DOCSLIB.ORG

University of Groningen Engineering of Sugar Metabolism in Lactococcus

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
University of Groningen Engineering of Sugar Metabolism in Lactococcus University of Groningen Engineering of sugar metabolism in Lactococcus lactis Pool, Weia Arianne IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below. Document Version Publisher's PDF, also known as Version of record Publication date: 2008 Link to publication in University of Groningen/UMCG research database Citation for published version (APA): Pool, W. A. (2008). Engineering of sugar metabolism in Lactococcus lactis. s.n. Copyright Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons). The publication may also be distributed here under the terms of Article 25fa of the Dutch Copyright Act, indicated by the “Taverne” license. More information can be found on the University of Groningen website: https://www.rug.nl/library/open-access/self-archiving-pure/taverne- amendment. Take-down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum. Download date: 02-10-2021 CHAPTER 5 THE α-PHOSPHOGLUCOMUTASE OF LACTOCOCCUS LACTIS IS UNRELATED TO THE α-D-PHOSPHOHEXOMUTASE SUPERFAMILY AND ENCODED BY THE ESSENTIAL GENE pgmH Ana R. Neves*, Wietske A. Pool*, Rute Castro, Ana Mingote, Filipe Santos, Jan Kok, Oscar P. Kuipers and Helena Santos Based on J. Biol. Chem. 2006, 281:36864-36873. * Both authors contributed equally to the results described in this chapter. Chapter 5 104 A novel α-phosphoglucomutase SUMMARY α-Phosphoglucomutase (α-PGM) plays an important role in carbohydrate metabolism, by catalyzing the reversible conversion of α-glucose-1-phosphate to glucose-6-phosphate. Isolation of α-PGM activity from cell extracts of Lactococcus lactis strain MG1363 led to the conclusion that this activity is encoded by yfgH, herein renamed to pgmH. Its gene product has no sequence homology to proteins in the α-D-phosphohexomutase superfamily and instead is related to the eukaryotic phosphomannomutases within the haloacid dehalogenase superfamily. In contrast to known bacterial α-PGMs, this 28 kDa enzyme is highly specific for α-glucose-1- phosphate and glucose-6-phosphate and showed no activity with mannose- phosphate. To elucidate the function of pgmH, the metabolism of glucose and galactose was characterized in mutants overproducing or with deficiency of α-PGM activity. Overproduction of α-PGM led to increased glycolytic flux and growth rate on galactose. Additionally, the intracellular concentration of UDP-glucose was decreased. Despite several attempts, we failed to obtain a deletion mutant of pgmH. The essentiality of this gene was proven by using a conditional knock-out strain, in which a native copy of the gene was provided in trans under the control of the nisin promoter. Growth of this strain was severely impaired when α-PGM activity was below the control level. Moreover, the growth-rate and biomass production were directly related to α-PGM activity. We show that the novel L. lactis α-PGM is the only enzyme mediating the interconversion of α-glucose-1-phosphate to glucose-6- phosphate in L. lactis and is essential for growth. 105 Chapter 5 INTRODUCTION Phosphoglucomutase (E.C. 5.4.2.2) is widespread in living organisms from bacteria to humans (217). It plays various roles in carbohydrate metabolism, by catalyzing the reversible conversion of α-glucose-1-phosphate (α-G1P) to glucose-6-phosphate (G6P). In higher organisms, its major function is mediating the mobilization of sugar moieties from energy reserves (e.g. glycogen, trehalose, starch). Also, α-PGM activity is essential for the synthesis of UDP-glucose, a sugar donor for the production of glucose-containing polysaccharides. Therefore, PGM is a crucial link between catabolic and anabolic processes. The lactic acid bacterium Lactococcus lactis is used worldwide in the industrial manufacture of fermented milk products. The organism converts sugars primarily into lactic acid, thus providing an efficient means of food conservation. In L. lactis, α- phosphoglucomutase is assumed to be essential for the utilization of galactose via the Leloir pathway (105) and also for the synthesis of precursors of cell wall polysaccharides and exopolysaccharides (40, 74). In a number of Gram positive bacteria, namely Bacillus subtilis and Streptococcus pneumoniae, pgm mutants showed altered cell wall morphology and altered polysaccharide production as well as growth defects on glucose (58, 91, 100). Despite the key metabolic role of α- PGM and the wealth of knowledge on sugar metabolism of L. lactis (122), genes coding for this activity have not been identified in this organism. More than a decade ago the presence of two distinct phosphoglucomutase activities in L. lactis subsp. lactis with specificity for α- and β-anomers of phosphoglucose has been reported (150). A 28 