DOCSLIB.ORG

Asymmetry and Karyotypic Relationships of Cervidae (Artiodactyla) Taxa

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Asymmetry and Karyotypic Relationships of Cervidae (Artiodactyla) Taxa Punjab University Journal of Zoology 36(1): 71-79 (2021) https://dx.doi.org/10.17582/journal.pujz/2021.36.1.71.79 Research Article Karyotype Symmetry/ Asymmetry and Karyotypic Relationships of Cervidae (Artiodactyla) Taxa Halil Erhan Eroğlu Department of Biology, Faculty of Science and Art, Yozgat Bozok University, Yozgat, Turkey. Article History Received: February 26, 2019 Abstract | Karyotype asymmetry is one of the most widely used approaches in cytotaxonomic Revised: May 03, 2021 studies. The symmetry/asymmetry index (S/AI) is used to determine karyotype asymmetry in Accepted: May 18, 2021 higher animals and humans. The formula designed by the number of chromosome types is Published: June 13, 2021 S/AI = (1 × M) + (2 × SM) + (3 × A) + (4 × T) / 2n. The S/AI value varies from 1.0000 (full symmetric) to 4.0000 (full asymmetric). After a detailed literature review, the chromosomal Keywords data of 36 female species and 32 male species of family Cervidae were detected, namely (i) Artiodactyla, Cervidae, Kary- karyotype formulae, (ii) symmetry/asymmetry index values (iii) karyotype types. According otype, Phylogeny, Symmetry/ asymmetry index to the chromosomal data, two phylogenetic trees were formed. The phylogenetic trees were showed karyotypic relationships among the taxa. Novelty Statement | This is the first report on karyotype asymmetry of Cervidae. Karyotypic relationships are useful to infer processes of evolution and speciation. Karyotype asymmetry is an important parameter that helps to establish phylogenetic relationships among various species. To cite this article: Eroğlu, H.E., 2021. Karyotype symmetry/ asymmetry and karyotypic relationships of cervidae (Artiodactyla) taxa. Punjab Univ. J. Zool., 36(1): 71-79. https://dx.doi.org/10.17582/journal.pujz/2021.36.1.71.79 Introduction Wild (EW) and Extinct (EX), respectively (IUCN, 2018). ervidae (Goldfuss, 1820) is placed in the order The family Cervidae is one of the most important Artiodactyla (Owen, 1848). The family consists of at members of the world’s wildlife. Therefore, many Cleast 51 wild species in 19 genera. The Cervidae are the most taxonomic and cytotaxonomic studies have been reported widespread family of extant Artiodactyla after Bovidae related cervids till now and some of them have been (ITIS, 2019). They are distributed naturally in all continents summarized. The chromosome numbers of Cervidae are except Antarctica and Australia (Gilbert et al., 2006). The generally 2n = 50–70 (Wurster and Benirschke, 1967a, number of cervids decreases with human effects as a result 1967b; Hsu and Benirschke, 1973a, 1973b; Jorge and of uncontrolled hunting, especially in Europe, Asia and Benirschke, 1977). The majority of species have 66–70 America. According to the International Union for the chromosomes (Naik et al., 1964; Wurster and Benirschke, Conservation of Nature (IUCN) Red List, the seven species 1967a, 1967b; Gustavsson and Sundt, 1968; Koulischer et are categorized as Endangered (EN). In addition, Axis al., 1972; Sokolov et al., 1978; Wang and Du, 1983; Herzog, kuhlii (bawean deer), Elaphurus davidianus (père David’s 1987). As an extreme example, Muntiacus muntjak has the deer) and Rucervus schomburgki (Schomburgk’s deer) are lowest diploid chromosome number among mammals categorized as Critically Endangered (CR), Extinct in the (female 2n = 6; male 2n = 7) (Tanomtong et al., 2005). The chromosome numbers of genus Muntiacus are extremely diverse, ranging from 6 in Muntiacus muntjak (Tanomtong Corresponding author: Halil Erhan Eroğlu et al., 2005) to the relatively high number of 46 in Muntiacus [email protected] reevesi reevesi (Wurster and Benirschke, 1967a; Chiang et June 2021 | Volume 36 | Issue 1 | Page 71 H.E. Eroğlu al., 2004) and Muntiacus reevesi micrurus (Chiang et al., 2.0 (symmetric), 2.0 < S/AI ≤ 3.0 (between symmetric and 2004). In addition, there are B chromosomes in the family asymmetric), 3.0 < S/AI < 4.0 (asymmetric) and 4.0 = S/AI Cervidae (Abril and Duarte, 2008; Resende et al., 2011; (full asymmetric). Fiorillo et al., 2013). B chromosomes, are not necessarily necessary chromosomes, are extra chromosomes that do Sample application of symmetry/asymmetry on taxa not comply with Mendelian inheritance rules. They are The karyotypes of the sample application belong commonly found in mammals (Palestis et al., 2004). to Cervidae taxa. The Cervidae includes the ruminant mammals commonly known as deer, elk, moose and Karyotype asymmetry is an important parameter caribou. After a detailed literature review, the information in karyotype studies. Many parameters have been about family Cervidae was detected namely; (i) scientific/ proposed in the calculation of karyotype asymmetry, common names and author(s), (ii) karyotype formulae which are parameters of Stebbins classification, TF (total with B-chromosomes, if any (iii) symmetry/asymmetry form percentage), AsK (karyotype asymmetry index index values (iv) karyotype types (Table 1). percentage), Syi (symmetric index), Rec (ratios of each chromosome), A1 (intrachromosomal asymmetry index), Table 1 includes the scientific/common names A2 (interchromosomal asymmetry index), DI (dispersion and author(s) of the taxa. The databases were used for index), A (asymmetry index), CVCL (coefficient of the control of scientific names, namely IUCN Red List variation of chromosome length), CVCI (coefficient of (IUCN, 2018) and the Integrated Taxonomic Information variation of centromeric index), MCA (mean centromeric System (ITIS, 2019), because sometimes scientific names asymmetry) and S/AI. All except S/AI have been proposed can be expressed with different names in different sources. for the calculation of plant karyotype asymmetries (Eroğlu The genus Rucervus is an important example. The names et al., 2013; Peruzzi and Eroğlu, 2013; Eroğlu, 2015). The of genus are Cervus (Chandra et al., 1967; Chavananikul S/AI is used to determine karyotype asymmetry in higher et al., 1995; Thevenon et al., 2000; Bonnet-Garnier et al., animals and humans (Eroğlu, 2015). All methods use 2003) and Rucervus (IUCN, 2018; ITIS, 2019). basic measurement data such as long and short arms of chromosomes. The symmetrical karyotype is characterized In addition, Table 1 includes the symmetry/ asymmetry by chromosomes with central centromere that do not index values and the karyotype types. Calculation of these differ much between long and short arm lengths. On values is given below with Cervus albirostris karyotype. In the contrary, the asymmetric karyotype is characterized Table 1, the karyotype formulae are 2n = 66 = 2M + 2SM by chromosomes with very different long and short + 62A in female and 2n = 66 = 2M + 3SM + 61A in male. arm lengths and without a central centromere (Peruzzi and Eroğlu, 2013). The aim of this study is to reveal the S/AI (female)= (1×M)+(2 × SM) + (3 × A) + (4 × T) / 2n karyotypic relationships of Cervidae taxa by determining S/AI (female) = (1 × 2) + (2 × 2) + (3 × 62) / 66 the karyotype asymmetries. S/AI (female) = 2.9091 2.0 < S/AI (female)≤ 3.0 (between symmetric and asymmetric) Materials and Methods S/AI (male)= (1 × M) + (2 × SM) + (3 × A) + (4 × T) / 2n S/AI (male) = (1 × 2) + (2 × 3) + (3 × 61) / 66 S/A (male) = 2.8939 The karyotype symmetry/asymmetry index I 2.0 < S/A (male) ≤ 3.0 (between symmetric and asymmetric) Eroğlu (2015) reported a formula to calculate I karyotype symmetry/asymmetry index with two important The phylogenetic trees formed by chromosomal data matters. Firstly, while other parameters use chromosome in Table 1 present the karyotype relationships among the arm lengths, the S/AI parameter uses the karyotype taxa of Cervidae (Figures 1 and 2). The Figures 1 and formula. Secondly, the chromosomal lengths may contain 2 include 36 female taxa and 32 male taxa, respectively. small differences in different karyotype studies of the For two reasons, four taxa are not included in the male same species. The differences do not affect the karyotype phylogenetic tree: (i) The male subjects were not studied formula and S/A value. The S/A formula is shown below. I I in Capreolus pygargus, Mazama gouazoubira and Ozotoceros