain containing 2 NM_013859 Aspn 66695 asporin NM_025711 Cdc20 107995 cell division cycle 20 NM_023223 Serpine2 20720 serine (or cysteine) peptidase inhibitor, NM_009255clade E, member 2 Coil 12812 coilin NM_016706 Gk2 14626 glycerol kinase 2 NM_010294 Tppp3 67971 tubulin polymerization-promoting proteinNM_026481 family member 3 Gjb3 14620 gap junction protein, beta 3 NM_008126 Crisp2 22024 cysteine-rich secretory protein 2 NM_009420 Sigmar1 18391 sigma non-opioid intracellular receptor NM_0110141 Pgk2 18663 phosphoglycerate kinase 2 NM_031190 Ehbp1l1 114601 EH domain binding protein 1-like 1 NM_053252 Fam198b 68659 family with sequence similarity 198, memberNM_133187 B Parva 57342 parvin, alpha NM_020606 Snta1 20648 syntrophin, acidic 1 NM_009228 Slc39a8 67547 solute carrier family 39 (metal ion transporter),NM_026228 member 8 Mid1ip1 68041 Mid1 interacting protein 1 (gastrulationNM_026524 specific G12-like (zebrafish)) Gstm5 14866 glutathione S-transferase, mu 5 NM_010360 Slc34a2 20531 solute carrier family 34 (sodium phosphate),NM_011402 member 2 Adam8 11501 a disintegrin and metallopeptidase domainNM_007403 8 Tnni2 21953 troponin I, skeletal, fast 2 NM_009405 Fam107b 66540 family with sequence similarity 107, memberBC021353 B Elf3 13710 E74-like factor 3 NM_007921 Trp53inp1 60599 transformation related protein 53 inducibleAW495711 nuclear protein 1 Ly6d 17068 lymphocyte antigen 6 complex, locus DNM_010742 Trpv2 22368 transient receptor potential cation channel,NM_011706 subfamily V, member 2 Aatk 11302 apoptosis-associated tyrosine kinase NM_007377 Ppa1 67895 pyrophosphatase (inorganic) 1 NM_026438 Pou2af1 18985 POU domain, class 2, associating factor NM_0111361 Mettl7b 71664 methyltransferase like 7B NM_027853 Mfng 17305 MFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferaseNM_008595 Tbc1d8 54610 TBC1 domain family, member 8 BC005421 Cyp17a1 13074 cytochrome P450, family 17, subfamily a,NM_007809 polypeptide 1 Spata4 69281 spermatogenesis associated 4 NM_133711 Spo11 26972 SPO11 meiotic protein covalently boundNM_012046 to DSB homolog (S. cerevisiae) Diabetes Page 142 of 205

Tmem206 66950 transmembrane protein 206 NM_025864 Prom2 192212 prominin 2 AF269062 C1qtnf4 67445 C1q and tumor necrosis factor related proteinNM_026161 4 Slc40a1 53945 solute carrier family 40 (iron-regulated transporter),AF226613 member 1 Egr1 13653 early growth response 1 NM_007913 Cyp4v3 102294 cytochrome P450, family 4, subfamily v,NM_133969 polypeptide 3 Cyp4v3 102294 cytochrome P450, family 4, subfamily v,NM_133969 polypeptide 3 Ceacam10 26366 carcinoembryonic antigen-related cell adhesionNM_007675 molecule 10 Fabp9 21884 fatty acid binding protein 9, testis NM_027281 Rcn1 19672 reticulocalbin 1 NM_009037 Mecr 26922 mitochondrial trans-2-enoyl-CoA reductaseNM_025297 Mecr 26922 mitochondrial trans-2-enoyl-CoA reductaseNM_025297 Hspa2 15512 heat shock protein 2 BC004714 Ahcy 269378 S-adenosylhomocysteine hydrolase NM_016661 P4ha2 18452 procollagen-proline, 2-oxoglutarate 4-dioxygenaseNM_011031 (proline 4-hydroxylase), alpha II polypeptide Ntsr2 18217 neurotensin receptor 2 NM_008747 Mycn 18109 v-myc myelocytomatosis viral related oncogene,BC005453 neuroblastoma derived (avian) Krt19 16669 keratin 19 NM_008471 Expi 14038 extracellular proteinase inhibitor NM_007969 Dusp10 63953 dual specificity phosphatase 10 NM_022019 Usp2 53376 ubiquitin specific peptidase 2 AI553394 Gipc2 54120 GIPC PDZ domain containing family, memberNM_016867 2 Fah 14085 fumarylacetoacetate hydrolase NM_010176 Cldn2 12738 claudin 2 NM_016675 Ehd3 57440 EH-domain containing 3 BM234719 Ehd3 57440 EH-domain containing 3 BM234719 Palmd 114301 palmdelphin NM_023245 Ptgs2 19225 prostaglandin-endoperoxide synthase 2M94967 Ptgs2 19225 prostaglandin-endoperoxide synthase 2M94967 Pdk4 27273 pyruvate dehydrogenase kinase, isoenzymeNM_013743 4 Mal 17153 myelin and lymphocyte protein, T cell differentiationNM_010762 protein Tulp2 56734 tubby-like protein 2 NM_008807 Nkd1 93960 naked cuticle 1 homolog (Drosophila) NM_027280 Plekha2 83436 pleckstrin homology domain-containing,NM_031257 family A (phosphoinositide binding specific) member 2 Plekha2 83436 pleckstrin homology domain-containing,NM_031257 family A (phosphoinositide binding specific) member 2 Fzd6 14368 frizzled homolog 6 (Drosophila) NM_008056 Crip2 68337 cysteine rich protein 2 NM_024223 C2///Cfb 12263///14962complement component 2 (within H-2S)///complementNM_008198 factor B Cav2 12390 caveolin 2 NM_016900 Sytl4 27359 synaptotagmin-like 4 NM_013757 Peg3 18616 paternally expressed 3 AB003040 Sorbs1 20411 sorbin and SH3 domain containing 1 NM_009166 Rhcg 56315 Rhesus blood group-associated C glycoproteinNM_019799 Tuba4a 22145 tubulin, alpha 4A AW491660 Tuba4a 22145 tubulin, alpha 4A AW491660 Bex2 12069 brain expressed X-linked 2 NM_009749 Gpc1 14733 glypican 1 NM_016696 Rai14 75646 retinoic acid induced 14 NM_030690 Elovl6 170439 ELOVL family member 6, elongation of longNM_130450 chain fatty acids (yeast) Elovl6 170439 ELOVL family member 6, elongation of longNM_130450 chain fatty acids (yeast) Nap1l5 58243 nucleosome assembly protein 1-like 5 NM_021432 Cuzd1 16433 CUB and zona pellucida-like domains 1 NM_008411 Cdr2 12585 cerebellar degeneration-related 2 NM_007672 Gpd2 14571 glycerol phosphate dehydrogenase 2, mitochondrialNM_010274 Cks2///Gm12891///Gm19945///LOC100044750100044750///100503893///100504506///66197CDC28 protein kinase regulatory subunitNM_025415 2///predicted gene 12891///predicted gene, 19945///cyclin-dependent kinases regulatory subunit 2-like Cks2///Gm12891///Gm19945///LOC100044750100044750///100503893///100504506///66197CDC28 protein kinase regulatory subunitNM_025415 2///predicted gene 12891///predicted gene, 19945///cyclin-dependent kinases regulatory subunit 2-like Tnnc2 21925 troponin C2, fast NM_009394 Ramp1 51801 receptor (calcitonin) activity modifying proteinNM_016894 1 Ctsb 13030 cathepsin B M14222 Cyb561 13056 cytochrome b-561 BC006732 Page 143 of 205 Diabetes

Rnf19a 30945 ring finger protein 19A AF120206 Lyar 17089 Ly1 antibody reactive clone NM_025281 Ssx2ip 99167 synovial sarcoma, X breakpoint 2 interactingNM_138744 protein Nfe2l3 18025 nuclear factor, erythroid derived 2, like NM_0109033 Pcbp3 59093 poly(rC) binding protein 3 NM_021568 Spag6 50525 sperm associated antigen 6 NM_015773 Itgb5 16419 integrin beta 5 NM_010580 Itgb5 16419 integrin beta 5 NM_010580 Hells 15201 helicase, lymphoid specific NM_008234 Gsg1 14840 germ cell-specific gene 1 NM_010352 Fap 14089 fibroblast activation protein NM_007986 Apoc1 11812 apolipoprotein C-I NM_007469 Cxcl12 20315 chemokine (C-X-C motif) ligand 12 NM_013655 Otub2 68149 OTU domain, ubiquitin aldehyde bindingAK006346 2 Nup210 54563 nucleoporin 210 NM_018815 Galnt3 14425 UDP-N-acetyl-alpha-D-galactosamine:polypeptideAK019995 N-acetylgalactosaminyltransferase 3 Cyp27a1 104086 cytochrome P450, family 27, subfamily a,NM_024264 polypeptide 1 Slc15a2 57738 solute carrier family 15 (H+/peptide transporter),NM_021301 member 2 Rgs1 50778 regulator of G-protein signaling 1 NM_015811 Per2 18627 period homolog 2 (Drosophila) AF035830 Camk1 52163 calcium/calmodulin-dependent protein NM_133926kinase I Camk1 52163 calcium/calmodulin-dependent protein NM_133926kinase I St6galnac2 20446 ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminideBC010208 alpha-2,6-sialyltransferase 2 Slc12a2 20496 solute carrier family 12, member 2 BG069505 Pde4dip 83679 phosphodiesterase 4D interacting proteinNM_031401 (myomegalin) Sod3 20657 superoxide dismutase 3, extracellular NM_011435 Sod3 20657 superoxide dismutase 3, extracellular NM_011435 Spa17 20686 sperm autoantigenic protein 17 NM_011449 Slc22a4 30805 solute carrier family 22 (organic cation transporter),BC010590 member 4 Cd79b 15985 CD79B antigen NM_008339 Galntl5 67909 UDP-N-acetyl-alpha-D-galactosamine:polypeptideNM_026449 N-acetylgalactosaminyltransferase-like 5 Rsph1 22092 radial spoke head 1 homolog (Chlamydomonas)NM_025290 Sspn 16651 sarcospan BC021484 Pvalb 19293 parvalbumin NM_013645 Pter 19212 phosphotriesterase related NM_008961 Grb14 50915 growth factor receptor bound protein 14NM_016719 Opn3 13603 opsin 3 NM_010098 Kcna5 16493 potassium voltage-gated channel, shaker-relatedNM_008419 subfamily, member 5 Lgals12 56072 lectin, galactose binding, soluble 12 AF244979 Lgals12 56072 lectin, galactose binding, soluble 12 AF244979 Fam20c 80752 family with sequence similarity 20, memberNM_030565 C Pdzk1ip1 67182 PDZK1 interacting protein 1 BC013542 Soat1 20652 sterol O-acyltransferase 1 BG064396 Soat1 20652 sterol O-acyltransferase 1 BG064396 Soat1 20652 sterol O-acyltransferase 1 BG064396 Rab38 72433 RAB38, member of RAS oncogene familyNM_028238 Hnmt 140483 histamine N-methyltransferase NM_080462 Got2 14719 glutamate oxaloacetate transaminase 2,U82470 mitochondrial Got2 14719 glutamate oxaloacetate transaminase 2,U82470 mitochondrial Anxa8 11752 annexin A8 NM_013473 Cpn1 93721 carboxypeptidase N, polypeptide 1 NM_030703 Dkkl1 50722 dickkopf-like 1 NM_015789 Sncg 20618 synuclein, gamma NM_011430 Ccl11 20292 chemokine (C-C motif) ligand 11 NM_011330 Chl1 12661 cell adhesion molecule with homology toNM_007697 L1CAM 1810019J16Rik 69073 RIKEN cDNA 1810019J16 gene NM_133707 Lamb3 16780 laminin, beta 3 NM_008484 D17H6S56E-5 110956 DNA segment, Chr 17, human D6S56E 5NM_033075 D17H6S56E-5 110956 DNA segment, Chr 17, human D6S56E 5NM_033075 Galr3///Gcat14429///26912galanin receptor 3///glycine C-acetyltransferaseAK013138 (2-amino-3-ketobutyrate-coenzyme A ligase) Diabetes Page 144 of 205

LOC100038944///LOC100039068///LOC100039209///LOC100039271///LOC100039294///LOC100039393///LOC100039444///LOC100039523///LOC100039574///LOC100039602///LOC100039614///LOC100039659///LOC100039732///LOC100039753///LOC100039810///LOC100039876///LOC100040031///LOC100040400///LOC100040418///LOC100040429///LOC100040489///LOC100040564///LOC100040595///LOC100040636///LOC100040673///LOC100040744///LOC100040786///LOC100040873///LOC100040911///LOC100040991///LOC100041080///LOC100041117///LOC100041141///LOC100041142///LOC100041168///LOC100041207///LOC100041223///LOC100041255///LOC100041256///LOC100041662///LOC100041682///LOC100041683///LOC100041776///LOC100041789///LOC100041813///LOC100041913///LOC100041922///LOC100041934///LOC100041973///LOC100042013///LOC100042080///LOC100042116///LOC100042268///LOC100042321///LOC100042391///LOC100042395///LOC100042401///LOC100042428///LOC100042435///LOC100042440///LOC100042475///LOC100042512///LOC100042537///LOC100042550///LOC100042563///LOC100042585///LOC100042619///LOC100042649///LOC1100038944///100039068///100039209///100039271///100039294///100039393///100039444///100039523///100039574///100039602///100039614///100039659///100039732///100039753///100039810///100039876///100040031///100040400///100040418///100040429///100040489///100040564///100040595///100040636///100040673///100040744///100040786///100040873///100040911///100040991///100041080///100041117///100041141///100041142///100041168///100041207///100041223///100041255///100041256///100041662///100041682///100041683///100041776///100041789///100041813///100041913///100041922///100041934///100041973///100042013///100042080///100042116///100042268///100042321///100042391///100042395///100042401///100042428///100042435///100042440///100042475///100042512///100042537///100042550///100042563///100042585///100042619///100042649///100042669///100042682///100042689///100861599///100861611///100861659///100861662///100861667///100861677///100861704///100861709///100861717///100861720///100861743///100861748///100861769///100861817///1008Y-linked testis-specific protein 1-like///Y-linkedNM_023546 testis-specific protein 1-like///Y-linked testis-specific protein 1-like///Y-linked testis-specific protein 1-like///Y-linked testis-specific protein 1-like///Y-linked testis-specific protein 1-like///Y-linked testis-specific protein 1-like///Y-linked testis-specific protein 1-like///spermiogenesis specific transcript on the Y 2-like///Y-linked testis-specific protein 1-like///uncharacterized LOC100039614///Y-linked testis-specific protein 1-like///Y-linked testis-specific protein 1-like///spermiogenesis specific transcript on the Y family member///uncharacterized LOC100039810///Y-linked testis-specific protein 1-like///uncharacterized LOC100040031///Y-linked testis-specific protein 1-like///Y-linked testis-specific protein 1-like///Y-linked testis-specific protein 1-like///Y-linked testis-specific protein 1-like///Y-linked testis-specific protein 1-like///Y-linked testis-specific protein 1-like///Y-linked testis-specific protein 1-like///Y-linked testis-spec Cxcl13 55985 chemokine (C-X-C motif) ligand 13 AF030636 Clca1 12722 chloride channel calcium activated 1 AF047838 Spata19 75469 spermatogenesis associated 19 NM_029299 Ctsz 64138 cathepsin Z NM_022325 Ctsz 64138 cathepsin Z NM_022325 Ctsz 64138 cathepsin Z NM_022325 Eepd1 67484 endonuclease/exonuclease/phosphataseNM_026189 family domain containing 1 Zp3r 22789 zona pellucida 3 receptor NM_009581 Vldlr 22359 very low density lipoprotein receptor NM_013703 Dfna5 54722 deafness, autosomal dominant 5 (human)NM_018769 1700001F09Rik///Gm10375///Gm10377///Gm3676100042055///100042114///100042342///71826RIKEN cDNA 1700001F09 gene///predictedNM_027940 gene 10375///predicted gene 10377///predicted gene 3676 Ccna2 12428 cyclin A2 X75483 Cnn1 12797 calponin 1 NM_009922 Ncapg2 76044 non-SMC condensin II complex, subunitNM_133762 G2 Fam3c 27999 family with sequence similarity 3, memberAK016470 C Cidea 12683 cell death-inducing DNA fragmentation NM_007702factor, alpha subunit-like effector A Tspan1 66805 tetraspanin 1 AV371704 Pdlim7 67399 PDZ and LIM domain 7 NM_026131 Fbxo31 76454 F-box protein 31 NM_133765 Tssk1 22114 testis-specific serine kinase 1 NM_009435 Svs3a///Svs3b329557///64335seminal vesicle secretory protein 3A///seminalNM_021363 vesicle secretory protein 3B Svs3a 64335 seminal vesicle secretory protein 3A NM_021363 C4bp 12269 complement component 4 binding proteinNM_007576 Iqcf3 68265 IQ motif containing F3 NM_026645 Apoc2 11813 apolipoprotein C-II NM_009695 St14 19143 suppression of tumorigenicity 14 (colonNM_011176 carcinoma) Tfcp2l1 81879 transcription factor CP2-like 1 NM_023755 Egf 13645 epidermal growth factor NM_010113 Smpx 66106 small muscle protein, X-linked NM_025357 Tcea2 21400 transcription elongation factor A (SII), 2NM_009326 Gspt2 14853 G1 to S phase transition 2 NM_008179 Unc119 22248 unc-119 homolog (C. elegans) BC001990 Dhcr24 74754 24-dehydrocholesterol reductase BG295389 Sult1d1 53315 sulfotransferase family 1D, member 1 NM_016771 Lama1 16772 laminin, alpha 1 NM_008480 Nr2f1 13865 nuclear receptor subfamily 2, group F, memberNM_010151 1 Trp63 22061 transformation related protein 63 NM_011641 Hebp1 15199 heme binding protein 1 AF117613 Dbp 13170 D site albumin promoter binding proteinBC018323 Gstt1 14871 glutathione S-transferase, theta 1 BC012254 Malat1 72289 metastasis associated lung adenocarcinomaAF146523 transcript 1 (non-coding RNA) Malat1 72289 metastasis associated lung adenocarcinomaAF146523 transcript 1 (non-coding RNA) Pon1 18979 paraoxonase 1 NM_011134 Usp18 24110 ubiquitin specific peptidase 18 NM_011909 Aif1 11629 allograft inflammatory factor 1 NM_019467 Sdf2l1 64136 stromal cell-derived factor 2-like 1 NM_022324 Fxyd4 108017 FXYD domain-containing ion transport regulatorNM_033648 4 Pax8 18510 paired box gene 8 NM_011040 Pfn2 18645 profilin 2 NM_019410 Pfn2 18645 profilin 2 NM_019410 Hspa4l 18415 heat shock protein 4 like NM_011020 Ddx25 30959 DEAD (Asp-Glu-Ala-Asp) box polypeptideBC024852 25 Oxct2a 64059 3-oxoacid CoA transferase 2A NM_022033 Apoc3 11814 apolipoprotein C-III BC021776 Akap1 11640 A kinase (PRKA) anchor protein 1 BG067335 Cldn4 12740 claudin 4 NM_009903 Epb4.1l4b 54357 erythrocyte protein band 4.1-like 4b NM_019427 Dgat1 13350 diacylglycerol O-acyltransferase 1 BC003717 Irf6 54139 interferon regulatory factor 6 NM_016851 Page 145 of 205 Diabetes

H2afb1 68231 H2A histone family, member B1 NM_026627 Sbp///Sbpl 20234///638345spermine binding protein///spermine bindingNM_011321 protein-like Rnf128 66889 ring finger protein 128 AK004847 Prss8 76560 protease, serine, 8 (prostasin) BC003851 Fem1b 14155 feminization 1 homolog b (C. elegans) BM232562 Sephs2 20768 selenophosphate synthetase 2 NM_009266 Slc7a5 20539 solute carrier family 7 (cationic amino acidBC026131 transporter, y+ system), member 5 Insl6 27356 insulin-like 6 NM_013754 Nucb2 53322 nucleobindin 2 NM_016773 Smcp 17235 sperm mitochondria-associated cysteine-richNM_008574 protein Hist2h2aa1///Hist2h2aa2///Hist2h2ac15267///319176///319192histone cluster 2, H2aa1///histone clusterBC010564 2, H2aa2///histone cluster 2, H2ac Pgam2 56012 phosphoglycerate mutase 2 NM_018870 Apcdd1 494504 adenomatosis polyposis coli down-regulatedBB770932 1 Apcdd1 494504 adenomatosis polyposis coli down-regulatedBB770932 1 Itga7 16404 integrin alpha 7 NM_008398 Pde8a 18584 phosphodiesterase 8A BB220000 Tpd52l1 21987 tumor protein D52-like 1 NM_009413 Gtf2a1l 71828 general transcription factor IIA, 1-like NM_023630 Gde1 56209 glycerophosphodiester phosphodiesteraseBC003902 1 Slc16a2 20502 solute carrier family 16 (monocarboxylicAW105741 acid transporters), member 2 Slc16a2 20502 solute carrier family 16 (monocarboxylicAW105741 acid transporters), member 2 Lad1 16763 ladinin NM_133664 Islr 26968 immunoglobulin superfamily containingNM_012043 leucine-rich repeat Gng2 14702 guanine nucleotide binding protein (G protein),BB522409 gamma 2 Atp1b1 11931 ATPase, Na+/K+ transporting, beta 1 polypeptideNM_009721 Copz2 56358 coatomer protein complex, subunit zetaNM_019877 2 Cxcl14 57266 chemokine (C-X-C motif) ligand 14 AF252873 Ccdc91 67015 coiled-coil domain containing 91 AA067702 Smarcd3 66993 SWI/SNF related, matrix associated, actinNM_025891 dependent regulator of chromatin, subfamily d, member 3 Ppbp 57349 pro-platelet basic protein NM_023785 Tekt2 24084 tektin 2 NM_011902 Ripk4 72388 receptor-interacting serine-threonine kinaseAF302127 4 Sdsl 257635 serine dehydratase-like NM_133902 Grem2 23893 gremlin 2 homolog, cysteine knot superfamilyNM_011825 (Xenopus laevis) Snca 20617 synuclein, alpha NM_009221 Fgf13 14168 fibroblast growth factor 13 AF020737 Fgf13 14168 fibroblast growth factor 13 AF020737 Kcne3 57442 potassium voltage-gated channel, Isk-relatedNM_020574 subfamily, gene 3 Nap1l3 54561 nucleosome assembly protein 1-like 3 NM_138742 Socs2 216233 suppressor of cytokine signaling 2 NM_007706 Tfpi2 21789 tissue factor pathway inhibitor 2 NM_009364 Svs6 20945 seminal vesicle secretory protein 6 NM_013679 Capza3 12344 capping protein (actin filament) muscle NM_007605Z-line, alpha 3 Tssk3 58864 testis-specific serine kinase 3 NM_021479 Prss39 21755 protease, serine, 39 NM_009355 Rtp4 67775 receptor transporter protein 4 BC024872 Mlf1 17349 myeloid leukemia factor 1 AF100171 Dnaja4 58233 DnaJ (Hsp40) homolog, subfamily A, memberNM_021422 4 Fgfr4 14186 fibroblast growth factor receptor 4 NM_008011 Aldh1a7 26358 aldehyde dehydrogenase family 1, subfamilyNM_011921 A7 Hoxd10 15430 homeobox D10 BC013463 Calml3 70405 calmodulin-like 3 NM_027416 Mafk 17135 v-maf musculoaponeurotic fibrosarcomaNM_010757 oncogene family, protein K (avian) Clgn 12745 calmegin NM_009904 Clu 12759 clusterin NM_013492 Hal 15109 histidine ammonia lyase L07645 Egln3 112407 EGL nine homolog 3 (C. elegans) BB284358 Spata6 67946 spermatogenesis associated 6 AK005819 Cxcl9 17329 chemokine (C-X-C motif) ligand 9 NM_008599 Mpdz 17475 multiple PDZ domain protein AK019164 Diabetes Page 146 of 205

Mpdz 17475 multiple PDZ domain protein AK019164 Adad1 21744 adenosine deaminase domain containingNM_009350 1 (testis specific) Comt 12846 catechol-O-methyltransferase NM_007744 Apoc4 11425 apolipoprotein C-IV BC024657 Cox7a1 12865 cytochrome c oxidase, subunit VIIa 1 AF037370 Cd59a 12509 CD59a antigen NM_007652 Pcbd1 13180 pterin 4 alpha carbinolamine dehydratase/dimerizationNM_025273 cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 1 Pank1 75735 pantothenate kinase 1 BC023496 Mrps25 64658 mitochondrial ribosomal protein S25 AK004037 Lpar3 65086 lysophosphatidic acid receptor 3 NM_022983 Cfi 12630 complement component factor i NM_007686 Dnajc5b 66326 DnaJ (Hsp40) homolog, subfamily C, memberNM_025489 5 beta Tnnt2 21956 troponin T2, cardiac NM_011619 H2-Q2 15013 histocompatibility 2, Q region locus 2 U96752 Spert 67926 spermatid associated NM_026457 Pnkd 56695 paroxysmal nonkinesiogenic dyskinesiaNM_019999 Adcy8 11514 adenylate cyclase 8 NM_009623 Trim69 70928 tripartite motif-containing 69 NM_080510 Ptpn20 19256 protein tyrosine phosphatase, non-receptorNM_008978 type 20 Cd55 13136 CD55 antigen NM_010016 Cd2 12481 CD2 antigen NM_013486 Fads3 60527 fatty acid desaturase 3 BE652876 Cyp39a1 56050 cytochrome P450, family 39, subfamily a,NM_018887 polypeptide 1 Sh3gl2 20404 SH3-domain GRB2-like 2 AF326561 Sh3gl2 20404 SH3-domain GRB2-like 2 AF326561 3110070M22Rik 67304 RIKEN cDNA 3110070M22 gene NM_026084 Serpina5 268591 serine (or cysteine) peptidase inhibitor, NM_008785clade A, member 5 Cdh2 12558 cadherin 2 BC022107 Arg2 11847 arginase type II NM_009705 Aqp7 11832 aquaporin 7 AB056091 Fanca 14087 Fanconi anemia, complementation groupNM_016925 A Letmd1 68614 LETM1 domain containing 1 NM_134093 Acrv1 11451 acrosomal vesicle protein 1 NM_007391 Tuba1a 22142 tubulin, alpha 1A NM_011653 Rab3d 19340 RAB3D, member RAS oncogene family BB349707 Pam 18484 peptidylglycine alpha-amidating monooxygenaseNM_013626 Igfbp1 16006 insulin-like growth factor binding proteinNM_008341 1 Celsr1 12614 cadherin, EGF LAG seven-pass G-type receptorNM_009886 1 (flamingo homolog, Drosophila) Cxcl10 15945 chemokine (C-X-C motif) ligand 10 NM_021274 Nfil3 18030 nuclear factor, interleukin 3, regulated AY061760 Maff 17133 v-maf musculoaponeurotic fibrosarcomaBC022952 oncogene family, protein F (avian) Fscn3 56223 fascin homolog 3, actin-bundling protein,NM_019569 testicular (Strongylocentrotus purpuratus) Tssk6 83984 testis-specific serine kinase 6 NM_032004 Akr1c14 105387 aldo-keto reductase family 1, member C14NM_134072 Cnp 12799 2',3'-cyclic nucleotide 3' phosphodiesteraseM58045 Inadl 12695 InaD-like (Drosophila) AV287690 Inadl 12695 InaD-like (Drosophila) AV287690 Gtsf1l 68236 gametocyte specific factor 1-like NM_026630 Actl7a 11470 actin-like 7a NM_009611 Klk1b5 16622 kallikrein 1-related peptidase b5 NM_008456 Wisp2 22403 WNT1 inducible signaling pathway proteinNM_016873 2 1700034I23Rik 73297 FUN14 domain containing 2 pseudogeneNM_028494 Akap4///LOC100503160100503160///11643A kinase (PRKA) anchor protein 4///A-kinaseU07423 anchor protein 4-like Mcf2 109904 mcf.2 transforming sequence NM_133197 Eno1///Gm550613806///433182enolase 1, alpha non-neuron///predictedNM_023119 gene 5506 Eno1 13806 enolase 1, alpha non-neuron NM_023119 Fads2 56473 fatty acid desaturase 2 NM_019699 Iigp1 60440 interferon inducible GTPase 1 BM239828 Iigp1 60440 interferon inducible GTPase 1 BM239828 Rtn2 20167 reticulon 2 (Z-band associated protein) AF038538 Page 147 of 205 Diabetes

Gstm7 68312 glutathione S-transferase, mu 7 NM_026672 Saa1 20208 serum amyloid A 1 NM_011314 Serpinb2 18788 serine (or cysteine) peptidase inhibitor, NM_011111clade B, member 2 Anxa2 12306 annexin A2 NM_007585 Tdo2 56720 tryptophan 2,3-dioxygenase AI098840 Slc22a2 20518 solute carrier family 22 (organic cation transporter),NM_013667 member 2 Hoxd9 15438 homeobox D9 BC019150 Npy 109648 neuropeptide Y NM_023456 Itgax 16411 integrin alpha X NM_021334 Cypt1///Cypt7///Cypt8664723///664725///66742cysteine-rich perinuclear theca 1///cysteine-richNM_025738 perinuclear theca 7///cysteine-rich perinuclear theca 8 Rec8 56739 REC8 homolog (yeast) NM_020002 Serpine1 18787 serine (or cysteine) peptidase inhibitor, NM_008871clade E, member 1 Tmprss2 50528 transmembrane protease, serine 2 NM_015775 Sox4 20677 SRY-box containing gene 4 AI428101 1700012L04Rik///Gm14474///Gm14484///Gm14501100042927///547154///547160///76383RIKEN cDNA 1700012L04 gene///predictedNM_029588 gene 14474///predicted gene 14484///predicted gene 14501 Hipk3 15259 homeodomain interacting protein kinaseNM_010434 3 Wfdc15b 192201 WAP four-disulfide core domain 15B NM_138685 Cxcl1 14825 chemokine (C-X-C motif) ligand 1 NM_008176 Cct6b 12467 chaperonin containing Tcp1, subunit 6bNM_009839 (zeta) Apoa1 11806 apolipoprotein A-I NM_009692 Rgs2 19735 regulator of G-protein signaling 2 AF215668 Rgs2 19735 regulator of G-protein signaling 2 AF215668 Cdk14 18647 cyclin-dependent kinase 14 AI327038 Mthfd2 17768 methylenetetrahydrofolate dehydrogenaseBG076333 (NAD+ dependent), methenyltetrahydrofolate cyclohydrolase Mthfd2 17768 methylenetetrahydrofolate dehydrogenaseBG076333 (NAD+ dependent), methenyltetrahydrofolate cyclohydrolase Spnb2 20742 spectrin beta 2 BM213516 Agr2 23795 anterior gradient 2 (Xenopus laevis) NM_011783 Enpp1 18605 ectonucleotide pyrophosphatase/phosphodiesteraseAF339910 1 Ccl12///LOC100862578100862578///20293chemokine (C-C motif) ligand 12///c-C motifU50712 chemokine 12-like Tns1 21961 tensin 1 NM_027884 Jam2 67374 junction adhesion molecule 2 NM_023844 Htra3 78558 HtrA serine peptidase 3 NM_030127 1700011H14Rik 67082 RIKEN cDNA 1700011H14 gene NM_025956 Fzd4 14366 frizzled homolog 4 (Drosophila) BF783030 Ccdc96 66717 coiled-coil domain containing 96 NM_025725 Tinag 26944 tubulointerstitial nephritis antigen BC010745 F7 14068 coagulation factor VII NM_010172 1700028P14Rik 67483 RIKEN cDNA 1700028P14 gene NM_026188 Egfl6 54156 EGF-like-domain, multiple 6 NM_019397 Lcn5 13863 lipocalin 5 NM_007947 1700080E11Rik 73532 RIKEN cDNA 1700080E11 gene NM_028562 Svs5 20944 seminal vesicle secretory protein 5 NM_009301 Svs5 20944 seminal vesicle secretory protein 5 NM_009301 Hook2 170833 hook homolog 2 (Drosophila) NM_133255 Sorcs2 81840 sortilin-related VPS10 domain containingNM_030889 receptor 2 Rnf138 56515 ring finger protein 138 NM_019706 Fxyd2 11936 FXYD domain-containing ion transport regulatorNM_052823 2 S100a8 20201 S100 calcium binding protein A8 (calgranulinNM_013650 A) Reep5 13476 receptor accessory protein 5 NM_007874 Mns1 17427 meiosis-specific nuclear structural proteinNM_008613 1 Fam50b 108161 family with sequence similarity 50, memberNM_138746 B Stab2 192188 stabilin 2 NM_138673 Ccl21a///Ccl21b///Ccl21c///Gm10591///Gm13304///Gm1987///LOC100041504///LOC100041593///LOC100862177100041504///100041593///100042493///100504239///100504346///100504362///100862177///18829///65956chemokine (C-C motif) ligand 21A (serine)///chemokineNM_011335 (C-C motif) ligand 21B (leucine)///chemokine (C-C motif) ligand 21C (leucine)///predicted gene 10591///predicted gene 13304///predicted gene 1987///c-C motif chemokine 21c-like///c-C motif chemokine 21c-like///c-C motif chemokine 21c-like Gaa 14387 glucosidase, alpha, acid NM_008064 Spam1 20690 sperm adhesion molecule 1 NM_009241 Slc2a10 170441 solute carrier family 2 (facilitated glucoseNM_130451 transporter), member 10 Clca2 80797 chloride channel calcium activated 2 AF108501 Cck 12424 cholecystokinin NM_031161 Ehf 13661 ets homologous factor BC008249 Ehf 13661 ets homologous factor BC008249 Diabetes Page 148 of 205

Adamdec1 58860 ADAM-like, decysin 1 NM_021475 Sectm1b 58210 secreted and transmembrane 1B AI481997 C3ar1 12267 complement component 3a receptor 1 NM_009779 Defb1 13214 defensin beta 1 BC024380 Defb1 13214 defensin beta 1 BC024380 Tpd52 21985 tumor protein D52 BC002036 Tpd52 21985 tumor protein D52 BC002036 Gpam 14732 glycerol-3-phosphate acyltransferase, mitochondrialNM_008149 Pabpc2 18459 poly(A) binding protein, cytoplasmic 2 NM_011033 Ces1e 13897 carboxylesterase 1E NM_133660 Tuba8 53857 tubulin, alpha 8 NM_017379 Comp 12845 cartilage oligomeric matrix protein NM_016685 1700102P08Rik 112418 RIKEN cDNA 1700102P08 gene NM_053216 Slco6b1 67854 solute carrier organic anion transporterNM_026413 family, member 6b1 Tfec 21426 transcription factor EC NM_031198 Dazl 13164 deleted in azoospermia-like NM_010021 Arg1 11846 arginase, liver NM_007482 Echdc1 52665 enoyl Coenzyme A hydratase domain containingNM_025855 1 Elf5 13711 E74-like factor 5 BC012424 Fank1 66930 fibronectin type 3 and ankyrin repeat domainsBF018996 1 Isg20 57444 interferon-stimulated protein BC022751 Rp2h 19889 retinitis pigmentosa 2 homolog (human)BF168611 Greb1 268527 gene regulated by estrogen in breast cancerNM_015764 protein Mia1 12587 melanoma inhibitory activity 1 NM_019394 Trpv6 64177 transient receptor potential cation channel,NM_022413 subfamily V, member 6 Bbox1 170442 butyrobetaine (gamma), 2-oxoglutarateNM_130452 dioxygenase 1 (gamma-butyrobetaine hydroxylase) Prss21 57256 protease, serine, 21 NM_020487 1700010I14Rik 66931 RIKEN cDNA 1700010I14 gene NM_025851 Hspa1l 15482 heat shock protein 1-like NM_013558 Clec4n 56620 C-type lectin domain family 4, member NM_020001n Tecta 21683 tectorin alpha NM_009347 Myo1c 17913 myosin IC NM_008659 Tle3 21887 transducin-like enhancer of split 3, homologNM_009389 of Drosophila E(spl) Nupr1 56312 nuclear protein 1 NM_019738 Ccl8///LOC100503254100503254///20307chemokine (C-C motif) ligand 8///c-C motifNM_021443 chemokine 8-like Prom1 19126 prominin 1 NM_008935 Col5a3 53867 collagen, type V, alpha 3 NM_016919 Akap12 83397 A kinase (PRKA) anchor protein (gravin) NM_03118512 1700029F12Rik 66479 RIKEN cDNA 1700029F12 gene NM_025585 Sema3e 20349 sema domain, immunoglobulin domain NM_011348(Ig), short basic domain, secreted, (semaphorin) 3E 4921530L21Rik 66732 RIKEN cDNA 4921530L21 gene NM_025733 Gabrb1 14400 gamma-aminobutyric acid (GABA) A receptor,NM_008069 subunit beta 1 Niacr1 80885 niacin receptor 1 NM_030701 Adam18 13524 a disintegrin and metallopeptidase domainNM_010084 18 Daf2 13137 decay accelerating factor 2 NM_007827 Ahcyl2 74340 S-adenosylhomocysteine hydrolase-likeNM_021414 2 Cyp2b19 13090 cytochrome P450, family 2, subfamily b,NM_007814 polypeptide 19 Glipr1l2 67537 GLI pathogenesis-related 1 like 2 NM_026223 Tpm2 22004 tropomyosin 2, beta AK003186 Abcd2 26874 ATP-binding cassette, sub-family D (ALD),NM_011994 member 2 Ubd 24108 ubiquitin D NM_023137 Chi3l3 12655 chitinase 3-like 3 NM_009892 Pkhd1 241035 polycystic kidney and hepatic disease 1AI182499 Kif17 16559 kinesin family member 17 AW492270 Hpgd 15446 hydroxyprostaglandin dehydrogenase 15AV026552 (NAD) Ccnb1///Gm5593268697///434175cyclin B1///predicted gene 5593 AU015121 Wwc1 211652 WW, C2 and coiled-coil domain containingAU017197 1 Slc35c2 228875 solute carrier family 35, member C2 C85957 BE628832 Nfkbia 18035 nuclear factor of kappa light polypeptideAI462015 gene enhancer in B cells inhibitor, alpha Page 149 of 205 Diabetes