kDa protein, designated β-PGM, was shown to catalyze the reversible conversion of β-G1P to G6P. The L. lactis β-PGM belongs to the haloacid dehalogenase (HAD) enzyme superfamily; its X-ray structure has been determined and the catalytic mechanism investigated (87, 88, 224). β-PGM is a catabolic enzyme in the pathway for maltose and trehalose degradation (99), which is encoded by a gene (pgmB) in the trehalose operon (4, 15). A larger protein (around 65 kDa) showing affinity for the α-anomer of glucose-1-phosphate was partially purified (150). The α-specificity and the protein size, matching the analogous parameters of bacterial α-PGMs, led the authors to conclude that it was the lactococcal α-PGM. It is pertinent noting that all α-PGMs described thus far belong to the α-D-phosphohexomutase superfamily of proteins (171, 217). Intriguingly, a BLASTp search of the available L. lactis genome sequences (15, 215) using members of the α-D-phosphohexomutase superfamily as query, or a domain 106 A novel α-phosphoglucomutase search using the highly conserved regions of proteins in this family, retrieved only FemD, a protein tentatively annotated as a phosphoglucosamine mutase. In this work we report the identification, purification, expression and characterization of L. lactis α-PGM and its encoding gene pgmH (previously yfgH), and show that this activity is essential for growth. To our knowledge the lactococcal α-PGM is the first member of the HAD superfamily of proteins with strict specificity for α-G1P. 107 Chapter 5 EXPERIMENTAL PROCEDURES Microbial strains and growth conditions Strains and plasmids used throughout this study are listed in Table 1. For molecular biology procedures, L. lactis strains were cultivated as batch cultures (flasks) without aeration in M17 medium (Difco, Sparks, MD) containing 0.5% glucose (w/v) at 30°C or 38ºC. For physiological studies, L. lactis NZ9000 (84) derivatives, NZ9000[pNZ8048] (control strain), NZ9000[pNZ8048-pgmH] (hereafter designated NZ9000[pgmH+]) and NZ9000ΔpgmH[pgmH+], were grown in Chemically Defined Medium (CDM) (144) at 30ºC in 2 or 5-liter vessels (B. Braun Biostat®, MD), under anaerobic conditions and pH 6.5 as previously described (123). Glucose or galactose was added to a final concentration of 1% (w/v). Plasmid selection was achieved by addition of chloramphenicol (5 mg/l) or erythromycin (5 mg/l) to the growth medium. For overproduction of α-PGM, nisin (1 μg/l) was added to the medium when an optical density at 600 nm (OD600) of 0.5 was reached. For studies in which the nisin-inducible conditional mutant NZ9000ΔpgmH[pgmH+] was used, cells were grown overnight in M17 containing different levels of nisin and washed once with fresh M17 lacking nisin. The washed cultures were subsequently subcultured for 15 h (initial OD600 around 0.025 or 0.05 for growth on glucose or galactose, respectively) in fresh medium, either with or without nisin (0.01 to 1 µg/l). Growth was monitored by measuring the optical density at 600 nm. General DNA techniques General molecular techniques were performed as described by Sambrook et al. (162). Chromosomal and plasmid DNA were isolated from L. lactis according to Johansen and Kibenich (68) and Birnboim (12), respectively. L. lactis was transformed with plasmid DNA by electroporation as described by Holo and Nes (60) using a Bio-Rad Gene Pulser (Bio-Rad Laboratories, Richmond, CA). All DNA modification enzymes were purchased from Roche Molecular Biochemicals (Mannheim, Germany), and used according to the manufacturer’s directions. Polymerase chain reactions (PCRs) were performed using Expand DNA polymerase (Roche Molecular Biochemicals) and purified with the Roche PCR purification kit (Roche Molecular Biochemicals). Primers (listed in Table 1) were purchased from Biolegio BV (Malden, the Netherlands). 108 A novel α-phosphoglucomutase TABLE 1: Strains, plasmids and primers used in this study Strains Description Reference MG1363 Plasmid free and prophage cured derivative of NCDO712 (52) NZ9000 Derivative of MG1363 carrying pepN::nisRK (84) LL302 RepA+ MG1363, carrying single copy of pWV01 repA in pepX (95) NZ9000::pORI280-ΔpgmH Derivative of NZ9000 containing pORI280ΔpgmH integrated in the chromosome in pgmH This work NZ9000ΔpgmH[pgmH+] Derivative of NZ9000 containing a 711-bp deletion in pgmH and carrying pNZ8048-pgmH This work Plasmids Description Reference r pNZ8048 Cm ; inducible expression vector carrying PnisA (84) pNZ8048-pgmH Cmr, derivative of pNZ8048 carrying a copy of pgmH This work pORI280 Emr, LacZ+, ori+ of pWV01, replicates only in strains providing repA in trans (96) pORI280-ΔpgmH Emr; derivative of pORI280 specific for integration in the L. lactis pgmH gene This work pORI13 Emr; integration vector; ori+ repA- derivative of pWV01; promoterless lacZ (163) pORI13-pgmH’ Emr; derivative of pORI13 specific for integration in the L.
