Protein Survival in 6000 Year Old Dwarf Deer Remains from Pedro
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
O18934 Plard, F., Bonenfant, C. and Gaillard, JM 2011
Oikos O18934 Plard, F., Bonenfant, C. and Gaillard, J. M. 2011. Re- visiting the allometry of antlers among deer species: male-male sexual competition as a driver. – Oikos 120: 601–606. Table A1. Data basis. Sexual size dimorphism (SSD) was measured by the residuals of the regression of male body mass against female body mass. Breeding group sizes (BGS) were divided into three categories: group of one or two animals (A), group of three, four and five animals (B), and groups larger than five animals (C). The different mating tactics (MT) were harem (H), territorial (T) and tending (F). Non-available mating tactics (NA) and monogamous species (M) are indicated. Sub-family Genus Species Common name Male Female SSD BGS MT Ref Antler Body Body length mass mass Cervinae Axis axis chital 845 89.5 39 0.58 C F 1,2,3 Cervinae Axis porcinus hog deer 399 41 31 0.07 C F 2,3,4,5 Cervinae Cervus albirostris white-lipped deer 1150 204 125 0.06 C H 1,6 Cervinae Cervus canadensis wapiti 1337 350 250 –0.21 C H 3,8,9 Cervinae Cervus duvaucelii barasingha 813 236 145 0.03 C H 1,3,10,11 Cervinae Cervus elaphus red deer 936 250 125 0.34 C H 1,2,3 Cervinae Cervus eldi Eld’s deer 971.5 105 67 0.12 C H 1,2,3 Cervinae Cervus nippon sika deer 480 52 37 0.1 B T 1,2,3,9,12,13 Cervinae Cervus timorensis Timor deer 675 95.5 53 0.29 C H 1,9 Cervinae Cervus unicolor sambar 1049 192 146 –0.18 B T 1,2,3,7 Cervinae Dama dama fallow deer 615 67 44 0.15 C T 1,2,3,14 Cervinae Elaphurus davidianus Père David’s deer 737 214 159 –0.17 C H 1,2,3 Muntiacinae Elaphodus cephalophus -
Friday Night Auction
GETTING YOUTH OUTDOORS Welcome Dear Friends and Fellow Outdoor Supporters, Welcome and thank you for supporting the second annual Heartland DSC Banquet! Heartland DSC is excited to state that during the last year we were able to successfully pursue our mission of “Getting Youth Outdoors” by exposing kids to hunting and fishing that may have not otherwise had the opportunity. Highlights of the past year included a youth fishing tournament, certification of new young hunters during our hunter education course, a youth shooting clinic and Heartland DSC sponsored youth hunts. For many of the young participants it was their first time doing these types of activities. We took a large step in providing hunting opportunities for young people by securing exclusive access to a tract of land teaming with deer and turkey. This provides us the ability to offer youth hunting in a well-controlled environment. While our efforts are focused on all youth, we are putting a special emphasis on introducing outdoor activities to those youth that may not otherwise have the opportunity due to disabilities, lack of accessibility, or other life circumstances. We have worked hard to attract outstanding auction items from reputable outfitters and donors who have graciously donated to the organization’s mission. Heartland DSC encourages you to place your bids with confidence and in the spirit of providing the funds necessary to further the organization’s objectives while obtaining goods and services for your enjoyment. Again, thank you for your support and have a wonderful evening! Corey Goss & Family Heartland DSC President GETTING YOUTH OUTDOORS Schedule of Events Saturday March 2, 2019 NOON: Lunch with Larry Weishuhn Pasta and Nacho Bars 5:00 PM: Social Time / Cash Bar Silent Auction Opens Raffles Games 7:00 PM: Special Guest Speaker Larry Weishuhn Dinner 7:30 PM: Silent Auction Closes 8:00 PM: Live Auction Begins Heartland DSC About Heartland DSC Heartland DSC is the local chapter of Dallas Safari Club (DSC) with members throughout Iowa and Nebraska. -