bezoarticus; only female reports (Sokolov et al., 1978; S/A = (1 × M) + (2 × SM) + (3 × A or ST) + (4 × T) / 2n I Spotorno et al., 1987; Resende et al., 2011). (ii) In the karyotype study of Hippocamelus bisulcus, there are small The formula was designed according to the number Y chromosomes that cannot be examined. Therefore, of chromosome types, namely the chromosome number chromosome cannot be classified (Spotorno et al., 1987). of metacentric (M), submetacentric (SM), acrocentric Finally, drawings of some species were added to the figures (A), subtelocentric (ST) and telocentric (T). In addition, to further clarify the karyotype relationships among taxa. a classification model was given according to the S/AI value, namely 1.0 = S/AI (full symmetric), 1.0 < S/AI ≤ June 2021 | Volume 36 | Issue 1 | Page 72 Karyotype Asymmetry of Cervidae Table 1: The karyotype formulae, index values and karyotype types of the taxa. No Family/ Species Sample 2n Autosomes and References S/AI Kary- Scientific name/common name number sex chromosomes otype type 1 Hydropotes inermis (Swinhoe, 1870) 1 F 70 68A Hsu and Benirschke, 1973b 3.0000 (F) BSA (Water deer) 1 M X = A, Y = A 3.0000 (M) 2 Muntiacus reevesi reevesi (Ogilby, 1 F 46 44A Wurster and Benirschke, 3.0000 (F) BSA 1839) (Chinese muntjac) 1 M X = A, Y = SM 1967a; Chiang et al., 2004 2.9783 (M) 3 Muntiacus reevesi micrurus (Sclater, 1 F 46 44A Chiang et al., 2004 3.0000 (F) BSA 1875) (Formosan muntjac) 1 M X = A, Y = SM 2.9783 (M) 4 Muntiacus feae (Thomas & Doria, 4 F 14 13A Tanomtong et al., 2005 3.0000 (F) BSA 1889) (Fea's muntjac) 2 M X*, Y = SM 2.8571 (M) 5 Muntiacus muntjak (Zimmermann, 3 F 6 (F) 2M + 4A Tanomtong et al., 2005 2.3333 (F) BSA 1780), (Indian muntjac) 2 M 7 (M) X**, Y = M 2.2857 (M) 6 Capreolus capreolus (Linnaeus, 1758) 1 F 70 68A Wurster and Benirschke, 2.9714 (F) BSA (European roe deer) 1 M X = SM, Y = ST 1967b 2.9857 (M) 7 Capreolus pygargus (Pallas, 1771) — 70 68A Sokolov et al., 1978 2.9714 (F) BSA (Siberian roe deer) X = SM, Y ?*** 8 Mazama gouazoubira (G.
Load more

Recommended publications
  • Chromosome Polymorphism in the Brazilian Dwarf Brocket Deer, Mazama Nana (Mammalia, Cervidae)
    Genetics and Molecular Biology, 31, 1, 53-57 (2008) Copyright by the Brazilian Society of Genetics. Printed in Brazil www.sbg.org.br Research Article Chromosome polymorphism in the Brazilian dwarf brocket deer, Mazama nana (Mammalia, Cervidae) Vanessa Veltrini Abril1,2 and José Maurício Barbanti Duarte2 1Programa de Pós-Graduação em Genética e Melhoramento Animal, Faculdade de Ciências Agrárias e Veterinárias, Universidade Estadual Paulista, Campus de Jaboticabal, Jaboticabal, SP, Brazil. 2Núcleo de Pesquisa e Conservação de Cervídeos, Departamento de Zootecnia, Faculdade de Ciências Agrárias e Veterinárias, Universidade Estadual Paulista, Campus de Jaboticabal, Jaboticabal, SP, Brazil. Abstract The Brazilian dwarf brocket deer (Mazama nana) is the smallest deer species in Brazil and is considered threatened due to the reduction and alteration of its habitat, the Atlantic Rainforest. Moreover, previous work suggested the pres- ence of intraspecific chromosome polymorphisms which may contribute to further population instability because of the reduced fertility arising from the deleterious effects of chromosome rearrangements during meiosis. We used G- and C-banding, and nucleolus organizer regions localization by silver-nitrate staining (Ag-NOR) to investigate the causes of this variation. Mazama nana exhibited eight different karyotypes (2n = 36 through 39 and FN = 58) result- ing from centric fusions and from inter and intraindividual variation in the number of B chromosomes (one to six). Most of the animals were heterozygous for a single fusion, suggesting one or several of the following: a) genetic in- stability in a species that has not reached its optimal karyotypic evolutionary state yet; b) negative selective pressure acting on accumulated rearrangements; and c) probable positive selection pressure for heterozygous individuals which maintains the polymorphism in the population (in contrast with the negative selection for many rearrangements within a single individual).