Load more

Recommended publications
  • Annual Report DDUV 2009
    Research at the de Duve Institute and Brussels Branch of the Ludwig Institute for Cancer Research August 2009 de Duve Institute Introduction 5 Miikka Vikkula 12 Frédéric Lemaigre 20 Annabelle Decottignies and Charles de Smet 25 Emile Vanschaftingen 31 Françoise Bontemps 37 Jean-François Collet 42 Guido Bommer 47 Mark Rider 50 Fred Opperdoes 56 Pierre Courtoy 62 Etienne Marbaix 69 Jean-Baptiste Demoulin 75 Jean-Paul Coutelier 80 Thomas Michiels 84 Pierre Coulie 89 LICR Introduction 95 Benoît Van den Eynde 98 Pierre van der Bruggen 106 Nicolas Van Baren 114 Jean-Christophe Renauld 119 Stefan Constantinescu 125 The de Duve Institute 5 THE DE DUVE INSTITUTE: AN INTERNATIONAL BIOMEDICAL RESEARCH INSTITUTE In 1974, when Christian de Duve founded the Institute of Cellular Pathology (ICP), now rena- med the de Duve Institute, he was acutely aware of the constrast between the enormous progress in biological sciences that had occurred in the 20 preceding years and the modesty of the medical advances that had followed. He therefore crea- ted a research institution based on the principle that basic research in biology would be pursued by the investigators with complete freedom, but that special attention would be paid to the exploi- tation of basic advances for medical progress. It was therefore highly appropriate for the Institute to be located on the campus of the Faculty of Emile Van Schaftingen Medicine of the University of Louvain (UCL). This campus is located in Brussels. The Univer- sity hospital (Clinique St Luc) is located within walking distance of the Institute. The main commitment of the members of the de Duve Institute is research.
    [Show full text]
  • Articles Catalytic Cycling in Β-Phosphoglucomutase: a Kinetic
    9404 Biochemistry 2005, 44, 9404-9416 Articles Catalytic Cycling in â-Phosphoglucomutase: A Kinetic and Structural Analysis†,‡ Guofeng Zhang, Jianying Dai, Liangbing Wang, and Debra Dunaway-Mariano* Department of Chemistry, UniVersity of New Mexico, Albuquerque, New Mexico 87131-0001 Lee W. Tremblay and Karen N. Allen* Department of Physiology and Biophysics, Boston UniVersity School of Medicine, Boston, Massachusetts 02118-2394 ReceiVed March 26, 2005; ReVised Manuscript ReceiVed May 18, 2005 ABSTRACT: Lactococcus lactis â-phosphoglucomutase (â-PGM) catalyzes the interconversion of â-D-glucose 1-phosphate (â-G1P) and â-D-glucose 6-phosphate (G6P), forming â-D-glucose 1,6-(bis)phosphate (â- G16P) as an intermediate. â-PGM conserves the core domain catalytic scaffold of the phosphatase branch of the HAD (haloalkanoic acid dehalogenase) enzyme superfamily, yet it has evolved to function as a mutase rather than as a phosphatase. This work was carried out to identify the structural basis underlying this diversification of function. In this paper, we examine â-PGM activation by the Mg2+ cofactor, â-PGM activation by Asp8 phosphorylation, and the role of cap domain closure in substrate discrimination. First, the 1.90 Å resolution X-ray crystal structure of the Mg2+-â-PGM complex is examined in the context of + + previously reported structures of the Mg2 -R-D-galactose-1-phosphate-â-PGM, Mg2 -phospho-â-PGM, and Mg2+-â-glucose-6-phosphate-1-phosphorane-â-PGM complexes to identify conformational changes that occur during catalytic turnover. The essential role of Asp8 in nucleophilic catalysis was confirmed by demonstrating that the D8A and D8E mutants are devoid of catalytic activity.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Transcriptomic and Proteomic Profiling Provides Insight Into