Tcta 102791 T cell leukemia translocation altered geneC85065 Tcta 102791 T cell leukemia translocation altered geneC85065 Pttg1ip 108705 Pituitary tumor-transforming 1 interactingAU018448 protein Spsb1 74646 splA/ryanodine receptor domain and SOCSAI596360 box containing 1 Tmem191c 224019 transmembrane protein 191C N28171 Prss58 232717 protease, serine 58 AV204466 Txndc8 67402 thioredoxin domain containing 8 NM_026132 Alox15 11687 arachidonate 15-lipoxygenase L34570 Tmco5 67356 transmembrane and coiled-coil domainsNM_026104 5 Grk4 14772 G protein-coupled receptor kinase 4 NM_019497 Xlr3a///Xlr3b///Xlr3c22445///22446///574437X-linked lymphocyte-regulated 3A///X-linkedNM_011726 lymphocyte-regulated 3B///X-linked lymphocyte-regulated 3C Sva 20939 seminal vesicle antigen NM_009299 Spesp1 66712 sperm equatorial segment protein 1 NM_025721 Ccl2 20296 chemokine (C-C motif) ligand 2 AF065933 Ubl4b 67591 ubiquitin-like 4B NM_026261 Rgs18 64214 regulator of G-protein signaling 18 BB139986 Ramp3 56089 receptor (calcitonin) activity modifying proteinNM_019511 3 Pi4k2b 67073 phosphatidylinositol 4-kinase type 2 betaNM_028744 Slc7a11 26570 solute carrier family 7 (cationic amino acidNM_011990 transporter, y+ system), member 11 1700054O13Rik 67334 RIKEN cDNA 1700054O13 gene NM_026096 Ccdc159 67119 coiled-coil domain containing 159 NM_025977 Ido1 15930 indoleamine 2,3-dioxygenase 1 NM_008324 Orm2 18406 orosomucoid 2 NM_011016 Tsx 22127 testis specific X-linked gene NM_009440 Slc22a3 20519 solute carrier family 22 (organic cation transporter),NM_011395 member 3 Odf3 69287 outer dense fiber of sperm tails 3 NM_027019 Gm10693///Gm14548///Gm15448///Lilra6///Lilrb3///Pira1///Pira11///Pira2///Pira4///Pira6///Pira7100038909///100041146///18722///18724///18725///18726///18727///18729///18730///18733///675749predicted pseudogene 10693///predictedNM_011093 gene 14548///predicted gene 15448///leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6///leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3///paired-Ig-like receptor A1///paired-Ig-like receptor A11///paired-Ig-like receptor A2///paired-Ig-like receptor A4///paired-Ig-like receptor A6///paired-Ig-like receptor A7 Gm2083///LOC100861909///Mup1///Mup10///Mup12///Mup13///Mup14///Mup15///Mup16///Mup19///Mup2///Mup7///Mup8///Mup9100038948///100039008///100039054///100039089///100039116///100039150///100039177///100041658///100041687///100048885///100189605///100861909///17840///17841major urinary protein LOC100048885///majorNM_031188 urinary protein 2-like///major urinary protein 1///major urinary protein 10///major urinary protein 12///major urinary protein 13///major urinary protein 14///major urinary protein 15///major urinary protein 16///major urinary protein 19///major urinary protein 2///major urinary protein 7///major urinary protein 8///major urinary protein 9 Mucl1 20771 mucin-like 1 NM_009268 Asb17 66772 ankyrin repeat and SOCS box-containingNM_025758 17 Cnnm3 94218 cyclin M3 NM_053186 Nol7 70078 nucleolar protein 7 AW060738 Sat1 20229 spermidine/spermine N1-acetyl transferaseNM_009121 1 Efcab2 68226 EF-hand calcium binding domain 2 BC025062 Tcp10a///Tcp10b21461///21462t-complex protein 10a///t-complex proteinNM_011553 10b Rdh16 19683 retinol dehydrogenase 16 NM_009040 Chn1 108699 chimerin (chimaerin) 1 NM_029716 Tsga8 100502723 testis specific gene A8 NM_021898 1700065I17Rik 67343 RIKEN cDNA 1700065I17 gene NM_026099 Cftr 12638 cystic fibrosis transmembrane conductanceNM_021050 regulator Tsga13 116732 testis specific gene A13 NM_054073 Spinlw1 75526 serine protease inhibitor-like, with KunitzNM_029325 and WAP domains 1 (eppin) Krt8 16691 keratin 8 NM_031170 Pnpla3 116939 patatin-like phospholipase domain containingNM_054088 3 Ucp3 22229 uncoupling protein 3 (mitochondrial, protonAF053352 carrier) Lrrc6 54562 leucine rich repeat containing 6 (testis) NM_019457 Pla2g2e 26970 phospholipase A2, group IIE NM_012044 Cryba4 12959 crystallin, beta A4 NM_021351 4933415F23Rik 66755 RIKEN cDNA 4933415F23 gene NM_025746 Fgf10 14165 fibroblast growth factor 10 NM_008002 Gpx5 14780 glutathione peroxidase 5 NM_010343 1700093K21Rik 67358 RIKEN cDNA 1700093K21 gene NM_026105 Dao 13142 D-amino acid oxidase BC018377 A930018P22Rik 68243 RIKEN cDNA A930018P22 gene NM_026634 Tex15 104271 testis expressed gene 15 NM_031374 1700067P10Rik 68224 RIKEN cDNA 1700067P10 gene NM_026625 Tmlhe 192289 trimethyllysine hydroxylase, epsilon AY033513 Tmlhe 192289 trimethyllysine hydroxylase, epsilon AY033513 Tcp11 21463 t-complex protein 11 NM_013687 Csrp2 13008 cysteine and glycine-rich protein 2 NM_007792 Diabetes Page 150 of 205

Gabrr2 14409 gamma-aminobutyric acid (GABA) C receptor,AF024621 subunit rho 2 Pmfbp1 56523 polyamine modulated factor 1 binding proteinNM_019938 1 Adam7 11500 a disintegrin and metallopeptidase domainNM_007402 7 Ndrg1 17988 N-myc downstream regulated gene 1 NM_008681 Socs7 192157 suppressor of cytokine signaling 7 NM_138657 Klk1b24 16617 kallikrein 1-related peptidase b24 NM_010643 Tsc22d3 14605 TSC22 domain family, member 3 NM_010286 Mgarp 67749 mitochondria localized glutamic acid richNM_026358 protein Hdhd1a 67365 haloacid dehalogenase-like hydrolase domainNM_026108 containing 1A 4933400A11Rik 66747 capping protein (actin filament) muscle NM_025743Z-line, alpha 1 pseudogene Pcdha1///Pcdha10///Pcdha11///Pcdha12///Pcdha2///Pcdha3///Pcdha4///Pcdha5///Pcdha6///Pcdha7///Pcdha8///Pcdha9///Pcdhac1///Pcdhac2116731///12936///12937///12939///12941///12942///12943///192161///192163///192164///353234///353235///353236///353237protocadherin alpha 1///protocadherin NM_054072alpha 10///protocadherin alpha 11///protocadherin alpha 12///protocadherin alpha 2///protocadherin alpha 3///protocadherin alpha 4///protocadherin alpha 5///protocadherin alpha 6///protocadherin alpha 7///protocadherin alpha 8///protocadherin alpha 9///protocadherin alpha subfamily C, 1///protocadherin alpha subfamily C, 2 Clec4d 17474 C-type lectin domain family 4, member NM_010819d Myl10 59310 myosin, light chain 10, regulatory NM_021611 Ywhag 22628 tyrosine 3-monooxygenase/tryptophan NM_0188715-monooxygenase activation protein, gamma polypeptide Sgpp1 81535 sphingosine-1-phosphate phosphatase 1NM_030750 Sgpp1 81535 sphingosine-1-phosphate phosphatase 1NM_030750 Ntrk2 18212 neurotrophic tyrosine kinase, receptor, AK018789type 2 Ptprf 19268 protein tyrosine phosphatase, receptor BF235516type, F Ptprf 19268 protein tyrosine phosphatase, receptor BF235516type, F Sufu 24069 suppressor of fused homolog (Drosophila)AJ308624 Pard6g 93737 par-6 partitioning defective 6 homolog gammaNM_053117 (C. elegans) Eln 13717 elastin BB229377 Pkia 18767 protein kinase inhibitor, alpha AK010212 Pkia 18767 protein kinase inhibitor, alpha AK010212 Mfge8 17304 milk fat globule-EGF factor 8 protein NM_008594 St6gal1 20440 beta galactoside alpha 2,6 sialyltransferaseBG075800 1 Zfp185 22673 zinc finger protein 185 AK014497 Zfp185 22673 zinc finger protein 185 AK014497 Add1 11518 adducin 1 (alpha) BF140063 Enc1 13803 ectodermal-neural cortex 1 BM120053 Enc1 13803 ectodermal-neural cortex 1 BM120053 Pctp 18559 phosphatidylcholine transfer protein AF114437 4933411K20Rik 66756 RIKEN cDNA 4933411K20 gene NM_025747 Angptl2 26360 angiopoietin-like 2 BG244279 Rsad2 58185 radical S-adenosyl methionine domain containingBB741897 2 Rsad2 58185 radical S-adenosyl methionine domain containingBB741897 2 Clybl 69634 citrate lyase beta like BC023398 Hilpda 69573 hypoxia inducible lipid droplet associatedNM_023516 Npas2 18143 neuronal PAS domain protein 2 BG070037 Gsta2 14858 glutathione S-transferase, alpha 2 (Yc2)NM_008182 Gm3776///Gsta1///Gsta2100042295///14857///14858predicted gene 3776///glutathione S-transferase,NM_008182 alpha 1 (Ya)///glutathione S-transferase, alpha 2 (Yc2) Mrc2 17534 mannose receptor, C type 2 BB528408 Ypel1 106369 yippee-like 1 (Drosophila) NM_023249 Snrpn///Snurf20646///84704small nuclear ribonucleoprotein N///SNRPNNM_033174 upstream reading frame Cyp7b1 13123 cytochrome P450, family 7, subfamily b,NM_007825 polypeptide 1 Per3 18628 period homolog 3 (Drosophila) NM_011067 Epb4.1l1 13821 erythrocyte protein band 4.1-like 1 NM_013510 Slc7a10 53896 solute carrier family 7 (cationic amino acidNM_017394 transporter, y+ system), member 10 Stap1 56792 signal transducing adaptor family memberNM_019992 1 Rtn4 68585 reticulon 4 NM_024226 Atp2a3 53313 ATPase, Ca++ transporting, ubiquitous NM_016745 Pkib 18768 protein kinase inhibitor beta, cAMP dependent,AV047342 testis specific Rpgrip1 77945 retinitis pigmentosa GTPase regulator interactingNM_023879 protein 1 Btc 12223 betacellulin, epidermal growth factor familyNM_007568 member Adam12 11489 a disintegrin and metallopeptidase domainNM_007400 12 (meltrin alpha) Irf4 16364 interferon regulatory factor 4 U34307 Tex12 66654 testis expressed gene 12 AF285582 Bche 12038 butyrylcholinesterase NM_009738 Ccl7 20306 chemokine (C-C motif) ligand 7 AF128193 Lipg 16891 lipase, endothelial BC020991 Page 151 of 205 Diabetes

Dst 13518 dystonin NM_134448 Atp4a 11944 ATPase, H+/K+ exchanging, gastric, alphaNM_018731 polypeptide Hspb7 29818 heat shock protein family, member 7 (cardiovascular)BG968304 Hspb7 29818 heat shock protein family, member 7 (cardiovascular)BG968304 Hdgfl1 15192 hepatoma derived growth factor-like 1 AF180109 Hdgfl1 15192 hepatoma derived growth factor-like 1 AF180109 Chrdl1 83453 chordin-like 1 NM_031258 Car13 71934 carbonic anhydrase 13 AK010166 Myb 17863 myeloblastosis oncogene NM_033597 Net1 56349 neuroepithelial cell transforming gene 1NM_019671 Ftmt 67634 ferritin mitochondrial NM_026286 Gcnt2 14538 glucosaminyl (N-acetyl) transferase 2, I-branchingNM_008105 enzyme Slc5a7 63993 solute carrier family 5 (choline transporter),NM_022025 member 7 Ptrf 19285 polymerase I and transcript release factorNM_008986 Slc26a3 13487 solute carrier family 26, member 3 NM_021353 Stat5a 20850 signal transducer and activator of transcriptionU36502 5A Zfp318 57908 zinc finger protein 318 NM_021346 2010106E10Rik 67715 RIKEN cDNA 2010106E10 gene NM_026333 Acer2 230379 alkaline ceramidase 2 NM_028605 4930430A15Rik 67575 RIKEN cDNA 4930430A15 gene NM_026248 Dfna5 54722 deafness, autosomal dominant 5 (human)NM_008016 Adrb3 11556 adrenergic receptor, beta 3 NM_013462 Serpina3a 74069 serine (or cysteine) peptidase inhibitor, NM_028740clade A, member 3A Abo 80908 ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase,NM_030718 transferase B, alpha 1-3-galactosyltransferase) Serpina3c 16625 serine (or cysteine) peptidase inhibitor, NM_008458clade A, member 3C Klk1b27 16619 kallikrein 1-related peptidase b27 NM_020268 Fam184b 58227 family with sequence similarity 184, memberNM_021416 B Rasgrf2 19418 RAS protein-specific guanine nucleotide-releasingNM_009027 factor 2 Enah 13800 enabled homolog (Drosophila) NM_010135 Igh-VJ558///Igha16061///238447immunoglobulin heavy chain (J558 family)///immunoglobulinNM_134051 heavy constant alpha Cdkn1a 12575 cyclin-dependent kinase inhibitor 1A (P21)NM_007669 Nrg4 83961 neuregulin 4 NM_032002 Gm3417///Gm3448///Tcte3100041586///100041639///21647predicted gene 3417///predicted gene 3448///t-complex-associatedNM_011560 testis expressed 3 Gm3417///Gm3448///Tcte3100041586///100041639///21647predicted gene 3417///predicted gene 3448///t-complex-associatedNM_011560 testis expressed 3 Rdh1 107605 retinol dehydrogenase 1 (all trans) NM_080436 Stat6 20852 signal transducer and activator of transcriptionNM_009284 6 Dtx2 74198 deltex 2 homolog (Drosophila) NM_023742 Glrp1 14659 glutamine repeat protein 1 NM_008132 Serpinb5 20724 serine (or cysteine) peptidase inhibitor, NM_009257clade B, member 5 Ear1 13586 eosinophil-associated, ribonuclease A family,NM_007894 member 1 Fabp9 21884 fatty acid binding protein 9, testis NM_011598 Defb6 116746 defensin beta 6 NM_054074 Thbs1///X9938421825///27355thrombospondin 1///cDNA sequence X99384AI385532 Psap 19156 prosaposin BM212050 Ak4 11639 adenylate kinase 4 NM_009647 Pip5k1b 18719 phosphatidylinositol-4-phosphate 5-kinase,NM_008846 type 1 beta Pip5k1b 18719 phosphatidylinositol-4-phosphate 5-kinase,NM_008846 type 1 beta Dbil5 13168 diazepam binding inhibitor-like 5 AK006528 Aplp2 11804 amyloid beta (A4) precursor-like proteinM97216 2 St3gal2 20444 ST3 beta-galactoside alpha-2,3-sialyltransferaseBB750118 2 St3gal2 20444 ST3 beta-galactoside alpha-2,3-sialyltransferaseBB750118 2 Serpina3m 20717 serine (or cysteine) peptidase inhibitor, BC011158clade A, member 3M Igfbp4 16010 insulin-like growth factor binding proteinNM_010517 4 Tfap2a 21418 transcription factor AP-2, alpha NM_011547 Akr1c12 622402 aldo-keto reductase family 1, member C12AF177041 Cxcr5 12145 chemokine (C-X-C motif) receptor 5 NM_007551 D730048I06Rik 68171 RIKEN cDNA D730048I06 gene NM_026593 Pilrb1 170741 paired immunoglobin-like type 2 receptorNM_133209 beta 1 Adh4 26876 alcohol dehydrogenase 4 (class II), pi polypeptideNM_011996 Gstm6 14867 glutathione S-transferase, mu 6 NM_008184 Diabetes Page 152 of 205

Acot4 171282 acyl-CoA thioesterase 4 AA571017 Acot4 171282 acyl-CoA thioesterase 4 AA571017 2410066E13Rik 68235 RIKEN cDNA 2410066E13 gene NM_026629 Gm2619///Gm7609///LOC100041903///LOC100503923100040135///100041903///100503923///665378predicted gene 2619///predicted pseudogeneNM_033616 7609///uncharacterized LOC100041903///uncharacterized LOC100503923 Csprs///Gm15433///Gm2666///Gm7592///Gm7609100040213///100503433///114564///665338///665378component of Sp100-rs///predicted pseudogeneNM_033616 15433///predicted gene 2666///predicted gene 7592///predicted pseudogene 7609 Asb11 68854 ankyrin repeat and SOCS box-containingNM_026853 11 Hist1h3b///Hist1h3c///Hist1h3d///Hist1h3e///Hist1h3f///Hist2h3b///Hist2h3c1///Hist2h3c215077///260423///319148///319149///319150///319151///319154///97114histone cluster 1, H3b///histone clusterBC015270 1, H3c///histone cluster 1, H3d///histone cluster 1, H3e///histone cluster 1, H3f///histone cluster 2, H3b///histone cluster 2, H3c1///histone cluster 2, H3c2 Bdnf 12064 brain derived neurotrophic factor AY057913 Il13ra2 16165 interleukin 13 receptor, alpha 2 BC003723 Rab17 19329 RAB17, member RAS oncogene family NM_008998 Cyb5r3 109754 cytochrome b5 reductase 3 NM_029787 Tcp10b///Tcp10c100041352///21462t-complex protein 10b///t-complex proteinNM_009341 10c Tcp10a///Tcp10b///Tcp10c100041352///21461///21462t-complex protein 10a///t-complex proteinNM_009341 10b///t-complex protein 10c Ttc39d 67737 tetratricopeptide repeat domain 39D NM_026351 Cyp2b10 13088 cytochrome P450, family 2, subfamily b,NM_009998 polypeptide 10 Lgals7 16858 lectin, galactose binding, soluble 7 AF038562 G6pd2///G6pdx14380///14381glucose-6-phosphate dehydrogenase 2///glucose-6-phosphateNM_019468 dehydrogenase X-linked Actg2 11468 actin, gamma 2, smooth muscle, entericNM_009610 Il15ra 16169 interleukin 15 receptor, alpha chain NM_008358 Gml///Hemt115202///625599GPI anchored molecule like protein///hematopoieticNM_010416 cell transcript 1 Tnp2 21959 transition protein 2 NM_013694 Svs2 53878 seminal vesicle secretory protein 2 NM_017390 Acsbg1 94180 acyl-CoA synthetase bubblegum family memberNM_053178 1 Fignl1 60530 fidgetin-like 1 NM_021891 Ephx1 13849 epoxide hydrolase 1, microsomal NM_010145 Ube2t 67196 ubiquitin-conjugating enzyme E2T (putative)NM_026024 Cables1 63955 CDK5 and Abl enzyme substrate 1 AF328140 Idh3a 67834 isocitrate dehydrogenase 3 (NAD+) alphaNM_029573 Idh3a 67834 isocitrate dehydrogenase 3 (NAD+) alphaNM_029573 Glrb 14658 glycine receptor, beta subunit NM_010298 Pate4 56872 prostate and testis expressed 4 NM_020264 Dctn1 13191 dynactin 1 NM_007835 Acsl1 14081 acyl-CoA synthetase long-chain family memberBI413218 1 Cyp51 13121 cytochrome P450, family 51 NM_020010 Ropn1 76378 ropporin, rhophilin associated protein 1NM_030744 Tbx2 21385 T-box 2 NM_009324 Mtap6 17760 microtubule-associated protein 6 NM_010837 Rprm 67874 reprimo, TP53 dependent G2 arrest mediatorNM_023396 candidate Gamt 14431 guanidinoacetate methyltransferase AF015887 Adamts5 23794 a disintegrin-like and metallopeptidase BB658835(reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2) Thbs2 21826 thrombospondin 2 NM_011581 Myl4 17896 myosin, light polypeptide 4 NM_010858 Lep 16846 leptin U18812 Odf1 18285 outer dense fiber of sperm tails 1 NM_008757 Rasgrf1 19417 RAS protein-specific guanine nucleotide-releasingNM_011245 factor 1 Ppp1r1a 58200 protein phosphatase 1, regulatory (inhibitor)NM_021391 subunit 1A Igf2bp3 140488 insulin-like growth factor 2 mRNA bindingNM_023670 protein 3 Gm10058///Gm10096///Gm10147///Gm10230///Gm10486///Gm10487///Gm10488///Gm14525///Gm14632///Gm14819///Gm1993///Gm2003///Gm2012///Gm2030///Gm4297///Gm4836///Gm5169///Gm5934///Gm6121///Gm7365///LOC100862354///Slx100038977///100038997///100039030///100039065///100039120///100039240///100039324///100039377///100039467///100039550///100039585///100042109///100042144///100042175///100043216///100862354///22526///382277///546272///619991///664829///664844predicted gene 10058///predicted geneNM_009529 10096///predicted gene 10147///predicted gene 10230///predicted gene 10486///predicted gene 10487///predicted gene 10488///predicted gene 14525///predicted gene 14632///predicted gene 14819///predicted gene 1993///predicted pseudogene 2003///predicted gene 2012///predicted gene 2030///predicted gene 4297///predicted gene 4836///predicted gene 5169///predicted gene 5934///predicted gene 6121///predicted gene 7365///X-linked lymphocyte-regulated protein PM1-like///Sycp3 like X-linked Gm10058///Gm10096///Gm10147///Gm10230///Gm10486///Gm10487///Gm10488///Gm14525///Gm14632///Gm14819///Gm1993///Gm2003///Gm2012///Gm2030///Gm4297///Gm4836///Gm5169///Gm5934///Gm6121///Gm7365///LOC100862354///Slx100038977///100038997///100039030///100039065///100039120///100039240///100039324///100039377///100039467///100039550///100039585///100042109///100042144///100042175///100043216///100862354///22526///382277///546272///619991///664829///664844predicted gene 10058///predicted geneNM_009529 10096///predicted gene 10147///predicted gene 10230///predicted gene 10486///predicted gene 10487///predicted gene 10488///predicted gene 14525///predicted gene 14632///predicted gene 14819///predicted gene 1993///predicted pseudogene 2003///predicted gene 2012///predicted gene 2030///predicted gene 4297///predicted gene 4836///predicted gene 5169///predicted gene 5934///predicted gene 6121///predicted gene 7365///X-linked lymphocyte-regulated protein PM1-like///Sycp3 like X-linked 1700020D05Rik 75555 RIKEN cDNA 1700020D05 gene NM_023781 Cdc42ep3 260409 CDC42 effector protein (Rho GTPase binding)BB012489 3 Sh3bgr 50795 SH3-binding domain glutamic acid-rich proteinNM_015825 Hfe 15216 hemochromatosis AJ306425 Rasl2-9 19428 RAS-like, family 2, locus 9 NM_009028 Plcz1 114875 phospholipase C, zeta 1 NM_054066 Krt15 16665 keratin 15 NM_008469 Rnd2 11858 Rho family GTPase 2 NM_009708 Crygb///Crygc12965///12966crystallin, gamma B///crystallin, gammaNM_007775 C Dgat2 67800 diacylglycerol O-acyltransferase 2 AK002443 Dgat2 67800 diacylglycerol O-acyltransferase 2 AK002443 Page 153 of 205 Diabetes

4930547C10Rik 68274 RIKEN cDNA 4930547C10 gene NM_026652 Ttyh1 57776 tweety homolog 1 (Drosophila) NM_021324 Ttyh1 57776 tweety homolog 1 (Drosophila) NM_021324 Gyk 14933 glycerol kinase BF683028 Gyk 14933 glycerol kinase BF683028 Pmepa1 65112 prostate transmembrane protein, androgenAV370981 induced 1 Pmepa1 65112 prostate transmembrane protein, androgenAV370981 induced 1 Cacna1h 58226 calcium channel, voltage-dependent, T type,NM_021415 alpha 1H subunit Isl1 16392 ISL1 transcription factor, LIM/homeodomainBQ176915 Tnk1 83813 tyrosine kinase, non-receptor, 1 NM_031880 1700001K19Rik 66323 RIKEN cDNA 1700001K19 gene NM_025488 Mak 17152 male germ cell-associated kinase BG069426 Speer4a 75657 spermatogenesis associated glutamate NM_029376(E)-rich protein 4a Nme5 75533 NME/NM23 family member 5 NM_080637 Inha 16322 inhibin alpha NM_010564 Bbx 70508 bobby sox homolog (Drosophila) BF319769 Ly6g6c 68468 lymphocyte antigen 6 complex, locus G6CNM_023463 Zmynd10 114602 zinc finger, MYND domain containing 10NM_053253 Smad6 17130 SMAD family member 6 AF010133 Krt6a 16687 keratin 6A NM_008476 Fstl3 83554 follistatin-like 3 NM_031380 Rims2 116838 regulating synaptic membrane exocytosisNM_053271 2 Slc27a1 26457 solute carrier family 27 (fatty acid transporter),NM_011977 member 1 Nedd9 18003 neural precursor cell expressed, developmentallyNM_017464 down-regulated gene 9 Lipe///LOC100862213100862213///16890lipase, hormone sensitive///hormone-sensitiveNM_010719 lipase-like Igfals 16005 insulin-like growth factor binding protein,NM_008340 acid labile subunit Mbnl3 171170 muscleblind-like 3 (Drosophila) NM_134163 Scel 64929 sciellin NM_022886 Kcnu1 16532 potassium channel, subfamily U, memberNM_008432 1 Ube2d2b 73318 ubiquitin-conjugating enzyme E2D 2B NM_028502 Cib2 56506 calcium and integrin binding family memberNM_019686 2 Cd84 12523 CD84 antigen NM_013489 Abcg2 26357 ATP-binding cassette, sub-family G (WHITE),NM_011920 member 2 Prm3 19120 protamine 3 NM_013638 Fgf21///LOC100862558100862558///56636fibroblast growth factor 21///fibroblast NM_020013growth factor 21-like Hrasls 27281 HRAS-like suppressor NM_013751 Acot3 171281 acyl-CoA thioesterase 3 NM_134246 Hist1h4a///Hist1h4b///Hist1h4c///Hist1h4d///Hist1h4f///Hist1h4h///Hist1h4i///Hist1h4j///Hist1h4k///Hist1h4m///Hist1h4n///Hist2h4///Hist4h4///LOC100862646100041230///100862646///319155///319156///319157///319158///319159///319160///319161///320332///326619///326620///69386///97122histone cluster 1, H4a///histone clusterNM_013550 1, H4b///histone cluster 1, H4c///histone cluster 1, H4d///histone cluster 1, H4f///histone cluster 1, H4h///histone cluster 1, H4i///histone cluster 1, H4j///histone cluster 1, H4k///histone cluster 1, H4m///histone cluster 1, H4n///histone cluster 2, H4///histone cluster 4, H4///histone H4-like Hist1h4a///Hist1h4b///Hist1h4c///Hist1h4d///Hist1h4f///Hist1h4h///Hist1h4i///Hist1h4j///Hist1h4k///Hist1h4m///Hist1h4n///Hist2h4///Hist4h4///LOC100862646100041230///100862646///319155///319156///319157///319158///319159///319160///319161///320332///326619///326620///69386///97122histone cluster 1, H4a///histone clusterNM_013550 1, H4b///histone cluster 1, H4c///histone cluster 1, H4d///histone cluster 1, H4f///histone cluster 1, H4h///histone cluster 1, H4i///histone cluster 1, H4j///histone cluster 1, H4k///histone cluster 1, H4m///histone cluster 1, H4n///histone cluster 2, H4///histone cluster 4, H4///histone H4-like D1Pas1 110957 DNA segment, Chr 1, Pasteur Institute 1NM_033077 Srd5a2 94224 steroid 5 alpha-reductase 2 NM_053188 Kat2a 14534 K(lysine) acetyltransferase 2A NM_020004 Thrsp 21835 thyroid hormone responsive SPOT14 homologNM_009381 (Rattus) Acot1///Acot2171210///26897acyl-CoA thioesterase 1///acyl-CoA thioesteraseNM_134188 2 Insl3///Jak3 16336///16453insulin-like 3///Janus kinase 3 NM_013564 Sfrp5 54612 secreted frizzled-related sequence proteinNM_018780 5 Igfbp3 16009 insulin-like growth factor binding proteinAV175389 3 9930105H17Rik 100669 RIKEN cDNA 9930105H17 gene AW549928 6720475J19Rik 68157 RIKEN cDNA 6720475J19 gene AW549928 B3galt2 26878 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase,BB223909 polypeptide 2 Fos 14281 FBJ osteosarcoma oncogene AV026617 Paqr4 76498 progestin and adipoQ receptor family memberBB279185 IV Irs1 16367 insulin receptor substrate 1 BB345784 Col1a2 12843 collagen, type I, alpha 2 BF227507 Scg5 20394 secretogranin V AK019337 Gnpnat1 54342 glucosamine-phosphate N-acetyltransferaseAK008566 1 Gnpnat1 54342 glucosamine-phosphate N-acetyltransferaseAK008566 1 Kcnb1 16500 potassium voltage gated channel, Shab-relatedBB324482 subfamily, member 1 Kcnb1 16500 potassium voltage gated channel, Shab-relatedBB324482 subfamily, member 1 Cetn1 26369 centrin 1 AK005736 Diabetes Page 154 of 205

Cap2 67252 CAP, adenylate cyclase-associated protein,AV261931 2 (yeast) Ms4a1 12482 membrane-spanning 4-domains, subfamilyBB236617 A, member 1 Krt17 16667 keratin 17 AA798563 Id4 15904 inhibitor of DNA binding 4 BB121406 1500015O10Rik 78896 RIKEN cDNA 1500015O10 gene BB426248 2810405K02Rik 66469 RIKEN cDNA 2810405K02 gene AI836168 Gjb2 14619 gap junction protein, beta 2 AV239646 Ptprk 19272 protein tyrosine phosphatase, receptor AI893646type, K Mest 17294 mesoderm specific transcript AW555393 Pde7a 18583 phosphodiesterase 7A BG070255 Pde7a 18583 phosphodiesterase 7A BG070255 Tacstd2 56753 tumor-associated calcium signal transducerAV241768 2 Rpl39l 68172 ribosomal protein L39-like AK005645 Pvrl3 58998 poliovirus receptor-related 3 BG070704 Tfap2b 21419 transcription factor AP-2 beta AV334599 Fmr1 14265 fragile X mental retardation syndrome 1BG172150 Akr1cl 70861 aldo-keto reductase family 1, member C-likeBB667221 Mapkbp1 26390 mitogen-activated protein kinase bindingBQ174980 protein 1 Timp4 110595 tissue inhibitor of metalloproteinase 4 BI788452 Fbln2 14115 fibulin 2 BF228318 Meig1 104362 meiosis expressed gene 1 BF021951 Ndrg1 17988 N-myc downstream regulated gene 1 AI987929 Adrb1 11554 adrenergic receptor, beta 1 AK018378 Gsta3 14859 glutathione S-transferase, alpha 3 AI172943 Gsta3 14859 glutathione S-transferase, alpha 3 AI172943 D2Ertd750e 51944 DNA segment, Chr 2, ERATO Doi 750, expressedAK012148 Ms4a4b 60361 membrane-spanning 4-domains, subfamilyBB199001 A, member 4B 1700129C05Rik 67932 RIKEN cDNA 1700129C05 gene AK006084 Slc46a2 30936 solute carrier family 46, member 2 BB329435 Mmd 67468 monocyte to macrophage differentiation-associatedBC021914 Mmd 67468 monocyte to macrophage differentiation-associatedBC021914 Nfix 18032 nuclear factor I/X BB315728 2310042E22Rik 66561 RIKEN cDNA 2310042E22 gene AV010984 Decr2 26378 2-4-dienoyl-Coenzyme A reductase 2, peroxisomalBE952632 Klhl10 66720 kelch-like 10 (Drosophila) AK006288 Aldoart2 79459 aldolase 1 A retrogene 2 AK006425 Sox5 20678 SRY-box containing gene 5 AI528773 Nnat 18111 neuronatin AV218841 Gykl1 14625 glycerol kinase-like 1 AI449806 Aass 30956 aminoadipate-semialdehyde synthase BF687395 4921510H08Rik 66716 RIKEN cDNA 4921510H08 gene AK006212 4930511I11Rik 67645 RIKEN cDNA 4930511I11 gene AV044983 Klk7 23993 kallikrein related-peptidase 7 (chymotryptic,BB283507 stratum corneum) Dnajb3 15504 DnaJ (Hsp40) homolog, subfamily B, memberAK005688 3 Ggcx 56316 gamma-glutamyl carboxylase AV370848 Akr1b7 11997 aldo-keto reductase family 1, member B7AV021656 Hsph1 15505 heat shock 105kDa/110kDa protein 1 BI499717 Fhl4 14202 four and a half LIM domains 4 AV283456 Ankrd36 76389 ankyrin repeat domain 36 AK005925 Rock2 19878 Rho-associated coiled-coil containing proteinBB761686 kinase 2 Nek6 59126 NIMA (never in mitosis gene a)-related expressedBB528391 kinase 6 Atp8a1 11980 ATPase, aminophospholipid transporterBB303874 (APLT), class I, type 8A, member 1 Itm2a 16431 integral membrane protein 2A BI966443 Rasd1 19416 RAS, dexamethasone-induced 1 BB217136 Dst 13518 dystonin BB150886 Nqo1 18104 NAD(P)H dehydrogenase, quinone 1 AV158882 Gsdma 57911 gasdermin A AI506986 Bmp2 12156 bone morphogenetic protein 2 AV239587 Wdr31 71354 WD repeat domain 31 AK017259 Col1a1 12842 collagen, type I, alpha 1 U08020 Page 155 of 205 Diabetes