    [Show full text]
  • Line Transect Surveys Underdetect Terrestrial Mammals: Implications for the Sustainability of Subsistence Hunting
    RESEARCH ARTICLE Line Transect Surveys Underdetect Terrestrial Mammals: Implications for the Sustainability of Subsistence Hunting José M. V. Fragoso1☯¤*, Taal Levi2‡, Luiz F. B. Oliveira3‡, Jeffrey B. Luzar4‡, Han Overman5‡, Jane M. Read6‡, Kirsten M. Silvius7☯ 1 Stanford University, Stanford, CA, 94305–5020, United States of America, 2 Department of Fisheries and Wildlife, Oregon State University, Corvallis, OR, United States of America, 3 Departamento de Vertebrados, Museu Nacional, UFRJ, RJ, 20.940–040, Brazil, 4 Stanford University, Stanford, CA, 94305–5020, United States of America, 5 Environmental and Forest Biology, State University of New York-College of Environmental Science and Forestry, Syracuse, NY, 13210, United States of America, 6 Geography Department, Syracuse University, Syracuse, NY, 13244, United States of America, 7 Department of Forest Resources and Environmental Conservation, Virginia Tech, Blacksburg, VA, United States of America ☯ These authors contributed equally to this work. ¤ Current address: Biodiversity Science and Sustainability, California Academy of Sciences, San Francisco, California, United States of America OPEN ACCESS ‡ These authors contributed subsets of effort equally to this work. * [email protected] Citation: Fragoso JMV, Levi T, Oliveira LFB, Luzar JB, Overman H, Read JM, et al. (2016) Line Transect Surveys Underdetect Terrestrial Mammals: Implications for the Sustainability of Subsistence Abstract Hunting. PLoS ONE 11(4): e0152659. doi:10.1371/ journal.pone.0152659 Conservation of Neotropical game species must take into account the livelihood and food Editor: Mathew S. Crowther, University of Sydney, security needs of local human populations. Hunting management decisions should there- AUSTRALIA fore rely on abundance and distribution data that are as representative as possible of true Received: January 19, 2016 population sizes and dynamics.
    [Show full text]
  • Identification of the Endangered Small Red Brocket Deer (Mazama Bororo) Using Noninvasive Genetic Techniques (Mammalia; Cervidae)
    Molecular Ecology Resources (2009) 9, 754-758 doi:10.1111/j.l755-0998.2008.02390.x MOLECULAR DIAGNOSTICS AND DNA TAXONOMY Identification of the endangered small red brocket deer (Mazama bororo) using noninvasive genetic techniques (Mammalia; Cervidae) SUSANA GONZALEZ,* JESUS E. MALDONADO/r JORGE ORTEGA/tJ: ANGELA CRISTINA TALARICO,§LETICIABIDEGARAY-BATISTA,*,**JOSE EDUARDO GARCIA! and JOSE MAURICIO BARBANTI DUARTEg *Unidad de Genetica de la Conservation, Departamento de Genetica, IIBCE-Facultad de Ciencias/UdelaR, Montevideo, Uruguay, tCenterfor Conservation and Evolutionary Genetics, NZP/NMNH, Smithsonian Institution, 3001 Connecticut Ave. NW, Washington D.C. 20008, USA, %Laboratorio de Ictiologia y Limnologia, Posgrado en Ciencias Quimico-Biologicas, Escuela National de Ciencias Biologicas, lnstituto Politecnico National, Prolongation de Carpio y Plan de Ayala s/n, Col. Santo Tomds, 11340 Mexico, %Nucleo de Pesauisa e Conservacao de Cervideos (NUPECCE), Departamento de Zootecnia, FCAV/UNESP, Sao Paulo State University, Via de Acesso Paulo Donato Castellane, s/n, CEP 14884-900, Jaboticabal-SP, Brazil, fCentro Academico de Vitoria. Universidade Federal de Pernambuco, 55608-680 Vitoria de Santo Antao — PE, Brazil Abstract The small red brocket deer Mazama bororo is one of the most endangered deer in the Neotropics. The great morphological similarities with three other sympatric brocket deer species, coupled with the fact that they inhabit densely forested habitats complicate detection and prevent the use of traditional methodologies for accurate identification of species. The ability to determine the presence of this endangered species in an area is crucial for estimating its distribution range, and is critical for establishing conservation management strategies. Here we describe a fast and reliable noninvasive genetic method for species identification of Mazama species from faeces.