    BASIC RESEARCH www.jasn.org Transcriptomic and Proteomic Profiling Provides Insight into Mesangial Cell Function in IgA Nephropathy † † ‡ Peidi Liu,* Emelie Lassén,* Viji Nair, Celine C. Berthier, Miyuki Suguro, Carina Sihlbom,§ † | † Matthias Kretzler, Christer Betsholtz, ¶ Börje Haraldsson,* Wenjun Ju, Kerstin Ebefors,* and Jenny Nyström* *Department of Physiology, Institute of Neuroscience and Physiology, §Proteomics Core Facility at University of Gothenburg, University of Gothenburg, Gothenburg, Sweden; †Division of Nephrology, Department of Internal Medicine and Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, Michigan; ‡Division of Molecular Medicine, Aichi Cancer Center Research Institute, Nagoya, Japan; |Department of Immunology, Genetics and Pathology, Uppsala University, Uppsala, Sweden; and ¶Integrated Cardio Metabolic Centre, Karolinska Institutet Novum, Huddinge, Sweden ABSTRACT IgA nephropathy (IgAN), the most common GN worldwide, is characterized by circulating galactose-deficient IgA (gd-IgA) that forms immune complexes. The immune complexes are deposited in the glomerular mesangium, leading to inflammation and loss of renal function, but the complete pathophysiology of the disease is not understood. Using an integrated global transcriptomic and proteomic profiling approach, we investigated the role of the mesangium in the onset and progression of IgAN. Global gene expression was investigated by microarray analysis of the glomerular compartment of renal biopsy specimens from patients with IgAN (n=19) and controls (n=22). Using curated glomerular cell type–specific genes from the published literature, we found differential expression of a much higher percentage of mesangial cell–positive standard genes than podocyte-positive standard genes in IgAN. Principal coordinate analysis of expression data revealed clear separation of patient and control samples on the basis of mesangial but not podocyte cell–positive standard genes.
    [Show full text]
  • The Analysis of Variants in the General Population Reveals That PMM2 Is Extremely Tolerant to Missense Mutations and That Diagno
    International Journal of Molecular Sciences Article The Analysis of Variants in the General Population Reveals That PMM2 Is Extremely Tolerant to Missense Mutations and That Diagnosis of PMM2-CDG Can Benefit from the Identification of Modifiers Valentina Citro 1, Chiara Cimmaruta 1, Maria Monticelli 1, Guglielmo Riccio 1, Bruno Hay Mele 1,2, Maria Vittoria Cubellis 1,* ID and Giuseppina Andreotti 3 ID 1 Dipartimento di Biologia, Università Federico II, 80126 Napoli, Italy; [email protected] (V.C.); [email protected] (C.C.); [email protected] (M.M.); [email protected] (G.R.); [email protected] (B.H.M.) 2 Dipartimento di Scienze Agrarie ed Agroalimentari, Università Federico II, 80055 Napoli, Italy 3 Istituto di Chimica Biomolecolare—CNR, 80078 Pozzuoli, Italy; [email protected] * Correspondence: [email protected]; Tel.: +39-081-679118; Fax: +39-081-679233 Received: 30 May 2018; Accepted: 26 July 2018; Published: 30 July 2018 Abstract: Type I disorders of glycosylation (CDG), the most frequent of which is phosphomannomutase 2 (PMM2-CDG), are a group of diseases causing the incomplete N-glycosylation of proteins. PMM2-CDG is an autosomal recessive disease with a large phenotypic spectrum, and is associated with mutations in the PMM2 gene. The biochemical analysis of mutants does not allow a precise genotype–phenotype correlation for PMM2-CDG. PMM2 is very tolerant to missense and loss of function mutations, suggesting that a partial deficiency of activity might be beneficial under certain circumstances. The patient phenotype might be influenced by variants in other genes associated with the type I disorders of glycosylation in the general population.
