DOCSLIB.ORG

Lack of Homozygotes for the Most Frequent Disease Allele In

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Lack of Homozygotes for the Most Frequent Disease Allele In View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Am. J. Hum. Genet. 62:542–550, 1998 Lack of Homozygotes for the Most Frequent Disease Allele in Carbohydrate-Deficient Glycoprotein Syndrome Type 1A Gert Matthijs,1 Els Schollen,1 Emile Van Schaftingen,3 Jean-Jacques Cassiman,1 and Jaak Jaeken2 1Center for Human Genetics, University of Leuven, and 2Center for Metabolic Diseases, University Hospital Leuven, Leuven; and 3Laboratory of Physiological Chemistry, International Institute of Cellular and Molecular Pathology and University of Louvain, Brussels Summary Introduction Carbohydrate-deficient–glycoprotein syndrome type 1 Carbohydrate-deficient glycoprotein (CDG) syndromes (CDG1; also known as “Jaeken syndrome”) is an au- are a series of genetic disorders characterized by defec- tosomal recessive disorder characterized by defective gly- tive N-glycosylation of serum and cellular proteins (Jae- cosylation. Most patients show a deficiency of phos- ken et al. 1980, 1997b; Jaeken and Carchon 1993; Jae- phomannomutase (PMM), the enzyme that converts ken and Casaer 1997). At present, four types of CDG mannose 6-phosphate to mannose 1-phosphate in the have been described on the basis of serum transferrin synthesis of GDP-mannose. The disease is linked to chro- isoelectrofocusing (IEF). CDG type 1 (CDG1 [MIM mosome 16p13, and mutations have recently been iden- 212065]) is the most frequent type. It is a severe disorder tified in the PMM2 gene in CDG1 patients with a PMM that presents neonatally. There is a life-threatening liver deficiency (CDG1A). The availability of the genomic se- insufficiency (with an overall 20% mortality during the quences of PMM2 allowed us to screen for mutations neonatal period), combined with a severe cerebellar dys- in 56 CDG1 patients from different geographic origins. function and peripheral neuropathy, leading to severe By SSCP analysis and by sequencing, we identified 23 psychomotor retardation. These children also have skel- different missense mutations and 1 single-base-pair de- etal deformities and a characteristic deposition of adi- letion. In total, mutations were found on 99% of the pose tissue (Jaeken and Carchon 1993; Jaeken et al. disease chromosomes in CDG1A patients. The R141H 1997b). CDG type 2 (CDG2), type 3 (CDG3), and type substitution is present on 43 of the 112 disease alleles. 4 (CDG4) represent only two cases each (Stibler et al. However, this mutation was never observed in the ho- 1993, 1995; Jaeken et al. 1994). CDG2 is caused by a mozygous state, suggesting that homozygosity for these deficiency of UDP-GlcNAc:a-6-D-mannoside b-1,2-N- alterations is incompatible with life. On the other hand, acetylglucosaminyltransferase 2 (GnT 2), located in the patients were found homozygous for the D65Y and Golgi apparatus, and mutations in the GnT 2 gene F119L mutations, which must therefore be mild muta- (MGAT2) on 14q21 have been identified (Jaeken et al. tions. One particular genotype, R141H/D188G, which 1994; Tan et al. 1996). The causes of CDG3 and CDG4 is prevalent in Belgium and the Netherlands, is associ- remain unknown. ated with a severe phenotype and a high mortality. Apart CDG1 is inherited in an autosomal recessive manner, from this, there is only a limited relation between the and its locus has been mapped to chromosome 16p13 genotype and the clinical phenotype. (Martinsson et al. 1994). Linkage to the region between D16S406 and D16S500 has been confirmed in 10 of 11 informative families (Matthijs et al. 1996). In one family with two affected siblings, the disease was, however, not linked to chromosome 16p, indicating genetic hetero- geneity for CDG1 (Matthijs et al. 1996). Biochemical evidence has long suggested a basic defect in the synthesis of the dolichol-P-oligosaccharides (syn- thesis of the asparagine-N-linked oligosaccharides) in Received October 16, 1997; accepted for publication January 12, 1998; electronically published March 6, 1998. the endoplasmic reticulum (ER) (Jaeken et al. 1984; Address for correspondence and reprints: Dr. Gert Matthijs, Center Wada et al. 1992). In 1995, Van Schaftingen and Jaeken for Human Genetics, University of Leuven, Campus Gasthuisberg (1995) identified a deficiency of phosphomannomutase O&N6, Herestraat 49, B-3000 Leuven, Belgium. E-mail: (PMM) activity in patients with CDG1. This observation [email protected] ᭧ 1998 by The American Society of Human Genetics. All rights reserved. has been confirmed in more than 50 CDG1 patients from 0002-9297/98/6203-0007$02.00 different geographic origins (Jaeken et al. 1997a). We 542 Matthijs et al.: Mutations in the PMM2 Gene in CDG1A 543 have recently cloned the human PMM gene PMM2 and drome, or status epilepticus. Salient features in some have shown that it is the CDG1 gene (Matthijs et al. patients are listed in table 1. 