    [Show full text]
  • Zoologische Mededelingen Uitgegeven Door Het
    ZOOLOGISCHE MEDEDELINGEN UITGEGEVEN DOOR HET RIJKSMUSEUM VAN NATUURLIJKE HISTORIE TE LEIDEN (MINISTERIE VAN CULTUUR, RECREATIE EN MAATSCHAPPELIJK WERK) Deel 45 no. 7 15 Februari 1971 ON THE IDENTITY OF CERVUS NIGRICANS BROOKE, 1877, WITH REMARKS UPON OTHER DEER FROM THE PHILIPPINES by L. J. DOBRORUKA Zoological Garden, Prague With 2 text-figures and 3 plates A great number of papers deal with the deer of the Philippine Islands but in spite of this fact the taxonomy and the nomenclature are still not clear. The first author who recapitulated all known facts about the Philippine deer was Brooke (1877), who also described a new species, Cervus nigricans. The description is exact, with figures of the habitus and the skull of the indicated holotype (♀), and in my opinion Haltenorth (1963) had no reason to con- sider C. nigricans a nomen nudum. The validity of the name Cervus nigricans is in full agreement with the International Code of Zoological Nomenclature, adopted by the XVth International Congress of Zoology. Cervus nigricans is rather rare in the collections of museums and, there- fore, I am much obliged to Dr. A. M. Husson for allowing me to examine the material of the Rijksmuseum van Natuurlijke Historie in Leiden. The material of this museum was mentioned already in Brooke's paper (1877:59) and is therefore most valuable for a study of this species, apart from the type material, of course. At the present time the following material of this species is available in the Leiden Museum: No. 19605 ♂ — mounted specimen and skull from Manila, Philippines. Presented by M.
    [Show full text]
  • Non-Flying Mammals of Mindanao Island, Philippines WEB VERSION 1 Lawrence R
    Non-Flying Mammals of Mindanao Island, Philippines WEB VERSION 1 Lawrence R. Heaney, Nina R. Ingle, Jodi L. Sedlock, Blas R. Tabaranza Jr., Zoology Dept., The Field Museum, 1400 S. Lake Shore Drive, Chicago, IL 60605, USA Illustrations by J.L. Sedlock. Photos by: L.R. Heaney, N.R. Ingle, P.D. Heideman, M. Dagosto. Produced by: R.B. Foster, N.R. Ingle, M.R. Metz, with support from the Andrew Mellon Foundation, the MacArthur Foundation, and the Brown Fund of The Field Museum.© L. Heaney, N. Ingle, J. Sedlock, B. Tabaranza Jr.; Environ. & Conservation Programs, The Field Museum, Chicago, IL 60605, USA. [[email protected]] Rapid Color Guide #50 version 1.1 Macaca fascicularis Tarsius syrichta Paradoxurus hermaphroditus Viverra tangalunga CERCOPITHECIDAE TARSIIDAE VIVERRIDAE VIVERRIDAE Cynocephalus volans Urogale everetti Crocidura beatus Suncus murinus CYNOCEPHALIDAE TUPAIIDAE SORICIDAE SORICIDAE Podogymnura truei Batomys salomonseni Bullimus bagobus Crunomys suncoides ERICINACEIDAE MURIDAE MURIDAE MURIDAE Limnomys sibuanus Rattus everetti Rattus tanezumi Tarsomys apoensis MURIDAE MURIDAE MURIDAE MURIDAE Apomys insignis Rattus exulans Tarsomys apoensis, Tarsomys sp., Apomys hylocoetes Exilisciurus concinnus (Top) MURIDAE (Bottom) (Left to Right) MURIDAE (Top to Bottom) SCIURDAE These photos show most genera of non-flying mammals known from Mindanao. Not pictured here but easily identified are the Philippine Wild Pig (Sus philippensis, Suidae) and the Philippine Deer (Cervus mariannus, Cervidae). Rats and mice of the family Muridae are represented by 15 species, some very hard to tell apart. Many characters should be examined, such as body measurements and the structure of the feet, including the shape and size of pads and the fur on them; fur texture and color; and the number and location of nipples (on females).