    [Show full text]
  • Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays
    Supplemental Table S1. Primers for SYBRGreen quantitative RT-PCR assays. Gene Accession Primer Sequence Length Start Stop Tm GC% GAPDH NM_002046.3 GAPDH F TCCTGTTCGACAGTCAGCCGCA 22 39 60 60.43 59.09 GAPDH R GCGCCCAATACGACCAAATCCGT 23 150 128 60.12 56.52 Exon junction 131/132 (reverse primer) on template NM_002046.3 DNAH6 NM_001370.1 DNAH6 F GGGCCTGGTGCTGCTTTGATGA 22 4690 4711 59.66 59.09% DNAH6 R TAGAGAGCTTTGCCGCTTTGGCG 23 4797 4775 60.06 56.52% Exon junction 4790/4791 (reverse primer) on template NM_001370.1 DNAH7 NM_018897.2 DNAH7 F TGCTGCATGAGCGGGCGATTA 21 9973 9993 59.25 57.14% DNAH7 R AGGAAGCCATGTACAAAGGTTGGCA 25 10073 10049 58.85 48.00% Exon junction 9989/9990 (forward primer) on template NM_018897.2 DNAI1 NM_012144.2 DNAI1 F AACAGATGTGCCTGCAGCTGGG 22 673 694 59.67 59.09 DNAI1 R TCTCGATCCCGGACAGGGTTGT 22 822 801 59.07 59.09 Exon junction 814/815 (reverse primer) on template NM_012144.2 RPGRIP1L NM_015272.2 RPGRIP1L F TCCCAAGGTTTCACAAGAAGGCAGT 25 3118 3142 58.5 48.00% RPGRIP1L R TGCCAAGCTTTGTTCTGCAAGCTGA 25 3238 3214 60.06 48.00% Exon junction 3124/3125 (forward primer) on template NM_015272.2 Supplemental Table S2. Transcripts that differentiate IPF/UIP from controls at 5%FDR Fold- p-value Change Transcript Gene p-value p-value p-value (IPF/UIP (IPF/UIP Cluster ID RefSeq Symbol gene_assignment (Age) (Gender) (Smoking) vs. C) vs. C) NM_001178008 // CBS // cystathionine-beta- 8070632 NM_001178008 CBS synthase // 21q22.3 // 875 /// NM_0000 0.456642 0.314761 0.418564 4.83E-36 -2.23 NM_003013 // SFRP2 // secreted frizzled- 8103254 NM_003013
    [Show full text]
  • Successes and Challenges in Functional Assignment in a Superfamily of Phosphatases
    99 Experimental Standard Conditions of Enzyme Characterization Beilstein-Institut September 12th –16th, 2011, Ru¨desheim/Rhein, Germany Successes and Challenges in Functional Assignment in a Superfamily of Phosphatases Karen N. Allen1,* and Debra Dunaway-Mariano2,# 1Department of Chemistry, Boston University, 590 Commonwealth Avenue, Boston, MA 02215 – 2521, U.S.A. 2Department of Chemistry and Chemical Biology, University of New Mexico, Albuquerque, NM, 87131, U.S.A. E-Mail: *[email protected] and #[email protected] Received: 17th September 2012/Published: 15th February 2013 Abstract The explosion of protein sequence information from genome sequen- cing efforts requires that current experimental strategies for function assignment must evolve into computationally-based function predic- tion. This necessitates the development of new strategies based, in part, on the identification of sequence markers, including residues that sup- port structure and specificity as well as a more informed definition of orthologues. We have undertaken the function assignment of unknown members of the haloalkanoate dehalogenase superfamily using an in- tegrated bioinformatics/structure/mechanism approach. Notably, a number of members show ‘‘substrate blurring’’, with activity toward a number of substrates and significant substrate overlap between para- logues. Other family members have been honed to a specific substrate with high catalytic efficiency and proficiency. Our findings highlight the use of the cap domain structure and enzyme conformational dy- namics in delineating specificity. http://www.beilstein-institut.de/escec2011/Proceedings/Allen/Allen.pdf 100 Allen, K.N. and Dunaway-Mariano, D. The Haloalkanoate Dehalogenase Superfamily (HADSF) The ‘‘central dogma’’ of protein structure/function studies is that protein sequence dictates protein structure which, in turn defines protein function.