Krt8 16691 keratin 8 M21836 Cela1 109901 chymotrypsin-like elastase family, memberBC011218 1 Abcb8 74610 ATP-binding cassette, sub-family B (MDR/TAP),BC015301 member 8 Ak3 56248 adenylate kinase 3 BC019174 Ak3 56248 adenylate kinase 3 BC019174 Pls3 102866 plastin 3 (T-isoform) BC005459 Pdk1 228026 pyruvate dehydrogenase kinase, isoenzymeBC027196 1 Igfbp4 16010 insulin-like growth factor binding proteinBC019836 4 Cd44 12505 CD44 antigen M27130 Prkcdbp 109042 protein kinase C, delta binding protein BC009660 Usp20 74270 ubiquitin specific peptidase 20 AK006800 Dap 223453 death-associated protein BC024876 Gm13502///Idi1207933///319554predicted gene 13502///isopentenyl-diphosphateBC004801 delta isomerase Fasn 14104 fatty acid synthase AF127033 Prkag2 108099 protein kinase, AMP-activated, gamma BB7567942 non-catalytic subunit Shisa2 219134 shisa homolog 2 (Xenopus laevis) BC024118 Shisa2 219134 shisa homolog 2 (Xenopus laevis) BC024118 Hmgcs2 15360 3-hydroxy-3-methylglutaryl-Coenzyme ABC014714 synthase 2 Ptgds 19215 prostaglandin D2 synthase (brain) AB006361 Ptgds 19215 prostaglandin D2 synthase (brain) AB006361 Serpina3k 20714 serine (or cysteine) peptidase inhibitor, BF234005clade A, member 3K Gm5617 434402 predicted gene 5617 BC011344 Atp1b1 11931 ATPase, Na+/K+ transporting, beta 1 polypeptideBC027319 Pvr 52118 poliovirus receptor BB049138 Pvr 52118 poliovirus receptor BB049138 Mlf2 30853 myeloid leukemia factor 2 BC003975 1600029D21Rik 76509 RIKEN cDNA 1600029D21 gene BC022950 Krt14 16664 keratin 14 BC011074 Ropn1l 252967 ropporin 1-like AF305427 Ugt3a2 223337 UDP glycosyltransferases 3 family, polypeptideBC022134 A2 Aqp9 64008 aquaporin 9 BC024105 Bub1 12235 budding uninhibited by benzimidazoles AF0028231 homolog (S. cerevisiae) Tcta 102791 T cell leukemia translocation altered geneBC019397 Gdpd1 66569 glycerophosphodiester phosphodiesteraseAK016023 domain containing 1 Gdpd1 66569 glycerophosphodiester phosphodiesteraseAK016023 domain containing 1 Pcgf6 71041 polycomb group ring finger 6 BC016195 Sdcbp2 228765 syndecan binding protein (syntenin) 2 BC005556 Glo1 109801 glyoxalase 1 BC024663 Glo1 109801 glyoxalase 1 BC024663 Eya2 14049 eyes absent 2 homolog (Drosophila) BC003755 Ptrf 19285 polymerase I and transcript release factorBC012674 Stap2 106766 signal transducing adaptor family memberBC026642 2 Fabp4 11770 fatty acid binding protein 4, adipocyte BC002148 Ehd2 259300 EH-domain containing 2 BC027084 Trim29 72169 tripartite motif-containing 29 BC027353 Ccdc80 67896 coiled-coil domain containing 80 BG074158 Creb3l4 78284 cAMP responsive element binding proteinBC022605 3-like 4 Susd4 96935 sushi domain containing 4 BC021842 9030617O03Rik 217830 RIKEN cDNA 9030617O03 gene BC021385 Dyrk3 226419 dual-specificity tyrosine-(Y)-phosphorylationBC006704 regulated kinase 3 Lmf1 76483 lipase maturation factor 1 BC020104 Ces1f 234564 carboxylesterase 1F BC013479 Fga 14161 fibrinogen alpha chain BC005467 Ubap2 68926 ubiquitin-associated protein 2 BC007179 Depdc7 211896 DEP domain containing 7 BC013499 Igj 16069 immunoglobulin joining chain BC006026 Elovl4 83603 elongation of very long chain fatty acidsBB829575 (FEN1/Elo2, SUR4/Elo3, yeast)-like 4 Slc24a3 94249 solute carrier family 24 (sodium/potassium/calciumBC017615 exchanger), member 3 Slc25a19 67283 solute carrier family 25 (mitochondrial thiamineBC018167 pyrophosphate carrier), member 19 Slc25a19 67283 solute carrier family 25 (mitochondrial thiamineBC018167 pyrophosphate carrier), member 19 Diabetes Page 156 of 205

Tspan17 74257 tetraspanin 17 BC010346 Slc6a13 14412 solute carrier family 6 (neurotransmitterBC023117 transporter, GABA), member 13 Lpgat1 226856 lysophosphatidylglycerol acyltransferaseBE987427 1 Lpgat1 226856 lysophosphatidylglycerol acyltransferaseBE987427 1 Wfdc2 67701 WAP four-disulfide core domain 2 AF334269 Cyp4a12a 277753 cytochrome P450, family 4, subfamily a,BC025936 polypeptide 12a Sin3b 20467 transcriptional regulator, SIN3B (yeast) AF038848 Tmem45b 235135 transmembrane protein 45b BC026654 Tmem51 214359 transmembrane protein 51 BC003277 Asrgl1 66514 asparaginase like 1 AU040643 Asrgl1 66514 asparaginase like 1 AU040643 Uck1 22245 uridine-cytidine kinase 1 BC025146 Cldn23 71908 claudin 23 BC019534 Msrb2 76467 methionine sulfoxide reductase B2 BC021619 Gprc5c 70355 G protein-coupled receptor, family C, groupBC008228 5, member C Rapgef3 223864 Rap guanine nucleotide exchange factorBC020532 (GEF) 3 Rapgef3 223864 Rap guanine nucleotide exchange factorBC020532 (GEF) 3 Tmem184a 231832 transmembrane protein 184a BC019731 Cst8 13012 cystatin 8 (cystatin-related epididymal spermatogenic)AF090691 Angptl3 30924 angiopoietin-like 3 BC019491 Cklf 75458 chemokine-like factor AY047360 Oit1 18300 oncoprotein induced transcript 1 BC024542 Aurka 20878 aurora kinase A U80932 Gm10921///Gm10922///Gm14345///Gm14346///Gm14347///Gm14351///Gm14374///Gm2777///Gm2784///Gm2799///Gm2825///Gm2863///Gm2913///Gm2964///Gm3701///Gm3706///Gm3750///Gm3763///Gm5925///Gmcl1l///LOC100861966///LOC100861971///LOC100862067///LOC100862274///LOC100862323///LOC100862329///LOC100862341///LOC100862369///LOC100862389100040448///100040458///100040482///100040533///100040606///100040698///100040781///100042159///100042168///100042254///100042275///100861966///100861971///100862067///100862274///100862323///100862329///100862341///100862369///100862389///434725///546185///627264///630022///668958///668960///668963///668964///71847predicted gene 10921///predicted geneAB055854 10922///predicted gene 14345///predicted gene 14346///predicted gene 14347///predicted gene 14351///predicted gene 14374///predicted gene 2777///predicted gene 2784///predicted gene 2799///predicted gene 2825///predicted gene 2863///predicted gene 2913///predicted gene 2964///predicted gene 3701///predicted gene 3706///predicted gene 3750///predicted gene 3763///germ cell-less homolog 1 family pseudogene///germ cell-less homolog 1 (Drosophila)-like///putative germ cell-less protein-like 1-like///putative germ cell-less protein-like 1-like///putative germ cell-less protein-like 1-like///putative germ cell-less protein-like 1-like///putative germ cell-less protein-like 1-like///putative germ cell-less protein-like 1-like///putative germ cell-less protein-like 1-like///putative germ cell-less protein-like 1-like///putative germ cell-less protein-like 1-like Pycr1 209027 pyrroline-5-carboxylate reductase 1 BC006727 Cabyr 71132 calcium-binding tyrosine-(Y)-phosphorylationAF359383 regulated (fibrousheathin 2) Cyp2c44 226143 cytochrome P450, family 2, subfamily c,BC025819 polypeptide 44 Samd4 74480 sterile alpha motif domain containing 4BC011507 Fgl1 234199 fibrinogen-like protein 1 BC021946 Gm4354 100043316 predicted gene 4354 BM225255 Gm4354 100043316 predicted gene 4354 BM225255 Pgap2 233575 post-GPI attachment to proteins 2 BG063931 Pgap2 233575 post-GPI attachment to proteins 2 BG063931 Pgap2 233575 post-GPI attachment to proteins 2 BG063931 2010003K11Rik 69861 RIKEN cDNA 2010003K11 gene BC021951 Cst12 69362 cystatin 12 AF440737 Ighg 380794 Immunoglobulin heavy chain (gamma polypeptide)BC025447 Cdkn1a 12575 cyclin-dependent kinase inhibitor 1A (P21)AK007630 Tspan8 216350 tetraspanin 8 BC025461 Pdia5 72599 protein disulfide isomerase associated 5BC009151 Fam176a 232146 family with sequence similarity 176, memberBC027150 A Actl7b 11471 actin-like 7b AF113520 Fam134b 66270 family with sequence similarity 134, memberBC019494 B Ccdc136 232664 coiled-coil domain containing 136 BC006583 Runx2 12393 runt related transcription factor 2 D14636 Retsat 67442 retinol saturase (all trans retinol 13,14 reductase)BB775176 Retsat 67442 retinol saturase (all trans retinol 13,14 reductase)BB775176 Slc15a2 57738 solute carrier family 15 (H+/peptide transporter),BC018335 member 2 P2ry14 140795 purinergic receptor P2Y, G-protein coupled,AF177211 14 Thrsp 21835 thyroid hormone responsive SPOT14 homologBC009165 (Rattus) Jmjd8 72106 jumonji domain containing 8 BC010800 Hip1 215114 huntingtin interacting protein 1 BB320674 Rsph9 75564 radial spoke head 9 homolog (Chlamydomonas)BC019423 Cald1 109624 caldesmon 1 BI248947 Reep3 28193 receptor accessory protein 3 AK005026 Pbp2 76400 phosphatidylethanolamine binding proteinAF307146 2 Rnf186 66825 ring finger protein 186 BC011492 1700001O22Rik 73598 RIKEN cDNA 1700001O22 gene BC023044 Pitx2 18741 paired-like homeodomain transcription U80011factor 2 Adam5 11499 a disintegrin and metallopeptidase domainU22059 5 Page 157 of 205 Diabetes

Enah 13800 enabled homolog (Drosophila) BQ044016 Enah 13800 enabled homolog (Drosophila) BQ044016 Lama4 16775 laminin, alpha 4 BB053010 Bcl2l14 66813 BCL2-like 14 (apoptosis facilitator) BC025541 Gys2 232493 glycogen synthase 2 BC021322 Cpne2 234577 copine II BC023348 Gstm4 14865 glutathione S-transferase, mu 4 AF464943 Olah 99035 oleoyl-ACP hydrolase BC025001 Hipk2 15258 homeodomain interacting protein kinaseAF170301 2 Ndel1 83431 nuclear distribution gene E-like homologBC021434 1 (A. nidulans) Pqlc3 217430 PQ loop repeat containing BC025220 Lrrc46 69297 leucine rich repeat containing 46 BC022723 Lyzl4 69032 lysozyme-like 4 BC024932 Iglc1///Iglv1 110785///16142immunoglobulin lambda constant 1///immunoglobulinM94350 lambda variable 1 Dnahc8 13417 dynein, axonemal, heavy chain 8 AF356522 Chrdl1 83453 chordin-like 1 AF321853 Sox9 20682 SRY-box containing gene 9 BC024958 Baiap2l1 66898 BAI1-associated protein 2-like 1 BC015459 Anxa13 69787 annexin A13 BC013521 Tnnt2 21956 troponin T2, cardiac L47552 Ppp1r42 69312 protein phosphatase 1, regulatory subunitBC022722 42 Odf4 252868 outer dense fiber of sperm tails 4 AB074438 2700078E11Rik 78832 RIKEN cDNA 2700078E11 gene BB137173 Usp3 235441 ubiquitin specific peptidase 3 BM936366 Tpm2 22004 tropomyosin 2, beta BC024358 Mboat2 67216 membrane bound O-acyltransferase domainBC025020 containing 2 4921517L17Rik 70873 RIKEN cDNA 4921517L17 gene BC027204 Isoc1 66307 isochorismatase domain containing 1 AK010892 Isoc1 66307 isochorismatase domain containing 1 AK010892 Isoc1 66307 isochorismatase domain containing 1 AK010892 Dnajc18 76594 DnaJ (Hsp40) homolog, subfamily C, memberAI606403 18 Zfp106 20402 zinc finger protein 106 BC025424 Arntl 11865 aryl hydrocarbon receptor nuclear translocator-likeBC011080 Rab3il1 74760 RAB3A interacting protein (rabin3)-like 1BC020147 H2-Q10 15007 histocompatibility 2, Q region locus 10 BC011215 Il1rl1 17082 interleukin 1 receptor-like 1 D13695 Golt1a 68338 golgi transport 1 homolog A (S. cerevisiae)BC024448 Phkg1 18682 phosphorylase kinase gamma 1 J03293 Klk1b22///Klk1b913646///13648kallikrein 1-related peptidase b22///kallikreinM17962 1-related peptidase b9 Epb4.1l5 226352 erythrocyte protein band 4.1-like 5 BC011476 Ank3 11735 ankyrin 3, epithelial BC021657 Synj2 20975 synaptojanin 2 AF041862 Theg 21830 testicular haploid expressed gene AB033128 Acot5 217698 acyl-CoA thioesterase 5 BC016076 Cst11 78240 cystatin 11 AF454373 Alb 11657 albumin BC024643 Kif1b 16561 kinesin family member 1B BE199508 Psmc3ip 19183 proteasome (prosome, macropain) 26S AB000121subunit, ATPase 3, interacting protein Tsc22d3 14605 TSC22 domain family, member 3 AF201289 Mtl5 17771 metallothionein-like 5, testis-specific (tesmin)BC024377 Foxj1 15223 forkhead box J1 L13204 Ear11 93726 eosinophil-associated, ribonuclease A family,BC020070 member 11 Catsper2 212670 cation channel, sperm associated 2 AF411816 Gpr98 110789 G protein-coupled receptor 98 AF435926 Stk31 77485 serine threonine kinase 31 AF285580 Tfr2 50765 transferrin receptor 2 BC013654 Ighm 16019 Immunoglobulin heavy constant mu BC018365 Adam26a 13525 a disintegrin and metallopeptidase domainAF167404 26A (testase 3) Cited4 56222 Cbp/p300-interacting transactivator, withBC025116 Glu/Asp-rich carboxy-terminal domain, 4 Chrna2 110902 cholinergic receptor, nicotinic, alpha polypeptideBC011490 2 (neuronal) Diabetes Page 158 of 205

Arl4a 11861 ADP-ribosylation factor-like 4A BC003725 Slc1a1 20510 solute carrier family 1 (neuronal/epithelialU75214 high affinity glutamate transporter, system Xag), member 1 Lats2 50523 large tumor suppressor 2 AY015061 Fam84a 105005 family with sequence similarity 84, memberBC002154 A BC003855 BC003855 BC003855 Col4a5 12830 collagen, type IV, alpha 5 BM250666 Gcnt2 14538 glucosaminyl (N-acetyl) transferase 2, I-branchingAB037596 enzyme Acsm3 20216 acyl-CoA synthetase medium-chain familyAB022340 member 3 Qk 19317 quaking AW060288 Dusp3 72349 dual specificity phosphatase 3 (vaccinia BC016269virus phosphatase VH1-related) Dsg2 13511 desmoglein 2 AB072269 Adap2 216991 ArfGAP with dual PH domains 2 BC027165 Adap2 216991 ArfGAP with dual PH domains 2 BC027165 Lepr 16847 leptin receptor U42467 Cyp2b10 13088 cytochrome P450, family 2, subfamily b,AF128849 polypeptide 10 Rbpms 19663 RNA binding protein gene with multipleAF148511 splicing Akr1b10 67861 aldo-keto reductase family 1, member B10BB493454 (aldose reductase) Rgs3 50780 regulator of G-protein signaling 3 AF350047 Ero1lb 67475 ERO1-like beta (S. cerevisiae) AF489856 1500002F19Rik 76683 RIKEN cDNA 1500002F19 gene BC002195 D730039F16Rik 77996 RIKEN cDNA D730039F16 gene BC021771 Stxbp6 217517 syntaxin binding protein 6 (amisyn) BC024598 Igh-VJ558///Igha16061///238447immunoglobulin heavy chain (J558 family)///immunoglobulinBC019425 heavy constant alpha Olfm1 56177 olfactomedin 1 D78264 Anxa8 11752 annexin A8 BC013271 Usp12 22217 ubiquitin specific peptidase 12 AF441835 Fabp4 11770 fatty acid binding protein 4, adipocyte BC018558 Sorbs1 20411 sorbin and SH3 domain containing 1 AF078667 Cxcr6 80901 chemokine (C-X-C motif) receptor 6 AF301018 Gpam 14732 glycerol-3-phosphate acyltransferase, mitochondrialBC019201 Nek6 59126 NIMA (never in mitosis gene a)-related expressedBC019524 kinase 6 Cabp4 73660 calcium binding protein 4 AY039218 Grtp1 66790 GH regulated TBC protein 1 AF329833 Fhit 14198 fragile histidine triad gene AF055573 Fbn1 14118 fibrillin 1 AF007248 Itsn1 16443 intersectin 1 (SH3 domain protein 1A) AF132478 BC022961 Clec4n 56620 C-type lectin domain family 4, member AF240358n Ros1 19886 Ros1 proto-oncogene U15443 Hipk2 15258 homeodomain interacting protein kinaseAF208292 2 Hsph1 15505 heat shock 105kDa/110kDa protein 1 D67017 Epb4.1l3 13823 erythrocyte protein band 4.1-like 3 AF177146 Odf2 18286 outer dense fiber of sperm tails 2 AF000968 Capn3 12335 calpain 3 AF127766 Prkcq 18761 protein kinase C, theta AB062122 BC007159 BC007159 Slc7a4 224022 solute carrier family 7 (cationic amino acidBC016100 transporter, y+ system), member 4 Slc7a4 224022 solute carrier family 7 (cationic amino acidBC016100 transporter, y+ system), member 4 Cmklr1 14747 chemokine-like receptor 1 U79525 Rhbdl1 214951 rhomboid, veinlet-like 1 (Drosophila) BC021549 Cyp2j13 230459 cytochrome P450, family 2, subfamily j, BC016446polypeptide 13 Hnrnpab 15384 heterogeneous nuclear ribonucleoproteinL36663 A/B Trdn 76757 triadin AF223415 Trdn 76757 triadin AF223417 Trdn 76757 triadin AF223417 Trdn 76757 triadin AF223417 Cldn10 58187 claudin 10 BC021770 Page 159 of 205 Diabetes

Cd209a 170786 CD209a antigen AF374470 Ighg 380794 Immunoglobulin heavy chain (gamma polypeptide)S69212 Cd209d 170779 CD209d antigen AF440280 Parp3 235587 poly (ADP-ribose) polymerase family, memberBC014870 3 Ddc 13195 dopa decarboxylase AF071068 Glcci1 170772 glucocorticoid induced transcript 1 AA152997 Cmtm2a 73381 CKLF-like MARVEL transmembrane domainAF401531 containing 2A Rbp4 19662 retinol binding protein 4, plasma U63146 Sp2 78912 Sp2 transcription factor BC021759 Cth 107869 cystathionase (cystathionine gamma-lyase)BC019483 Cpz 242939 carboxypeptidase Z AF356844 Cwh43 231293 cell wall biogenesis 43 C-terminal homologBC016523 (S. cerevisiae) Lrp4 228357 low density lipoprotein receptor-relatedAF247637 protein 4 Irx2 16372 Iroquois related homeobox 2 (Drosophila)AF295369 Mbd3l1 73503 methyl-CpG binding domain protein 3-likeAY038023 1 Asb9 69299 ankyrin repeat and SOCS box-containingAF398970 9 Stard6 170461 StAR-related lipid transfer (START) domainAF480303 containing 6 Cldn3 12739 claudin 3 AF087821 Slc1a3 20512 solute carrier family 1 (glial high affinityBB357585 glutamate transporter), member 3 Stat6 20852 signal transducer and activator of transcriptionAI746342 6 Far1 67420 fatty acyl CoA reductase 1 BG094874 Far1 67420 fatty acyl CoA reductase 1 BG094874 Far1 67420 fatty acyl CoA reductase 1 BG094874 Reep5 13476 receptor accessory protein 5 BI249075 Actr1b 226977 ARP1 actin-related protein 1B, centractinBG801851 beta Tmem43 74122 transmembrane protein 43 AI747289 Tmem135 72759 transmembrane protein 135 AV225967 Pias2 17344 protein inhibitor of activated STAT 2 BG065828 Nr1d1 217166 nuclear receptor subfamily 1, group D, memberW13191 1 Sh3glb2 227700 SH3-domain GRB2-like endophilin B2 AI481067 Gpt 76282 glutamic pyruvic transaminase, soluble AK008086 Rbm28 68272 RNA binding motif protein 28 BM228459 Klhl5 71778 kelch-like 5 (Drosophila) BM120233 Gc 14473 group specific component AI195150 Mesp1 17292 mesoderm posterior 1 AK006394 Olfm1 56177 olfactomedin 1 BE952082 Frk 14302 fyn-related kinase BB787292 Frk 14302 fyn-related kinase BB787292 Sgms1 208449 sphingomyelin synthase 1 BE629162 Rnasel 24014 ribonuclease L (2', 5'-oligoisoadenylate BF714880synthetase-dependent) Crtac1 72832 cartilage acidic protein 1 BB426194 Gm7120 633640 predicted gene 7120 BG068672 Ndrg4 234593 N-myc downstream regulated gene 4 AV006122 Ppp2r2b 72930 protein phosphatase 2 (formerly 2A), regulatoryBB560759 subunit B (PR 52), beta isoform Kctd14 233529 potassium channel tetramerisation domainAW553424 containing 14 Gm8096///Phgdh236539///6664223-phosphoglycerate dehydrogenase pseudogene///3-phosphoglycerateL21027 dehydrogenase Phgdh 236539 3-phosphoglycerate dehydrogenase L21027 Slc45a3 212980 solute carrier family 45, member 3 BC024519 Flna 192176 filamin, alpha BM233746 Obfc2a 109019 oligonucleotide/oligosaccharide-bindingAV313559 fold containing 2A Mki67 17345 antigen identified by monoclonal antibodyX82786 Ki 67 Ddx26b 236790 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptideBB460424 26B Nov 18133 nephroblastoma overexpressed gene X96585 Nov 18133 nephroblastoma overexpressed gene X96585 Ncam1 17967 neural cell adhesion molecule 1 BB698413 Ncam1 17967 neural cell adhesion molecule 1 BB698413 Pm20d1 212933 peptidase M20 domain containing 1 BC025830 Nudt10///Nudt11102954///58242nudix (nucleoside diphosphate linked moietyBQ174833 X)-type motif 10///nudix (nucleoside diphosphate linked moiety X)-type motif 11 Utrn 22288 utrophin AI788797 Dnajc10 66861 DnaJ (Hsp40) homolog, subfamily C, memberAV114239 10 Diabetes Page 160 of 205

Dnajc10 66861 DnaJ (Hsp40) homolog, subfamily C, memberAV114239 10 Dsc2 13506 desmocollin 2 BC004663 Marveld2 218518 MARVEL (membrane-associating) domainBG076407 containing 2 Celf4 108013 CUGBP, Elav-like family member 4 AV327653 Nhsl1 215819 NHS-like 1 BC013565 Muc15 269328 mucin 15 BC020027 Fa2h 338521 fatty acid 2-hydroxylase BM118638 Pcsk6 18553 proprotein convertase subtilisin/kexin typeBI157485 6 Zfand3 21769 zinc finger, AN1-type domain 3 BG976649 Hnf4a 15378 hepatic nuclear factor 4, alpha BF580781 Rnf43 207742 ring finger protein 43 BC004781 Tsnaxip1 72236 translin-associated factor X (Tsnax) interactingAK006041 protein 1 Myh4 17884 myosin, heavy polypeptide 4, skeletal muscleAJ278733 Htra3 78558 HtrA serine peptidase 3 AK008764 Ace 11421 angiotensin I converting enzyme (peptidyl-dipeptidaseAW208573 A) 1 Eif4g1 208643 eukaryotic translation initiation factor 4,BF227830 gamma 1 Mdfic 16543 MyoD family inhibitor domain containingU13371 Grhl2 252973 grainyhead-like 2 (Drosophila) BC004783 Smo 319757 smoothened homolog (Drosophila) AW555326 5330417C22Rik 229722 RIKEN cDNA 5330417C22 gene AK017241 Ap2b1 71770 adaptor-related protein complex 2, betaAV271093 1 subunit Cdcp1 109332 CUB domain containing protein 1 BM205949 Metrn 70083 meteorin, glial cell differentiation regulatorBE947704 Slfn4 20558 schlafen 4 AF099975 Copg2as2 100044236 coatomer protein complex, subunit gammaBE653037 2, antisense 2 Copg2as2 100044236 coatomer protein complex, subunit gammaBE653037 2, antisense 2 Hspa1b 15511 heat shock protein 1B M12573 Lrp2 14725 low density lipoprotein receptor-relatedC80829 protein 2 Cenpf 108000 centromere protein F BE848253 Armcx4 100503043 armadillo repeat containing, X-linked 4 BE865094 Col14a1 12818 collagen, type XIV, alpha 1 AJ131395 Psma8 73677 proteasome (prosome, macropain) subunit,BF318721 alpha type, 8 Tmc4 353499 transmembrane channel-like gene familyBB667469 4 Npr2 230103 natriuretic peptide receptor 2 AW558468 Wnk4 69847 WNK lysine deficient protein kinase 4 BG074348 Mustn1 66175 musculoskeletal, embryonic nuclear proteinAJ277212 1 Svs5 20944 seminal vesicle secretory protein 5 AK007282 Slc6a20a 102680 solute carrier family 6 (neurotransmitterAJ428067 transporter), member 20A Svs4 20941 seminal vesicle secretory protein 4 AK020349 Epn2 13855 epsin 2 AF057286 Epn2 13855 epsin 2 AF057286 Palld 72333 palladin, cytoskeletal associated proteinAF205078 Hmgcr 15357 3-hydroxy-3-methylglutaryl-Coenzyme ABB123978 reductase Robo1 19876 roundabout homolog 1 (Drosophila) BG065230 Ift122 81896 intraflagellar transport 122 AV319292 Ddx4 13206 DEAD (Asp-Glu-Ala-Asp) box polypeptideAK014844 4 D3Bwg0562e 229791 DNA segment, Chr 3, Brigham & Women'sBB238462 Genetics 0562 expressed Dmrtb1 56296 DMRT-like family B with proline-rich C-terminal,BB726544 1 Wwc1 211652 WW, C2 and coiled-coil domain containingBQ176786 1 Six1 20471 sine oculis-related homeobox 1 homologBB137929 (Drosophila) Ttpa 50500 tocopherol (alpha) transfer protein AU019171 Sycp1 20957 synaptonemal complex protein 1 AV275615 Piga 18700 phosphatidylinositol glycan anchor biosynthesis,AV340508 class A Ryr1 20190 ryanodine receptor 1, skeletal muscle X83932 Copg2as2 100044236 coatomer protein complex, subunit gammaBB316578 2, antisense 2 Cxadr 13052 coxsackie virus and adenovirus receptorAK004908 Tmem120b 330189 transmembrane protein 120B BC022593 Ighm 16019 immunoglobulin heavy constant mu AI326478 Slc30a2 230810 solute carrier family 30 (zinc transporter),AW542735 member 2 Gm10439///Gm15080///Gm15085///Gm15093///Gm15107///Gm15114///Gm15128///Luzp4///Ott100034729///100039890///100039934///18422///382243///434863///434864///434865///666184predicted gene 10439///predicted geneX96606 15080///predicted gene 15085///predicted gene 15093///predicted gene 15107///predicted gene 15114///predicted gene 15128///leucine zipper protein 4///ovary testis transcribed Page 161 of 205 Diabetes

Ighm 16019 immunoglobulin heavy constant mu BB226392 Krt79 223917 keratin 79 BC019155 Calca 12310 calcitonin/calcitonin-related polypeptide,X97991 alpha Cda 72269 cytidine deaminase AK008793 Muc3 666339 mucin 3, intestinal AF027131 Arhgef16 230972 Rho guanine nucleotide exchange factorBB235768 (GEF) 16 Eno1///Gm550613806///433182enolase 1, alpha non-neuron///predictedBC004017 gene 5506 Tcp10a///Tcp10b///Tcp10c100041352///21461///21462t-complex protein 10a///t-complex proteinAV257292 10b///t-complex protein 10c Mcart1 230125 mitochondrial carrier triple repeat 1 BC026435 Ryr3 20192 ryanodine receptor 3 AV238793 AI848100 226551 expressed sequence AI848100 BB148987 Triobp 110253 TRIO and F-actin binding protein BC003984 Igk-V28///Igkc///Igkj1///Igkv4-53///Igkv6-23///Igkv8-30110759///16071///16114///384419///546213///637227immunoglobulin kappa chain variable 28BI107286 (V28)///immunoglobulin kappa constant///immunoglobulin kappa joining 1///immunoglobulin kappa variable 4-53///immunoglobulin kappa variable 6-23///immunoglobulin kappa chain variable 8-30 Tmprss13 214531 transmembrane protease, serine 13 BF138523 Car8 12319 carbonic anhydrase 8 X61397 Pof1b 69693 premature ovarian failure 1B AF408412 Trim17 56631 tripartite motif-containing 17 AI385992 Eppk1 223650 epiplakin 1 BC026387 Slc26a3 13487 solute carrier family 26, member 3 BC022639 Atp9a 11981 ATPase, class II, type 9A AF011336 Defb9 246079 defensin beta 9 BM936051 Muc5b 74180 mucin 5, subtype B, tracheobronchial AF369933 Igk-V28///Igkc///Igkj1///Igkv4-53///Igkv6-23///Igkv8-30110759///16071///16114///384419///546213///637227immunoglobulin kappa chain variable 28BC013496 (V28)///immunoglobulin kappa constant///immunoglobulin kappa joining 1///immunoglobulin kappa variable 4-53///immunoglobulin kappa variable 6-23///immunoglobulin kappa chain variable 8-30 Egr2 13654 early growth response 2 X06746 Egr2 13654 early growth response 2 X06746 Nt5c1b 70881 5'-nucleotidase, cytosolic IB AF356186 Acta1 11459 actin, alpha 1, skeletal muscle M12233 Lcn2 16819 lipocalin 2 X14607 Defb15 246082 defensin beta 15 AJ437648 Defb10 246085 defensin beta 10 AJ437645 Defb35 246084 defensin beta 35 AJ437650 Defb13 246083 defensin beta 13 AJ437649 Adam1a///Mapkapk517165///280668a disintegrin and metallopeptidase domainU22056 1a///MAP kinase-activated protein kinase 5 BF580235 BC021831 Hbb-b2 15130 hemoglobin, beta adult minor chain AF071431 0610010O12Rik 66060 RIKEN cDNA 0610010O12 gene AK002512 Pmvk 68603 phosphomevalonate kinase BI713896 Cst6 73720 cystatin E/M AK003744 Srpx2 68792 sushi-repeat-containing protein, X-linkedBC028307 2 Vma21 67048 VMA21 vacuolar H+-ATPase homolog (S.BB410125 cerevisiae) Acyp2 75572 acylphosphatase 2, muscle type BI730288 Dpyd 99586 dihydropyrimidine dehydrogenase BC028831 Dpyd 99586 dihydropyrimidine dehydrogenase BC028831 9530008L14Rik 109254 RIKEN cDNA 9530008L14 gene AI256077 Rdh9 103142 retinol dehydrogenase 9 BE979765 Cmtm8 70031 CKLF-like MARVEL transmembrane domainBG063249 containing 8 Rasl10a 75668 RAS-like, family 10, member A AK008807 Amhr2 110542 anti-Mullerian hormone type 2 receptorAF503863 Tshr 22095 thyroid stimulating hormone receptor BB223263 Snrnp25 78372 small nuclear ribonucleoprotein 25 (U11/U12)BC028766 Mosc1 66112 MOCO sulphurase C-terminal domain containingAA958845 1 Hist1h4a///Hist1h4b///Hist1h4c///Hist1h4d///Hist1h4f///Hist1h4h///Hist1h4i///Hist1h4j///Hist1h4k///Hist1h4m///Hist1h4n///Hist2h4///Hist4h4///LOC100862646100041230///100862646///319155///319156///319157///319158///319159///319160///319161///320332///326619///326620///69386///97122histone cluster 1, H4a///histone clusterBC028550 1, H4b///histone cluster 1, H4c///histone cluster 1, H4d///histone cluster 1, H4f///histone cluster 1, H4h///histone cluster 1, H4i///histone cluster 1, H4j///histone cluster 1, H4k///histone cluster 1, H4m///histone cluster 1, H4n///histone cluster 2, H4///histone cluster 4, H4///histone H4-like Mccc2 78038 methylcrotonoyl-Coenzyme A carboxylaseBI155184 2 (beta) Gm15498 100134986 predicted gene 15498 BC028660 Ahnak 66395 AHNAK nucleoprotein (desmoyokin) BC028439 Ahnak 66395 AHNAK nucleoprotein (desmoyokin) BC028439 Rasl12 70784 RAS-like, family 12 AK014511 1110038D17Rik 68778 RIKEN cDNA 1110038D17 gene AK004153 Slc38a4 69354 solute carrier family 38, member 4 AK003626 Diabetes Page 162 of 205