    [Show full text]
  • Gallina & Mandujano
    Mongabay.com Open Access Journal - Tropical Conservation Science Vol. 2 (2):116-127, 2009 Special issue: introduction Research on ecology, conservation and management of wild ungulates in Mexico Sonia Gallina1 and Salvador Mandujano1 1 Departamento de Biodiversidad y Ecología Animal, Instituto de Ecología A. C., km. 2.5 Carret. Ant. Coatepec No. 351, Congregación del Haya, Xalapa 91070, Ver. México. E‐mail: <[email protected]>; <[email protected]> Abstract This special issue of Tropical Conservation Science provides a synopsis of nine of the eleven presentations on ungulates presented at the Symposium on Ecology and Conservation of Ungulates in Mexico during the Mexican Congress of Ecology held in November 2008 in Merida, Yucatan. Of the eleven species of wild ungulates in Mexico (Baird´s tapir Tapirus bairdii, pronghorn antelope Antilocapra americana, American bison Bison bison, bighorn sheep Ovis canadensis, elk Cervus canadensis, red brocket deer Mazama temama, Yucatan brown brocket Mazama pandora, mule deer Odocoileus hemionus, white-tailed deer Odocoileus virginianus, white-lipped peccary Tayassu pecari and collared peccary Pecari tajacu), studies which concern four of these species are presented: Baird’s tapir and the white lipped peccary, which are tropical species in danger of extinction; the bighorn sheep, of high value for hunting in the north-west; and the white-tailed deer, the most studied ungulate in Mexico due to its wide distribution in the country and high hunting and cultural value. In addition, two studies of exotic species, wild boar (Sus scrofa) and red deer (Cervus elaphus), are presented. Issues addressed in these studies are: population estimates, habitat use, evaluation of UMA (Spanish acronym for ‘Wildlife Conservation, Management and Sustainable Utilization Units’) and ANP (Spanish acronym for ‘Natural Protected Areas’) to sustain minimum viable populations, and the effect of alien species in protected areas and UMA, all of which allow an insight into ungulate conservation and management within the country.
    [Show full text]
  • Sexual Selection and Extinction in Deer Saloume Bazyan
    Sexual selection and extinction in deer Saloume Bazyan Degree project in biology, Master of science (2 years), 2013 Examensarbete i biologi 30 hp till masterexamen, 2013 Biology Education Centre and Ecology and Genetics, Uppsala University Supervisor: Jacob Höglund External opponent: Masahito Tsuboi Content Abstract..............................................................................................................................................II Introduction..........................................................................................................................................1 Sexual selection........................................................................................................................1 − Male-male competition...................................................................................................2 − Female choice.................................................................................................................2 − Sexual conflict.................................................................................................................3 Secondary sexual trait and mating system. .............................................................................3 Intensity of sexual selection......................................................................................................5 Goal and scope.....................................................................................................................................6 Methods................................................................................................................................................8
    [Show full text]
  • Online Resources Supplemental Material Supplementary Information