    [Show full text]
  • The Effects of Genetic Variants on Protein Structure and Their Associations with Preeclampsia
    The Effects of Genetic Variants on Protein Structure and their Associations with Preeclampsia Elizabeth Geena Woo Undergraduate Honors Thesis April 20, 2020 Thesis Advisor: Alper Uzun, PhD Second Reader: James Padbury, MD A thesis submitted in partial fulfillment for the degree of Bachelor of Arts With Honors in Computational Biology 1 Table of Contents Introduction......................................................................................................................................3 Methods and Materials.....................................................................................................................4 Results and Discussion....................................................................................................................8 Conclusion.....................................................................................................................................28 References......................................................................................................................................32 2 Introduction Preeclampsia is a complex pregnancy-specific disorder characterized by the onset of maternal hypertension and proteinuria.1,2 This multifactorial disorder complicates 2-8% of US deliveries and is a major cause of maternal and fetal morbidity and mortality.3 Preeclamptic pregnancies are associated with long-term outcomes for both the mother and offspring. Stroke, cardiovascular disease, diabetes, and premature mortality are linked to preeclampsia in affected mothers
    [Show full text]
  • Induction of Therapeutic Tissue Tolerance Foxp3 Expression Is
    Downloaded from http://www.jimmunol.org/ by guest on October 2, 2021 is online at: average * The Journal of Immunology , 13 of which you can access for free at: 2012; 189:3947-3956; Prepublished online 17 from submission to initial decision 4 weeks from acceptance to publication September 2012; doi: 10.4049/jimmunol.1200449 http://www.jimmunol.org/content/189/8/3947 Foxp3 Expression Is Required for the Induction of Therapeutic Tissue Tolerance Frederico S. Regateiro, Ye Chen, Adrian R. Kendal, Robert Hilbrands, Elizabeth Adams, Stephen P. Cobbold, Jianbo Ma, Kristian G. Andersen, Alexander G. Betz, Mindy Zhang, Shruti Madhiwalla, Bruce Roberts, Herman Waldmann, Kathleen F. Nolan and Duncan Howie J Immunol cites 35 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription http://www.jimmunol.org/content/suppl/2012/09/17/jimmunol.120044 9.DC1 This article http://www.jimmunol.org/content/189/8/3947.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2012 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of October 2, 2021.
    [Show full text]
  • University of Oklahoma Graduate College
    UNIVERSITY OF OKLAHOMA GRADUATE COLLEGE SEQUENCE AND ANALYSIS OF THE PHYMATOTRICHOPSIS OMNIVORA GENOME AND EXPRESSED SEQUENCE TAGS A DISSERTATION SUBMITTED TO THE GRADUATE FACULTY in partial fulfillment of the requirements for the Degree of DOCTOR OF PHILOSOPHY BY SIMONE MACMIL Norman, Oklahoma 2009 SEQUENCE AND ANALYSIS OF PHYMATOTRICHOPSIS OMNIVORA GENOME AND EXPRESSED SEQUENCE TAGS A DISSERTATION APPROVED FOR THE DEPARTMENT OF CHEMISTRY AND BIOCHEMISTRY By Dr. Bruce A. Roe, Chair Dr. Paul F. Cook Dr. Ann H. West Dr. Kathleen E. Duncan Dr. Charles V. Rice ©Copyright by SIMONE LYNETTE MACMIL 2009 All Rights Reserved. Acknowledgements I wish to express my sincere gratitude to my major advisor Dr. Bruce Roe for accepting me to his lab at the brink of his retirement, giving me the opportunity to work on this challenging yet rewarding project and for cheering me on through the many roadblocks and bumps that I encountered during the course of this study. His scientific accomplishments and discussions have always inspired me and have spurred me to reach higher in my goals and delve deeper in my understanding and it would be impossible to complete this project sans his patience, guidance and encouragement. I am extremely grateful to my advisory committee, Dr. Paul Cook, Dr. Kathleen Duncan, and Dr. Charles Rice for their advice, encouragement and participation in my research and dissertation. I would specially like to thank Dr. Ann West for chairing my committee during my candidacy exam and for her willingness to be present on my doctoral defense committee as well. My special thanks also goes to Dr.