Oxct1 67041 3-oxoacid CoA transferase 1 AK010029 Ndufab1 70316 NADH dehydrogenase (ubiquinone) 1, alpha/betaAK010307 subcomplex, 1 5730494M16Rik 66648 RIKEN cDNA 5730494M16 gene BQ174627 Bex4 406217 brain expressed gene 4 AK010400 Atxn7l1 380753 ataxin 7-like 1 AK013145 Gm10340///Gm10406///Gm2888///Gm2897///Gm3095///Gm3173///Gm3239///Gm3298///Gm3317///Gm3373///Gm3383///Gm3500///Gm3558///Gm3636///Gm3642///Gm3667///Gm3696///Gm3739///Gm5796///LOC100861615100036568///100038847///100040657///100040671///100040697///100041012///100041151///100041262///100041374///100041515///100041678///100041874///100042054///100042100///100042149///100042235///100169868///100861615///545007///666329predicted gene 10340///predicted geneBM195235 10406///predicted gene 2888///predicted gene 2897///predicted gene 3095///predicted gene 3173///predicted gene 3239///predicted gene 3298///predicted gene 3317///predicted gene 3373///predicted gene 3383///predicted gene 3500///predicted gene 3558///predicted gene 3636///predicted gene 3642///predicted gene 3667///predicted gene 3696///predicted gene 3739///predicted gene 5796///uncharacterized LOC100861615 Pdlim7 67399 PDZ and LIM domain 7 AK010339 Arxes1///Arxes276219///76976adipocyte-related X-chromosome expressedAK013740 sequence 1///adipocyte-related X-chromosome expressed sequence 2 2610019F03Rik 72148 RIKEN cDNA 2610019F03 gene AK011462 Col14a1 12818 collagen, type XIV, alpha 1 BB521934 Dzip1 66573 DAZ interacting protein 1 AI509011 Spsb1 74646 splA/ryanodine receptor domain and SOCSAK003707 box containing 1 Car12 76459 carbonic anyhydrase 12 AK009873 Phkg2 68961 phosphorylase kinase, gamma 2 (testis)AK005277 Snhg5 72655 small nucleolar RNA host gene 5 AK012825 Basp1 70350 brain abundant, membrane attached signalAK011545 protein 1 Chn2 69993 chimerin (chimaerin) 2 AK006398 Blvra 109778 biliverdin reductase A AK010847 Vip 22353 vasoactive intestinal polypeptide AK018599 Maoa 17161 monoamine oxidase A AW986246 Bmyc 107771 brain expressed myelocytomatosis oncogeneAK012810 Pacrg 69310 PARK2 co-regulated AK005771 Dmkn 73712 dermokine BI452905 Myh14 71960 myosin, heavy polypeptide 14 AK010278 Ngfrap1 12070 nerve growth factor receptor (TNFRSF16)BI407690 associated protein 1 Mt2 17750 metallothionein 2 AA796766 Abcc3 76408 ATP-binding cassette, sub-family C (CFTR/MRP),AK006128 member 3 Gm10345 100503915 predicted gene 10345 AK005822 Gm16136 100503499 predicted gene 16136 AK005410 Nsun4 72181 NOL1/NOP2/Sun domain family, memberAW701004 4 Ncapg 54392 non-SMC condensin I complex, subunit BB702347G Pkp2 67451 plakophilin 2 AK005020 Lrrc51 69358 leucine rich repeat containing 51 AK005758 2610524H06Rik 330173 RIKEN cDNA 2610524H06 gene AW494389 Anxa6 11749 annexin A6 AK013026 Anxa6 11749 annexin A6 AK013026 Syce2 71846 synaptonemal complex central elementAK005954 protein 2 Slc52a3 69698 solute carrier protein family 52, memberAK009850 3 Rnf149 67702 ring finger protein 149 T12280 Hmgb4 69317 high-mobility group box 4 AK005588 Igh-VJ558///Igha16061///238447immunoglobulin heavy chain (J558 family)///immunoglobulinAK007826 heavy constant alpha Clcn5 12728 chloride channel 5 BB794830 Psapl1 76943 prosaposin-like 1 BB001825 Ccdc46 76380 coiled-coil domain containing 46 AW741712 Clic3 69454 chloride intracellular channel 3 AK009020 4930579C15Rik 67753 RIKEN cDNA 4930579C15 gene BG066938 Clip4 78785 CAP-GLY domain containing linker proteinAV273445 family, member 4 Dtna 13527 dystrobrevin alpha BB355121 Gpr137b///Gpr137b-ps664862///83924G protein-coupled receptor 137B///G protein-coupledAK009736 receptor 137B, pseudogene Dnajb6 23950 DnaJ (Hsp40) homolog, subfamily B, memberAK005680 6 Cd59a 12509 CD59a antigen AK005507 Arl2bp 107566 ADP-ribosylation factor-like 2 binding proteinAK006418 Mtap7 17761 microtubule-associated protein 7 AK008018 Rimklb 108653 ribosomal modification protein rimK-likeAK016936 family member B Rimklb 108653 ribosomal modification protein rimK-likeAK016936 family member B Cabyr 71132 calcium-binding tyrosine-(Y)-phosphorylationBF319512 regulated (fibrousheathin 2) Ccnd2 12444 cyclin D2 AK007904 Rwdd3 66568 RWD domain containing 3 AK014130 Clgn 12745 calmegin AK019534 Ppp1r42 69312 protein phosphatase 1, regulatory subunitAK005871 42 Page 163 of 205 Diabetes

Atp6v1c2 68775 ATPase, H+ transporting, lysosomal V1 subunitAK004157 C2 Gusb 110006 glucuronidase, beta AK002832 Iglv1 16142 immunoglobulin lambda variable 1 AK008145 Tcte2 21646 t-complex-associated testis expressed 2AI429170 Pmm1 29858 phosphomannomutase 1 BI739353 Nuf2 66977 NUF2, NDC80 kinetochore complex component,AK010351 homolog (S. cerevisiae) Bbx 70508 bobby sox homolog (Drosophila) BC024449 Mbd1 17190 methyl-CpG binding domain protein 1 AK007371 Morn3 74890 MORN repeat containing 3 AK015339 Pank1 75735 pantothenate kinase 1 AK017345 Hoxd8 15437 homeobox D8 AA265122 Dnajb13 69387 DnaJ (Hsp40) related, subfamily B, memberBE644537 13 Chd1 12648 chromodomain helicase DNA binding proteinBF319155 1 Hspa8 15481 heat shock protein 8 AK004608 Gm3579 100041932 predicted gene 3579 BG297038 Gm3579 100041932 predicted gene 3579 BG297038 Hist1h3f 260423 histone cluster 1, H3f AK010121 Tbpl1 237336 TATA box binding protein-like 1 AK005604 Acp5 11433 acid phosphatase 5, tartrate resistant AK008391 Ica1 15893 islet cell autoantigen 1 AK005965 Pdzk1 59020 PDZ domain containing 1 AK006269 Dnajb4 67035 DnaJ (Hsp40) homolog, subfamily B, memberAK006478 4 Gm7008 629820 predicted gene 7008 AK004585 Pdzd9 67983 PDZ domain containing 9 AK015115 Ypel1 106369 yippee-like 1 (Drosophila) AK006049 Rgl3 71746 ral guanine nucleotide dissociation stimulator-likeAK004876 3 Mllt3 70122 myeloid/lymphoid or mixed-lineage leukemiaAK019458 (trithorax homolog, Drosophila); translocated to, 3 Pdss1 56075 prenyl (solanesyl) diphosphate synthase,AK011869 subunit 1 Il34 76527 interleukin 34 AK008082 Tekt1 21689 tektin 1 AK005801 Sh3gl3 20408 SH3-domain GRB2-like 3 AK012114 Allc 94041 allantoicase AK005893 Rnf32 56874 ring finger protein 32 AK012288 Sh3kbp1 58194 SH3-domain kinase binding protein 1 AK018032 1700074P13Rik 73481 RIKEN cDNA 1700074P13 gene AK006951 Aplp2 11804 amyloid beta (A4) precursor-like proteinAK013376 2 Ak3 56248 adenylate kinase 3 AK007618 Rnf19b 75234 ring finger protein 19B AK015966 Pdcl2 79455 phosducin-like 2 AK006040 Mal 17153 myelin and lymphocyte protein, T cell differentiationAK019046 protein BF607489 Ttc7b 104718 tetratricopeptide repeat domain 7B BB329157 Tcf7 21414 transcription factor 7, T cell specific AI323642 Ubr7 66622 ubiquitin protein ligase E3 component n-recogninAV030071 7 (putative) Fgfr2 14183 fibroblast growth factor receptor 2 BG873440 Epb4.1l2 13822 erythrocyte protein band 4.1-like 2 BE951907 Epb4.1l2 13822 erythrocyte protein band 4.1-like 2 BE951907 Fam73b 108958 family with sequence similarity 73, memberBI556043 B Pygb 110078 brain glycogen phosphorylase AW547988 Reep1 52250 receptor accessory protein 1 BQ174328 Sox4 20677 SRY-box containing gene 4 BG083485 Tmem30b 238257 transmembrane protein 30B BG068678 Arglu1 234023 arginine and glutamate rich 1 BG093966 Inpp5a 212111 inositol polyphosphate-5-phosphatase ABB307136 Fam117a 215512 family with sequence similarity 117, memberAW548096 A Snhg1 83673 small nucleolar RNA host gene (non-proteinBQ177137 coding) 1 Snhg1 83673 small nucleolar RNA host gene (non-proteinBQ177137 coding) 1 Esrp2 77411 epithelial splicing regulatory protein 2 BF124648 Ppp1r3c 53412 protein phosphatase 1, regulatory (inhibitor)BQ176864 subunit 3C Chchd10 103172 coiled-coil-helix-coiled-coil-helix domainAI647775 containing 10 Diabetes Page 164 of 205

Slc31a1 20529 solute carrier family 31, member 1 AV287019 Ldb3 24131 LIM domain binding 3 BB479063 Dusp9 75590 dual specificity phosphatase 9 AV295798 Dusp9 75590 dual specificity phosphatase 9 AV295798 Abat 268860 4-aminobutyrate aminotransferase BF462185 Tpm4 326618 tropomyosin 4 AV122663 Spag5 54141 sperm associated antigen 5 BM208112 Ggnbp1 70772 gametogenetin binding protein 1 AV279768 Clvs1 74438 clavesin 1 BE956483 Asns 27053 asparagine synthetase AV212753 BG069607 Mthfr 17769 5,10-methylenetetrahydrofolate reductaseBG069750 Ppargc1a 19017 peroxisome proliferative activated receptor,BB752393 gamma, coactivator 1 alpha Ppargc1a 19017 peroxisome proliferative activated receptor,BB752393 gamma, coactivator 1 alpha Dnaja4 58233 DnaJ (Hsp40) homolog, subfamily A, memberBQ176119 4 Krtdap 64661 keratinocyte differentiation associated proteinAV007306 Cds2 110911 CDP-diacylglycerol synthase (phosphatidateBM214378 cytidylyltransferase) 2 Fam174b 100038347 family with sequence similarity 174, memberBG073439 B BG976607 BG976607 Serf1 20365 small EDRK-rich factor 1 AA709993 Snhg11 319317 small nucleolar RNA host gene 11 BI731047 Rab3ip 216363 RAB3A interacting protein BF319015 S100b 20203 S100 protein, beta polypeptide, neural BB316114 Clrn3 212070 clarin 3 BB496366 Sfmbt2 353282 Scm-like with four mbt domains 2 BM200222 Cryab 12955 crystallin, alpha B AV016515 Tchh 99681 trichohyalin AI597080 Morc4 75746 microrchidia 4 AV036158 Rrm2 20135 ribonucleotide reductase M2 AV301324 Arhgap39 223666 Rho GTPase activating protein 39 BB403657 Col5a1 12831 collagen, type V, alpha 1 AV246911 1100001G20Rik 66107 RIKEN cDNA 1100001G20 gene AV006463 Slc4a1 20533 solute carrier family 4 (anion exchanger),BB448377 member 1 Aard 239435 alanine and arginine rich domain containingAV256613 protein Gpt2 108682 glutamic pyruvate transaminase (alanineBI648645 aminotransferase) 2 Tmem56 99887 transmembrane protein 56 BB667728 Hip1 215114 huntingtin interacting protein 1 BB794880 Erbb3 13867 v-erb-b2 erythroblastic leukemia viral oncogeneBF140685 homolog 3 (avian) Sin3b 20467 transcriptional regulator, SIN3B (yeast) BF017589 Tbl1x 21372 transducin (beta)-like 1 X-linked BF682509 Cldn3 12739 claudin 3 AW611462 Ero1lb 67475 ERO1-like beta (S. cerevisiae) BB234316 Slc2a1 20525 solute carrier family 2 (facilitated glucoseBM207588 transporter), member 1 Sema5a 20356 sema domain, seven thrombospondin repeatsBQ176610 (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A Wars 22375 tryptophanyl-tRNA synthetase AI528863 Crb3 224912 crumbs homolog 3 (Drosophila) AU015319 Mkrn1 54484 makorin, ring finger protein, 1 AA717142 Nptx1 18164 neuronal pentraxin 1 AI152800 Hspb7 29818 heat shock protein family, member 7 (cardiovascular)BM124741 Mycbp2 105689 MYC binding protein 2 AW546647 Morn4 226123 MORN repeat containing 4 BF464669 Dmpk 13400 dystrophia myotonica-protein kinase AW108486 Tmem27 57394 transmembrane protein 27 AI314694 Limch1 77569 LIM and calponin homology domains 1 AV024662 Npr3 18162 natriuretic peptide receptor 3 BG066982 Cdsn 386463 corneodesmosin BM231053 Odf2 18286 outer dense fiber of sperm tails 2 BF319642 Cox6b2 333182 cytochrome c oxidase subunit VIb polypeptideAV013496 2 Limch1 77569 LIM and calponin homology domains 1 BM117827 Page 165 of 205 Diabetes

Mboat1 218121 membrane bound O-acyltransferase domainAV366860 containing 1 Lpgat1 226856 lysophosphatidylglycerol acyltransferaseBG071867 1 Lpgat1 226856 lysophosphatidylglycerol acyltransferaseBG071867 1 Gnptab 432486 N-acetylglucosamine-1-phosphate transferase,BG144467 alpha and beta subunits Ndn 17984 necdin AW743020 Ndn 17984 necdin AW743020 AI464131 329828 expressed sequence AI464131 BG063189 Dsp 109620 desmoplakin AV297961 Dsp 109620 desmoplakin AV297961 Brdt 114642 bromodomain, testis-specific BG070923 Btc 12223 betacellulin, epidermal growth factor familyAV231340 member Myo6 17920 myosin VI BB200233 Sephs2 20768 Selenophosphate synthetase 2 BE200310 Rasgrf1 19417 RAS protein-specific guanine nucleotide-releasingAI850720 factor 1 Dpp7 83768 dipeptidylpeptidase 7 BG067113 Il17d 239114 interleukin 17D BB809808 Fam169a 320557 family with sequence similarity 169, memberBB476773 A Csprs///Gm15433///Gm2666///Gm7592///Gm7609100040213///100503433///114564///665338///665378component of Sp100-rs///predicted pseudogeneBB148221 15433///predicted gene 2666///predicted gene 7592///predicted pseudogene 7609 Sugp2 234373 SURP and G patch domain containing 2 BB772209 BB381550 Slc5a6 330064 solute carrier family 5 (sodium-dependentBF450030 vitamin transporter), member 6 Chpt1 212862 choline phosphotransferase 1 BM899344 Hr 15460 hairless AV231755 Nav2 78286 neuron navigator 2 BM118398 Krt8 16691 keratin 8 AW322280 Zfp703 353310 zinc finger protein 703 BI558298 Cachd1 320508 cache domain containing 1 BB730977 Cachd1 320508 cache domain containing 1 BB730977 BB201888 Rsad2 58185 radical S-adenosyl methionine domain containingBB132493 2 Ndrg4 234593 N-myc downstream regulated gene 4 AI837704 Tle2 21886 transducin-like enhancer of split 2, homologAU067681 of Drosophila E(spl) 1700097N02Rik 67522 RIKEN cDNA 1700097N02 gene AA266367 Ptgs1 19224 prostaglandin-endoperoxide synthase 1AA833146 Dpp7 83768 dipeptidylpeptidase 7 BB746075 Arl4c 320982 ADP-ribosylation factor-like 4C BI964400 Sorbs1 20411 sorbin and SH3 domain containing 1 BB737680 Oxct1 67041 3-oxoacid CoA transferase 1 AV213379 LOC100861853///Luc7l2100861853///192196uncharacterized LOC100861853///LUC7-likeBB475271 2 (S. cerevisiae) Slc7a4 224022 solute carrier family 7 (cationic amino acidAA061682 transporter, y+ system), member 4 Svs3a///Svs3b329557///64335seminal vesicle secretory protein 3A///seminalBB106990 vesicle secretory protein 3B Snca 20617 synuclein, alpha AI324124 1700010I14Rik 66931 RIKEN cDNA 1700010I14 gene AW986175 Srsf7 225027 serine/arginine-rich splicing factor 7 BE825013 Sfpq 71514 splicing factor proline/glutamine rich (polypyrimidineBI738328 tract binding protein associated) Chchd10 103172 coiled-coil-helix-coiled-coil-helix domainAA038464 containing 10 Pfn2 18645 profilin 2 BB560492 Rapgef3 223864 Rap guanine nucleotide exchange factorBB226235 (GEF) 3 Slc2a3 20527 solute carrier family 2 (facilitated glucoseBB414515 transporter), member 3 Prm1 19118 protamine 1 AV209063 Mbd1 17190 methyl-CpG binding domain protein 1 BF121558 Phyhipl 70911 phytanoyl-CoA hydroxylase interacting protein-likeBB131270 2810474O19Rik 67246 RIKEN cDNA 2810474O19 gene BM232998 Nedd9 18003 neural precursor cell expressed, developmentallyBB535494 down-regulated gene 9 Mapk10 26414 mitogen-activated protein kinase 10 BB453775 Marcksl1 17357 MARCKS-like 1 AV110584 D2hgdh 98314 D-2-hydroxyglutarate dehydrogenase AV349520 Atad3a 108888 ATPase family, AAA domain containing 3AAV239773 Creb3l2 208647 cAMP responsive element binding proteinBB230757 3-like 2 Clu 12759 clusterin AV075715 Diabetes Page 166 of 205

Cd24a 12484 CD24a antigen BB560574 AU019880 Mcoln3 171166 mucolipin 3 AV313762 Dnajc14 74330 DnaJ (Hsp40) homolog, subfamily C, memberBB044517 14 Phgdh 236539 3-phosphoglycerate dehydrogenase AV216768 B3galt2 26878 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase,BB083643 polypeptide 2 Irs3 16369 insulin receptor substrate 3 AV286336 Clu 12759 clusterin AV152288 D1Pas1 110957 DNA segment, Chr 1, Pasteur Institute 1BG070553 Ppargc1a 19017 peroxisome proliferative activated receptor,AV337619 gamma, coactivator 1 alpha Nupl1 71844 nucleoporin like 1 AV303002 Bche 12038 butyrylcholinesterase BB667762 C77655 D530037H12Rik 96893 RIKEN cDNA D530037H12 gene BG066910 Cldn1 12737 claudin 1 AV227581 Hk1 15275 hexokinase 1 BB713410 Gja1 14609 gap junction protein, alpha 1 BB039269 Rab20 19332 RAB20, member RAS oncogene family BG066967 Cyr61 16007 cysteine rich protein 61 BM202770 Ankrd5 319196 ankyrin repeat domain 5 BB017776 Dbp 13170 D site albumin promoter binding proteinBB550183 Rreb1 68750 ras responsive element binding protein BG1435021 Nfib 18028 nuclear factor I/B BB092799 Gpt2 108682 glutamic pyruvate transaminase (alanineBB068040 aminotransferase) 2 Hsd17b10 15108 hydroxysteroid (17-beta) dehydrogenaseAV078914 10 Malat1 72289 metastasis associated lung adenocarcinomaBF537798 transcript 1 (non-coding RNA) Svs5 20944 seminal vesicle secretory protein 5 BB808046 Tnp1 21958 transition protein 1 AV206780 4930525F21Rik 75823 RIKEN cDNA 4930525F21 gene AV278176 Gja1 14609 gap junction protein, alpha 1 AV330726 Aplnr 23796 apelin receptor BB483357 Mmd2 75104 monocyte to macrophage differentiation-associatedAV269411 2 Gbp6 100702 guanylate binding protein 6 BM241485 Fnbp4 55935 formin binding protein 4 BG091626 BB622498 Dpysl3 22240 dihydropyrimidinase-like 3 AV161550 Foxp1 108655 Forkhead box P1 BB021390 Apoa1 11806 apolipoprotein A-I AI527359 Arg2 11847 arginase type II AV002218 Serpinb5 20724 serine (or cysteine) peptidase inhibitor, BB230853clade B, member 5 Gmcl1 23885 germ cell-less homolog 1 (Drosophila) BM239632 Rasgrp2 19395 RAS, guanyl releasing protein 2 BE688720 Gja1 14609 gap junction protein, alpha 1 BB142324 Cds2 110911 CDP-diacylglycerol synthase (phosphatidateBB027654 cytidylyltransferase) 2 Spint2 20733 serine protease inhibitor, Kunitz type 2 AV058358 Gja1 14609 gap junction protein, alpha 1 BB043407 Pm20d1 212933 peptidase M20 domain containing 1 BB027848 Flywch2 76917 FLYWCH family member 2 BB251185 Iqcf3 68265 IQ motif containing F3 BB020350 Atp1b1 11931 ATPase, Na+/K+ transporting, beta 1 polypeptideAV152334 Cenpe 229841 centromere protein E BG068387 Pfkl 18641 phosphofructokinase, liver, B-type BE914497 Rhox4b 57737 Reproductive homeobox 4B BE686792 Idua 15932 Iduronidase, alpha-L- BI133445 Gpr137b///Gpr137b-ps664862///83924G protein-coupled receptor 137B///G protein-coupledBB726971 receptor 137B, pseudogene Osbpl9 100273 oxysterol binding protein-like 9 BG066184 Ddit4l 73284 DNA-damage-inducible transcript 4-likeAV251625 Cdc20 107995 cell division cycle 20 BB041150 Prm1 19118 protamine 1 AV209010 Meg3 17263 maternally expressed 3 BB093563 Page 167 of 205 Diabetes

Snhg1 83673 small nucleolar RNA host gene (non-proteinBB493265 coding) 1 Agbl5 231093 ATP/GTP binding protein-like 5 AV277339 Dsg2 13511 desmoglein 2 BG092030 Nhedc2 97086 Na+/H+ exchanger domain containing 2AV251613 D18Ertd232e 52492 DNA segment, Chr 18, ERATO Doi 232, expressedBB205273 B4galnt2 14422 beta-1,4-N-acetyl-galactosaminyl transferaseAI593864 2 Fam164c 72350 family with sequence similarity 164, memberAV345094 C BB107628 AA717264 Gli2 14633 GLI-Kruppel family member GLI2 AW546128 Timm8a2 223262 translocase of inner mitochondrial membraneBG066908 8 homolog a2 (yeast) Npr3 18162 natriuretic peptide receptor 3 BG080055 Tbx3 21386 T-box 3 AA543734 Prm2 19119 protamine 2 NM_008933 Ctsd 13033 cathepsin D NM_009983 Fdft1 14137 farnesyl diphosphate farnesyl transferaseNM_010191 1 Tnfrsf19 29820 tumor necrosis factor receptor superfamily,NM_013869 member 19 Krt18 16668 keratin 18 NM_010664 Siah2 20439 seven in absentia 2 AA414485 Cd24a 12484 CD24a antigen NM_009846 Ccnb1///Gm5593268697///434175cyclin B1///predicted gene 5593 NM_007629 Atp6v0e2 76252 ATPase, H+ transporting, lysosomal V0 subunitNM_133764 E2 Gpd1 14555 glycerol-3-phosphate dehydrogenase 1 BC019391(soluble) 9030425E11Rik 71566 RIKEN cDNA 9030425E11 gene BG072972 9030425E11Rik 71566 RIKEN cDNA 9030425E11 gene BG072972 Ptn 19242 pleiotrophin BC002064 Cdh1 12550 cadherin 1 NM_009864 Mpzl2 14012 myelin protein zero-like 2 BC015076 Syp 20977 synaptophysin NM_009305 Hsd17b10 15108 hydroxysteroid (17-beta) dehydrogenaseNM_016763 10 Tuba3a///Tuba3b22144///22147tubulin, alpha 3A///tubulin, alpha 3B NM_009446 Slc1a1 20510 solute carrier family 1 (neuronal/epithelialNM_009199 high affinity glutamate transporter, system Xag), member 1 Gpnmb 93695 glycoprotein (transmembrane) nmb NM_053110 Smoc1 64075 SPARC related modular calcium bindingNM_022316 1 Crabp1 12903 cellular retinoic acid binding protein I NM_013496 Adam3 11497 a disintegrin and metallopeptidase domainNM_009619 3 (cyritestin) Mylpf 17907 myosin light chain, phosphorylatable, fastNM_016754 skeletal muscle Slpi 20568 secretory leukocyte peptidase inhibitorNM_011414 Ehhadh 74147 enoyl-Coenzyme A, hydratase/3-hydroxyacylNM_023737 Coenzyme A dehydrogenase Dhrs3 20148 dehydrogenase/reductase (SDR family) NM_011303member 3 Cldn7 53624 claudin 7 BC008104 Gjb6 14623 gap junction protein, beta 6 BC016507 Aspn 66695 asporin NM_025711 Sardh 192166 sarcosine dehydrogenase BI217574 Hsd3b1 15492 hydroxy-delta-5-steroid dehydrogenase,NM_008293 3 beta- and steroid delta-isomerase 1 Acvr1 11477 activin A receptor, type 1 NM_007394 Nid1 18073 nidogen 1 X14480 Fbp1 14121 fructose bisphosphatase 1 NM_019395 Ggt1 14598 gamma-glutamyltransferase 1 NM_008116 Slc16a7 20503 solute carrier family 16 (monocarboxylicNM_011391 acid transporters), member 7 Efhd1 98363 EF hand domain containing 1 BC019531 Hils1 54388 histone H1-like protein in spermatids 1 NM_018792 D4Wsu53e 27981 DNA segment, Chr 4, Wayne State UniversityBE447520 53, expressed Sdc2 15529 syndecan 2 AU021035 Lbp 16803 lipopolysaccharide binding protein NM_008489 Flot1 14251 flotillin 1 NM_008027 Slc20a1 20515 solute carrier family 20, member 1 NM_015747 Ceacam10 26366 carcinoembryonic antigen-related cell adhesionNM_007675 molecule 10 Il7r 16197 interleukin 7 receptor AI573431 Il7r 16197 interleukin 7 receptor AI573431 Diabetes Page 168 of 205

Bex1 19716 brain expressed gene 1 NM_009052 Srpk2 20817 serine/arginine-rich protein specific kinaseNM_009274 2 Tst 22117 thiosulfate sulfurtransferase, mitochondrialBC005644 Cdk5rap1 66971 CDK5 regulatory subunit associated proteinNM_025876 1 Pbk 52033 PDZ binding kinase NM_023209 Scg3 20255 secretogranin III NM_009130 Enpep 13809 glutamyl aminopeptidase NM_007934 Arfgap2 77038 ADP-ribosylation factor GTPase activatingNM_023854 protein 2 Pvrl3 58998 poliovirus receptor-related 3 NM_021495 Podxl 27205 podocalyxin-like AF290209 Kcnk1 16525 potassium channel, subfamily K, memberNM_008430 1 Heph 15203 hephaestin NM_010417 Cxcr4 12767 chemokine (C-X-C motif) receptor 4 D87747 Stat4 20849 signal transducer and activator of transcriptionNM_011487 4 Ctsb 13030 cathepsin B M14222 Rangrf 57785 RAN guanine nucleotide release factor NM_021329 Ssx2ip 99167 synovial sarcoma, X breakpoint 2 interactingNM_138744 protein Plek 56193 pleckstrin AF181829 Car2 12349 carbonic anhydrase 2 NM_009801 Col15a1 12819 collagen, type XV, alpha 1 AF011450 S100a9 20202 S100 calcium binding protein A9 (calgranulinNM_009114 B) Slc7a9 30962 solute carrier family 7 (cationic amino acidNM_021291 transporter, y+ system), member 9 Cyp2f2 13107 cytochrome P450, family 2, subfamily f,NM_007817 polypeptide 2 Aadac 67758 arylacetamide deacetylase (esterase) NM_023383 Rgn 19733 regucalcin NM_009060 Cxcl13 55985 chemokine (C-X-C motif) ligand 13 AF030636 Mapk13 26415 mitogen-activated protein kinase 13 NM_011950 Ocln 18260 occludin NM_008756 Evc 59056 Ellis van Creveld gene homolog (human)NM_021292 Gata3 14462 GATA binding protein 3 NM_008091 Slc38a4 69354 solute carrier family 38, member 4 NM_027052 Fam3c 27999 family with sequence similarity 3, memberAK016470 C Cdh16 12556 cadherin 16 NM_007663 Hoxa5 15402 homeobox A5 BC011063 Hdac6 15185 histone deacetylase 6 NM_010413 Cdyl 12593 chromodomain protein, Y chromosome-likeAF081260 Cadps 27062 Ca2+-dependent secretion activator NM_012061 Stard10 56018 START domain containing 10 NM_019990 Myh11 17880 myosin, heavy polypeptide 11, smooth muscleBC026142 Sult1d1 53315 sulfotransferase family 1D, member 1 NM_016771 Cdrt4 66338 CMT1A duplicated region transcript 4 NM_025496 Phlda3 27280 pleckstrin homology-like domain, familyNM_013750 A, member 3 Btg3///Gm733412228///654432B cell translocation gene 3///B-cell translocationNM_009770 gene 3 pseudogene Tgtp1///Tgtp2100039796///21822T cell specific GTPase 1///T cell specific NM_011579GTPase 2 Mknk2 17347 MAP kinase-interacting serine/threonineNM_021462 kinase 2 Cited1 12705 Cbp/p300-interacting transactivator withU65091 Glu/Asp-rich carboxy-terminal domain 1 Tnfrsf11b 18383 tumor necrosis factor receptor superfamily,AB013898 member 11b (osteoprotegerin) 4930544G11Rik 67653 RIKEN cDNA 4930544G11 gene NM_026294 Rnf128 66889 ring finger protein 128 AK004847 Sephs2 20768 selenophosphate synthetase 2 NM_009266 Pcbp4 59092 poly(rC) binding protein 4 NM_021567 Oxct1 67041 3-oxoacid CoA transferase 1 NM_024188 Kif2c 73804 kinesin family member 2C NM_134471 Acot1 26897 acyl-CoA thioesterase 1 NM_012006 Slc2a2 20526 solute carrier family 2 (facilitated glucoseNM_031197 transporter), member 2 Apcdd1 494504 adenomatosis polyposis coli down-regulatedBB770932 1 1700019N12Rik 67077 RIKEN cDNA 1700019N12 gene NM_025953 St3gal6 54613 ST3 beta-galactoside alpha-2,3-sialyltransferaseNM_018784 6 St3gal6 54613 ST3 beta-galactoside alpha-2,3-sialyltransferaseNM_018784 6 Cldn8 54420 claudin 8 BC003868 Page 169 of 205 Diabetes

Gjc1 14615 gap junction protein, gamma 1 NM_008122 Tex101 56746 testis expressed gene 101 NM_019981 Gpx3 14778 glutathione peroxidase 3 NM_008161 Socs2 216233 suppressor of cytokine signaling 2 NM_007706 Rgl1 19731 ral guanine nucleotide dissociation stimulator,-likeNM_016846 1 Cd1d1 12479 CD1d1 antigen NM_007639 Cd1d1 12479 CD1d1 antigen NM_007639 Sprr1a 20753 small proline-rich protein 1A NM_009264 Mmp12 17381 matrix metallopeptidase 12 BC019135 S100a14 66166 S100 calcium binding protein A14 NM_025393 Akap2 11641 A kinase (PRKA) anchor protein 2 BC003735 Piwil2 57746 piwi-like homolog 2 (Drosophila) NM_021308 Ttk 22137 Ttk protein kinase NM_009445 Art4 109978 ADP-ribosyltransferase 4 NM_026639 Ccna1 12427 cyclin A1 NM_007628 Pdlim3 53318 PDZ and LIM domain 3 NM_016798 Comt 12846 catechol-O-methyltransferase NM_007744 Cd5l 11801 CD5 antigen-like NM_009690 Slco1a5 108096 solute carrier organic anion transporterNM_130861 family, member 1a5 Ovol2 107586 ovo-like 2 (Drosophila) NM_026924 Papolb 56522 poly (A) polymerase beta (testis specific)NM_019943 Slc22a21 56517 solute carrier family 22 (organic cation transporter),NM_019723 member 21 Itgae 16407 integrin alpha E, epithelial-associated NM_008399 Cox8b 12869 cytochrome c oxidase, subunit VIIIb NM_007751 Fads3 60527 fatty acid desaturase 3 BE652876 Dnajb8 56691 DnaJ (Hsp40) homolog, subfamily B, memberNM_019964 8 Ch25h 12642 cholesterol 25-hydroxylase NM_009890 Cdkl2 53886 cyclin-dependent kinase-like 2 (CDC2-relatedNM_016912 kinase) Actrt2 73353 actin-related protein T2 NM_028513 Smc1b 140557 structural maintenance of chromosomesNM_080470 1B Spp1 20750 secreted phosphoprotein 1 NM_009263 Hebp2 56016 heme binding protein 2 NM_019487 1700029P11Rik 66346 RIKEN cDNA 1700029P11 gene NM_025503 1700008P20Rik 69301 RIKEN cDNA 1700008P20 gene NM_027028 Cst9 13013 cystatin 9 NM_009979 Skp2 27401 S-phase kinase-associated protein 2 (p45)AV259620 Sesn3 75747 Sestrin 3 NM_030261 C6 12274 complement component 6 NM_016704 Klk1b5 16622 kallikrein 1-related peptidase b5 NM_008456 Fads2 56473 fatty acid desaturase 2 NM_019699 Ly75 17076 lymphocyte antigen 75 NM_013825 Fhl5 57756 four and a half LIM domains 5 NM_021318 Osr1 23967 odd-skipped related 1 (Drosophila) NM_011859 2310030G06Rik 66952 RIKEN cDNA 2310030G06 gene NM_025865 Pipox 19193 pipecolic acid oxidase BC013525 Nicn1 66257 nicolin 1 AV031928 4931417E11Rik 66740 RIKEN cDNA 4931417E11 gene NM_025737 Zfp37 22696 zinc finger protein 37 NM_009554 Ankrd61 66729 ankyrin repeat domain 61 NM_025732 Aoc3 11754 amine oxidase, copper containing 3 NM_009675 Rpl3l 66211 ribosomal protein L3-like NM_025425 Sult1c2 69083 sulfotransferase family, cytosolic, 1C, memberNM_026935 2 Fzd4 14366 frizzled homolog 4 (Drosophila) BF783030 Dock8 76088 dedicator of cytokinesis 8 NM_028785 Prss37 67690 protease, serine, 37 NM_026317 P2rx5 94045 purinergic receptor P2X, ligand-gated ionNM_033321 channel, 5 Decr1 67460 2,4-dienoyl CoA reductase 1, mitochondrialNM_026172 Cma1 17228 chymase 1, mast cell NM_010780 Foxi1 14233 forkhead box I1 BC007475 LOC100039014///LOC100039034///LOC100039595///LOC100040171///LOC100040223///LOC100040262///LOC100040335///LOC100040714///LOC100042337///LOC100042565///LOC100861899///LOC100862042///LOC100862059///LOC100862075///LOC100862345///LOC100862366///LOC382131///LOC664924///LOC665276///LOC665301///LOC665687///LOC665918///Ssty1100039014///100039034///100039595///100040171///100040223///100040262///100040335///100040714///100042337///100042565///100861899///100862042///100862059///100862075///100862345///100862366///20611///382131///664924///665276///665301///665687///665918Y-linked testis-specific protein 1-like///Y-linkedNM_009220 testis-specific protein 1-like///Y-linked testis-specific protein 1-like///Y-linked testis-specific protein 1-like///Ssty1 family member///Y-linked testis-specific protein 1-like///Y-linked testis-specific protein 1-like///Y-linked testis-specific protein 1-like///Y-linked testis-specific protein 1-like///Y-linked testis-specific protein 1-like///Y-linked testis-specific protein 1-like///Y-linked testis-specific protein 1-like///Y-linked testis-specific protein 1-like///Y-linked testis-specific protein 1-like///Y-linked testis-specific protein 1-like///Y-linked testis-specific protein 1-like///Y-linked testis-specific protein 1-like///Y-linked testis-specific protein 1-like///Y-linked testis-specific protein 1-like///Y-linked testis-specific protein 1-like///Y-linked testis-specific protein 1-like///Y-linked testis-specific protein 1-like///spermiogenesis specific transcript on the Y 1 Diabetes Page 170 of 205