Line Transect Surveys Underdetect Terrestrial Mammals: Implications for the Sustainability of Subsistence Hunting
RESEARCH ARTICLE Line Transect Surveys Underdetect Terrestrial Mammals: Implications for the Sustainability of Subsistence Hunting José M. V. Fragoso1☯¤*, Taal Levi2‡, Luiz F. B. Oliveira3‡, Jeffrey B. Luzar4‡, Han Overman5‡, Jane M. Read6‡, Kirsten M. Silvius7☯ 1 Stanford University, Stanford, CA, 94305–5020, United States of America, 2 Department of Fisheries and Wildlife, Oregon State University, Corvallis, OR, United States of America, 3 Departamento de Vertebrados, Museu Nacional, UFRJ, RJ, 20.940–040, Brazil, 4 Stanford University, Stanford, CA, 94305–5020, United States of America, 5 Environmental and Forest Biology, State University of New York-College of Environmental Science and Forestry, Syracuse, NY, 13210, United States of America, 6 Geography Department, Syracuse University, Syracuse, NY, 13244, United States of America, 7 Department of Forest Resources and Environmental Conservation, Virginia Tech, Blacksburg, VA, United States of America ☯ These authors contributed equally to this work. ¤ Current address: Biodiversity Science and Sustainability, California Academy of Sciences, San Francisco, California, United States of America OPEN ACCESS ‡ These authors contributed subsets of effort equally to this work. * [email protected] Citation: Fragoso JMV, Levi T, Oliveira LFB, Luzar JB, Overman H, Read JM, et al. (2016) Line Transect Surveys Underdetect Terrestrial Mammals: Implications for the Sustainability of Subsistence Abstract Hunting. PLoS ONE 11(4): e0152659. doi:10.1371/ journal.pone.0152659 Conservation of Neotropical game species must take into account the livelihood and food Editor: Mathew S. Crowther, University of Sydney, security needs of local human populations. Hunting management decisions should there- AUSTRALIA fore rely on abundance and distribution data that are as representative as possible of true Received: January 19, 2016 population sizes and dynamics. -
Redalyc.Osteomyelitis and Periosteal Reaction in a Red Brocket Deer
Revista Colombiana de Ciencias Pecuarias ISSN: 0120-0690 [email protected] Universidad de Antioquia Colombia Henao-Duque, Ana M; Peña-Stadlin, Juliana; Wehdeking-Hernández, Dave Osteomyelitis and periosteal reaction in a red brocket deer (Mazama americana) Revista Colombiana de Ciencias Pecuarias, vol. 26, núm. 2, junio, 2013, pp. 137-143 Universidad de Antioquia Medellín, Colombia Available in: http://www.redalyc.org/articulo.oa?id=295027566009 How to cite Complete issue Scientific Information System More information about this article Network of Scientific Journals from Latin America, the Caribbean, Spain and Portugal Journal's homepage in redalyc.org Non-profit academic project, developed under the open access initiative Henao-Duque AM et al. Osteomyelitis and periosteal reaction in a red brocket deer 137 Clinical case Revista Colombiana de Ciencias Pecuarias Osteomyelitis and periosteal reaction in a red brocket deer (Mazama americana) Osteomielitis y reacción perióstica en un venado soche (Mazama americana) Osteomelite e reação periosteal em um veado (Mazama americana) Ana M Henao-Duque 1* , DVM; Juliana Peña-Stadlin 2, DVM; Dave Wehdeking-Hernández 2, DVM. 1 Programa de Odismo/Escorpionismo, Universidad de Antioquia, AA 1226, Medellín, Colombia. 2Unidad de Bienestar Animal, Fundación Zoológica de Cali, AA 760045, Cali, Colombia. (Received: June 24, 2012; accepted: January 28, 2013) Summary Anamnesis and treatment approach: a female red brocket deer (Mazama americana , Erxleben 1777 ) presented a post-traumatic abscess in the left-carpometacarpal joint. The deer was treated with enrofloxacin (5 mg/kg) and ivermectin (0.2 mg/kg) with no response. The animal underwent two surgical procedures to remove purulent material and perform adequate antisepsis as well as several antimicrobial therapies, with satisfactory results in a period of 68 days. -