    [Show full text]
  • Supplemental Figures 04 12 2017
    Jung et al. 1 SUPPLEMENTAL FIGURES 2 3 Supplemental Figure 1. Clinical relevance of natural product methyltransferases (NPMTs) in brain disorders. (A) 4 Table summarizing characteristics of 11 NPMTs using data derived from the TCGA GBM and Rembrandt datasets for 5 relative expression levels and survival. In addition, published studies of the 11 NPMTs are summarized. (B) The 1 Jung et al. 6 expression levels of 10 NPMTs in glioblastoma versus non‐tumor brain are displayed in a heatmap, ranked by 7 significance and expression levels. *, p<0.05; **, p<0.01; ***, p<0.001. 8 2 Jung et al. 9 10 Supplemental Figure 2. Anatomical distribution of methyltransferase and metabolic signatures within 11 glioblastomas. The Ivy GAP dataset was downloaded and interrogated by histological structure for NNMT, NAMPT, 12 DNMT mRNA expression and selected gene expression signatures. The results are displayed on a heatmap. The 13 sample size of each histological region as indicated on the figure. 14 3 Jung et al. 15 16 Supplemental Figure 3. Altered expression of nicotinamide and nicotinate metabolism‐related enzymes in 17 glioblastoma. (A) Heatmap (fold change of expression) of whole 25 enzymes in the KEGG nicotinate and 18 nicotinamide metabolism gene set were analyzed in indicated glioblastoma expression datasets with Oncomine. 4 Jung et al. 19 Color bar intensity indicates percentile of fold change in glioblastoma relative to normal brain. (B) Nicotinamide and 20 nicotinate and methionine salvage pathways are displayed with the relative expression levels in glioblastoma 21 specimens in the TCGA GBM dataset indicated. 22 5 Jung et al. 23 24 Supplementary Figure 4.
    [Show full text]
  • Supplemental Tables.Pdf
    Table S1. Genes associated with H4K20me1, me2 and me3 H4K20 mitochondrial TOM complex subunit Systematic name Description me1 SPAC17H9.16 Tom22 (predicted) 1.54 SPBC1348.10c phospholipase (predicted) 3.81 SPAC17A2.07c sequence orphan 1.54 SPCC4B3.12 histone lysine methyltransferase Set9 2.69 RNase P and RNase MRP subunit p30 retrotransposable element/transposon Tf2- SPAC3A12.04c (predicted) 1.53 SPBC9B6.02c type 2.55 SPAC17G8.05 mediator complex subunit Med20 1.49 TIM22 inner membrane protein import mitochondrial translation elongation factor SPAC13G6.04 complex subunit Tim8 (predicted) 2.51 SPBC9B6.04c EF-Tu Tuf1 1.47 SPBC29A10.13 F0-ATPase subunit D (predicted) 2.16 superoxide dismutase%2C mitochondrial SPBC3B9.10 SNARE Vti1 (predicted) 1.99 SPBC16A3.14 ribosomal protein subunit (predicted) 1.45 mitotic spindle organizing protein Mzt1 guanyl-nucleotide exchange factor SPAC9G1.15c (predicted) 1.98 SPBC4C3.04c (predicted) 1.43 SPAC11E3.04c ubiquitin conjugating enzyme Ubc13 1.96 SPAC3C7.14c ubiquitinated histone-like protein Uhp1 1.43 SPAC26A3.11 amidohydrolase 1.94 SPAC20G8.07c C-8 sterol isomerase Erg2 1.41 SPBC3B9.22c DASH complex subunit Dad4 1.89 isopentenyl-diphosphate delta-isomerase oligosaccharyltransferase complex zeta SPBC106.15 Idi1 1.40 SPCC18.19c subunit Ost5 (predicted) 1.89 19S proteasome regulatory subunit Rpn2 SPAC22F3.15 GatB/YqeY domain protein 1.78 SPBC17D11.07c (predicted) 1.39 RNA polymerase I transcription factor glucan endo-1%2C3-alpha-glucosidase SPBC725.17c subunit Rrn11 (predicted) 1.77 SPBC646.06c Agn2 1.37
    [Show full text]