Pkd2l2 53871 polycystic kidney disease 2-like 2 BB706784 Kcnmb4 58802 potassium large conductance calcium-activatedNM_021452 channel, subfamily M, beta member 4 Atp12a 192113 ATPase, H+/K+ transporting, nongastric,NM_138652 alpha polypeptide Slc2a10 170441 solute carrier family 2 (facilitated glucoseNM_130451 transporter), member 10 Mmp7 17393 matrix metallopeptidase 7 NM_010810 Stc2 20856 stanniocalcin 2 AF031035 Ccdc70 67929 coiled-coil domain containing 70 NM_026459 Tssk2 22115 testis-specific serine kinase 2 NM_009436 Rab3c 67295 RAB3C, member RAS oncogene family AY026947 Marco 17167 macrophage receptor with collagenous NM_010766structure Dazl 13164 deleted in azoospermia-like NM_010021 Serf1 20365 small EDRK-rich factor 1 NM_011353 Adam24 13526 a disintegrin and metallopeptidase domainNM_010086 24 (testase 1) Gadd45a 13197 growth arrest and DNA-damage-inducibleNM_007836 45 alpha Fmo3 14262 flavin containing monooxygenase 3 NM_008030 Sycp3 20962 synaptonemal complex protein 3 NM_011517 Znrf4 20834 zinc and ring finger 4 NM_011483 1700010I14Rik 66931 RIKEN cDNA 1700010I14 gene NM_025851 Myo1c 17913 myosin IC NM_008659 Nkapl 66707 NFKB activating protein-like NM_025719 Klrb1c 17059 killer cell lectin-like receptor subfamily BNM_008527 member 1C Sh3yl1 24057 Sh3 domain YSC-like 1 NM_013709 Emid1 140703 EMI domain containing 1 NM_080595 Txnrd3 232223 thioredoxin reductase 3 AI196535 Mark1 226778 MAP/microtubule affinity-regulating kinaseAW491150 1 Adk 11534 adenosine kinase AI508733 Suz12 52615 Suppressor of zeste 12 homolog (Drosophila)AW536442 Gpr137b 83924 G protein-coupled receptor 137B AW546472 Dsg2 13511 desmoglein 2 C79957 Tmem191c 224019 transmembrane protein 191C N28171 Pkp2 67451 plakophilin 2 AA516617 Phf7 71838 PHD finger protein 7 AI427892 Prg4 96875 proteoglycan 4 (megakaryocyte stimulatingNM_021400 factor, articular superficial zone protein) Tctex1d1 67344 Tctex1 domain containing 1 NM_026100 1700091H14Rik 73553 RIKEN cDNA 1700091H14 gene NM_028570 Spesp1 66712 sperm equatorial segment protein 1 NM_025721 Pi4k2b 67073 phosphatidylinositol 4-kinase type 2 betaNM_028744 1700008F21Rik///Zfp82175453///75871RIKEN cDNA 1700008F21 gene///zinc fingerNM_029292 protein 821 Lyzl1 67328 lysozyme-like 1 NM_026092 Lrig1 16206 leucine-rich repeats and immunoglobulin-likeNM_008377 domains 1 Lrrc18 67580 leucine rich repeat containing 18 NM_026253 Mlph 171531 melanophilin NM_053015 Crtam 54698 cytotoxic and regulatory T cell moleculeNM_019465 1700018F24Rik 69396 RIKEN cDNA 1700018F24 gene NM_027069 Endou 19011 endonuclease, polyU-specific AI528824 Ppargc1b 170826 peroxisome proliferative activated receptor,NM_133249 gamma, coactivator 1 beta AV320801///Gm15023///Gm5128///Gm7903///Pramel3100040635///331529///331531///666040///83565expressed sequence AV320801///predictedNM_031390 gene 15023///predicted gene 5128///predicted gene 7903///preferentially expressed antigen in melanoma-like 3 Sim1 20464 single-minded homolog 1 (Drosophila) NM_011376 Gapdhs 14447 glyceraldehyde-3-phosphate dehydrogenase,M60978 spermatogenic Nqo2 18105 NAD(P)H dehydrogenase, quinone 2 NM_020282 Ltf 17002 lactotransferrin NM_008522 Sgpp1 81535 sphingosine-1-phosphate phosphatase 1NM_030750 Arx 11878 aristaless related homeobox BB322201 Pigr 18703 polymeric immunoglobulin receptor NM_011082 Enc1 13803 ectodermal-neural cortex 1 BM120053 4933411K20Rik 66756 RIKEN cDNA 4933411K20 gene NM_025747 Nrk 27206 Nik related kinase AK012873 Cxx1c 72865 CAAX box 1 homolog C (human) NM_028375 Zbtb7a 16969 zinc finger and BTB domain containing 7aNM_010731 Tnnt3 21957 troponin T3, skeletal, fast NM_011620 Page 171 of 205 Diabetes

Ptprg 19270 protein tyrosine phosphatase, receptor NM_008981type, G Bspry 192120 B-box and SPRY domain containing NM_138653 Folh1 53320 folate hydrolase 1 NM_016770 Kcnj15 16516 potassium inwardly-rectifying channel, subfamilyNM_019664 J, member 15 Lipg 16891 lipase, endothelial BC020991 Myb 17863 myeloblastosis oncogene NM_033597 Dusp13 27389 dual specificity phosphatase 13 NM_013849 Dlc1 50768 deleted in liver cancer 1 NM_015802 Hoxd4 15436 homeobox D4 J03770 4933417A18Rik 66761 RIKEN cDNA 4933417A18 gene NM_025750 Scin 20259 scinderin NM_009132 Npr3 18162 natriuretic peptide receptor 3 NM_008728 Hormad1 67981 HORMA domain containing 1 NM_026489 Pvr 52118 poliovirus receptor NM_009310 Klrb1a 17057 killer cell lectin-like receptor subfamily BNM_010737 member 1A Ptger3 19218 prostaglandin E receptor 3 (subtype EP3)NM_011196 Thbs1 21825 thrombospondin 1 AI385532 Msn 17698 moesin NM_010833 Epdr1 105298 ependymin related protein 1 (zebrafish)AF353717 Ak4 11639 adenylate kinase 4 NM_009647 Pip5k1b 18719 phosphatidylinositol-4-phosphate 5-kinase,NM_008846 type 1 beta Mgll 23945 monoglyceride lipase NM_011844 Slc48a1 67739 solute carrier family 48 (heme transporter),BC022913 member 1 Capn6 12338 calpain 6 AI747133 Gfra1 14585 glial cell line derived neurotrophic factorBE534815 family receptor alpha 1 Lrrc50 68270 leucine rich repeat containing 50 AK006656 Stc1 20855 stanniocalcin 1 BQ032752 Myoc 17926 myocilin AW125804 BC100451 58251 cDNA sequence BC100451 NM_021440 Cmpk2 22169 cytidine monophosphate (UMP-CMP) kinaseAK004595 2, mitochondrial Fam134b 66270 family with sequence similarity 134, memberNM_025459 B Plagl1 22634 pleiomorphic adenoma gene-like 1 NM_009538 Atp6v1e2 74915 ATPase, H+ transporting, lysosomal V1 subunitNM_029121 E2 Defb2 13215 defensin beta 2 NM_010030 Ly6f 17071 lymphocyte antigen 6 complex, locus F NM_008530 Mgst3 66447 microsomal glutathione S-transferase 3NM_029392 Lcn8 78076 lipocalin 8 NM_033145 Orm3 18407 orosomucoid 3 NM_013623 Pemt 18618 phosphatidylethanolamine N-methyltransferaseNM_008819 Bhmt 12116 betaine-homocysteine methyltransferaseNM_016668 Alppl2 11650 alkaline phosphatase, placental-like 2 NM_007433 Cyp51 13121 cytochrome P450, family 51 NM_020010 Spz1 79401 spermatogenic leucine zipper 1 NM_030237 Adamts5 23794 a disintegrin-like and metallopeptidase BB658835(reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2) Rgs7 24012 regulator of G protein signaling 7 NM_011880 Thbs2 21826 thrombospondin 2 NM_011581 Cdc42ep3 260409 CDC42 effector protein (Rho GTPase binding)BB012489 3 Hfe 15216 hemochromatosis AJ306425 Sh2b2 23921 SH2B adaptor protein 2 NM_018825 Isl1 16392 ISL1 transcription factor, LIM/homeodomainBQ176915 Bicd2 76895 bicaudal D homolog 2 (Drosophila) NM_029791 Zpbp 53604 zona pellucida binding protein NM_015785 Cyct 13067 cytochrome c, testis NM_009989 Rims2 116838 regulating synaptic membrane exocytosisNM_053271 2 Nedd9 18003 neural precursor cell expressed, developmentallyNM_017464 down-regulated gene 9 Fabp7 12140 fatty acid binding protein 7, brain NM_021272 Wnt4 22417 wingless-related MMTV integration siteNM_009523 4 Ifit1 15957 interferon-induced protein with tetratricopeptideNM_008331 repeats 1 Saa1 20208 serum amyloid A 1 NM_009117 Rhpn1 14787 rhophilin, Rho GTPase binding protein 1NM_008164 Diabetes Page 172 of 205

Tg 21819 thyroglobulin NM_009375 4930550L24Rik 75352 RIKEN cDNA 4930550L24 gene NM_023774 Saa3 20210 serum amyloid A 3 NM_011315 Synpo2 118449 synaptopodin 2 NM_080451 Serpinh1 12406 serine (or cysteine) peptidase inhibitor, BI220012clade H, member 1 Fgf1 14164 fibroblast growth factor 1 AI649186 Gpr137b///Gpr137b-ps664862///83924G protein-coupled receptor 137B///G protein-coupledAK010724 receptor 137B, pseudogene Gsg2 14841 germ cell-specific gene 2 BE457839 Ms4a1 12482 membrane-spanning 4-domains, subfamilyBB236617 A, member 1 Myom2 17930 myomesin 2 BB474208 Ccnb2 12442 cyclin B2 AK013312 Id4 15904 inhibitor of DNA binding 4 BB121406 Pde7a 18583 phosphodiesterase 7A BG070255 Dnase1l2 66705 deoxyribonuclease 1-like 2 AI507229 Prkca 18750 protein kinase C, alpha BM246539 Scd3 30049 stearoyl-coenzyme A desaturase 3 BE133651 Pdha2 18598 pyruvate dehydrogenase E1 alpha 2 AV206348 Timp4 110595 tissue inhibitor of metalloproteinase 4 BI788452 Ndrg1 17988 N-myc downstream regulated gene 1 AI987929 Cnn2 12798 calponin 2 BI663014 Dnajb7 57755 DnaJ (Hsp40) homolog, subfamily B, memberBF319385 7 Folr1 14275 folate receptor 1 (adult) BG245669 1700029H14Rik 66501 RIKEN cDNA 1700029H14 gene AI507132 1700019N19Rik 67507 RIKEN cDNA 1700019N19 gene AK006423 Rnf151 67504 ring finger protein 151 AK005854 Sfrp4 20379 secreted frizzled-related protein 4 BB221995 Rock2 19878 Rho-associated coiled-coil containing proteinBB761686 kinase 2 Itm2a 16431 integral membrane protein 2A BI966443 Orm1 18405 orosomucoid 1 BE628912 1700018B24Rik 66332 enhancer of rudimentary homolog pseudogeneAK006080 Pex5l 58869 peroxisomal biogenesis factor 5-like AV327933 Esyt1 23943 extended synaptotagmin-like protein 1 BC011482 Cdv3 321022 carnitine deficiency-associated gene expressedAI845410 in ventricle 3 Haus4 219072 HAUS augmin-like complex, subunit 4 BC011095 Vash2 226841 vasohibin 2 BC024141 Gm13502///Idi1207933///319554predicted gene 13502///isopentenyl-diphosphateBC004801 delta isomerase Atp1b1 11931 ATPase, Na+/K+ transporting, beta 1 polypeptideBC027319 Vldlr 22359 very low density lipoprotein receptor BB628702 Nomo1 211548 nodal modulator 1 BC024503 Crabp2 12904 cellular retinoic acid binding protein II BC018397 Aldob 230163 aldolase B, fructose-bisphosphate BC024112 Mb 17189 myoglobin BC025172 Cytip 227929 cytohesin 1 interacting protein BC007144 Hdac11 232232 histone deacetylase 11 BC016208 Rerg 232441 RAS-like, estrogen-regulated, growth-inhibitorBC026463 Glo1 109801 glyoxalase 1 BC024663 Acsl6 216739 acyl-CoA synthetase long-chain family memberBC022959 6 Stap2 106766 signal transducing adaptor family memberBC026642 2 Ogdh 18293 oxoglutarate dehydrogenase (lipoamide)BC013670 Fus 233908 fusion, derived from t(12;16) malignantAF224264 liposarcoma (human) Map1lc3a 66734 microtubule-associated protein 1 light chainBC010596 3 alpha Elovl4 83603 elongation of very long chain fatty acidsBB829575 (FEN1/Elo2, SUR4/Elo3, yeast)-like 4 Cmbl 69574 carboxymethylenebutenolidase-like (Pseudomonas)BC024580 Zfp7 223669 zinc finger protein 7 BC011501 Plac8 231507 placenta-specific 8 AF263458 Suox 211389 sulfite oxidase BC027197 Spon1 233744 spondin 1, (f-spondin) extracellular matrixBC020531 protein Ino80e 233875 INO80 complex subunit E BG065288 Deptor 97998 DEP domain containing MTOR-interactingBC004774 protein Dennd2d 72121 DENN/MADD domain containing 2D BC008266 Page 173 of 205 Diabetes

Cklf 75458 chemokine-like factor AY047360 Ehf 13661 ets homologous factor BC006789 Igsf5 72058 immunoglobulin superfamily, member 5BC004806 2210415F13Rik 70163 RIKEN cDNA 2210415F13 gene BC026828 Aldoc 11676 aldolase C, fructose-bisphosphate BC008184 Cadps2 320405 Ca2+-dependent activator protein for secretionAF000969 2 Nol3 78688 nucleolar protein 3 (apoptosis repressorBC027290 with CARD domain) Olah 99035 oleoyl-ACP hydrolase BC025001 Pcolce2 76477 procollagen C-endopeptidase enhancer AF3527882 Sox9 20682 SRY-box containing gene 9 BC024958 Iyd 70337 iodotyrosine deiodinase BC023358 Nln 75805 neurolysin (metallopeptidase M3 family)BC016224 Emr4 52614 EGF-like module containing, mucin-like,AF396935 hormone receptor-like sequence 4 Eci3 69123 enoyl-Coenzyme A delta isomerase 3 BC014724 A530016L24Rik 319942 RIKEN cDNA A530016L24 gene BC026527 Pla2g16 225845 phospholipase A2, group XVI BC024581 Mt1 17748 metallothionein 1 BC027262 C8g 69379 complement component 8, gamma polypeptideBC019967 U58494 Ank3 11735 ankyrin 3, epithelial BC021657 Ddo 70503 D-aspartate oxidase BC006690 Vsig4 278180 V-set and immunoglobulin domain containingBC025105 4 Hoxb6 15414 homeobox B6 BC016893 Akap4///LOC100503160100503160///11643A kinase (PRKA) anchor protein 4///A-kinaseU10341 anchor protein 4-like Akap4///LOC100503160100503160///11643A kinase (PRKA) anchor protein 4///A-kinaseU10341 anchor protein 4-like Alas2 11656 aminolevulinic acid synthase 2, erythroidM63244 Arxes1///Arxes276219///76976adipocyte-related X-chromosome expressedBC016270 sequence 1///adipocyte-related X-chromosome expressed sequence 2 Ednra 13617 endothelin receptor type A BC008277 Cldn3 12739 claudin 3 BC012650 Plp1 18823 proteolipid protein (myelin) 1 BB768495 Gcnt2 14538 glucosaminyl (N-acetyl) transferase 2, I-branchingAB037596 enzyme Paip1 218693 polyadenylate binding protein-interactingBC019726 protein 1 Ddit4l 73284 DNA-damage-inducible transcript 4-likeAF335325 Marveld3 73608 MARVEL (membrane-associating) domainBC025851 containing 3 Tpcn1 252972 two pore channel 1 AF217002 Cyp2b10 13088 cytochrome P450, family 2, subfamily b,AF128849 polypeptide 10 Trdn 76757 triadin AF223416 Vegfb 22340 vascular endothelial growth factor B U48800 Lrrc16a 68732 leucine rich repeat containing 16A BC012229 Rwdd3 66568 RWD domain containing 3 AF439556 Nox4 50490 NADPH oxidase 4 BC021378 Spnb2 20742 spectrin beta 2 AF016040 Pde7a 18583 phosphodiesterase 7A AY007702 Ghr 14600 growth hormone receptor M33324 Odz4 23966 odd Oz/ten-m homolog 4 (Drosophila) AB025413 Dhcr24 74754 24-dehydrocholesterol reductase BC004738 Nbr1 17966 neighbor of Brca1 gene 1 AF227188 Fgfrl1 116701 fibroblast growth factor receptor-like 1AF321301 Adamtsl4 229595 ADAMTS-like 4 BC016215 Spint2 20733 serine protease inhibitor, Kunitz type 2 AF099020 Srpx 51795 sushi-repeat-containing protein AB028050 Trdn 76757 triadin AF223415 Cabyr 71132 calcium-binding tyrosine-(Y)-phosphorylationAF359384 regulated (fibrousheathin 2) Igkv14-111 545847 Immunoglobulin kappa variable 14-111U62386 Parp3 235587 poly (ADP-ribose) polymerase family, memberBC014870 3 Glcci1 170772 glucocorticoid induced transcript 1 AA152997 Cmtm1///Cmtm2a100504164///73381CKLF-like MARVEL transmembrane domainAF401531 containing 1///CKLF-like MARVEL transmembrane domain containing 2A Cdca3 14793 cell division cycle associated 3 BI081061 Slc4a4 54403 solute carrier family 4 (anion exchanger),BE655147 member 4 Tmem135 72759 transmembrane protein 135 AV225967 Diabetes Page 174 of 205

Dcun1d1 114893 DCN1, defective in cullin neddylation 1, BE851193domain containing 1 (S. cerevisiae) Rbm28 68272 RNA binding motif protein 28 BM228459 Tsc2 22084 tuberous sclerosis 2 BB759096 Npnt 114249 nephronectin AA223007 Npnt 114249 nephronectin AA223007 Rbm4b 66704 RNA binding motif protein 4B AV047974 Igfbp5 16011 insulin-like growth factor binding proteinBF225802 5 Plk4 20873 polo-like kinase 4 BB706079 Ank3 11735 ankyrin 3, epithelial BB628935 H6pd 100198 hexose-6-phosphate dehydrogenase (glucoseBC027358 1-dehydrogenase) 2310001A20Rik 71881 RIKEN cDNA 2310001A20 gene AJ310638 Pde2a 207728 phosphodiesterase 2A, cGMP-stimulatedBG069616 Obfc2a 109019 oligonucleotide/oligosaccharide-bindingAV313559 fold containing 2A Ahnak 66395 AHNAK nucleoprotein (desmoyokin) BE570050 Gcap14 72972 granule cell antiserum positive 14 BM214039 Sel1l3 231238 sel-1 suppressor of lin-12-like 3 (C. elegans)BC026655 Dnajc10 66861 DnaJ (Hsp40) homolog, subfamily C, memberAV114239 10 Celf4 108013 CUGBP, Elav-like family member 4 AV327653 Kcnj14 211480 potassium inwardly-rectifying channel, subfamilyBB282273 J, member 14 Bdh1 71911 3-hydroxybutyrate dehydrogenase, typeBF322712 1 Tenc1 209039 tensin like C1 domain-containing phosphataseBI408679 Farp1 223254 FERM, RhoGEF (Arhgef) and pleckstrin domainBB097480 protein 1 (chondrocyte-derived) Pmepa1 65112 prostate transmembrane protein, androgenAV291712 induced 1 Myo5b 17919 myosin VB AW546331 Cenpn 72155 centromere protein N BM230253 Atp1a2 98660 ATPase, Na+/K+ transporting, alpha 2 polypeptideBB462665 Lrp2 14725 low density lipoprotein receptor-relatedC80829 protein 2 Smarca2 67155 SWI/SNF related, matrix associated, actinBM230202 dependent regulator of chromatin, subfamily a, member 2 Mfsd8 72175 major facilitator superfamily domain containingAV024565 8 Itsn1 16443 intersectin 1 (SH3 domain protein 1A) AA172344 2810459M11Rik 72792 RIKEN cDNA 2810459M11 gene AK013367 Trim16 94092 tripartite motif-containing 16 BB834440 Malat1 72289 metastasis associated lung adenocarcinomaAW012617 transcript 1 (non-coding RNA) Amotl2 56332 angiomotin-like 2 AI156725 Hspa1a 193740 heat shock protein 1A AW763765 Plce1 74055 phospholipase C, epsilon 1 AV306884 Phactr2 215789 phosphatase and actin regulator 2 BB321846 Erdr1 170942 erythroid differentiation regulator 1 AJ007909 Spag4 245865 sperm associated antigen 4 AB041554 C230081A13Rik 244895 RIKEN cDNA C230081A13 gene BC026466 Igk-V28///Igkc///Igkj1///Igkv4-53///Igkv6-23///Igkv8-30110759///16071///16114///384419///546213///637227immunoglobulin kappa chain variable 28AV057155 (V28)///immunoglobulin kappa constant///immunoglobulin kappa joining 1///immunoglobulin kappa variable 4-53///immunoglobulin kappa variable 6-23///immunoglobulin kappa chain variable 8-30 BF719154 BC004065 BB662083 LOC100862072///Loxl2100862072///94352lysyl oxidase homolog 2-like///lysyl oxidase-likeAF117951 2 Slc41a2 338365 solute carrier family 41, member 2 BC026874 Igkv8-30 384419 immunoglobulin kappa chain variable 8-30BG966217 Prr15 78004 proline rich 15 AJ132433 Pcsk5 18552 proprotein convertase subtilisin/kexin typeD17583 5 Hoxb7///Hoxb815415///15416homeobox B7///homeobox B8 X13721 BC005497 Kit 16590 kit oncogene X65997 Defb11 246081 defensin beta 11 AJ437646 LOC641050 641050 uncharacterized protein LOC641050 M11024 Galm 319625 galactose mutarotase AV307219 Gins1 69270 GINS complex subunit 1 (Psf1 homolog)AK013116 1700001C19Rik 75462 RIKEN cDNA 1700001C19 gene AI195035 Bcl2l15 229672 BCLl2-like 15 BG243248 Trp53inp2 68728 transformation related protein 53 inducibleAK003956 nuclear protein 2 Myl1 17901 myosin, light polypeptide 1 AK003182 Page 175 of 205 Diabetes

Zdhhc2 70546 zinc finger, DHHC domain containing 2 BB224658 Zdhhc2 70546 zinc finger, DHHC domain containing 2 BB224658 Zdhhc2 70546 zinc finger, DHHC domain containing 2 BB224658 Tmcc2 68875 transmembrane and coiled-coil domainsAK004359 2 Ahcyl2 74340 S-adenosylhomocysteine hydrolase-likeBG072404 2 Gm10340///Gm10406///Gm10409///Gm2897///Gm3002///Gm3095///Gm3173///Gm3239///Gm3298///Gm3317///Gm3373///Gm3383///Gm3500///Gm3558///Gm3636///Gm3642///Gm3667///Gm3696///Gm3739///Gm5796///LOC100861615100036568///100038847///100040671///100040697///100040852///100041012///100041151///100041262///100041374///100041515///100041530///100041678///100041874///100042054///100042100///100042149///100042235///100169868///100861615///545007///666329predicted gene 10340///predicted geneBM195235 10406///predicted gene 10409///predicted gene 2897///alpha-takusan pseudogene///predicted gene 3095///predicted gene 3173///predicted gene 3239///predicted gene 3298///predicted gene 3317///predicted gene 3373///predicted gene 3383///predicted gene 3500///predicted gene 3558///predicted gene 3636///predicted gene 3642///predicted gene 3667///predicted gene 3696///predicted gene 3739///predicted gene 5796///uncharacterized LOC100861615 Asprv1 67855 aspartic peptidase, retroviral-like 1 AK004007 Creld2 76737 cysteine-rich with EGF-like domains 2 AK017880 Tex261 21766 testis expressed gene 261 AK013971 Fggy 75578 FGGY carbohydrate kinase domain containingAK009249 Cad 69719 carbamoyl-phosphate synthetase 2, aspartateAK010453 transcarbamylase, and dihydroorotase Cad 69719 carbamoyl-phosphate synthetase 2, aspartateAK010453 transcarbamylase, and dihydroorotase Med12l 329650 mediator of RNA polymerase II transcription,BM022689 subunit 12 homolog (yeast)-like Pcp4l1 66425 Purkinje cell protein 4-like 1 AV337888 Pgp 67078 phosphoglycolate phosphatase W59405 Fam166a 68222 family with sequence similarity 166, memberAK016459 A Crct1 74175 cysteine-rich C-terminal 1 AK009010 4933413G19Rik///Foxm1///Pebp114235///23980///71149RIKEN cDNA 4933413G19 gene///forkheadAK008037 box M1///phosphatidylethanolamine binding protein 1 Lrrc18 67580 leucine rich repeat containing 18 AK006063 4930579C15Rik 67753 RIKEN cDNA 4930579C15 gene BG066938 Khdrbs3 13992 KH domain containing, RNA binding, signalAK014353 transduction associated 3 Tex9 21778 testis expressed gene 9 AK008505 Deptor 97998 DEP domain containing MTOR-interactingBB324973 protein Derl3 70377 Der1-like domain family, member 3 AK007348 Mbd1 17190 methyl-CpG binding domain protein 1 AK007371 Serpinf1 20317 serine (or cysteine) peptidase inhibitor, AK012411clade F, member 1 Ankrd40 71452 ankyrin repeat domain 40 AK017451 Mgll 23945 monoglyceride lipase AK006949 Gadd45g 23882 growth arrest and DNA-damage-inducibleAK007410 45 gamma Cetn1 26369 centrin 1 AK015808 Aldoart1 353204 aldolase 1 A retrogene 1 BB016623 Pfn3 75477 profilin 3 AK005930 Pdss1 56075 prenyl (solanesyl) diphosphate synthase,AK012307 subunit 1 Stk31 77485 serine threonine kinase 31 AK021186 Grk4 14772 G protein-coupled receptor kinase 4 AK020792 Rpgrip1 77945 retinitis pigmentosa GTPase regulator interactingAK015037 protein 1 Dpysl3 22240 dihydropyrimidinase-like 3 AV162270 Fam73b 108958 family with sequence similarity 73, memberBI556043 B Slc38a5 209837 solute carrier family 38, member 5 BG066984 Cpa2 232680 carboxypeptidase A2, pancreatic BG141511 Pah 18478 phenylalanine hydroxylase AW106920 Esrp1 207920 epithelial splicing regulatory protein 1 BG070112 Snhg1 83673 small nucleolar RNA host gene (non-proteinBF163381 coding) 1 Mcart1 230125 mitochondrial carrier triple repeat 1 AW212577 Hdc 15186 histidine decarboxylase BG072171 Phgdh 236539 3-phosphoglycerate dehydrogenase AA561726 Dusp9 75590 dual specificity phosphatase 9 AV295798 Hdac11 232232 histone deacetylase 11 BB183559 Clu 12759 clusterin BB433678 Mtm1 17772 X-linked myotubular myopathy gene 1 BG976607 Ibtk 108837 inhibitor of Bruton agammaglobulinemiaBM250711 tyrosine kinase Sin3b 20467 transcriptional regulator, SIN3B (yeast) BF017589 Mogat2 233549 monoacylglycerol O-acyltransferase 2 BB414982 Cox8c 75483 cytochrome c oxidase, subunit VIIIc AA144594 Myzap 102371 myocardial zonula adherens protein BG063148 Kif1b 16561 kinesin family member 1B AV104668 Znrf2 387524 zinc and ring finger 2 BG071922 Znrf2 387524 zinc and ring finger 2 BG071922 Plekha7 233765 pleckstrin homology domain containing,BF159528 family A member 7 Khdc1a 368204 KH domain containing 1A BG067959 Diabetes Page 176 of 205

D430019H16Rik 268595 RIKEN cDNA D430019H16 gene BM116882 Pdzk1ip1 67182 PDZK1 interacting protein 1 AA396586 Ap2a2 11772 adaptor protein complex AP-2, alpha 2 subunitBQ175609 Pigr 18703 polymeric immunoglobulin receptor AV027632 Col1a1 12842 collagen, type I, alpha 1 BI794771 Ighv14-2 668421 immunoglobulin heavy variable 14-2 BE686052 C1qtnf1 56745 C1q and tumor necrosis factor related proteinBI156044 1 Hoxa9 15405 homeobox A9 AA987181 Tspan17 74257 tetraspanin 17 AI844703 Ccnj 240665 cyclin J BB051001 Ndn 17984 necdin AV124445 Olfm1 56177 olfactomedin 1 BB549310 Agr2 23795 anterior gradient 2 (Xenopus laevis) AV066597 Oxct1 67041 3-oxoacid CoA transferase 1 AV213379 4922502D21Rik 381816 RIKEN cDNA 4922502D21 gene AV258142 Fus 233908 fusion, derived from t(12;16) malignantBE985138 liposarcoma (human) BG862223 BB794742 Kcnk1 16525 potassium channel, subfamily K, memberAU043100 1 Slc2a3 20527 solute carrier family 2 (facilitated glucoseBB414515 transporter), member 3 Socs3 12702 suppressor of cytokine signaling 3 BB241535 Chpt1 212862 choline phosphotransferase 1 AI642069 Gas5///Snord47100217446///14455growth arrest specific 5///small nucleolarBI650268 RNA, C/D box 47 Adrb3 11556 adrenergic receptor, beta 3 BB224790 Rbpms 19663 RNA binding protein gene with multipleBG069460 splicing Adamts4 240913 a disintegrin-like and metallopeptidase BG064671(reprolysin type) with thrombospondin type 1 motif, 4 Ccbl2 229905 cysteine conjugate-beta lyase 2 BG094881 Dtna 13527 dystrobrevin alpha BM117918 4930403N07Rik 73936 RIKEN cDNA 4930403N07 gene AV048064 Secisbp2l 70354 SECIS binding protein 2-like BB427489 Svs5 20944 seminal vesicle secretory protein 5 BB799136 Itgb5 16419 integrin beta 5 BB543646 Tstd1 226654 thiosulfate sulfurtransferase (rhodanese)-likeAW111083 domain containing 1 Ndrg1 17988 N-myc downstream regulated gene 1 AV309418 Svs2 53878 seminal vesicle secretory protein 2 BB807675 Itgb5 16419 integrin beta 5 BB543979 Limd2///LOC632329632329///67803LIM domain containing 2///LIM domain-containingAV010467 protein 2-like Ppargc1a 19017 peroxisome proliferative activated receptor,BM120569 gamma, coactivator 1 alpha Rab3il1 74760 RAB3A interacting protein (rabin3)-like 1BG065737 Gm6756///Phgdh236539///6274273-phosphoglycerate dehydrogenase pseudogene///3-phosphoglycerateBB204486 dehydrogenase Esyt3 272636 extended synaptotagmin-like protein 3 BB525078 Osbpl6 99031 oxysterol binding protein-like 6 BG070848 Tcfl5 277353 transcription factor-like 5 (basic helix-loop-helix)AV044715 Prokr1 58182 prokineticin receptor 1 BB037474 Phgdh 236539 3-phosphoglycerate dehydrogenase BB495884 Fxyd2 11936 FXYD domain-containing ion transport regulatorAV002675 2 Eya4 14051 eyes absent 4 homolog (Drosophila) AI646535 3110002H16Rik 76482 RIKEN cDNA 3110002H16 gene BM219457 Gli2 14633 GLI-Kruppel family member GLI2 AW546128 Enpp1 18605 ectonucleotide pyrophosphatase/phosphodiesteraseC76301 1 Iqgap2 544963 IQ motif containing GTPase activating proteinBE631962 2 Tfr2 50765 transferrin receptor 2 AV027486 Slc23a3 22626 solute carrier family 23 (nucleobase transporters),AV293965 member 3 Lasp1 16796 LIM and SH3 protein 1 BC010840 Sfrp1 20377 secreted frizzled-related protein 1 BI658627 Ap1m2 11768 adaptor protein complex AP-1, mu 2 subunitNM_009678 Steap4 117167 STEAP family member 4 NM_054098 Pcp4 18546 Purkinje cell protein 4 NM_008791 Cd52 23833 CD52 antigen NM_013706 Epb4.9 13829 erythrocyte protein band 4.9 NM_013514 Page 177 of 205 Diabetes

Stag3 50878 stromal antigen 3 NM_016964 Syn2 20965 synapsin II NM_013681 Hsd3b2///Hsd3b3///Hsd3b615493///15494///15497hydroxy-delta-5-steroid dehydrogenase,NM_013821 3 beta- and steroid delta-isomerase 2///hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 3///hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 6 Clca1///Clca212722///80797chloride channel calcium activated 1///chlorideAF108501 channel calcium activated 2 Smarca1 93761 SWI/SNF related, matrix associated, actinNM_053123 dependent regulator of chromatin, subfamily a, member 1 Thbs1 21825 thrombospondin 1 AI385532 Acsl1 14081 acyl-CoA synthetase long-chain family memberBI413218 1 Ppargc1a 19017 peroxisome proliferative activated receptor,BB745167 gamma, coactivator 1 alpha Sh3kbp1 58194 SH3-domain kinase binding protein 1 BB326929 Piwil1 57749 piwi-like homolog 1 (Drosophila) AV253931 Krt14 16664 keratin 14 BC011074 Gm12854///S100a11100502897///20195predicted gene 12854///S100 calcium bindingBC021916 protein A11 (calgizzarin) Asrgl1 66514 asparaginase like 1 AU040643 Duoxa1 213696 dual oxidase maturation factor 1 BC019755 Adam2 11495 a disintegrin and metallopeptidase domainU38806 2 Tes 21753 testis derived transcript BC010465 Phf8 320595 PHD finger protein 8 BG070151 Csprs///Gm15433///Gm2666///Gm7592///Gm7609///LOC100041903///LOC100503923100040213///100041903///100503433///100503923///114564///665338///665378component of Sp100-rs///predicted pseudogeneM55219 15433///predicted gene 2666///predicted gene 7592///predicted pseudogene 7609///uncharacterized LOC100041903///uncharacterized LOC100503923 AB041803 232685 cDNA sequence AB041803 AB041803 Adam28 13522 a disintegrin and metallopeptidase domainAV380671 28 Gorasp2 70231 golgi reassembly stacking protein 2 AK010664 Lrriq4 68307 leucine-rich repeats and IQ motif containingAK015024 4 Cldn3 12739 claudin 3 AW611462 Epb4.1l1 13821 erythrocyte protein band 4.1-like 1 BI684958 Trim16 94092 tripartite motif-containing 16 BB033733 Tm7sf2 73166 transmembrane 7 superfamily member BC0147692 Ehmt2 110147 euchromatic histone lysine N-methyltransferaseBI412952 2 BC026585 226527 cDNA sequence BC026585 BC026585 Mc5r 17203 melanocortin 5 receptor NM_013596 Sik2 235344 salt inducible kinase 2 AI505185 BG083989 Etv5 104156 ets variant gene 5 AK003461 Mpzl1 68481 myelin protein zero-like 1 AK003513 Ankrd23 78321 ankyrin repeat domain 23 BG793484 Slc25a1 13358 solute carrier family 25 (mitochondrial carrier,AK005070 citrate transporter), member 1 Mfsd2a 76574 major facilitator superfamily domain containingAK006096 2A Atl1 73991 atlastin GTPase 1 BE948928 Acbd4 67131 acyl-Coenzyme A binding domain containingAK008243 4 8430427H17Rik 329540 RIKEN cDNA 8430427H17 gene AK018446 Arrdc2 70807 arrestin domain containing 2 AW542672 Osbp2 74309 oxysterol binding protein 2 AI326285 Ip6k2 76500 inositol hexaphosphate kinase 2 AK005166 Smarcc2 68094 SWI/SNF related, matrix associated, actinAK013190 dependent regulator of chromatin, subfamily c, member 2 Rab3il1 74760 RAB3A interacting protein (rabin3)-like 1AK004767 Nrn1 68404 neuritin 1 AK003046 Hipk2 15258 homeodomain interacting protein kinaseAK003718 2 Tmem14a 75712 transmembrane protein 14A AK017734 Syn2 20965 synapsin II AK013810 Sorbs1 20411 sorbin and SH3 domain containing 1 BQ176684 1700123L14Rik 78482 nucleoporin 50 pseudogene AV045649 Mlf1ip 71876 myeloid leukemia factor 1 interacting proteinBB667813 Fam115a 77574 family with sequence similarity 115, memberBE944524 A Nt5e 23959 5' nucleotidase, ecto AV273591 Ccdc3 74186 coiled-coil domain containing 3 AK009833 Ldhd 52815 lactate dehydrogenase D AW105779 Ldhd 52815 lactate dehydrogenase D AW105779 Deptor///LOC100505173100505173///97998DEP domain containing MTOR-interactingAK014624 protein///uncharacterized LOC100505173 Ak8 68870 adenylate kinase 8 AK004439 Tns1 21961 tensin 1 AK003780 Phf7 71838 PHD finger protein 7 AK005852 Diabetes Page 178 of 205