1997a). Another PMM gene, PMM1, could be assigned The blood samples and/or fibroblast or lymphoblast to chromosome 22q13 (Matthijs et al. 1997b). Both cultures from patients were provided to us after a request PMM1 and PMM2 have been expressed in Escherichia for enzymatic assays and molecular diagnosis, and the coli and have been found to be active proteins (Pirard referring physicians and the families have been informed et al. 1997; E. Van Schaftingen and M. Pirard, unpub- about the results. Amniocytes were analyzed in the con- lished data). We have previously reported 11 missense text of prenatal diagnosis. mutations in 16 CDG1 patients with a documented PMM deficiency (CDG1A) (Matthijs et al. 1997a). These SSCP Analysis and Sequencing mutations have been identified at the cDNA level, after reverse transcriptase–PCR amplification, followed by DNA was isolated either from fresh blood or from SSCP analysis and sequencing. To search for mutations fibroblast or lymphoblast cultures from patients by use in genomic DNA, the PMM2 intron/exon structure has of a high-salt-extraction procedure. On the basis of the been determined, whereby eight exons have been iden- available sequence, primers were designed for the PCR tified (Schollen et al. 1998), and primers flanking each amplification of nine DNA fragments suitable for SSCP translated exon have been designed. We here describe analysis. One primer in each pair was labeled with FITC. the results of an exhaustive mutation analysis of the The primer sequences are given in table 2. PCR reactions m PMM2 gene in patients with a documented PMM were typically done in 25 l, and the cycling conditions Њ Њ Њ Њ deficiency. were 30 s at 95 C, 30 s at 50 –60 C, and 30 s at 72 C, for 32 cycles. A 10–15-ml portion of each PCR product was mixed with an equal volume of formamide and then Patients and Methods was denatured for 5 min at 95ЊC, loaded onto a non- denaturing polyacrylamide gel (0.5 # Hydrolink MDE Patients [J. T. Baker] in 0.6 # TBE [10 # TBE ϭ 1 M Tris, Fifty-six patients from 12 countries were included in 0.82 M boric acid, and 10 mM EDTA]), and electro- Њ the study; all except 2 were of Caucasian origin. A di- phoresed for 10 h at 4 C at 400 V. The gels were directly agnosis of CDG1 was made in all these patients, on the scanned on a Fluorimager (Vistra), and the signals were basis of clinical manifestations, and was substantiated analyzed with the ImagequaNT software (Molecular by the typical IEF pattern of serum transferrins: there is Dynamics). both a strong reduction in the intensity of the normal The PCR fragments were sequenced by cycle sequenc- tetrasialotransferrin band and a concomitant increase in ing or solid-phase sequencing. Prior to cycle sequencing the disialo- and asialotransferrin concentration. PMM with the Thermosequenase kit (Amersham), the PCR deficiency was documented in most cases (see table 1 fragments were purified by use of the Qiaquick-PCR and the Results section). The clinical features of CDG1 purification kit (Qiagen), and, typically, 50–100 ng was patients have recently been reviewed by Jaeken and Ca- used with 1 pmol of fluorescently labeled primer, for saer (1997) and Jaeken et al. (1997b). In brief, the neu- 15–22 cycles. Solid-phase sequencing using a biotiny- rological picture includes abnormal eye movements, lated template and streptavidin-coated DynaBeads (Dy- combined with slow head movements in the neonatal nal) was done according to established procedures. period, and axial hypotonia with hyporeflexia. Most children present with an alternating strabismus. There Results is a severe psychomotor retardation and failure to thrive, with ataxia and, sometimes, deafness. Additional fea- Fifty-six patients and their affected siblings were in- tures, presenting after infancy, are hypogonadism, reti- cluded in this series. Included are three pairs of patients nitis pigmentosa, joint contractures, and strokelike ep- in which each pair has at least one common ancestor isodes. Most patients never attain the ability to walk (table 1). The diagnosis of CDG1 with PMM deficiency without support, but there is no regression. Other symp- was confirmed biochemically in 46 patients for whom toms include mild facial dysmorphism (with large, some- fibroblasts, lymphoblasts, or fresh leukocytes were avail- what dysplastic ears), skeletal deformities, and a typical able; in 2 of these patients, a partial deficiency of PMM subcutaneous deposition of adipose tissue (“fat pads”). was found in fibroblasts (patients 47 [SAO] and 48 There is a mild to moderate hepatomegaly, and some [GSS]), and, in 1 family (family 4, patients FG and FP, infants develop pericardial effusion and/or cardiomy- both affected), intermediate values were measured in opathy. Approximately 20% of the patients die before lymphoblasts. From the remaining 10 patients, whose the age of 5 years, as a consequence of liver failure, diagnosis had been made previously on clinical grounds, severe infection, cardiac insufficiency, nephrotic syn- no cells were available for the enzymatic assay; in 7 of 544 Am.