    Hystrix (2019) — online resources Supplemental Material Supplementary Information Phylogeny and diversity of moose (Alces alces, Cervidae, Mammalia) revealed by complete mitochondrial genomes M. Świsłocka, M. Matosiuk, M. Ratkiewicz, A. Borkowska, M. Czajkowska, P. Mackiewicz Table S1: List of primer pairs used for PCR and sequencing of mitogenomes in Alces alces. Primer Primer sequence Position Tm [℃] Product [bp] Genes Primer source 12S-FW GGTAAATCTCGTGCCAGCCA 00295 57.3 712 <12s_rRNA> Fajardo et al., 2007† 12S-REV TCCAGTATGCTTACCTTGTTACGAC 01007 56.2 00871c_F TGCTTAGTTGAATTAGGCAATG 00872 51.3 1176 <12s_rRNA...tRNA-Val...16s_rRNA> Matosiuk et al., 2014‡ 02052c_R AGAGAACAAGTGATTATGCTACC 02048 52.2 01950c_F ACCTCCAGCATAACTAGTATTGG 01945 53.7 1455 <16s_rRNA...tRNA-Leu...ND1> Matosiuk et al., 2014‡ 03402c_R AATGGTCCTGCTGCATACTCTA 03400 55.2 03140c_F CTACGAGCAGTAGCTCAAACA 03138 54.1 1025 <ND1...tRNA-Ile...tRNA-Gln...tRNA-Met...ND2> Matosiuk et al., 2014‡ 04165c_R ACAGTTCATTGGCCTGAAAATA 04163 52.5 3910a_F CCTTCCCGTACTAATAAACC 03894 50.0 1519 <tRNA-Met...ND2...tRNA-Trp...tRNA-Ala...> This study 4300a_F2 TCATCAGGCCTAATTCTACT 04279 - <tRNA-Asn...tRNA-Cys...tRNA-Tyr...COX1> 5430a_R TATGCCTGCTCARGCACCAA 05413 56.0 COX1_F TCAGCCATTTTACCTATGTTCA 05315 51.7 826 <tRNA-Tyr...COX1> GenBank§ COX1_R ATRTAGCCAAARGGTTCTTTTT 06141 48.5 06060a_F TCTTTGGACACCCCGAAGTA 06039 55.2 991 <COX1...tRNA-Ser...tRNA-Asp...COX2> This study 07050a_R ATGGGGTAAGCCATATGAGG 07030 53.8 06090a_F TCGTAACATACTACTCAGGG 06099 50.2 1503 <COX1...tRNA-Ser...tRNA-Asp...COX2> This study
    [Show full text]
  • Human Impacts on Carnivore Biodiversity Inside and Outside
    HUMAN IMPACTS ON CARNIVORE BIODIVERSITY INSIDE AND OUTSIDE PROTECTED AREAS IN TANZANIA MAURUS JANUARY MSUHA PhD THESIS UNIVERSITY COLLEGE LONDON (UCL) AND INSTITUTE OF ZOOLOGY, ZOOLOGICAL SOCIETY OF LONDON 2009 1 DECLARATION I, Maurus January Msuha hereby declare that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated. The material contained in this thesis has not been previously submitted for a degree at University College London or any other university. ©The copyright of this thesis rests with the author. No quotation of this thesis should be published without the author’s prior written consent and information derived from this should be acknowledged. Thesis submitted in fulfilment of the requirements for the Degree of Doctor of Philosophy, University College London, 2009 SUMMARY 2 Conservation of biodiversity throughout the world is often characterized by the establishment of protected areas. The implementation of this approach is extremely challenging particularly in developing countries due to expanding human population and demand for resources. Yet, information that is needed to guide managers and policy makers to develop effective conservation strategies is scarce in most of these countries. This thesis aimed to explore the impact of human activities on carnivore biodiversity inside and outside Tarangire National Park in Tanzania using camera traps, and to assess attitudes of agropastoralists towards carnivores using interviews. Results showed no significant difference in carnivore species richness between the park and communal grazing areas outside the park, but was a significantly different between the park and cultivated areas outside it.
    [Show full text]
  • Endangered Mammals in Peru by Ian Grimwood
    411 Endangered Mammals in Peru By Ian Grimwood Major Ian Grimwood spent two years, 1965-67, in Peru, through the British Ministry of Overseas Development, as wildlife adviser to the Peruvian Government. His recommendation in his report for the establishment of the Manu National Park, a 4800-square-mile area of forest on the eastern slopes of the Andes, rich in wildlife, was accepted by the Peruvian Government in March 1968, as reported in ORYX May 1968, and the FPS allocated £1000 from the FPS/WWF Revolving Fund for this park. In an appendix to his main report Major Grimwood made a survey of the status of some Peruvian mammals, from which the following extracts concerning the more endangered ones are made. The chinchilla he considers to be undoubtedly extinct now in Peru. l PERU, the conservation of terrestrial mammals is the responsibility rof the Servicio Forestal y de Caza (Forestry and Hunting), while marine mammals, including freshwater forms such as the two species of dolphins found in the Amazon tributaries, are in the care of the Servicio Pesqueria (Fisheries). In 1963, when the Servicio Forestal y de Caza came into being, there were no national parks or reserves to form sanctuaries for wild life and no regulations controlling hunting, other than a prohibition of the killing of vicunas, fur seals and sealions, and a regulation prohibiting the killing of certain Amazon basin forms, including both species of peccary and brocket deer, during the period December 1st to March 31st, which was introduced to prevent the mass slaughter of animals that became isolated on islands of high ground during the annual floods, but proved to be virtually unenforceable.