Pfn4 382562 profilin family, member 4 BQ174081 Cds1 74596 CDP-diacylglycerol synthase 1 AK014670 Syce1 74075 synaptonemal complex central elementAK016694 protein 1 1700012B07Rik 69324 RIKEN cDNA 1700012B07 gene AK005888 1700007K13Rik 69327 RIKEN cDNA 1700007K13 gene AK005731 2010309G21Rik 70018 RIKEN cDNA 2010309G21 gene AK008551 2010309G21Rik 70018 RIKEN cDNA 2010309G21 gene AK008551 1700008J07Rik 629159 RIKEN cDNA 1700008J07 gene AK005774 Bri3bp 76809 Bri3 binding protein BB028923 Bri3bp 76809 Bri3 binding protein BB028923 Gpc6 23888 glypican 6 AK020118 1110021L09Rik 76306 RIKEN cDNA 1110021L09 gene BB767129 Mfap3l 71306 microfibrillar-associated protein 3-like AK017269 Pabpc6 67543 poly(A) binding protein, cytoplasmic 6 AK014801 1810010H24Rik 69066 RIKEN cDNA 1810010H24 gene BI729991 1700040L02Rik 73287 RIKEN cDNA 1700040L02 gene AK006661 Gstt4 75886 glutathione S-transferase, theta 4 BF319534 Agpat2 67512 1-acylglycerol-3-phosphate O-acyltransferaseAK010891 2 (lysophosphatidic acid acyltransferase, beta) Dusp4 319520 dual specificity phosphatase 4 AK012530 Klhl14 225266 kelch-like 14 (Drosophila) AK018108 Best1 24115 bestrophin 1 AK006549 1300014I06Rik 66895 RIKEN cDNA 1300014I06 gene AK005003 Pdgfrl 68797 platelet-derived growth factor receptor-likeAK004179 2610029I01Rik 77032 RIKEN cDNA 2610029I01 gene AK011611 Tmem182 381339 transmembrane protein 182 AK010233 Fbxo31 76454 F-box protein 31 AK003388 Cmtm2b 75502 CKLF-like MARVEL transmembrane domainAK005970 containing 2B Enkur 71233 enkurin, TRPC channel interacting proteinAK017056 1700013F07Rik 75504 RIKEN cDNA 1700013F07 gene AK005946 Ccdc54 69339 coiled-coil domain containing 54 AK005741 Tctex1d2 66061 Tctex1 domain containing 2 AK007178 Tctex1d2 66061 Tctex1 domain containing 2 AK007178 1700012B09Rik 69325 RIKEN cDNA 1700012B09 gene AK005747 Dynlrb2 75465 dynein light chain roadblock-type 2 AK005789 Mtap7d2 78283 MAP7 domain containing 2 AK021126 Dock11 75974 dedicator of cytokinesis 11 AK017170 Sgms2 74442 sphingomyelin synthase 2 AK016659 Micalcl 100504195 MICAL C-terminal like AK014911 1700019A02Rik 69397 RIKEN cDNA 1700019A02 gene AK006101 Malat1 72289 metastasis associated lung adenocarcinomaAK020483 transcript 1 (non-coding RNA) 1700026D08Rik 75556 RIKEN cDNA 1700026D08 gene AK006375 Arrdc5 76920 arrestin domain containing 5 AK005944 4921509J17Rik///Hspa4l18415///70857RIKEN cDNA 4921509J17 gene///heat shockAK014853 protein 4 like Tln2 70549 talin 2 AV270892 Lrrcc1 71710 leucine rich repeat and coiled-coil domainAK004646 containing 1 Ttc25 74407 tetratricopeptide repeat domain 25 AK016657 1110059M19Rik 68800 RIKEN cDNA 1110059M19 gene AV015858 1700012A03Rik 76382 RIKEN cDNA 1700012A03 gene AK005884 Tekt3 71062 tektin 3 AK016718 Svip 75744 small VCP/p97-interacting protein BF011349 Slc35f2 72022 solute carrier family 35, member F2 BG069340 Gm15453///Rbm3100043257///19652predicted gene 15453///RNA binding motifAK011224 protein 3 Apol6 71939 apolipoprotein L 6 AK010208 Rabgap1l 29809 RAB GTPase activating protein 1-like BB431654 Rabgap1l 29809 RAB GTPase activating protein 1-like BB431654 Col23a1 237759 collagen, type XXIII, alpha 1 BE290548 4930534B04Rik 75216 RIKEN cDNA 4930534B04 gene BE980134 9330171B17Rik100034360 RIKEN cDNA 9330171B17 gene AK015078 Aqp11 66333 aquaporin 11 BF472491 Rassf6 73246 Ras association (RalGDS/AF-6) domain familyAK005472 member 6 Page 179 of 205 Diabetes

4933425D22Rik 66759 RIKEN cDNA 4933425D22 gene AK007161 2610318N02Rik 70458 RIKEN cDNA 2610318N02 gene AK012048 Bmper 73230 BMP-binding endothelial regulator AK014221 Serpinb12 71869 serine (or cysteine) peptidase inhibitor, AK009018clade B (ovalbumin), member 12 Ddah1 69219 dimethylarginine dimethylaminohydrolaseBE283964 1 Gm10413 100041774 predicted gene 10413 AK005583 1700012A16Rik 71836 RIKEN cDNA 1700012A16 gene AK005886 AK019505 Kif2b 73470 kinesin family member 2B AK006866 Hrasls5 66727 HRAS-like suppressor family, member 5AK014971 Cep72 74470 centrosomal protein 72 BB733638 Eid3 66341 EP300 interacting inhibitor of differentiationAV260051 3 4930511M11Rik 75010 RIKEN cDNA 4930511M11 gene BB233319 Tekt5 70426 tektin 5 AK014352 1700016M24Rik 69439 RIKEN cDNA 1700016M24 gene AK006048 Lrrc34 71827 leucine rich repeat containing 34 AK005720 Cypt12 75439 cysteine-rich perinuclear theca 12 AK005586 Grap 71520 GRB2-related adaptor protein AK018457 Acpl2 235534 acid phosphatase-like 2 BB183525 Fam71d 70897 family with sequence similarity 71, memberAK014851 D Rnf125 67664 ring finger protein 125 BB667823 Slco6c1 74441 solute carrier organic anion transporterAV254330 family, member 6c1 Tbc1d21 74286 TBC1 domain family, member 21 AK007086 Nlrp14 76858 NLR family, pyrin domain containing 14AK014932 Cpm 70574 carboxypeptidase M AK017670 Riiad1 66353 regulatory subunit of type II PKA R-subunitAK009192 (RIIa) domain containing 1 Cst13 69294 cystatin 13 AK005665 Efcab3 70894 EF-hand calcium binding domain 3 AK014861 Samd4 74480 sterile alpha motif domain containing 4BF319665 1700026J04Rik 71864 RIKEN cDNA 1700026J04 gene AK006388 Gpr115 78249 G protein-coupled receptor 115 AK019508 1700010M22Rik 66328 RIKEN cDNA 1700010M22 gene AK005847 Slc26a3 13487 solute carrier family 26, member 3 BB118542 Spdya 70891 speedy homolog A (Xenopus laevis) AK014910 1110017D15Rik 73721 RIKEN cDNA 1110017D15 gene AK003742 6720463M24Rik 77744 RIKEN cDNA 6720463M24 gene AK020138 Ddi1 71829 DDI1, DNA-damage inducible 1, homologAK005882 1 (S. cerevisiae) 1700003H04Rik 384775 RIKEN cDNA 1700003H04 gene AK005639 Nkd1 93960 naked cuticle 1 homolog (Drosophila) AK020249 Lsm12 268490 LSM12 homolog (S. cerevisiae) BB771548 2810410L24Rik100042332 RIKEN cDNA 2810410L24 gene AK013071 4933402E13Rik 74437 RIKEN cDNA 4933402E13 gene AK016614 Zpbp2 69376 zona pellucida binding protein 2 AK006058 1700019M22Rik 69423 RIKEN cDNA 1700019M22 gene AK006132 Ankrd42 73845 ankyrin repeat domain 42 BB796723 Myo1f 17916 myosin IF AK021181 1700007B14Rik 71831 RIKEN cDNA 1700007B14 gene BF153008 4930423K06Rik100502740 RIKEN cDNA 4930423K06 gene BB525750 4930578I06Rik 67750 RIKEN cDNA 4930578I06 gene AK005778 4930579G22Rik 69034 RIKEN cDNA 4930579G22 gene AK007417 Wdr16 71860 WD repeat domain 16 AK006118 Spaca1 67652 sperm acrosome associated 1 AK006187 Nsun7 70918 NOL1/NOP2/Sun domain family, memberAK014968 7 Dmrtc1a 70887 DMRT-like family C1a AK014934 Ms4a13 73466 membrane-spanning 4-domains, subfamilyAK006841 A, member 13 Iqcf4 67320 IQ motif containing F4 AK006688 Prss52 73382 protease, serine, 52 AK006746 Ankrd7 75196 ankyrin repeat domain 7 AV042608 Adora3 11542 adenosine A3 receptor AK005581 1700034E13Rik 78414 RIKEN cDNA 1700034E13 gene AK018840 Diabetes Page 180 of 205

Ccdc89 70054 coiled-coil domain containing 89 BB470050 1700010D01Rik///Gm5941546347///76386RIKEN cDNA 1700010D01 gene///predictedAK005817 gene 5941 1700025F22Rik 69416 RIKEN cDNA 1700025F22 gene AK006335 Zfand4 67492 zinc finger, AN1-type domain 4 AK012639 Prss56 69453 protease, serine 56 AK006434 Spata1 70951 spermatogenesis associated 1 AK015003 Kctd16 383348 potassium channel tetramerisation domainAV208947 containing 16 1700113H08Rik 76640 RIKEN cDNA 1700113H08 gene AK007195 1700023A16Rik///LOC100862499100862499///69371RIKEN cDNA 1700023A16 gene///uncharacterizedAK006257 LOC100862499 AK008862 Fam46c 74645 family with sequence similarity 46, memberAK015259 C Cox7b2 78174 cytochrome c oxidase subunit VIIb2 BB615400 Izumo1 73456 izumo sperm-egg fusion 1 AK006830 Izumo2 75510 IZUMO family member 2 AK006268 3110040M04Rik 73176 RIKEN cDNA 3110040M04 gene AV000681 Mageb16 71967 melanoma antigen family B, 16 AK010362 Iqcf5 75470 IQ motif containing F5 AK005734 Etohi1///Gm14288///Gm14306///Gm14431///Gm14435///Gm14436///Gm14440///Gm4245///Gm4723///Gm8898100043126///100043914///100190996///100302432///100303732///100503353///100503949///13999///626848///667962ethanol induced 1///predicted gene 14288///predictedAK005093 gene 14306///predicted gene 14431///predicted gene 14435///predicted gene 14436///predicted gene 14440///predicted gene 4245///predicted gene 4723///predicted gene 8898 4632434I11Rik 74041 RIKEN cDNA 4632434I11 gene AK014608 Crls1 66586 cardiolipin synthase 1 AK016165 4931407G18Rik 70977 RIKEN cDNA 4931407G18 gene BB667158 Efcab9 69306 EF-hand calcium binding domain 9 AK005716 1700009N14Rik 75471 RIKEN cDNA 1700009N14 gene AK005799 Zswim2 71861 zinc finger, SWIM domain containing 2 AK006367 4933406F09Rik 68308 RIKEN cDNA 4933406F09 gene AV279187 Spaca7 78634 sperm acrosome associated 7 AK018926 2810013P06Rik100503178 RIKEN cDNA 2810013P06 gene BM246000 Ccdc39 51938 coiled-coil domain containing 39 AK014839 Arpm1 76652 actin related protein M1 BB343185 1700001L05Rik 69291 RIKEN cDNA 1700001L05 gene AK005608 1700021F07Rik 72221 RIKEN cDNA 1700021F07 gene AK006200 Izumo3 69314 IZUMO family member 3 AK005867 Rictor 78757 RPTOR independent companion of MTOR,BM123174 complex 2 Armc3 70882 armadillo repeat containing 3 AK014880 Armc3 70882 armadillo repeat containing 3 AK014880 4930550C14Rik 75311 RIKEN cDNA 4930550C14 gene AK016083 Tmem225 75667 transmembrane protein 225 AK006538 1700010B08Rik 75485 RIKEN cDNA 1700010B08 gene AK005811 1700024P04Rik 69382 RIKEN cDNA 1700024P04 gene AK006311 9530003J23Rik 77397 RIKEN cDNA 9530003J23 gene AK020538 Spag16 66722 sperm associated antigen 16 AK016618 Mdh1b 76668 malate dehydrogenase 1B, NAD (soluble)AK007262 1700003M02Rik 69329 RIKEN cDNA 1700003M02 gene AK005650 Ccdc57 71276 coiled-coil domain containing 57 AK017054 1700018C11Rik 75524 RIKEN cDNA 1700018C11 gene AK006081 2900092C05Rik 73090 RIKEN cDNA 2900092C05 gene AV263708 Ppp1r2-ps7 76705 protein phosphatase 1, regulatory (inhibitor)AV209209 subunit 2, pseudogene 7 2900092D14Rik 73100 RIKEN cDNA 2900092D14 gene BB807002 1700011E24Rik 75467 RIKEN cDNA 1700011E24 gene AK005861 1700020N01Rik 67692 RIKEN cDNA 1700020N01 gene AK006179 1700034J05Rik 73344 RIKEN cDNA 1700034J05 gene BB667178 Lrriq3 74435 leucine-rich repeats and IQ motif containingAV253991 3 Ltn1 78913 listerin E3 ubiquitin protein ligase 1 AK019706 5830408B19Rik 74756 RIKEN cDNA 5830408B19 gene BE135996 5330406M23Rik 76671 RIKEN cDNA 5330406M23 gene BM241296 Prr5l 72446 proline rich 5 like AK014682 Sun5 76407 Sad1 and UNC84 domain containing 5 AK006225 Spata3 70060 spermatogenesis associated 3 AK005880 Ctag2 70062 cancer/testis antigen 2 AK006526 Ccdc19 71870 coiled-coil domain containing 19 AK006449 Page 181 of 205 Diabetes

Lcn12 77701 lipocalin 12 AK020307 Pih1d2 72614 PIH1 domain containing 2 BC019481 Mospd4 72076 motile sperm domain containing 4 AV265561 1700021C14Rik 76927 RIKEN cDNA 1700021C14 gene AK006195 Spaca3 75622 sperm acrosome associated 3 AK006357 Txnrd2 26462 thioredoxin reductase 2 BE948556 Lrrc63 70859 leucine rich repeat containing 63 AK014850 Prss54 70993 protease, serine, 54 AK016501 1700008A04Rik 69351 RIKEN cDNA 1700008A04 gene AK005748 Gm10471///Gm5862///Gm7347///Speer4b100039045///545739///664804///73526predicted gene 10471///predicted geneAK006975 5862///predicted gene 7347///spermatogenesis associated glutamate (E)-rich protein 4b Il31 76399 interleukin 31 AK005939 Iqcf1 74267 IQ motif containing F1 AK006797 Wdr20b 70948 WD repeat domain 20b AK015014 Hsfy2 71066 heat shock transcription factor, Y linkedAK016803 2 4930584F24Rik 75942 RIKEN cDNA 4930584F24 gene AK016349 Spata24 71242 spermatogenesis associated 24 AK017218 4930415F15Rik 73862 RIKEN cDNA 4930415F15 gene AK015144 Hyal6 74409 hyaluronoglucosaminidase 6 AV260265 Lrrc57 66606 leucine rich repeat containing 57 AK015684 4930571K23Rik 75861 RIKEN cDNA 4930571K23 gene AK016274 1700057K13Rik 73435 RIKEN cDNA 1700057K13 gene AK006825 Wdr64 75820 WD repeat domain 64 AK015753 1700001P01Rik 72215 RIKEN cDNA 1700001P01 gene AK005619 2900017F05Rik 72915 RIKEN cDNA 2900017F05 gene AK013544 Rnf148 71300 ring finger protein 148 AK017027 Trp53tg5 73603 transformation related protein 53 targetAV264266 5 Acbd7 78245 acyl-Coenzyme A binding domain containingAK020348 7 1700006E09Rik 75437 RIKEN cDNA 1700006E09 gene AK005669 Dnase2a 13423 deoxyribonuclease II alpha AK018651 1700017N19Rik 66605 RIKEN cDNA 1700017N19 gene AV265988 4930426D05Rik 74644 RIKEN cDNA 4930426D05 gene AK015205 Stk17b 98267 serine/threonine kinase 17b (apoptosis-inducing)AI661948 1700007K09Rik 69318 RIKEN cDNA 1700007K09 gene AV259535 H1fnt 70069 H1 histone family, member N, testis-specificAK006402 1700006J14Rik 321010 RIKEN cDNA 1700006J14 gene AK011105 Odam 69592 odontogenic, ameloblast asssociated AK009298 4930404H21Rik 73808 RIKEN cDNA 4930404H21 gene AK015080 2610020H08Rik 434234 RIKEN cDNA 2610020H08 gene BB103211 2610020H08Rik 434234 RIKEN cDNA 2610020H08 gene BB103211 Lrguk 74354 leucine-rich repeats and guanylate kinaseAK014976 domain containing 4933407E14Rik 71017 RIKEN cDNA 4933407E14 gene AW050308 4933424G06Rik 71166 RIKEN cDNA 4933424G06 gene AK016893 Glipr1l1 69286 GLI pathogenesis-related 1 like 1 AK005860 4933437F05Rik 71275 RIKEN cDNA 4933437F05 gene BB217068 1110005A03Rik 74319 RIKEN cDNA 1110005A03 gene AK016897 4930518J20Rik 67589 RIKEN cDNA 4930518J20 gene BF011273 Spata18 73472 spermatogenesis associated 18 AK006916 Adamts9 101401 a disintegrin-like and metallopeptidase BG141912(reprolysin type) with thrombospondin type 1 motif, 9 5730409N24Rik 70485 RIKEN cDNA 5730409N24 gene AI606154 Atf7ip2 75329 activating transcription factor 7 interactingAI429259 protein 2 1700019D03Rik 67080 RIKEN cDNA 1700019D03 gene AK006110 Lrrc9 78257 leucine rich repeat containing 9 AK019545 BM220939 9530086O07Rik 78741 RIKEN cDNA 9530086O07 gene AK020657 LOC75771 75771 uncharacterized LOC75771 BM239430 1700020A23Rik 75656 RIKEN cDNA 1700020A23 gene AK006141 4933438K21Rik 71270 RIKEN cDNA 4933438K21 gene AK017111 4921511H03Rik 70920 RIKEN cDNA 4921511H03 gene AK014870 Cpne8 66871 copine VIII AW548480 1700020N15Rik///Gm6812627927///75509RIKEN cDNA 1700020N15 gene///predictedAK006180 gene 6812 Diabetes Page 182 of 205

Tsc22d2 72033 TSC22 domain family, member 2 BB045401 Lipm 78753 lipase, family member M BB151055 Lipm 78753 lipase, family member M BB151055 Spink5 72432 serine peptidase inhibitor, Kazal type 5 AV241297 Cdkn3 72391 cyclin-dependent kinase inhibitor 3 AK010426 Car3 12350 carbonic anhydrase 3 BB213876 Vgll3 73569 vestigial like 3 (Drosophila) BG066866 4930520K10Rik 67587 RIKEN cDNA 4930520K10 gene AV266799 4833423F13Rik100504504 RIKEN cDNA 4833423F13 gene AW764291 Prkar2b 19088 protein kinase, cAMP dependent regulatory,BI695530 type II beta Wbscr25 71304 Williams Beuren syndrome chromosomeAK017044 region 25 (human) 1700016C15Rik 69428 RIKEN cDNA 1700016C15 gene AV266242 Lrp2bp 67620 Lrp2 binding protein AV278610 Pnpla5 75772 patatin-like phospholipase domain containingAV250770 5 Pebp4 73523 phosphatidylethanolamine binding proteinAK006750 4 Spata16 70862 spermatogenesis associated 16 AV254593 4930452G13Rik 73989 RIKEN cDNA 4930452G13 gene BF018617 Usp50 75083 ubiquitin specific peptidase 50 AV284294 4833427G06Rik 235345 RIKEN cDNA 4833427G06 gene AK014780 Ak7 78801 adenylate kinase 7 AV256298 Gprin3 243385 GPRIN family member 3 BB359379 4930449C09Rik 73994 RIKEN cDNA 4930449C09 gene BF152921 Crem 12916 cAMP responsive element modulator AK015641 Plcb4 18798 phospholipase C, beta 4 BB283066 1700011F03Rik 74221 RIKEN cDNA 1700011F03 gene AK005862 Nudt7 67528 nudix (nucleoside diphosphate linked moietyAK008824 X)-type motif 7 2900002J02Rik 70412 RIKEN cDNA 2900002J02 gene AV150162 9430064K01Rik 77294 RIKEN cDNA 9430064K01 gene BB098581 Cd47 16423 CD47 antigen (Rh-related antigen, integrin-associatedAI882525 signal transducer) Ttll9 74711 tubulin tyrosine ligase-like family, memberBB638308 9 Galntl6 270049 UDP-N-acetyl-alpha-D-galactosamine:polypeptideBB611374 N-acetylgalactosaminyltransferase-like 6 4930522H14Rik 67646 RIKEN cDNA 4930522H14 gene AK015869 Prr16 71373 proline rich 16 AI120070 1700110M21Rik 76627 RIKEN cDNA 1700110M21 gene AI046584 Gm2762 100040421 predicted gene 2762 AK006343 Fam53b 77938 family with sequence similarity 53, memberAK020830 B 1810019D21Rik 69771 RIKEN cDNA 1810019D21 gene BE630331 4930503B20Rik 75015 RIKEN cDNA 4930503B20 gene AK015685 4930578N16Rik 75051 RIKEN cDNA 4930578N16 gene AI451448 2810416G20Rik100040353 RIKEN cDNA 2810416G20 gene AI119761 Lrrc3 237387 leucine rich repeat containing 3 AI451838 Hyls1 76832 hydrolethalus syndrome 1 BM570636 Dmrtc1a 70887 DMRT-like family C1a AI430409 Spem1 74288 sperm maturation 1 AK007080 Mtap7d2 78283 MAP7 domain containing 2 AK019929 Spint4 78239 serine protease inhibitor, Kunitz type 4 BB073296 Slco6d1 70866 solute carrier organic anion transporterAK014872 family, member 6d1 4930444P10Rik 75799 RIKEN cDNA 4930444P10 gene AK015384 Ccdc30 73332 coiled-coil domain containing 30 AK015391 Tomm20l 75266 translocase of outer mitochondrial membraneAK016101 20 homolog (yeast)-like Crisp4 78081 cysteine-rich secretory protein 4 BB073566 9230110F15Rik 77080 RIKEN cDNA 9230110F15 gene AK020329 4932414N04Rik 75721 RIKEN cDNA 4932414N04 gene AV254510 5830427D02Rik 76042 RIKEN cDNA 5830427D02 gene BE225800 Satl1 73809 spermidine/spermine N1-acetyl transferase-likeAK015086 1 4930528F23Rik 75178 RIKEN cDNA 4930528F23 gene AK015924 4930557A04Rik 385317 RIKEN cDNA 4930557A04 gene AK016155 Tia1 21841 cytotoxic granule-associated RNA bindingAK009502 protein 1 Mpped2 77015 metallophosphoesterase domain containingAK012553 2 4930578N16Rik 75051 RIKEN cDNA 4930578N16 gene BE282424 Page 183 of 205 Diabetes

Cdhr4 69398 cadherin-related family member 4 AK006216 Tmed5 73130 transmembrane emp24 protein transportAK014065 domain containing 5 Syde1 71709 synapse defective 1, Rho GTPase, homologAK004654 1 (C. elegans) 4931408D14Rik 77059 RIKEN cDNA 4931408D14 gene AK016444 Ccdc81 70884 coiled-coil domain containing 81 AK014876 4933432B09Rik 75729 RIKEN cDNA 4933432B09 gene AK017017 Nme8 73412 NME/NM23 family member 8 AK006819 4933427G17Rik 74466 RIKEN cDNA 4933427G17 gene AK016951 4933427G17Rik 74466 RIKEN cDNA 4933427G17 gene AK016951 4931423N10Rik 70981 RIKEN cDNA 4931423N10 gene AK016475 1700006A11Rik 71824 RIKEN cDNA 1700006A11 gene AK005660 Gcap14 72972 granule cell antiserum positive 14 AK005931 Rnf38 73469 ring finger protein 38 AK006888 Lrp2bp 67620 Lrp2 binding protein AK006731 Veph1 72789 ventricular zone expressed PH domain homologAK013398 1 (zebrafish) Lrriq3 74435 leucine-rich repeats and IQ motif containingAK015758 3 Lrriq3 74435 leucine-rich repeats and IQ motif containingAK015758 3 Mettl4-ps1///Spdya668740///70891methyltransferase like 4, pseudogene 1///speedyAK016064 homolog A (Xenopus laevis) 1700028J19Rik 70004 RIKEN cDNA 1700028J19 gene AK006462 Zswim2 71861 zinc finger, SWIM domain containing 2 AK017097 Tmco5b 75275 transmembrane and coiled-coil domainsAK016214 5B 1700017D01Rik 69369 RIKEN cDNA 1700017D01 gene AK006056 Mpp7 75739 membrane protein, palmitoylated 7 (MAGUKAK012883 p55 subfamily member 7) Bpifa3 73388 BPI fold containing family A, member 3 AK006829 Zcchc13 75064 zinc finger, CCHC domain containing 13AK015789 1700027D21Rik 76573 RIKEN cDNA 1700027D21 gene AK006232 Ccny 67974 cyclin Y AK014201 2210039B01Rik 73644 RIKEN cDNA 2210039B01 gene AK008780 Cenpp 66336 centromere protein P AK014919 Spata3 70060 spermatogenesis associated 3 AK015193 Phf7 71838 PHD finger protein 7 AK005673 4930511M11Rik 75010 RIKEN cDNA 4930511M11 gene AK019559 4930505A04Rik 75087 RIKEN cDNA 4930505A04 gene AK015698 Ces5a 67935 carboxylesterase 5A AK007235 Tmem217 71138 transmembrane protein 217 AK016810 Fam71e1 75538 family with sequence similarity 71, memberAK006222 E1 Camsap3 69697 calmodulin regulated spectrin-associatedAK009960 protein family, member 3 Lcn9 77704 lipocalin 9 AK020305 Lyzl6 69444 lysozyme-like 6 AK006279 Lyzl6 69444 lysozyme-like 6 AK006279 1700009J07Rik 75188 RIKEN cDNA 1700009J07 gene AK015973 1700001C02Rik 75434 RIKEN cDNA 1700001C02 gene AK005574 Ccdc46 76380 coiled-coil domain containing 46 AK005611 1700108M19Rik 71156 RIKEN cDNA 1700108M19 gene AK007140 9230104L09Rik 77705 RIKEN cDNA 9230104L09 gene AK020314 Tepp 73407 testis, prostate and placenta expressedAK006802 Dcst1 77772 DC-STAMP domain containing 1 AK020737 Tmem190 78052 transmembrane protein 190 AK019807 Fam183b 75429 family with sequence similarity 183, memberAK013920 B 1110006G14Rik 68469 RIKEN cDNA 1110006G14 gene AK003497 Tmsb15a 78478 thymosin beta 15a AK018998 Cby3 76653 chibby homolog 3 (Drosophila) BF152799 Zfp711 245595 zinc finger protein 711 AK013051 2900011L18Rik 77082 RIKEN cDNA 2900011L18 gene AK019313 4933435G04Rik 71237 RIKEN cDNA 4933435G04 gene BF152773 2900046L07Rik 73027 RIKEN cDNA 2900046L07 gene AK013658 4930488N24Rik 75011 RIKEN cDNA 4930488N24 gene AK015649 4930448K20Rik 74662 glyceraldehyde-3-phosphate dehydrogenaseAK005798 pseudogene Ednra 13617 endothelin receptor type A AW558570 Pamr1 210622 peptidase domain containing associatedAU067747 with muscle regeneration 1 Diabetes Page 184 of 205

Lrp11 237253 low density lipoprotein receptor-relatedBB435348 protein 11 Hoxd8 15437 homeobox D8 BF785056 Capn3 12335 calpain 3 AI323605 Hn1l 52009 hematological and neurological expressedAV116987 1-like Gabra4 14397 gamma-aminobutyric acid (GABA) A receptor,BB430205 subunit alpha 4 Gfra2 14586 glial cell line derived neurotrophic factorBB284482 family receptor alpha 2 Slc13a4 243755 solute carrier family 13 (sodium/sulfateBB192951 symporters), member 4 Tmem64 100201 transmembrane protein 64 BG075363 Palld 72333 palladin, cytoskeletal associated proteinBG071905 Rab9b 319642 RAB9B, member RAS oncogene family BB084626 Agpat3 28169 1-acylglycerol-3-phosphate O-acyltransferaseAV296997 3 Fam40b 320609 family with sequence similarity 40, memberBB098407 B Lgr4 107515 leucine-rich repeat-containing G protein-coupledBI107632 receptor 4 Epn2 13855 epsin 2 BG794880 Cdkl4 381113 cyclin-dependent kinase-like 4 AU067824 Hs3st3b1 54710 heparan sulfate (glucosamine) 3-O-sulfotransferaseBG918344 3B1 Shroom2 110380 shroom family member 2 BQ176992 Arnt2 11864 aryl hydrocarbon receptor nuclear translocatorBQ174321 2 Zfp692 103836 zinc finger protein 692 BB037019 AA467197 433470 expressed sequence AA467197 BG961961 Hspa12a 73442 heat shock protein 12A BQ177161 AI662270 100043636 expressed sequence AI662270 BE688410 Gprasp2///LOC100504991100504991///245607G protein-coupled receptor associated sortingBB028100 protein 2///uncharacterized LOC100504991 Slc4a4 54403 solute carrier family 4 (anion exchanger),BB283443 member 4 4930402H24Rik 228602 RIKEN cDNA 4930402H24 gene BB667775 Lhfpl2 218454 lipoma HMGIC fusion partner-like 2 BG917242 Lhfpl2 218454 lipoma HMGIC fusion partner-like 2 BG917242 Slc16a12 240638 solute carrier family 16 (monocarboxylicAV220703 acid transporters), member 12 Chrdl1 83453 chordin-like 1 AV144145 Fam107a 268709 family with sequence similarity 107, memberBF682848 A Mical3 194401 microtubule associated monoxygenase,BB698852 calponin and LIM domain containing 3 LOC100044374///Oscp1100044374///230751protein OSCP1-like///organic solute carrierBG695079 partner 1 4632434I11Rik 74041 RIKEN cDNA 4632434I11 gene BB463610 Ldhal6b 106557 lactate dehydrogenase A-like 6B AV278619 Gm3925 100042605 predicted gene 3925 AV267027 Ank2 109676 ankyrin 2, brain BQ174638 Ank2 109676 ankyrin 2, brain BQ174638 Mycbp2 105689 MYC binding protein 2 AW107953 Zeb2 24136 zinc finger E-box binding homeobox 2 BQ174116 Tmem64 100201 transmembrane protein 64 AW489972 BM249454 1700008K24Rik 69311 RIKEN cDNA 1700008K24 gene BE456692 Cd44 12505 CD44 antigen AW146109 Fam73a 215708 family with sequence similarity 73, memberBB375245 A Col12a1 12816 collagen, type XII, alpha 1 BB114398 Foxred2 239554 FAD-dependent oxidoreductase domainBM227994 containing 2 D330028D13Rik 231946 RIKEN cDNA D330028D13 gene BB478071 Met 17295 met proto-oncogene BG060788 Fst 14313 follistatin BB444134 Zfyve28 231125 zinc finger, FYVE domain containing 28 BB132074 Odz4 23966 odd Oz/ten-m homolog 4 (Drosophila) BQ175876 Dsc3 13507 desmocollin 3 BB006344 Hdac9///LOC100861990100861990///79221histone deacetylase 9///histone deacetylaseBB750646 9-like 2410066E13Rik 68235 RIKEN cDNA 2410066E13 gene BB167663 Erc2 238988 ELKS/RAB6-interacting/CAST family memberAV173869 2 AV230978 Klhl29 208439 kelch-like 29 (Drosophila) BI988550 C530008M17Rik 320827 RIKEN cDNA C530008M17 gene BB493717 Atg4a 666468 autophagy related 4A, cysteine peptidaseBM237732 Mbnl3 171170 muscleblind-like 3 (Drosophila) AV306759 Page 185 of 205 Diabetes

Vhl 22346 von Hippel-Lindau tumor suppressor BG073142 Gramd1c 207798 GRAM domain containing 1C AV255657 Tmem146 106757 transmembrane protein 146 AV278444 Rap1gap2 380711 RAP1 GTPase activating protein 2 AU067654 5430421B17 330593 uncharacterized protein 5430421B17 AV292354 Kirrel 170643 kin of IRRE like (Drosophila) BB054275 Atp6v0d2 242341 ATPase, H+ transporting, lysosomal V0 subunitBB769890 D2 Sv2b 64176 synaptic vesicle glycoprotein 2 b BQ175909 Cage1 71213 cancer antigen 1 AI449799 Cage1 71213 cancer antigen 1 AI449799 BB259283 Nipa1 233280 non imprinted in Prader-Willi/AngelmanBB326329 syndrome 1 homolog (human) Rragd 52187 Ras-related GTP binding D BF462770 Slc9a6 236794 solute carrier family 9 (sodium/hydrogenBB611738 exchanger), member 6 Slc9a6 236794 solute carrier family 9 (sodium/hydrogenBB611738 exchanger), member 6 Arhgef4 226970 Rho guanine nucleotide exchange factorAV024939 (GEF) 4 Aspg 104816 asparaginase homolog (S. cerevisiae) BI146987 D10Bwg1379e 215821 DNA segment, Chr 10, Brigham & Women'sBB353607 Genetics 1379 expressed 4930455F23Rik 74895 RIKEN cDNA 4930455F23 gene BB667167 C730049O14Rik 320117 RIKEN cDNA C730049O14 gene BB200607 C030009O12Rik 77328 RIKEN cDNA C030009O12 gene BE980202 2810416G20Rik100040353 RIKEN cDNA 2810416G20 gene BB667085 Chl1 12661 cell adhesion molecule with homology toBB378591 L1CAM Ntrk2 18212 neurotrophic tyrosine kinase, receptor, BB795585type 2 Pou3f3 18993 POU domain, class 3, transcription factorBE993443 3 Dixdc1 330938 DIX domain containing 1 BB758432 P2rx2 231602 purinergic receptor P2X, ligand-gated ionBE948568 channel, 2 Emilin2 246707 elastin microfibril interfacer 2 BB811788 Ntrk2 18212 neurotrophic tyrosine kinase, receptor, AI848316type 2 Tph2 216343 tryptophan hydroxylase 2 BG071575 Dock10 210293 dedicator of cytokinesis 10 BF715043 Bend5 67621 BEN domain containing 5 AA189197 Kcnj15 16516 potassium inwardly-rectifying channel, subfamilyBB533892 J, member 15 4732415M23Rik 320869 RIKEN cDNA 4732415M23 gene BB614874 2210020M01Rik 66528 RIKEN cDNA 2210020M01 gene BE852759 Synpo2 118449 synaptopodin 2 AV092324 Tcam1 75870 testicular cell adhesion molecule 1 AV255830 Syce3 75459 synaptonemal complex central elementBF018978 protein 3 Pisd///Pisd-ps3320951///66776phosphatidylserine decarboxylase///phosphatidylserineAV212090 decarboxylase, pseudogene 3 Cttnbp2 30785 cortactin binding protein 2 BB357580 Slc5a3 53881 solute carrier family 5 (inositol transporters),BM729431 member 3 Letm2 270035 leucine zipper-EF-hand containing transmembraneAW060955 protein 2 Rab26 328778 RAB26, member RAS oncogene family BB270778 Gal3st4///Gpc2330217///71951galactose-3-O-sulfotransferase 4///glypicanBF147815 2 (cerebroglycan) Mmd 67468 monocyte to macrophage differentiation-associatedAA472735 Nexn 68810 nexilin BM225804 Abhd2 54608 abhydrolase domain containing 2 BG070904 Slc27a1 26457 solute carrier family 27 (fatty acid transporter),AI156620 member 1 Tfap2b 21419 transcription factor AP-2 beta AV237028 AI448005 98965 expressed sequence AI448005 BB756663 2610017I09Rik 66297 RIKEN cDNA 2610017I09 gene AW045679 Gm19935 100503868 predicted gene, 19935 AV280625 Agphd1 235386 aminoglycoside phosphotransferase domainBB209207 containing 1 Tln2 70549 talin 2 BQ174291 Zscan18 232875 zinc finger and SCAN domain containingBB305660 18 Rfx8 619289 regulatory factor X 8 AV278248 Pde8b 218461 phosphodiesterase 8B BB312125 Klhl23 277396 kelch-like 23 (Drosophila) AW548377 Wscd2 320916 WSC domain containing 2 AV280210 BB833422 Diabetes Page 186 of 205