Identification of the Endangered Small Red Brocket Deer (Mazama Bororo) Using Noninvasive Genetic Techniques (Mammalia; Cervidae)
Molecular Ecology Resources (2009) 9, 754-758 doi:10.1111/j.l755-0998.2008.02390.x MOLECULAR DIAGNOSTICS AND DNA TAXONOMY Identification of the endangered small red brocket deer (Mazama bororo) using noninvasive genetic techniques (Mammalia; Cervidae) SUSANA GONZALEZ,* JESUS E. MALDONADO/r JORGE ORTEGA/tJ: ANGELA CRISTINA TALARICO,§LETICIABIDEGARAY-BATISTA,*,**JOSE EDUARDO GARCIA! and JOSE MAURICIO BARBANTI DUARTEg *Unidad de Genetica de la Conservation, Departamento de Genetica, IIBCE-Facultad de Ciencias/UdelaR, Montevideo, Uruguay, tCenterfor Conservation and Evolutionary Genetics, NZP/NMNH, Smithsonian Institution, 3001 Connecticut Ave. NW, Washington D.C. 20008, USA, %Laboratorio de Ictiologia y Limnologia, Posgrado en Ciencias Quimico-Biologicas, Escuela National de Ciencias Biologicas, lnstituto Politecnico National, Prolongation de Carpio y Plan de Ayala s/n, Col. Santo Tomds, 11340 Mexico, %Nucleo de Pesauisa e Conservacao de Cervideos (NUPECCE), Departamento de Zootecnia, FCAV/UNESP, Sao Paulo State University, Via de Acesso Paulo Donato Castellane, s/n, CEP 14884-900, Jaboticabal-SP, Brazil, fCentro Academico de Vitoria. Universidade Federal de Pernambuco, 55608-680 Vitoria de Santo Antao — PE, Brazil Abstract The small red brocket deer Mazama bororo is one of the most endangered deer in the Neotropics. The great morphological similarities with three other sympatric brocket deer species, coupled with the fact that they inhabit densely forested habitats complicate detection and prevent the use of traditional methodologies for accurate identification of species. The ability to determine the presence of this endangered species in an area is crucial for estimating its distribution range, and is critical for establishing conservation management strategies. Here we describe a fast and reliable noninvasive genetic method for species identification of Mazama species from faeces. -
45765132012.Pdf
Mastozoología Neotropical ISSN: 0327-9383 ISSN: 1666-0536 [email protected] Sociedad Argentina para el Estudio de los Mamíferos Argentina González, Susana; Barbanti Duarte, José Maurício SPECIATION, EVOLUTIONARY HISTORY AND CONSERVATION TRENDS OF NEOTROPICAL DEER Mastozoología Neotropical, vol. 27, núm. 0, 2020, -Julio, pp. 37-47 Sociedad Argentina para el Estudio de los Mamíferos Tucumán, Argentina Disponible en: https://www.redalyc.org/articulo.oa?id=45765132012 Cómo citar el artículo Número completo Sistema de Información Científica Redalyc Más información del artículo Red de Revistas Científicas de América Latina y el Caribe, España y Portugal Página de la revista en redalyc.org Proyecto académico sin fines de lucro, desarrollado bajo la iniciativa de acceso abierto Mastozoología Neotropical, 27(SI):37-47, Mendoza, 2020 Copyright ©SAREM, 2020 Versión on-line ISSN 1666-0536 http://www.sarem.org.ar https://doi.org/10.31687/saremMN_SI.20.27.1.05 https://sbmz.org Número Aniversario SPECIATION, EVOLUTIONARY HISTORY AND CONSERVATION TRENDS OF NEOTROPICAL DEER Susana González1 and José Maurício Barbanti Duarte2 1 Biodiversidad y Genética, Instituto de Investigaciones Biológicas Clemente Estable-Ministerio de Educación y Cultura, Montevideo, Uruguay. [Correspondence: Susana González <[email protected]>] 2 Núcleo de Pesquisa e Conservação de Cervídeos (NUPECCE), Departamento de Zootecnia, Universidade Estadual Paulista Júlio de Mesquita Filho (UNESP), Jaboticabal-SP, Brasil. ABSTRACT. Neotropical deer species have broad geographic ranges in vulnerable Latin American ecosystems. Habitat destruction and overhunting have limited deer species to a portion of their historical ranges. Our aims are to provide an overview of the current state of knowledge of Neotropical deer species systematics and evo- lutionary history, and to discuss their current conservation status. -