    [Show full text]
  • Chewing and Sucking Lice As Parasites of Iviammals and Birds
    c.^,y ^r-^ 1 Ag84te DA Chewing and Sucking United States Lice as Parasites of Department of Agriculture IVIammals and Birds Agricultural Research Service Technical Bulletin Number 1849 July 1997 0 jc: United States Department of Agriculture Chewing and Sucking Agricultural Research Service Lice as Parasites of Technical Bulletin Number IVIammals and Birds 1849 July 1997 Manning A. Price and O.H. Graham U3DA, National Agrioultur«! Libmry NAL BIdg 10301 Baltimore Blvd Beltsvjlle, MD 20705-2351 Price (deceased) was professor of entomoiogy, Department of Ento- moiogy, Texas A&iVI University, College Station. Graham (retired) was research leader, USDA-ARS Screwworm Research Laboratory, Tuxtia Gutiérrez, Chiapas, Mexico. ABSTRACT Price, Manning A., and O.H. Graham. 1996. Chewing This publication reports research involving pesticides. It and Sucking Lice as Parasites of Mammals and Birds. does not recommend their use or imply that the uses U.S. Department of Agriculture, Technical Bulletin No. discussed here have been registered. All uses of pesti- 1849, 309 pp. cides must be registered by appropriate state or Federal agencies or both before they can be recommended. In all stages of their development, about 2,500 species of chewing lice are parasites of mammals or birds. While supplies last, single copies of this publication More than 500 species of blood-sucking lice attack may be obtained at no cost from Dr. O.H. Graham, only mammals. This publication emphasizes the most USDA-ARS, P.O. Box 969, Mission, TX 78572. Copies frequently seen genera and species of these lice, of this publication may be purchased from the National including geographic distribution, life history, habitats, Technical Information Service, 5285 Port Royal Road, ecology, host-parasite relationships, and economic Springfield, VA 22161.
    [Show full text]
  • Canada, Decembre 2008 Library and Bibliotheque Et 1*1 Archives Canada Archives Canada Published Heritage Direction Du Branch Patrimoine De I'edition
    ORGANISATION SOCIALE, DYNAMIQUE DE POPULATION, ET CONSERVATION DU CERF HUEMUL (HIPPOCAMELUS BISULCUS) DANS LA PATAGONIE DU CHILI par Paulo Corti these presente au Departement de biologie en vue de l'obtention du grade de docteur es sciences (Ph.D.) FACULTE DES SCIENCES UNIVERSITE DE SHERBROOKE Sherbrooke, Quebec, Canada, decembre 2008 Library and Bibliotheque et 1*1 Archives Canada Archives Canada Published Heritage Direction du Branch Patrimoine de I'edition 395 Wellington Street 395, rue Wellington Ottawa ON K1A0N4 Ottawa ON K1A0N4 Canada Canada Your file Votre reference ISBN: 978-0-494-48538-5 Our file Notre reference ISBN: 978-0-494-48538-5 NOTICE: AVIS: The author has granted a non­ L'auteur a accorde une licence non exclusive exclusive license allowing Library permettant a la Bibliotheque et Archives and Archives Canada to reproduce, Canada de reproduire, publier, archiver, publish, archive, preserve, conserve, sauvegarder, conserver, transmettre au public communicate to the public by par telecommunication ou par Plntemet, prefer, telecommunication or on the Internet, distribuer et vendre des theses partout dans loan, distribute and sell theses le monde, a des fins commerciales ou autres, worldwide, for commercial or non­ sur support microforme, papier, electronique commercial purposes, in microform, et/ou autres formats. paper, electronic and/or any other formats. The author retains copyright L'auteur conserve la propriete du droit d'auteur ownership and moral rights in et des droits moraux qui protege cette these. this thesis. Neither the thesis Ni la these ni des extraits substantiels de nor substantial extracts from it celle-ci ne doivent etre imprimes ou autrement may be printed or otherwise reproduits sans son autorisation.
    [Show full text]