Nat8l 269642 N-acetyltransferase 8-like AI644670 Jakmip3 74004 janus kinase and microtubule interactingBB013412 protein 3 Fads3 60527 fatty acid desaturase 3 BM235658 Ociad2 433904 OCIA domain containing 2 BM937735 LOC100502684100502684 uncharacterized LOC100502684 AV282519 1110059G02Rik 68786 RIKEN cDNA 1110059G02 gene BM570681 Spink8 78709 serine peptidase inhibitor, Kazal type 8 BB284475 Cmah 12763 cytidine monophospho-N-acetylneuraminicBM245957 acid hydroxylase Snhg12 100039864 small nucleolar RNA host gene 12 BI180630 Sfrp5 54612 secreted frizzled-related sequence proteinBQ175837 5 Bche 12038 butyrylcholinesterase BB667452 Rab3ip 216363 RAB3A interacting protein AV235634 Ccdc74a 72315 coiled-coil domain containing 74A BG068839 Ccdc74a 72315 coiled-coil domain containing 74A BG068839 AI317395 215929 expressed sequence AI317395 BE980249 Tmem212 208613 transmembrane protein 212 BB530769 Gm266 212539 predicted gene 266 BB829749 Dnali1 75563 dynein, axonemal, light intermediate polypeptideBE980690 1 Adam6a///Adam6b238405///238406a disintegrin and metallopeptidase domainAV255799 6A///a disintegrin and metallopeptidase domain 6B C730029A08Rik 320926 RIKEN cDNA C730029A08 gene BB428892 BB428892 Plekha2 83436 pleckstrin homology domain-containing,BE852755 family A (phosphoinositide binding specific) member 2 Nqo2 18105 NAD(P)H dehydrogenase, quinone 2 AV380561 Malat1 72289 metastasis associated lung adenocarcinomaAI853644 transcript 1 (non-coding RNA) 1110059G02Rik 68786 RIKEN cDNA 1110059G02 gene BM730637 1110059G02Rik 68786 RIKEN cDNA 1110059G02 gene BM730637 Ipmk 69718 inositol polyphosphate multikinase BB081797 Itgb8 320910 integrin beta 8 BB504737 Ttc9 69480 tetratricopeptide repeat domain 9 BE947764 B230214O09Rik 319319 RIKEN cDNA B230214O09 gene BM211445 BB131085 Slc26a7 208890 solute carrier family 26, member 7 AV292356 Ccdc113 244608 coiled-coil domain containing 113 AV279772 Wfdc15a 68221 WAP four-disulfide core domain 15A AV205574 Ankrd29 225187 ankyrin repeat domain 29 AV337707 Dnaic2 432611 dynein, axonemal, intermediate chain 2BE946605 Pgap1 241062 post-GPI attachment to proteins 1 BM115569 Egr3 13655 early growth response 3 AV346607 Hspb6 243912 heat shock protein, alpha-crystallin-related,BB755506 B6 Samd4 74480 sterile alpha motif domain containing 4AW107196 BB033554 Rprml 104582 reprimo-like BE946298 Arhgef33 381112 Rho guanine nucleotide exchange factorBB346846 (GEF) 33 Frk 14302 fyn-related kinase BB831042 BC049762 193286 cDNA sequence BC049762 AV264828 1700016G14Rik 666145 RIKEN cDNA 1700016G14 gene AV266901 Rbfox3 52897 RNA binding protein, fox-1 homolog (C. BE945919elegans) 3 Tmem194 210035 transmembrane protein 194 AV239972 1700012O15Rik 75488 RIKEN cDNA 1700012O15 gene AI449821 BC048546 232400 cDNA sequence BC048546 BF302511 Irak2 108960 interleukin-1 receptor-associated kinaseAV241470 2 Dclk3 245038 doublecortin-like kinase 3 BB326709 Fgfr1 14182 fibroblast growth factor receptor 1 AW494469 Slc7a2 11988 solute carrier family 7 (cationic amino acidAV244175 transporter, y+ system), member 2 Tmem139 109218 transmembrane protein 139 BB534983 Prex2 109294 phosphatidylinositol-3,4,5-trisphosphate-dependentBB360125 Rac exchange factor 2 Fam26f 215900 family with sequence similarity 26, memberBB239429 F 1700016K19Rik 74230 RIKEN cDNA 1700016K19 gene AV260052 Tox3 244579 TOX high mobility group box family memberBM119957 3 Cetn4 207175 centrin 4 AV211098 Page 187 of 205 Diabetes

Airn 104103 Antisense Igf2r RNA BB368203 Ctnna1 12385 catenin (cadherin associated protein), alphaBG066669 1 Tmem150c 231503 transmembrane protein 150C BE943567 Wdr63 242253 WD repeat domain 63 AU043001 1700011M02Rik 75443 RIKEN cDNA 1700011M02 gene BQ033083 Nat8l 269642 N-acetyltransferase 8-like BE989731 Accsl 381411 1-aminocyclopropane-1-carboxylate synthaseBG070524 (non-functional)-like Wee2 381759 WEE1 homolog 2 (S. pombe) BG070796 Itih5 209378 inter-alpha (globulin) inhibitor H5 AI317339 Cnst 226744 consortin, connexin sorting protein BM247060 Snhg4 100503380 small nucleolar RNA host gene 4 (non-proteinBB237072 coding) A630095E13Rik 235973 RIKEN cDNA A630095E13 gene BB807335 Fam59a 381126 family with sequence similarity 59, memberBB053232 A Trim67 330863 tripartite motif-containing 67 BB667112 Iqub 214704 IQ motif and ubiquitin domain containingAV042259 Mael 98558 maelstrom homolog (Drosophila) AV279061 Cdca8 52276 cell division cycle associated 8 BB702047 Mbnl2 105559 muscleblind-like 2 BB003847 Rtn4rl1 237847 reticulon 4 receptor-like 1 BM508396 Shh 20423 sonic hedgehog AV304616 Rgs7bp 52882 regulator of G-protein signalling 7 bindingAV337421 protein Ubqln3 244178 ubiquilin 3 AV278233 Ss18l1 269397 synovial sarcoma translocation gene onBG075210 chromosome 18-like 1 Rfx4 71137 regulatory factor X, 4 (influences HLA classAV255458 II expression) BM211430 Fam55c 385658 family with sequence similarity 55, memberBB626288 C A930035D04Rik 320946 RIKEN cDNA A930035D04 gene AW123929 Fam70a 245386 family with sequence similarity 70, memberBB520013 A Hspa12a 73442 heat shock protein 12A BB197697 4922501L14Rik 209601 RIKEN cDNA 4922501L14 gene AV258074 Pom121l2 195236 POM121 membrane glycoprotein-like 2AV254386 (rat) Ism1 319909 isthmin 1 homolog (zebrafish) BB322233 Pid1 98496 phosphotyrosine interaction domain containingAI504908 1 Oaz3 53814 ornithine decarboxylase antizyme 3 BF319714 Oaz3 53814 ornithine decarboxylase antizyme 3 BF319714 Plcd4 18802 phospholipase C, delta 4 AV257260 Actl9 69481 actin-like 9 AV259599 Eif1ax 66235 eukaryotic translation initiation factor 1A,BB471576 X-linked D630039A03Rik 242484 RIKEN cDNA D630039A03 gene AV370040 Ccdc63 330188 coiled-coil domain containing 63 AV254560 Clip4 78785 CAP-GLY domain containing linker proteinAV042829 family, member 4 Ttc29 73301 tetratricopeptide repeat domain 29 AV253502 Ttc30a2 620631 tetratricopeptide repeat domain 30A2 BB104484 Ern1 78943 endoplasmic reticulum (ER) to nucleus signallingBG075179 1 Fbxw10///Trim16213980///94092F-box and WD-40 domain protein 10///tripartiteBF018708 motif-containing 16 4930412F15Rik 242408 RIKEN cDNA 4930412F15 gene BB667186 Zbbx 213234 zinc finger, B-box domain containing BB018213 Sorbs2 234214 sorbin and SH3 domain containing 2 BB251748 Lrrc4c 241568 leucine rich repeat containing 4C AV336083 Fam71f1 330277 family with sequence similarity 71, memberAV303824 F1 Efhb 211482 EF hand domain family, member B AV256105 Skap1 78473 src family associated phosphoprotein 1BG075562 Mreg 381269 melanoregulin AV298358 Cdca2 108912 cell division cycle associated 2 BG065056 Slc9a2 226999 solute carrier family 9 (sodium/hydrogenAV274006 exchanger), member 2 BC051142 407788 cDNA sequence BC051142 AV278321 Txndc2 213272 thioredoxin domain containing 2 (spermatozoa)BG068022 Dpy19l2 320752 dpy-19-like 2 (C. elegans) AV253967 Htra4 330723 HtrA serine peptidase 4 AV315397 2700081O15Rik 108899 RIKEN cDNA 2700081O15 gene AV131166 Diabetes Page 188 of 205

Bmpr1b 12167 bone morphogenetic protein receptor, typeBB698679 1B Atp1a4 27222 ATPase, Na+/K+ transporting, alpha 4 polypeptideAI480619 Adam32 353188 a disintegrin and metallopeptidase domainAW107807 32 1700015E13Rik 76925 RIKEN cDNA 1700015E13 gene AI507036 Samd5 320825 sterile alpha motif domain containing 5BB308071 Prdx6b 320769 peroxiredoxin 6B AV269068 Ankrd5///BC034902228642///319196ankyrin repeat domain 5///cDNA sequenceBE199876 BC034902 Gpc6 23888 glypican 6 BB493031 Gm3515 100041799 predicted gene 3515 BG070683 B3galt2 26878 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase,BB254922 polypeptide 2 1700061G19Rik 78625 RIKEN cDNA 1700061G19 gene AV043151 Spata7 104871 spermatogenesis associated 7 AV175699 Ppp3r2 19059 protein phosphatase 3, regulatory subunitBF319679 B, alpha isoform (calcineurin B, type II) 2810408I11Rik 69941 RIKEN cDNA 2810408I11 gene BB093469 2810427A07Rik 72767 RIKEN cDNA 2810427A07 gene C76158 Clca2 80797 chloride channel calcium activated 2 AV231113 Nek2 18005 NIMA (never in mitosis gene a)-related expressedC77054 kinase 2 BE685667 Lypd4 232973 Ly6/Plaur domain containing 4 AV205346 Fam71b 432552 family with sequence similarity 71, memberBB667175 B Ube2u 381534 ubiquitin-conjugating enzyme E2U (putative)AV278535 Xrcc3 74335 X-ray repair complementing defective repairBB251723 in Chinese hamster cells 3 Mex3d 237400 mex3 homolog D (C. elegans) W91617 C730026J16///Zbtb38245007///331006uncharacterized protein C730026J16///zincBG918100 finger and BTB domain containing 38 Als2cr11 73463 amyotrophic lateral sclerosis 2 (juvenile)AV267870 chromosome region, candidate 11 (human) Acsm5 272428 acyl-CoA synthetase medium-chain familyBB667617 member 5 Hoxd3 15434 homeobox D3 BB195802 Ccrl1 252837 Chemokine (C-C motif) receptor-like 1 BB543291 Wnt5a 22418 wingless-related MMTV integration siteAV164956 5A Spag9 70834 sperm associated antigen 9 AV279478 Gm1564 268491 predicted gene 1564 BG070911 Myo5b 17919 myosin VB AV370579 Fam71e1 75538 family with sequence similarity 71, memberAI415163 E1 Galnt12 230145 UDP-N-acetyl-alpha-D-galactosamine:polypeptideAV376137 N-acetylgalactosaminyltransferase 12 AA177898 1700013D24Rik 76921 RIKEN cDNA 1700013D24 gene BF018738 Ltbp3 16998 latent transforming growth factor beta BB173900binding protein 3 Slco4c1 227394 solute carrier organic anion transporterAV024403 family, member 4C1 AI314760 106885 expressed sequence AI314760 BG070544 Dact2 240025 dapper homolog 2, antagonist of beta-cateninAV306847 (xenopus) Fam149a 212326 family with sequence similarity 149, memberBB818275 A Ubqlnl 244179 ubiquilin-like AV279818 Cct8l1 242891 chaperonin containing TCP1, subunit 8 (theta)-likeAV278295 1 Sall1 58198 sal-like 1 (Drosophila) BB739342 1700003E24Rik100042663 RIKEN cDNA 1700003E24 gene AV046698 Hook1 77963 hook homolog 1 (Drosophila) BB463518 4930402H24Rik 228602 RIKEN cDNA 4930402H24 gene C78926 Pde7a 18583 phosphodiesterase 7A BG963325 A130071D04Rik 320791 RIKEN cDNA A130071D04 gene BM239436 Rarres1 109222 retinoic acid receptor responder (tazaroteneBB035017 induced) 1 4930523C07Rik 67647 RIKEN cDNA 4930523C07 gene AV272196 Rprd1a 225283 regulation of nuclear pre-mRNA domainAI414526 containing 1A BB251859 Npy6r 18169 neuropeptide Y receptor Y6 BB497883 BB122985 2900006K08Rik 72873 RIKEN cDNA 2900006K08 gene AV278574 Taf15 70439 TAF15 RNA polymerase II, TATA box bindingBB427389 protein (TBP)-associated factor Cdhr4 69398 cadherin-related family member 4 C87564 Agbl4 78933 ATP/GTP binding protein-like 4 AV205871 Slco4a1 108115 solute carrier organic anion transporterAV348121 family, member 4a1 Page 189 of 205 Diabetes

Gm4871 231885 predicted gene 4871 AV046580 Myom2 17930 myomesin 2 BB288010 Gm13242///LOC100862458///LOC673430///Rex2///Zfp600100041379///100043034///100862458///667666///673430predicted gene 13242///zinc finger proteinBM198106 160-like///zinc finger protein 160-like///reduced expression 2///zinc finger protein 600 Ssh1 231637 slingshot homolog 1 (Drosophila) BE954973 Ocrl 320634 oculocerebrorenal syndrome of Lowe BB108784 1110059G02Rik 68786 RIKEN cDNA 1110059G02 gene BB766817 12-Sep 71089 septin 12 AI326328 Rnf180 71816 ring finger protein 180 AV340072 Acvr1c 269275 activin A receptor, type IC BB432539 Gpr64 237175 G protein-coupled receptor 64 BM234984 4933432K03Rik 75793 RIKEN cDNA 4933432K03 gene AI428127 1700013G23Rik100504121 RIKEN cDNA 1700013G23 gene AV208934 Spanxn4 73309 SPANX family, member N4 AV047675 Ocrl 320634 oculocerebrorenal syndrome of Lowe BB751120 Pex5l 58869 peroxisomal biogenesis factor 5-like BB428358 Fgf7 14178 fibroblast growth factor 7 BB791906 Sowahb 78088 sosondowah ankyrin repeat domain familyBB131927 member B Gpr81 243270 G protein-coupled receptor 81 BB009113 Pwwp2b 101631 PWWP domain containing 2B BB809239 Jph1 57339 junctophilin 1 BB432934 Abcd2 26874 ATP-binding cassette, sub-family D (ALD),BB197269 member 2 Spink10 328971 serine peptidase inhibitor, Kazal type 10AV381832 Otop1 21906 otopetrin 1 BB217568 Lin7a 108030 lin-7 homolog A (C. elegans) AV281676 Nebl 74103 nebulette BM121794 Dnahc7a///Dnahc7b///Dnahc7c100101919///227058///627872dynein, axonemal, heavy chain 7A///dynein,AI647999 axonemal, heavy chain 7B///dynein, axonemal, heavy chain 7C Pld6 194908 phospholipase D family, member 6 AW554531 Ddx26b 236790 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptideBM239943 26B BC048679 210321 cDNA sequence BC048679 AV360837 AW545979 A730054J21Rik 320862 RIKEN cDNA A730054J21 gene BM119567 Mecp2 17257 methyl CpG binding protein 2 BB499491 Ccdc38 237465 coiled-coil domain containing 38 AV254198 BB376947 Tbx22 245572 T-box 22 BB539178 Rapgef3 223864 Rap guanine nucleotide exchange factorBB280100 (GEF) 3 Atp8b3 67331 ATPase, class I, type 8B, member 3 BF319676 Zdhhc19 245308 zinc finger, DHHC domain containing 19AV279956 AI507597 100165 expressed sequence AI507597 AI507597 Prkar2b 19088 protein kinase, cAMP dependent regulatory,BB216074 type II beta Atp13a4 224079 ATPase type 13A4 BE687891 A530016L24Rik 319942 RIKEN cDNA A530016L24 gene BB222714 Gm10638 666945 predicted gene 10638 AV046468 Ankrd29 225187 ankyrin repeat domain 29 AV370837 Dnahc2 327954 dynein, axonemal, heavy chain 2 BB016751 Pgm2l1 70974 phosphoglucomutase 2-like 1 AW702170 BB325257 1700016P04Rik 69413 RIKEN cDNA 1700016P04 gene AI036784 Nr4a3 18124 nuclear receptor subfamily 4, group A, memberBE692107 3 Ahctf1 226747 AT hook containing transcription factor BM2472011 Rnf17 30054 ring finger protein 17 AV225034 Rmst 110333 rhabdomyosarcoma 2 associated transcriptBG075006 (non-coding RNA) BB227434 Fbn1 14118 fibrillin 1 BB327018 LOC100503146100503146 uncharacterized LOC100503146 BG145571 BB199681 1700007J24Rik100504462 RIKEN cDNA 1700007J24 gene AV206400 Amhr2 110542 anti-Mullerian hormone type 2 receptorAV259665 2810410L24Rik100042332 RIKEN cDNA 2810410L24 gene BB493215 Hyal5 74468 hyaluronoglucosaminidase 5 AV279122 Diabetes Page 190 of 205

Sel1l2 228684 sel-1 suppressor of lin-12-like 2 (C. elegans)AV253537 Acsbg2 328845 acyl-CoA synthetase bubblegum family memberAV282564 2 1700008F21Rik///Zfp82175453///75871RIKEN cDNA 1700008F21 gene///zinc fingerAV271377 protein 821 Gfra1 14585 glial cell line derived neurotrophic factorAV221299 family receptor alpha 1 Trpm3 226025 transient receptor potential cation channel,BB125842 subfamily M, member 3 Gpt2 108682 glutamic pyruvate transaminase (alanineBG069993 aminotransferase) 2 Angpt1 11600 angiopoietin 1 BB453314 Hspa4l 18415 heat shock protein 4 like BB270852 4930524O07Rik 406209 RIKEN cDNA 4930524O07 gene AV267216 LOC100502684100502684 uncharacterized LOC100502684 BF584071 A930018M24Rik 328399 RIKEN cDNA A930018M24 gene BB312992 Gm9999 629141 predicted gene 9999 AA138616 Zbtb16 235320 zinc finger and BTB domain containing 16BQ174973 Hook1 77963 hook homolog 1 (Drosophila) AV240656 Fhad1 329977 forkhead-associated (FHA) phosphopeptideAW537651 binding domain 1 BB306426 Morc2b 240069 microrchidia 2B BF319013 Gm14873 100126242 predicted gene 14873 AV260987 Slc26a8 224661 solute carrier family 26, member 8 BB667180 BM200180 BM119331 BM240022 Rbm39 170791 RNA binding motif protein 39 BB378059 AV281260 Clpx 270166 Caseinolytic peptidase X (E.coli) AV353028 Tmem56 99887 transmembrane protein 56 BB768133 4930444F02Rik 73968 RIKEN cDNA 4930444F02 gene AV258073 BC048507 408058 cDNA sequence BC048507 AV208159 BB493152 Pde7a 18583 phosphodiesterase 7A BM245060 A930004D18Rik 77940 RIKEN cDNA A930004D18 gene BB277834 1700066D14Rik 67925 RIKEN cDNA 1700066D14 gene BE456721 4833423E24Rik 228151 RIKEN cDNA 4833423E24 gene AV250450 1700125D06Rik 68233 RIKEN cDNA 1700125D06 gene BF319546 BG071024 Rlf 109263 rearranged L-myc fusion sequence BB704706 Ncam1 17967 neural cell adhesion molecule 1 BM201198 Gm5480 432995 predicted gene 5480 AV066667 Tmem247 78469 transmembrane protein 247 AV270327 Gprin3 243385 GPRIN family member 3 BB245373 Greb1 268527 gene regulated by estrogen in breast cancerAV373997 protein Tmem232 381107 transmembrane protein 232 AV276323 LOC548102 548102 uncharacterized LOC548102 BM240205 Katnal1 231912 katanin p60 subunit A-like 1 AV329023 Adcy10 271639 adenylate cyclase 10 AV271256 Tmod3 50875 tropomodulin 3 BB209799 BG076154 BB667934 Adam6a 238406 a disintegrin and metallopeptidase domainAV283162 6A Lpar4 78134 lysophosphatidic acid receptor 4 BB417145 Ppara 19013 peroxisome proliferator activated receptorAV282267 alpha BB235876 Rab14 68365 RAB14, member RAS oncogene family BM207947 9030224M15Rik 327747 RIKEN cDNA 9030224M15 gene AV370609 Kif20b 240641 kinesin family member 20B BB200034 Als2cr12 108812 amyotrophic lateral sclerosis 2 (juvenile)BF318690 chromosome region, candidate 12 (human) Celf2 14007 CUGBP, Elav-like family member 2 BB308170 Gpr64 237175 G protein-coupled receptor 64 AV242919 Clip1 56430 CAP-GLY domain containing linker proteinAI503514 1 Sun3 194974 Sad1 and UNC84 domain containing 3 BB504262 Page 191 of 205 Diabetes

Nfat5 54446 nuclear factor of activated T cells 5 BB488160 Ipcef1 320495 interaction protein for cytohesin exchangeBQ176089 factors 1 Adamts12 239337 a disintegrin-like and metallopeptidase BB004039(reprolysin type) with thrombospondin type 1 motif, 12 AW111920 2400009B08Rik100503924 RIKEN cDNA 2400009B08 gene AA261399 Abcd2 26874 ATP-binding cassette, sub-family D (ALD),BB253618 member 2 Asb15 78910 ankyrin repeat and SOCS box-containingBB138331 15 Polb 18970 polymerase (DNA directed), beta BB208426 Hoxc5 15424 homeobox C5 AA051236 BB148843 AV254043 Zfp449 78619 zinc finger protein 449 BE993413 AI647811 BM247333 Etnk1 75320 ethanolamine kinase 1 BB177192 Tmem150c 231503 transmembrane protein 150C BB281952 4930515I15 328633 uncharacterized protein 4930515I15 AV266248 Abcc12 244562 ATP-binding cassette, sub-family C (CFTR/MRP),BB013432 member 12 Tsc1 64930 tuberous sclerosis 1 BB668097 D930003E18Rik100048911 RIKEN cDNA D930003E18 gene BB378464 AV228877 BG072725 BB009361 Pbx1 18514 pre B cell leukemia homeobox 1 BB480970 BB467915 BB538816 Slc22a14 382113 solute carrier family 22 (organic cation transporter),AV275747 member 14 Eda2r 245527 ectodysplasin A2 receptor AV246296 BB497623 BB308208 Vps13a 271564 vacuolar protein sorting 13A (yeast) BB829606 AI854555 Edaradd 171211 EDAR (ectodysplasin-A receptor)-associatedBB446560 death domain Setd3 52690 SET domain containing 3 BB392503 1700113H08Rik 76640 RIKEN cDNA 1700113H08 gene AV210811 2810002N01Rik 68020 RIKEN cDNA 2810002N01 gene BB433442 Psapl1 76943 prosaposin-like 1 AV361125 Fam184b 58227 family with sequence similarity 184, memberBB128528 B BG075356 Ocln 18260 occludin AV304145 Slc5a3 53881 solute carrier family 5 (inositol transporters),AV245536 member 3 Pex1 71382 peroxisomal biogenesis factor 1 BM200210 Fgf12 14167 fibroblast growth factor 12 BQ175704 Gm20033 100504048 predicted gene, 20033 BB524346 AI506066 C230081A13Rik 244895 RIKEN cDNA C230081A13 gene BB821275 Gm16432 545391 predicted gene 16432 AV260651 Sorbs1 20411 sorbin and SH3 domain containing 1 BB259710 Rbm44 329207 RNA binding motif protein 44 BM194786 Enpp1 18605 ectonucleotide pyrophosphatase/phosphodiesteraseAW910504 1 G530011O06Rik 654820 RIKEN cDNA G530011O06 gene BB276544 Snord89 100217461 small nucleolar RNA, C/D box 89 BB535821 BG064527 BG071386 BQ176223 AI785253 BB041057 Pde1c 18575 phosphodiesterase 1C BB384086 BC051628 332713 cDNA sequence BC051628 AI427790 Cacna2d1 12293 calcium channel, voltage-dependent, alpha2/deltaBB464523 subunit 1 Diabetes Page 192 of 205

AV206142 BB210007 Gm1679 381667 predicted gene 1679 BB404976 E030016H06Rik 402722 RIKEN cDNA E030016H06 gene BB531351 Gm9999 629141 predicted gene 9999 BB615907 Spag17 74362 sperm associated antigen 17 BF318702 Slc1a3 20512 solute carrier family 1 (glial high affinityBB328290 glutamate transporter), member 3 C80258 97540 expressed sequence C80258 BG066764 Gm13139 666532 Predicted gene 13139 AI666798 1700051A21Rik 73366 RIKEN cDNA 1700051A21 gene BB117906 BI440542 Rbm11 224344 RNA binding motif protein 11 BB333100 BB667512 Gm2590 100040086 predicted gene 2590 BB037335 BM238838 4930407I10Rik 328573 RIKEN cDNA 4930407I10 gene BB012122 BB009291 BB277291 BB534355 AV341509 A130012E19Rik 320235 RIKEN cDNA A130012E19 gene BB162048 Zfp541 666528 zinc finger protein 541 BF018747 Vegfc 22341 vascular endothelial growth factor C AW228853 Defb41 77673 defensin beta 41 BB787829 1700052I22Rik 67340 RIKEN cDNA 1700052I22 gene AV209873 BB394466 A330021E22Rik 207686 RIKEN cDNA A330021E22 gene BB561281 Gm8267 666744 predicted gene 8267 BB099075 Tmco2 69469 transmembrane and coiled-coil domainsAV206071 2 Odf1 18285 outer dense fiber of sperm tails 1 AV041077 H2-Ob 15002 histocompatibility 2, O region beta locusBG144448 D630004K10Rik 103210 RIKEN cDNA D630004K10 gene BB335455 Rasgrf2 19418 RAS protein-specific guanine nucleotide-releasingAV327187 factor 2 Gm9745///Idi2100039655///320581predicted gene 9745///isopentenyl-diphosphateAV248340 delta isomerase 2 A530047J11Rik 103767 RIKEN cDNA A530047J11 gene BB218047 Oxtr 18430 oxytocin receptor BB551848 C77370 245555 expressed sequence C77370 AW495307 BM114723 Defb29 75400 defensin beta 29 BB847171 7-Mar 57438 membrane-associated ring finger (C3HC4)BB248730 7 BB201490 Kcnh8 211468 potassium voltage-gated channel, subfamilyAV258531 H (eag-related), member 8 Gm4926 237749 T-cell immunoglobulin and mucin domainBB076832 containing 2 pseudogene Gm15972 100502834 predicted gene 15972 BE952893 BB153362 Itpkb 320404 inositol 1,4,5-trisphosphate 3-kinase B BB434111 Adh6b 100417514 alcohol dehydrogenase 6B (class V) AI506561 Tusc5 237858 tumor suppressor candidate 5 BB373192 Pnldc1 240023 poly(A)-specific ribonuclease (PARN)-likeBG298178 domain containing 1 Samsn1 67742 SAM domain, SH3 domain and nuclear localizationBB829165 signals, 1 AW541437 Clstn2 64085 calsyntenin 2 AI448973 E330037M01Rik 319775 RIKEN cDNA E330037M01 gene BB070287 Synpo2 118449 synaptopodin 2 BB107526 BC021891 234878 cDNA sequence BC021891 AV370141 AV272776 BB233964 9630013D21Rik 319743 RIKEN cDNA 9630013D21 gene BB126309 BB229546 4930403D09Rik 319208 RIKEN cDNA 4930403D09 gene AV259068 Page 193 of 205 Diabetes

Strn3 94186 Striatin, calmodulin binding protein 3 BM238307 LOC100861869100861869 uncharacterized LOC100861869 BB615665 Jakmip1 76071 janus kinase and microtubule interactingBB316060 protein 1 BB222968 BB485544 BB336546 BB045448 BM247599 BG075809 Prrg1 546336 proline rich Gla (G-carboxyglutamic acid)BB039188 1 Nbeal1 269198 Neurobeachin like 1 BB022773 Mfap3l 71306 microfibrillar-associated protein 3-like AV262974 Spnb2 20742 spectrin beta 2 AW550681 Plcb4 18798 phospholipase C, beta 4 BB143801 BB476958 3110082D06Rik 627626 RIKEN cDNA 3110082D06 gene BB111245 Ctnna3 216033 catenin (cadherin associated protein), alphaAV279527 3 BB555654 BB634277 Tmeff2 56363 transmembrane protein with EGF-like andAV246773 two follistatin-like domains 2 Sorbs2 234214 sorbin and SH3 domain containing 2 BB479893 BB130259 3-Mar 320253 membrane-associated ring finger (C3HC4)AV272467 3 4930414N06Rik 73894 RIKEN cDNA 4930414N06 gene BB615011 Gm884 380730 predicted gene 884 AV271952 Smyd1 12180 SET and MYND domain containing 1 C78565 Spag16 66722 sperm associated antigen 16 AI644545 Art3 109979 ADP-ribosyltransferase 3 BB214143 BB822342 1700061N14Rik 73432 RIKEN cDNA 1700061N14 gene AV207074 9530006C21Rik 77393 RIKEN cDNA 9530006C21 gene BB750043 6030422H21Rik 402765 RIKEN cDNA 6030422H21 gene AI098139 AI851474 1700008F19Rik 75631 RIKEN cDNA 1700008F19 gene AV209890 Zmiz1 328365 zinc finger, MIZ-type containing 1 BB164673 Mboat1 218121 membrane bound O-acyltransferase domainAW457596 containing 1 Gtsf1 74174 Gametocyte specific factor 1 AV045004 BB521034 1700018G05Rik 69388 RIKEN cDNA 1700018G05 gene AV044666 4930534B04Rik 75216 RIKEN cDNA 4930534B04 gene AI480494 BB025762 Fam101a 73121 family with sequence similarity 101, memberBB458543 A Ccdc79 320022 coiled-coil domain containing 79 BB085179 Tex24 541463 testis expressed gene 24 AV208461 Odf3 69287 outer dense fiber of sperm tails 3 AV040303 Cables1 63955 CDK5 and Abl enzyme substrate 1 BB071777 Serpinb5 20724 serine (or cysteine) peptidase inhibitor, AV171845clade B, member 5 2010109A12Rik 75610 RIKEN cDNA 2010109A12 gene AV064063 H1fnt 70069 H1 histone family, member N, testis-specificAV265150 5730494M16Rik 66648 RIKEN cDNA 5730494M16 gene AV267590 Ccdc38 237465 coiled-coil domain containing 38 AV280828 AW543723 Acpp 56318 acid phosphatase, prostate BB008092 9630023C09Rik 320378 RIKEN cDNA 9630023C09 gene AI049170 Aqp6 11831 aquaporin 6 AI956846 4933416C03Rik 619332 RIKEN cDNA 4933416C03 gene AV257382 Ccdc79 320022 coiled-coil domain containing 79 BG067871 BB531645 Psmc3ip 19183 proteasome (prosome, macropain) 26S BE687992subunit, ATPase 3, interacting protein C230081A13Rik 244895 RIKEN cDNA C230081A13 gene BM227237 Diabetes Page 194 of 205

AI447438 BB498027 BE989344 5330417C22Rik 229722 RIKEN cDNA 5330417C22 gene BB183350 Gpr62 436090 G protein-coupled receptor 62 BE955672 5033411D12Rik 192136 RIKEN cDNA 5033411D12 gene BB179576 Enah 13800 Enabled homolog (Drosophila) AV329519 BE853428 4933402J07Rik 330820 RIKEN cDNA 4933402J07 gene AV267735 Chka 12660 choline kinase alpha BB546429 Syne2 319565 synaptic nuclear envelope 2 AW551808 A530053G22Rik 208079 RIKEN cDNA A530053G22 gene BB636451 Cyr61 16007 cysteine rich protein 61 BB533736 Lrp8 16975 low density lipoprotein receptor-relatedAI848122 protein 8, apolipoprotein e receptor Kctd12b 207474 potassium channel tetramerisation domainBB667457 containing 12b 9230104K21Rik 77688 RIKEN cDNA 9230104K21 gene BE852666 BB127931 BC048562 434439 cDNA sequence BC048562 BB615057 BM222179 2610027H17Rik 71811 RIKEN cDNA 2610027H17 gene AI593945 Nav2 78286 neuron navigator 2 AU067780 BG070998 Ell3///Serinc4269344///574418elongation factor RNA polymerase II-likeBI660702 3///serine incorporator 4 BB771206 Eya4 14051 eyes absent 4 homolog (Drosophila) BB363812 Mbnl3 171170 muscleblind-like 3 (Drosophila) BB211386 BB141057 BG071434 A530020G20Rik 319839 RIKEN cDNA A530020G20 gene BB114202 BB534545 BB497195 Atp2b3 320707 ATPase, Ca++ transporting, plasma membraneBB350662 3 Maoa 17161 monoamine oxidase A AV356118 AW548716 BB252728 Pde4b 18578 phosphodiesterase 4B, cAMP specific BG793493 BM250739 AV352204 AI481700 Cmtm2a 73381 CKLF-like MARVEL transmembrane domainAV258920 containing 2A BB667153 Qrich2 217341 glutamine rich 2 BG069309 4732423E21Rik 106967 RIKEN cDNA 4732423E21 gene AV237721 Gm11627 100040792 predicted gene 11627 BM195384 2010109K09Rik 70267 RIKEN cDNA 2010109K09 gene BG072448 130004C03 403343 uncharacterized LOC403343 BB361398 BB051952 AW556334 BB342968 9930031P18Rik 319589 RIKEN cDNA 9930031P18 gene BB420529 BB526944 BB541054 BB505010 BB440867 BB441213 BM232535 BB070264 Acvr1c 269275 activin A receptor, type IC BB396526 BG064470 9630050E16Rik 320168 RIKEN cDNA 9630050E16 gene BB112393 Page 195 of 205 Diabetes

AV328597 BB481555 BB531021 Adam1a///Mapkapk517165///280668a disintegrin and metallopeptidase domainBB012070 1a///MAP kinase-activated protein kinase 5 BG060869 BB016042 BB158810 AU042807 BM203526 BM201095 Slc7a11 26570 solute carrier family 7 (cationic amino acidBB453858 transporter, y+ system), member 11 Gm19723 100503490 predicted gene, 19723 AV261494 Deptor///LOC100505173100505173///97998DEP domain containing MTOR-interactingAI957118 protein///uncharacterized LOC100505173 BB212497 BE635194 Gm128 229588 predicted gene 128 BF319756 AV209602 BB710847 Cpped1 223978 calcineurin-like phosphoesterase domainAI451920 containing 1 H2-Aa 14960 histocompatibility 2, class II antigen A, alphaAV086906 Fam20c 80752 family with sequence similarity 20, memberBB375974 C Mtl5 17771 metallothionein-like 5, testis-specific (tesmin)AV277921 Fads2 56473 fatty acid desaturase 2 BB229957 BB342212 Rimbp3 239731 RIMS binding protein 3 BG075083 9030619P08Rik 105892 RIKEN cDNA 9030619P08 gene AI789751 BM234702 Cd55 13136 CD55 antigen BE686894 Ranbp3l 223332 RAN binding protein 3-like BB496379 Gm12824 666048 predicted gene 12824 BF021397 BB218653 Eif4e 13684 eukaryotic translation initiation factor 4EBQ032226 BE692322 BM218007 BE627440 BE447255 Sycp2 320558 synaptonemal complex protein 2 AW556894 Ddit4l 73284 DNA-damage-inducible transcript 4-likeBG797099 A530020G20Rik 319839 RIKEN cDNA A530020G20 gene BB214398 Atp6v0d2 242341 ATPase, H+ transporting, lysosomal V0 subunitAV204216 D2 BM117570 Rsph4a 212892 radial spoke head 4 homolog A (Chlamydomonas)BB312129 BG071091 BM238675 Trp53inp2 68728 Transformation related protein 53 inducibleBB546845 nuclear protein 2 AI506429 Lipi 320355 lipase, member I BB527125 BB154631 Prkag3 241113 protein kinase, AMP-activated, gamma BB1515163 non-catatlytic subunit 4930485B16Rik///Gm872380653///380654RIKEN cDNA 4930485B16 gene///PredictedAI551889 gene 872 BM238996 AI429363 100640 expressed sequence AI429363 AI429363 BF462741 Apod 11815 apolipoprotein D AV332635 AI465391 Nasp 50927 nuclear autoantigenic sperm protein (histone-binding)AW741754 1700061F12Rik 73438 RIKEN cDNA 1700061F12 gene AI550758 Eno4 226265 enolase 4 AV258949 4930592I03Rik 75853 RIKEN cDNA 4930592I03 gene AV281182 LOC553089 553089 uncharacterized LOC553089 AW554716 Diabetes Page 196 of 205