Medium to Large Size Mammals of Southern Serra Do Amolar, Mato Grosso Do Sul, Brazilian Pantanal
This is a repository copy of Medium to large size mammals of southern Serra do Amolar, Mato Grosso do Sul, Brazilian Pantanal. White Rose Research Online URL for this paper: http://eprints.whiterose.ac.uk/98067/ Version: Published Version Article: Porfirio, Grasiela, Sarmento, Pedro, Xavier Filho, Nilson Lino et al. (2 more authors) (2014) Medium to large size mammals of southern Serra do Amolar, Mato Grosso do Sul, Brazilian Pantanal. Check List. pp. 473-482. ISSN 1809-127X 10.15560/10.3.473 Reuse This article is distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs (CC BY-NC-ND) licence. This licence only allows you to download this work and share it with others as long as you credit the authors, but you can’t change the article in any way or use it commercially. More information and the full terms of the licence here: https://creativecommons.org/licenses/ Takedown If you consider content in White Rose Research Online to be in breach of UK law, please notify us by emailing [email protected] including the URL of the record and the reason for the withdrawal request. [email protected] https://eprints.whiterose.ac.uk/ Check List 10(3): 473–482, 2014 © 2014 Check List and Authors Chec List ISSN 1809-127X (available at www.checklist.org.br) Journal of species lists and distribution Medium to large size mammals of southern Serra do PECIES Amolar, Mato Grosso do Sul, Brazilian Pantanal S OF 1,2*, Pedro Sarmento 1, Nilson Lino Xavier Filho 2, Joana Cruz 3 and Carlos Fonseca 1 ISTS L Grasiela1 University Porfirio of Aveiro, Biology Department and CESAM – Centro de Estudos do Ambiente e do Mar. -
Activity Pattern of Brocket Deer (Genus Mazama) in the Atlantic Forest: Does Sampling Design Affect the Patterns?
Research Article JOJ Wildl Biodivers Copyright © All rights are reserved by Ana Carolina Srbek-Araujo Volume 1 Issue 2 - September 2019 Activity Pattern of Brocket Deer (Genus Mazama) in the Atlantic Forest: Does Sampling Design Affect the Patterns? Ana Carolina Srbek-Araujo1,2,3,4*, Tayná Seabra1 and Giovanna Colnago Cecanecchia1,2 1Laboratório de Ecologia e Conservação de Biodiversidade (LECBio), Universidade Vila Velha – UVV, Rua Comissário José Dantas de Melo, nº 21, Bairro Boa Vista, Vila Velha, Espírito Santo, Brazil 2Programa de Pós-graduação em Ecologia de Ecossistemas, Universidade Vila Velha – UVV, Brazil 3Programa de Pós-graduação em Ciência Animal, Universidade Vila Velha – UVV, Brazil 4Instituto SerraDiCal de Pesquisa e Conservação, Belo Horizonte, Minas Gerais, Brazil Submission: June 25, 2019; Published: September 19, 2019 *Corresponding author: Ana Carolina Srbek-Araujo, Laboratório de Ecologia e Conservação de Biodiversidade, Programa de Pós-graduação em Ecologia de Ecossistemas, Programa de Pós-graduação em Ciência Animal, Universidade Vila Velha, Vila Velha, Espírito Santo, Brazil Abstract This study aimed to describe the activity pattern of Mazama spp. in an Atlantic Forest remnant in southeastern Brazil, and to test whether sampling designs, and these included camera trapping installed along internal unpaved roads or in the forest interior. The records of Mazama spp. werethe sampling collected design throughout can affect the theday, recorded with no periods patterns. of Datainactivity, from 4similarly sampling to -