5830403L16Rik 240817 RIKEN cDNA 5830403L16 gene AV381533 Astx 100113394 amplified spermatogenic transcripts X encodedAV268386 Hsf5 327992 heat shock transcription factor family memberBG075885 5 Lass3 545975 LAG1 homolog, ceramide synthase 3 AI429073 Nav2 78286 neuron navigator 2 BI656658 Nol3 78688 nucleolar protein 3 (apoptosis repressorBB546891 with CARD domain) Hsbp1l1 66255 heat shock factor binding protein 1-like AV0484991 Sec62 69276 SEC62 homolog (S. cerevisiae) BM293801 BG072280 C230007H23Rik 319341 RIKEN cDNA C230007H23 gene BB380551 BG069451 AU015536 101232 expressed sequence AU015536 BG070304 BG075092 BB457876 BB041366 AK129341 234915 cDNA sequence AK129341 BF472675 Cnksr2 245684 connector enhancer of kinase suppressorBB355006 of Ras 2 BB393368 BI134892 C530044C16Rik 319981 RIKEN cDNA C530044C16 gene BB424956 AW550459 BB225402 BB051515 BG063377 Col4a4 12829 collagen, type IV, alpha 4 BB530633 Dtnb 13528 dystrobrevin, beta BB450122 Mycbp2 105689 MYC binding protein 2 BB156822 Kif27 75050 kinesin family member 27 BB054454 BB713790 Gm5142 380907 predicted gene 5142 BB018814 BM207275 BM206272 BE687857 Zmym5 219105 zinc finger, MYM-type 5 AI428811 AI844685 106267 expressed sequence AI844685 AI844685 AW125244 Hist1h1e 50709 Histone cluster 1, H1e BE688907 BG067678 Rsph10b2 75136 radial spoke head 10 homolog B (Chlamydomonas)AI413817 BM116762 BF011295 AI426376 BB727879 Lemd1 213409 LEM domain containing 1 AV156411 4930406D18Rik 73806 RIKEN cDNA 4930406D18 gene AI789536 Spry4 24066 sprouty homolog 4 (Drosophila) BB080456 BM934851 BF458407 BB667304 Zmynd8 228880 Zinc finger, MYND-type containing 8 BB223862 Cd300lb 217304 CD300 antigen like family member B BB230267 Ggcx 56316 gamma-glutamyl carboxylase AV311526 Fndc7 320181 fibronectin type III domain containing 7BG069833 BG075224 BG071600 BB667786 Mosc1 66112 MOCO sulphurase C-terminal domain containingBB667876 1 AV376107 Gm4988 245440 predicted gene 4988 BB429596 AW553625 Page 197 of 205 Diabetes

Dnahc12 110083 dynein, axonemal, heavy chain 12 AV269315 BB534411 Poln 272158 DNA polymerase N BB017002 BB024203 BG066346 BB038386 BM241206 BB453864 BG074662 D15Wsu126e 28112 DNA segment, Chr 15, Wayne State UniversityBG063165 126, expressed BG068123 AW543447 AU042527 AI747732 Mycbp2 105689 MYC binding protein 2 AW107633 BB374930 BG092767 AI845029 AI506532 BB748429 BB748743 Defb21 403172 defensin beta 21 AV267348 BM201377 BB712583 AI506883 1700023E05Rik 71868 RIKEN cDNA 1700023E05 gene AI848394 Fank1 66930 fibronectin type 3 and ankyrin repeat domainsAI850911 1 Cux2 13048 cut-like homeobox 2 BB129488 Lbp 16803 lipopolysaccharide binding protein AW208574 AI606908 AI428054 Itgae 16407 integrin alpha E, epithelial-associated AV210813 AY702102 446211 cDNA sequence AY702102 BF319663 BB486335 Gm8350///Zfp64452397///666892predicted gene 8350///zinc finger proteinBB545511 644 BB470306 BB535847 BB265147 C030034E14Rik 77469 RIKEN cDNA C030034E14 gene BE948505 1700001P01Rik 72215 RIKEN cDNA 1700001P01 gene AV208702 Plekhh1 211945 pleckstrin homology domain containing,AV336001 family H (with MyTH4 domain) member 1 Slc15a2 57738 solute carrier family 15 (H+/peptide transporter),BB244383 member 2 Rgs2 19735 regulator of G-protein signaling 2 BB034265 Thbs2 21826 thrombospondin 2 BB233297 Fgfrl1 116701 fibroblast growth factor receptor-like 1BB109694 Nedd9 18003 neural precursor cell expressed, developmentallyBB450608 down-regulated gene 9 0610040B09Rik 75395 RIKEN cDNA 0610040B09 gene AV302770 Iglv1 16142 Immunoglobulin lambda variable 1 AV376345 2410006H16Rik 69221 RIKEN cDNA 2410006H16 gene AA939619 LOC100038947///Sirpb1a///Sirpb1b100038947///320832///668101signal-regulatory protein beta 1-like///signal-regulatoryAI662854 protein beta 1A///signal-regulatory protein beta 1B 4933402N22Rik///Gm5861///Gm6460///Speer1-ps1545728///545732///623898///70896RIKEN cDNA 4933402N22 gene///predictedAK014925 gene 5861///predicted gene 6460///spermatogenesis associated glutamate (E)-rich protein 1, pseudogene 1 4933411K16Rik 66765 RIKEN cDNA 4933411K16 gene AK016775 Morn5 75495 MORN repeat containing 5 BG298252 D11Wsu47e 276852 DNA segment, Chr 11, Wayne State UniversityAK017508 47, expressed P2ry10 78826 purinergic receptor P2Y, G-protein coupledAK020001 10 Hspb9 75482 heat shock protein, alpha-crystallin-related,AK005714 B9 Ly6k 76486 lymphocyte antigen 6 complex, locus K AK010485 2010300C02Rik 72097 RIKEN cDNA 2010300C02 gene AK008485 1700003F12Rik 75480 RIKEN cDNA 1700003F12 gene AK005633 Lrrc27 76612 leucine rich repeat containing 27 AK009798 Diabetes Page 198 of 205

Synpo2 118449 synaptopodin 2 AI848603 Stk33 117229 serine/threonine kinase 33 AK014819 1700026L06Rik 69987 RIKEN cDNA 1700026L06 gene BQ175881 Dscc1 72107 defective in sister chromatid cohesion 1AK011162 homolog (S. cerevisiae) N4bp2l1 100637 NEDD4 binding protein 2-like 1 AK010587 Tmc5 74424 transmembrane channel-like gene familyAV226010 5 Crtac1 72832 cartilage acidic protein 1 AV341285 Gtsf1 74174 gametocyte specific factor 1 AK005675 Tsc22d2 72033 TSC22 domain family, member 2 AK017449 1700110I01Rik 73549 RIKEN cDNA 1700110I01 gene AK007159 Svip 75744 small VCP/p97-interacting protein BF011349 Scamp1 107767 secretory carrier membrane protein 1 BB704235 Serpina1f 68348 serine (or cysteine) peptidase inhibitor, AK002574clade A, member 1F Tekt4 71840 tektin 4 AK005842 Slc25a31 73333 solute carrier family 25 (mitochondrial carrier;AK006599 adenine nucleotide translocator), member 31 Fbxo30 71865 F-box protein 30 AK006369 4921507P07Rik 70821 RIKEN cDNA 4921507P07 gene AV281687 Glb1l3 70893 galactosidase, beta 1 like 3 AK014852 Mamdc2 71738 MAM domain containing 2 AK004794 1700029M20Rik 73937 RIKEN cDNA 1700029M20 gene AK006510 1700022A21Rik 72252 glycerol-3-phosphate dehydrogenase 1-likeAK006230 pseudogene Efhc1 71877 EF-hand domain (C-terminal) containingAK006489 1 1700013G24Rik 69380 RIKEN cDNA 1700013G24 gene AK005952 1700029J07Rik 69479 RIKEN cDNA 1700029J07 gene AK006501 4933404M02Rik 66748 RIKEN cDNA 4933404M02 gene AK006384 Iqch 78250 IQ motif containing H AV260593 Rnls 67795 renalase, FAD-dependent amine oxidaseAK018322 Prps1l1 75456 phosphoribosyl pyrophosphate synthetaseAK005874 1-like 1 Dydc1 69496 DPY30 domain containing 1 AK006511 Ccdc89 70054 coiled-coil domain containing 89 BB470050 Spata9 75571 spermatogenesis associated 9 AK006554 Rnase10 75019 ribonuclease, RNase A family, 10 (non-active)AK015573 Gm14590///Gm14594///Gm14595///Gm14596///Gm14598///Gm14625///Gm16404///Gm16405///Gm16430///Gm6660///Gm6664///Gm7950///Gm7958///Slxl1100039055///100040317///100040867///100040894///625210///625508///626274///626315///666096///666122///666135///666151///666161///75140predicted gene 14590///predicted geneAK015913 14594///predicted gene 14595///predicted gene 14596///predicted gene 14598///predicted gene 14625///predicted gene 16404///predicted gene 16405///predicted gene 16430///predicted gene 6660///predicted gene 6664///predicted pseudogene 7950///predicted gene 7958///Slx-like 1 Fam55b 78252 family with sequence similarity 55, memberBB138760 B Calr3 73316 calreticulin 3 AK006582 Calr3 73316 calreticulin 3 AK006582 Lelp1 69332 late cornified envelope-like proline-richAK005903 1 Gcap14 72972 granule cell antiserum positive 14 BB698883 Vwa3b 70853 von Willebrand factor A domain containingAK014863 3B 1700034O15Rik 76606 RIKEN cDNA 1700034O15 gene AK006606 Slc43a1 72401 solute carrier family 43, member 1 AK011417 2810032G03Rik 72669 RIKEN cDNA 2810032G03 gene AK012851 Marveld3 73608 MARVEL (membrane-associating) domainAK007346 containing 3 Ccdc103 73293 coiled-coil domain containing 103 AK006639 2810408A11Rik 70419 RIKEN cDNA 2810408A11 gene AK015537 Ppil6 73075 peptidylprolyl isomerase (cyclophilin)-likeAK013818 6 Prss55 71037 protease, serine, 55 AK016601 1700027A23Rik100503311 RIKEN cDNA 1700027A23 gene AK006407 2410002O22Rik 66975 RIKEN cDNA 2410002O22 gene AK012141 Spata3 70060 spermatogenesis associated 3 AK005880 Tmem202 73893 transmembrane protein 202 AK008510 1810032O08Rik 66293 RIKEN cDNA 1810032O08 gene AK007675 1700011L22Rik 67687 RIKEN cDNA 1700011L22 gene AK005876 4930589P08Rik 67748 RIKEN cDNA 4930589P08 gene AK017048 Atp10b 319767 ATPase, class V, type 10B BE979227 4932702P03Rik 73326 RIKEN cDNA 4932702P03 gene AK006712 Sh2d4a 72281 SH2 domain containing 4A AK008803 1700018L24Rik 75528 RIKEN cDNA 1700018L24 gene AK006092 Ccdc83 75338 coiled-coil domain containing 83 AK016535 9530057J20Rik///LOC100861725100861725///78672RIKEN cDNA 9530057J20 gene///uncharacterizedBE945468 LOC100861725 Page 199 of 205 Diabetes

1700007G11Rik 75784 RIKEN cDNA 1700007G11 gene AW045458 1110019D14Rik 76311 RIKEN cDNA 1110019D14 gene AK003812 4921539E11Rik 70941 RIKEN cDNA 4921539E11 gene AK015018 1700109H08Rik 77036 RIKEN cDNA 1700109H08 gene AK007150 1700058G18Rik 67342 RIKEN cDNA 1700058G18 gene AK006831 1700019B03Rik 76406 RIKEN cDNA 1700019B03 gene AK006106 1700086P04Rik 67349 RIKEN cDNA 1700086P04 gene AK007024 Zdhhc2 70546 zinc finger, DHHC domain containing 2 BB342242 1700023E05Rik 71868 RIKEN cDNA 1700023E05 gene AK006270 Pebp4 73523 phosphatidylethanolamine binding proteinBF319490 4 Dhdh 71755 dihydrodiol dehydrogenase (dimeric) AK005050 Spink12 78242 serine peptidase inhibitor, Kazal type 11BE691430 Fam184a 75906 family with sequence similarity 184, memberAK016375 A Lrrc69 73314 leucine rich repeat containing 69 AK006601 Actl9 69481 actin-like 9 AV043665 Efcab10 75040 EF-hand calcium binding domain 10 AK015697 Dapl1 76747 death associated protein-like 1 BE633038 Chka 12660 choline kinase alpha BB129366 Car3 12350 carbonic anhydrase 3 BB213876 Lrrc39 109245 leucine rich repeat containing 39 AK008119 Vgll3 73569 vestigial like 3 (Drosophila) BG066866 3110082D06Rik 627626 RIKEN cDNA 3110082D06 gene AW492445 Ccdc91 67015 coiled-coil domain containing 91 AK007017 Mfap3l 71306 microfibrillar-associated protein 3-like AV280494 Mllt3 70122 myeloid/lymphoid or mixed-lineage leukemiaAK008707 (trithorax homolog, Drosophila); translocated to, 3 Usp50 75083 ubiquitin specific peptidase 50 AW539155 4930480G23Rik 74988 RIKEN cDNA 4930480G23 gene AK015599 Gsto2 68214 glutathione S-transferase omega 2 AK019582 Efcab6 77627 EF-hand calcium binding domain 6 AK016516 1700026J12Rik 73255 RIKEN cDNA 1700026J12 gene AI036213 4930471G03Rik 74966 RIKEN cDNA 4930471G03 gene AK018831 1700016H13Rik 74218 RIKEN cDNA 1700016H13 gene AK006033 Ccdc30 73332 coiled-coil domain containing 30 AK015391 Ccdc7 74703 coiled-coil domain containing 7 AK016006 Fam122c 73866 family with sequence similarity 122, memberAK015916 C 4930578N16Rik 75051 RIKEN cDNA 4930578N16 gene BE282424 1700025E21Rik 75647 RIKEN cDNA 1700025E21 gene AK006332 Pdilt 71830 protein disulfide isomerase-like, testis expressedAK005692 Apobec4 71281 apolipoprotein B mRNA editing enzyme,AK017014 catalytic polypeptide-like 4 (putative) 1700067K01Rik 73453 RIKEN cDNA 1700067K01 gene AK006917 Mpp7 75739 membrane protein, palmitoylated 7 (MAGUKAK012883 p55 subfamily member 7) 4930579C15Rik 67753 RIKEN cDNA 4930579C15 gene AK006446 1700061J05Rik 73376 RIKEN cDNA 1700061J05 gene AK006856 1700061J05Rik 73376 RIKEN cDNA 1700061J05 gene AK006856 1600029D21Rik 76509 RIKEN cDNA 1600029D21 gene AK002767 Cldnd2 74276 claudin domain containing 2 AK006929 Nrip1 268903 nuclear receptor interacting protein 1 BB041915 Arrdc3 105171 arrestin domain containing 3 BG072824 Phf6 70998 PHD finger protein 6 BG073473 Srd5a1 78925 steroid 5 alpha-reductase 1 AV003635 4930503L19Rik 269033 RIKEN cDNA 4930503L19 gene AI450962 Tmem64 100201 transmembrane protein 64 BG075363 Spink2 69982 serine peptidase inhibitor, Kazal type 2 BE456717 Ankrd27 245886 ankyrin repeat domain 27 (VPS9 domain)BB401190 Rbm24 666794 RNA binding motif protein 24 AV307961 Xkrx 331524 X Kell blood group precursor related X linkedBM932447 Arl4c 320982 ADP-ribosylation factor-like 4C BQ176306 Morn2 378462 MORN repeat containing 2 BF319573 Fam49a 76820 family with sequence similarity 49, memberAV228737 A Plekha8 231999 pleckstrin homology domain containing,BQ031094 family A (phosphoinositide binding specific) member 8 Diabetes Page 200 of 205

Lhfpl2 218454 lipoma HMGIC fusion partner-like 2 BG917242 Clic6 209195 chloride intracellular channel 6 BQ176424 Mycbp2 105689 MYC binding protein 2 AW107953 Agps 228061 alkylglycerone phosphate synthase BB794868 Nmt2 18108 N-myristoyltransferase 2 BF682870 Sphkap 77629 SPHK1 interactor, AKAP domain containingAV327549 Itga8 241226 integrin alpha 8 BQ175493 Slc7a1 11987 solute carrier family 7 (cationic amino acidBB264620 transporter, y+ system), member 1 Ddah1 69219 dimethylarginine dimethylaminohydrolaseAW556888 1 Paqr9 75552 progestin and adipoQ receptor family memberAV103696 IX Efcab1 66793 EF hand calcium binding domain 1 AV307860 1700086L19Rik 74284 RIKEN cDNA 1700086L19 gene BI526033 Ccno 218630 cyclin O BB547482 Hpdl 242642 4-hydroxyphenylpyruvate dioxygenase-likeBB270534 Strbp 20744 spermatid perinuclear RNA binding proteinAV317838 2610203C20Rik100042464 RIKEN cDNA 2610203C20 gene BM220421 Ttc39a 230603 tetratricopeptide repeat domain 39A BI147002 Phf16 382207 PHD finger protein 16 BG064477 6330503K22Rik 101565 RIKEN cDNA 6330503K22 gene BG070835 Syne1 64009 synaptic nuclear envelope 1 AV237615 Mum1l1 245631 melanoma associated antigen (mutated)BB103233 1-like 1 Itga1 109700 integrin alpha 1 AV071536 Tnik 665113 TRAF2 and NCK interacting kinase AI117633 Kif5c 16574 kinesin family member 5C BB698320 BI076807 Adcy5 224129 adenylate cyclase 5 BE952286 Spin2 278240 spindlin family, member 2 BG070258 Vgll3 73569 vestigial like 3 (Drosophila) BB011882 Wipf3 330319 WAS/WASL interacting protein family, memberBG064092 3 Ddah1 69219 dimethylarginine dimethylaminohydrolaseBB770857 1 BM119433 D630045J12Rik 330286 RIKEN cDNA D630045J12 gene BB503889 Tet1 52463 tet methylcytosine dioxygenase 1 BG071655 Epha3 13837 Eph receptor A3 AV226618 Fam53b 77938 family with sequence similarity 53, memberBM248711 B Diras2 68203 DIRAS family, GTP-binding RAS-like 2 BM114282 Ptpn3 545622 protein tyrosine phosphatase, non-receptorAV231357 type 3 Kctd14 233529 potassium channel tetramerisation domainAW552116 containing 14 Kctd14 233529 potassium channel tetramerisation domainAW552116 containing 14 Akr1c19 432720 aldo-keto reductase family 1, member C19BG073853 Gpr50 14765 G-protein-coupled receptor 50 BQ032613 Slc25a34 384071 solute carrier family 25, member 34 BE650825 Slc35e2 320541 solute carrier family 35, member E2 BF318246 4430402I18Rik 381218 RIKEN cDNA 4430402I18 gene BE949408 Gm17750 553095 predicted gene, 17750 BB751199 Cndp1 338403 carnosine dipeptidase 1 (metallopeptidaseBB497651 M20 family) Ccl28 56838 chemokine (C-C motif) ligand 28 BE196980 Rspo3 72780 R-spondin 3 homolog (Xenopus laevis) BG072958 Sclt1 67161 sodium channel and clathrin linker 1 BB700774 Podxl2 319655 podocalyxin-like 2 BB461988 Drd1a 13488 dopamine receptor D1A BE957273 Olfml1 244198 olfactomedin-like 1 BB055163 Obfc2a 109019 oligonucleotide/oligosaccharide-bindingBE457727 fold containing 2A Fam124a 629059 family with sequence similarity 124, memberBQ175938 A Spata21 329972 spermatogenesis associated 21 AV280422 Gspt2 14853 G1 to S phase transition 2 BB441361 Prrg1 546336 proline rich Gla (G-carboxyglutamic acid)BM230193 1 Ap1s3 252903 adaptor-related protein complex AP-1, sigmaAW259574 3 BG797225 Fam149a 212326 family with sequence similarity 149, memberBB766438 A Page 201 of 205 Diabetes

Dse 212898 dermatan sulfate epimerase BM207218 Trim36 28105 tripartite motif-containing 36 AV270622 Fut4 14345 fucosyltransferase 4 AV309809 Nav1 215690 neuron navigator 1 BE980206 A330021E22Rik 207686 RIKEN cDNA A330021E22 gene AV277957 Akap2 11641 A kinase (PRKA) anchor protein 2 AI649048 Vwc2 319922 von Willebrand factor C domain containingBB313865 2 Nhedc1 74446 Na+/H+ exchanger domain containing 1AV254783 Rhof 23912 Ras homolog gene family, member f BB387838 Spinkl 77424 serine protease inhibitor, Kazal type-likeBB807669 Ttc30a2 620631 tetratricopeptide repeat domain 30A2 BB104484 Prdm8 77630 PR domain containing 8 AV349236 11-Mar 211147 membrane-associated ring finger (C3HC4)BB667208 11 Sorbs1 20411 sorbin and SH3 domain containing 1 BB372866 Cdca2 108912 cell division cycle associated 2 BG065056 Odz4 23966 odd Oz/ten-m homolog 4 (Drosophila) BG071076 D10Bwg1379e 215821 DNA segment, Chr 10, Brigham & Women'sBB125269 Genetics 1379 expressed Hipk2 15258 homeodomain interacting protein kinaseBB554636 2 Nxf3 245610 nuclear RNA export factor 3 BM236468 Drd1a 13488 dopamine receptor D1A BB282271 Cdkl3 213084 cyclin-dependent kinase-like 3 AV265508 Panx3 208098 pannexin 3 AV220875 Defb19 246700 defensin beta 19 AV209128 Cds1 74596 CDP-diacylglycerol synthase 1 BI152841 St8sia6 241230 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferaseBB486599 6 Lepr 16847 leptin receptor BM124366 BE951483 Akr1cl 70861 aldo-keto reductase family 1, member C-likeAI451536 Cypt3 69361 cysteine-rich perinuclear theca 3 AV209112 Gpat2 215456 glycerol-3-phosphate acyltransferase 2,BI407212 mitochondrial Cage1 71213 cancer antigen 1 BB667170 Hoxb3 15410 homeobox B3 BG073383 4933422H20Rik 432613 RIKEN cDNA 4933422H20 gene AV281168 Emx2 13797 empty spiracles homolog 2 (Drosophila)BG072869 Slc46a2 30936 solute carrier family 46, member 2 BB203897 Bank1 242248 B cell scaffold protein with ankyrin repeatsAI451642 1 1700015F17Rik 381716 RIKEN cDNA 1700015F17 gene BB833901 Gm4787 214321 predicted gene 4787 AV274161 Negr1 320840 neuronal growth regulator 1 BM118381 Adamts5 23794 a disintegrin-like and metallopeptidase BB475194(reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2) Klhdc7a 242721 kelch domain containing 7A BB308961 St8sia6 241230 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferaseAV375081 6 4930563D23Rik 75328 RIKEN cDNA 4930563D23 gene AV257768 4930523C07Rik 67647 RIKEN cDNA 4930523C07 gene BM246687 Prkar2b 19088 protein kinase, cAMP dependent regulatory,BB216074 type II beta Fry 320365 furry homolog (Drosophila) BB527078 Itga4 16401 integrin alpha 4 BB284583 AV020412 Gm550 225852 predicted gene 550 BF319483 Ccdc67 234964 coiled-coil domain containing 67 AV280234 Ccdc30 73332 coiled-coil domain containing 30 BB256666 BB769119 Allc 94041 allantoicase AV263744 Akap3 11642 A kinase (PRKA) anchor protein 3 AV255496 Fam13a 58909 family with sequence similarity 13, memberBB482650 A Fam13a 58909 family with sequence similarity 13, memberBB745929 A Heatr7b1 100040766 HEAT repeat containing 7B1 AV272901 Trpm3 226025 transient receptor potential cation channel,BB313276 subfamily M, member 3 Mthfd1l 270685 methylenetetrahydrofolate dehydrogenaseAV095209 (NADP+ dependent) 1-like LOC552902 552902 uncharacterized LOC552902 BM116906 Diabetes Page 202 of 205

Usp44 327799 ubiquitin specific peptidase 44 AV048089 BM238052 Tmem56 99887 transmembrane protein 56 BB768133 Chrdl1 83453 chordin-like 1 BI966456 Acpl2 235534 acid phosphatase-like 2 BB458645 4930414L22Rik 78108 RIKEN cDNA 4930414L22 gene BQ176011 Rnf133 386611 ring finger protein 133 AV045338 Gm6792 627821 predicted gene 6792 AV380908 Abcd2 26874 ATP-binding cassette, sub-family D (ALD),AW456685 member 2 Ppp1r36 210762 protein phosphatase 1, regulatory subunitAV274491 36 Asphd1 233879 aspartate beta-hydroxylase domain containingBB262764 1 Boll 75388 bol, boule-like (Drosophila) BQ174097 Camk2d 108058 calcium/calmodulin-dependent protein AV346472kinase II, delta 1500011B03Rik 66236 RIKEN cDNA 1500011B03 gene BB782615 6820445E23Rik100038580 RIKEN cDNA 6820445E23 gene AI854003 Cmklr1 14747 chemokine-like receptor 1 AW228687 Cxcl9 17329 chemokine (C-X-C motif) ligand 9 BI104444 BC023202 407816 cDNA sequence BC023202 BM114731 Trpm3 226025 transient receptor potential cation channel,BB377721 subfamily M, member 3 Cabp4 73660 calcium binding protein 4 BF461761 Gm9112 668339 predicted gene 9112 AV036298 BB555069 Wdr96 100048534 WD repeat domain 96 BG070237 LOC100504898100504898 uncharacterized LOC100504898 BB326368 BB797251 Amhr2 110542 anti-Mullerian hormone type 2 receptorAV209206 Sdr16c6 242286 short chain dehydrogenase/reductase familyAV249306 16C, member 6 Fsd2 244091 fibronectin type III and SPRY domain containingBE457750 2 1700042G07Rik 67323 RIKEN cDNA 1700042G07 gene AV046807 BB306048 4930526D03Rik 277496 RIKEN cDNA 4930526D03 gene AV267411 A030001D16Rik 399638 RIKEN cDNA A030001D16 gene BB149729 AA415038 103570 expressed sequence AA415038 AV318727 Nfe2l2 18024 nuclear factor, erythroid derived 2, like AV2482732 Shc4 271849 SHC (Src homology 2 domain containing)AV353605 family, member 4 Nrg4 83961 neuregulin 4 BB219343 Defb42 619548 defensin beta 42 BB625617 Tcerg1l 70571 transcription elongation regulator 1-likeBM195317 Trhde 237553 TRH-degrading enzyme BB245038 Plch1 269437 phospholipase C, eta 1 BB247624 9530029O12Rik 399629 RIKEN cDNA 9530029O12 gene BB111383 Strbp 20744 spermatid perinuclear RNA binding proteinBB296225 AI843755 Odz2 23964 odd Oz/ten-m homolog 2 (Drosophila) BM899576 Synm 233335 synemin, intermediate filament proteinAI594683 BQ031062 BG067469 Apol11b 328563 apolipoprotein L 11b AA214835 Ocrl 320634 oculocerebrorenal syndrome of Lowe BG074373 4921506M07Rik///Ttc6100503562///70846RIKEN cDNA 4921506M07 gene///tetratricopeptideBB636437 repeat domain 6 Inpp4b 234515 inositol polyphosphate-4-phosphatase, BB540672type II Nedd4l 83814 neural precursor cell expressed, developmentallyAV377264 down-regulated gene 4-like Klf14 619665 Kruppel-like factor 14 BB022571 Nfkbiz 80859 Nuclear factor of kappa light polypeptideBM240058 gene enhancer in B cells inhibitor, zeta 4930513N10Rik 319960 RIKEN cDNA 4930513N10 gene AI503156 L26640 Nalcn 338370 sodium leak channel, non-selective AI849508 Myom2 17930 myomesin 2 AV241307 Gm11827 100503518 predicted gene 11827 BE630363 Opcml 330908 opioid binding protein/cell adhesion molecule-likeBB383296 Page 203 of 205 Diabetes

1700057G04Rik 78459 RIKEN cDNA 1700057G04 gene AV265414 BG067509 AW536823 BM214036 BB377980 C430003N24Rik 320358 RIKEN cDNA C430003N24 gene BB410003 BB205419 9530036O11Rik 654796 RIKEN cDNA 9530036O11Rik BB110572 BM199910 BM203324 Cdkl2 53886 cyclin-dependent kinase-like 2 (CDC2-relatedBE979937 kinase) Ropn1l 252967 ropporin 1-like AV210805 Cxcl1 14825 chemokine (C-X-C motif) ligand 1 BB554288 Fam20c 80752 family with sequence similarity 20, memberBB084182 C Odf1 18285 outer dense fiber of sperm tails 1 AV209966 Eno4 226265 enolase 4 AV343405 A330021E22Rik 207686 RIKEN cDNA A330021E22 gene AV255758 BQ175190 Wfdc6a 209351 WAP four-disulfide core domain 6A AV378987 Gsdma 57911 gasdermin A AV240142 1110046J04Rik 68808 RIKEN cDNA 1110046J04 gene AV013305 Kcns3 238076 potassium voltage-gated channel, delayed-rectifier,AW489633 subfamily S, member 3 Cyr61 16007 cysteine rich protein 61 BB533736 Clgn 12745 calmegin BM199355 BG066654 Gm10451 100041694 predicted gene 10451 BB745211 C430042M11Rik 320021 RIKEN cDNA C430042M11 gene BB415623 4732496C06Rik 319685 RIKEN cDNA 4732496C06 gene BB010533 Esrrg 26381 estrogen-related receptor gamma BM120183 Zfp266 77519 zinc finger protein 266 BB374879 4930435E12Rik 74663 RIKEN cDNA 4930435E12 gene AV280630 Gm4876 232599 predicted gene 4876 BB339393 BB046190 BM240056 BB350401 BB161337 BB291417 Ccdc153 270150 coiled-coil domain containing 153 BB211614 Fam20b 215015 family with sequence similarity 20, memberBB078712 B BB472447 BB265352 E230012J19Rik 319664 RIKEN cDNA E230012J19 gene BB548850 Per3 18628 Period homolog 3 (Drosophila) BB021263 AV352768 Pde7a 18583 phosphodiesterase 7A AU015378 BB657751 BE979587 Igfbp3 16009 insulin-like growth factor binding proteinAI649005 3 BB417513 BI465650 Fam194a 545527 family with sequence similarity 194, memberBB012140 A Ces5a 67935 carboxylesterase 5A BB081581 Pde5a 242202 phosphodiesterase 5A, cGMP-specific BB397841 B930025B16Rik 503851 RIKEN cDNA B930025B16 gene BE648536 C79035 Hspa4l 18415 heat shock protein 4 like AI461691 Ccdc110 212392 coiled-coil domain containing 110 BB667184 1700027F06Rik 72268 RIKEN cDNA 1700027F06 gene AV259070 Lrrc3 237387 leucine rich repeat containing 3 AI413999 AI790191 Diabetes Page 204 of 205

BM941075 Specc1 432572 sperm antigen with calponin homology BB827631and coiled-coil domains 1 BB030901 9230110F11Rik 320432 RIKEN cDNA 9230110F11 gene BB504374 Gm614 245536 predicted gene 614 AV045544 BE133856 BB023775 AI585995 AI426237 BB291656 BB373038 Rasef 242505 RAS and EF hand domain containing AV256591 8030447M02Rik 399578 RIKEN cDNA 8030447M02 gene AI503942 Ntrk2 18212 neurotrophic tyrosine kinase, receptor, AW121243type 2 Ccdc62 208908 coiled-coil domain containing 62 AI661708 BG793487 BB223800 C79946 96895 expressed sequence C79946 BB218275 BB364131 Tmprss11e 243084 transmembrane protease, serine 11e BB148290 BB475301 BB167635 AI661876 BG072223 BG071113 1700023H06Rik 69442 RIKEN cDNA 1700023H06 gene AW556597 BB210405 Myo3b 329421 myosin IIIB AV381193 BB104577 BB096051 BB454472 BG075777 BB438847 Cyb5r2 320635 cytochrome b5 reductase 2 BB496517 BM218851 BM115255 AW495413 BM206467 Dcdc2a 195208 doublecortin domain containing 2a AW492955 AU040352 Ano1 101772 anoctamin 1, calcium activated chlorideAU040576 channel 1700065I17Rik 67343 RIKEN cDNA 1700065I17 gene AV047076 1700012D01Rik///Tmem194210035///72243RIKEN cDNA 1700012D01 gene///transmembraneAV040390 protein 194 Zmynd12 332934 zinc finger, MYND domain containing 12AI414736 Glrb 14658 glycine receptor, beta subunit BB345174 Crtac1 72832 cartilage acidic protein 1 AV354465 Ces5a 67935 carboxylesterase 5A AV278384 5730494M16Rik 66648 RIKEN cDNA 5730494M16 gene AV333371 Rnf185 193670 Ring finger protein 185 BB144036 Tnks 21951 tankyrase, TRF1-interacting ankyrin-relatedAW011961 ADP-ribose polymerase BB552070 Stat3 20848 Signal transducer and activator of transcriptionBG069527 3 1700015G11Rik100503036 RIKEN cDNA 1700015G11 gene AV047656 BC061194 381350 cDNA sequence BC061194 BB013876 Ap1s2 108012 adaptor-related protein complex 1, sigmaBE655707 2 subunit 1500015O10Rik 78896 RIKEN cDNA 1500015O10 gene BB392676 1700109F18Rik 73429 RIKEN cDNA 1700109F18 gene BB421876 BB473929 BI714082 Paqr5 74090 progestin and adipoQ receptor family memberAK002481 V Page 205 of 205 Diabetes

Lpcat2b 70902 lysophosphatidylcholine acyltransferaseAK014940 2B Iqcg 69707 IQ motif containing G AK010269 Acoxl 74121 acyl-Coenzyme A oxidase-like AK004775 1700097M23Rik 73561 RIKEN cDNA 1700097M23 gene AV270744 12-Sep 71089 septin 12 AK006458 9130409J20Rik 71576 RIKEN cDNA 9130409J20 gene AK018665 1700025K23Rik 66337 RIKEN cDNA 1700025K23 gene BF466605 Pgbd5 209966 piggyBac transposable element derived AV1515975 AI848100 226551 expressed sequence AI848100 BM240684 Susd4 96935 sushi domain containing 4 BF455403 Myrip 245049 myosin VIIA and Rab interacting proteinBB429683 Dlc1 50768 deleted in liver cancer 1 BB768194 Igsf11 207683 immunoglobulin superfamily, member 11BM899311 Cacna1b 12287 calcium channel, voltage-dependent, N AV326040type, alpha 1B subunit Slco4c1 227394 solute carrier organic anion transporterBB400146 family, member 4C1 Gm7444 665005 ring finger protein 19A pseudogene AV208009