Gross Anatomy of the Gastrointestinal Tract of a Red Brocket Deer (Mazama Americana): a Case Study
Journal of Advanced Veterinary Research Volume 8, Issue 3 (2018) 26-31 Journal of Advanced Veterinary Research http://advetresearch.com/index.php/avr/index Gross Anatomy of the Gastrointestinal Tract of a Red Brocket Deer (Mazama americana): A Case Study Kegan Romelle Jones*, Kavita Ranjeeta Lall, Gary Wayne Garcia The Open Tropical Forage-Animal Production Laboratory [OTF-APL], Department of Food Production [DFP], Faculty of Food and Agriculture [FFA], The University of the West Indies [UWI], St Augustine, Trinidad and Tobago ARTICLE INFO ABSTRACT Case Report A fresh carcass of a male red brocket deer (Mazama americana) was examined and dissected to macro- scopically and morphometrically examine its gastrointestinal tract. It was found to have the typical Received: rumen forestomach, consisting of the rumen, reticulum, omasum and abomasum. The tongue of the 17 May 2018 red brocket deer is pointed with a prominent torus lingua. The small intestine (4.743 m) was almost twice the length of the colon and rectum (1.940 m) and made up 65.84% of the intestinal tract, while Accepted the large intestine accounted for 35.16%. The hard palate had transverse folds which ran to the level of : the premolars, leading feed into the oesophagus. These preliminary findings classified the red brocket 29 June 2018 deer as a concentrate selector ruminant. This was the first known anatomical description of the gas- trointestinal tract of the red brocket deer (Mazama americana) documented. Keywords: Red brocket deer, Anatomy, Digestive tract, Measurements, Forestomach,Intestine J. Adv. Vet. Res. (2018), 8 (3),26-31 Introduction Bodmer, 1989; Emmons and Freer, 1990; Bodmer, 1991b; Eisenberg and Redford, 1999). -
Gallina & Mandujano
Mongabay.com Open Access Journal - Tropical Conservation Science Vol. 2 (2):116-127, 2009 Special issue: introduction Research on ecology, conservation and management of wild ungulates in Mexico Sonia Gallina1 and Salvador Mandujano1 1 Departamento de Biodiversidad y Ecología Animal, Instituto de Ecología A. C., km. 2.5 Carret. Ant. Coatepec No. 351, Congregación del Haya, Xalapa 91070, Ver. México. E‐mail: <[email protected]>; <[email protected]> Abstract This special issue of Tropical Conservation Science provides a synopsis of nine of the eleven presentations on ungulates presented at the Symposium on Ecology and Conservation of Ungulates in Mexico during the Mexican Congress of Ecology held in November 2008 in Merida, Yucatan. Of the eleven species of wild ungulates in Mexico (Baird´s tapir Tapirus bairdii, pronghorn antelope Antilocapra americana, American bison Bison bison, bighorn sheep Ovis canadensis, elk Cervus canadensis, red brocket deer Mazama temama, Yucatan brown brocket Mazama pandora, mule deer Odocoileus hemionus, white-tailed deer Odocoileus virginianus, white-lipped peccary Tayassu pecari and collared peccary Pecari tajacu), studies which concern four of these species are presented: Baird’s tapir and the white lipped peccary, which are tropical species in danger of extinction; the bighorn sheep, of high value for hunting in the north-west; and the white-tailed deer, the most studied ungulate in Mexico due to its wide distribution in the country and high hunting and cultural value. In addition, two studies of exotic species, wild boar (Sus scrofa) and red deer (Cervus elaphus), are presented. Issues addressed in these studies are: population estimates, habitat use, evaluation of UMA (Spanish acronym for ‘Wildlife Conservation, Management and Sustainable Utilization Units’) and ANP (Spanish acronym for ‘Natural Protected Areas’) to sustain minimum viable populations, and the effect of alien species in protected areas and UMA, all of which allow an insight into ungulate conservation and management within the country. -
Sexual Selection and Extinction in Deer Saloume Bazyan
Sexual selection and extinction in deer Saloume Bazyan Degree project in biology, Master of science (2 years), 2013 Examensarbete i biologi 30 hp till masterexamen, 2013 Biology Education Centre and Ecology and Genetics, Uppsala University Supervisor: Jacob Höglund External opponent: Masahito Tsuboi Content Abstract..............................................................................................................................................II Introduction..........................................................................................................................................1 Sexual selection........................................................................................................................1 − Male-male competition...................................................................................................2 − Female choice.................................................................................................................2 − Sexual conflict.................................................................................................................3 Secondary sexual trait and mating system. .............................................................................3 Intensity of sexual selection......................................................................................................5 Goal and scope.....................................................................................................................................6 Methods................................................................................................................................................8 -
Online Resources Supplemental Material Supplementary Information
Hystrix (2019) — online resources Supplemental Material Supplementary Information Phylogeny and diversity of moose (Alces alces, Cervidae, Mammalia) revealed by complete mitochondrial genomes M. Świsłocka, M. Matosiuk, M. Ratkiewicz, A. Borkowska, M. Czajkowska, P. Mackiewicz Table S1: List of primer pairs used for PCR and sequencing of mitogenomes in Alces alces. Primer Primer sequence Position Tm [℃] Product [bp] Genes Primer source 12S-FW GGTAAATCTCGTGCCAGCCA 00295 57.3 712 <12s_rRNA> Fajardo et al., 2007† 12S-REV TCCAGTATGCTTACCTTGTTACGAC 01007 56.2 00871c_F TGCTTAGTTGAATTAGGCAATG 00872 51.3 1176 <12s_rRNA...tRNA-Val...16s_rRNA> Matosiuk et al., 2014‡ 02052c_R AGAGAACAAGTGATTATGCTACC 02048 52.2 01950c_F ACCTCCAGCATAACTAGTATTGG 01945 53.7 1455 <16s_rRNA...tRNA-Leu...ND1> Matosiuk et al., 2014‡ 03402c_R AATGGTCCTGCTGCATACTCTA 03400 55.2 03140c_F CTACGAGCAGTAGCTCAAACA 03138 54.1 1025 <ND1...tRNA-Ile...tRNA-Gln...tRNA-Met...ND2> Matosiuk et al., 2014‡ 04165c_R ACAGTTCATTGGCCTGAAAATA 04163 52.5 3910a_F CCTTCCCGTACTAATAAACC 03894 50.0 1519 <tRNA-Met...ND2...tRNA-Trp...tRNA-Ala...> This study 4300a_F2 TCATCAGGCCTAATTCTACT 04279 - <tRNA-Asn...tRNA-Cys...tRNA-Tyr...COX1> 5430a_R TATGCCTGCTCARGCACCAA 05413 56.0 COX1_F TCAGCCATTTTACCTATGTTCA 05315 51.7 826 <tRNA-Tyr...COX1> GenBank§ COX1_R ATRTAGCCAAARGGTTCTTTTT 06141 48.5 06060a_F TCTTTGGACACCCCGAAGTA 06039 55.2 991 <COX1...tRNA-Ser...tRNA-Asp...COX2> This study 07050a_R ATGGGGTAAGCCATATGAGG 07030 53.8 06090a_F TCGTAACATACTACTCAGGG 06099 50.2 1503 <COX1...tRNA-Ser...tRNA-Asp...COX2> This study