Load more

Recommended publications
  • Annual Report DDUV 2009
    Research at the de Duve Institute and Brussels Branch of the Ludwig Institute for Cancer Research August 2009 de Duve Institute Introduction 5 Miikka Vikkula 12 Frédéric Lemaigre 20 Annabelle Decottignies and Charles de Smet 25 Emile Vanschaftingen 31 Françoise Bontemps 37 Jean-François Collet 42 Guido Bommer 47 Mark Rider 50 Fred Opperdoes 56 Pierre Courtoy 62 Etienne Marbaix 69 Jean-Baptiste Demoulin 75 Jean-Paul Coutelier 80 Thomas Michiels 84 Pierre Coulie 89 LICR Introduction 95 Benoît Van den Eynde 98 Pierre van der Bruggen 106 Nicolas Van Baren 114 Jean-Christophe Renauld 119 Stefan Constantinescu 125 The de Duve Institute 5 THE DE DUVE INSTITUTE: AN INTERNATIONAL BIOMEDICAL RESEARCH INSTITUTE In 1974, when Christian de Duve founded the Institute of Cellular Pathology (ICP), now rena- med the de Duve Institute, he was acutely aware of the constrast between the enormous progress in biological sciences that had occurred in the 20 preceding years and the modesty of the medical advances that had followed. He therefore crea- ted a research institution based on the principle that basic research in biology would be pursued by the investigators with complete freedom, but that special attention would be paid to the exploi- tation of basic advances for medical progress. It was therefore highly appropriate for the Institute to be located on the campus of the Faculty of Emile Van Schaftingen Medicine of the University of Louvain (UCL). This campus is located in Brussels. The Univer- sity hospital (Clinique St Luc) is located within walking distance of the Institute. The main commitment of the members of the de Duve Institute is research.
    [Show full text]
  • Articles Catalytic Cycling in Β-Phosphoglucomutase: a Kinetic
    9404 Biochemistry 2005, 44, 9404-9416 Articles Catalytic Cycling in â-Phosphoglucomutase: A Kinetic and Structural Analysis†,‡ Guofeng Zhang, Jianying Dai, Liangbing Wang, and Debra Dunaway-Mariano* Department of Chemistry, UniVersity of New Mexico, Albuquerque, New Mexico 87131-0001 Lee W. Tremblay and Karen N. Allen* Department of Physiology and Biophysics, Boston UniVersity School of Medicine, Boston, Massachusetts 02118-2394 ReceiVed March 26, 2005; ReVised Manuscript ReceiVed May 18, 2005 ABSTRACT: Lactococcus lactis â-phosphoglucomutase (â-PGM) catalyzes the interconversion of â-D-glucose 1-phosphate (â-G1P) and â-D-glucose 6-phosphate (G6P), forming â-D-glucose 1,6-(bis)phosphate (â- G16P) as an intermediate. â-PGM conserves the core domain catalytic scaffold of the phosphatase branch of the HAD (haloalkanoic acid dehalogenase) enzyme superfamily, yet it has evolved to function as a mutase rather than as a phosphatase. This work was carried out to identify the structural basis underlying this diversification of function. In this paper, we examine â-PGM activation by the Mg2+ cofactor, â-PGM activation by Asp8 phosphorylation, and the role of cap domain closure in substrate discrimination. First, the 1.90 Å resolution X-ray crystal structure of the Mg2+-â-PGM complex is examined in the context of + + previously reported structures of the Mg2 -R-D-galactose-1-phosphate-â-PGM, Mg2 -phospho-â-PGM, and Mg2+-â-glucose-6-phosphate-1-phosphorane-â-PGM complexes to identify conformational changes that occur during catalytic turnover. The essential role of Asp8 in nucleophilic catalysis was confirmed by demonstrating that the D8A and D8E mutants are devoid of catalytic activity.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Transcriptomic and Proteomic Profiling Provides Insight Into
    BASIC RESEARCH www.jasn.org Transcriptomic and Proteomic Profiling Provides Insight into Mesangial Cell Function in IgA Nephropathy † † ‡ Peidi Liu,* Emelie Lassén,* Viji Nair, Celine C. Berthier, Miyuki Suguro, Carina Sihlbom,§ † | † Matthias Kretzler, Christer Betsholtz, ¶ Börje Haraldsson,* Wenjun Ju, Kerstin Ebefors,* and Jenny Nyström* *Department of Physiology, Institute of Neuroscience and Physiology, §Proteomics Core Facility at University of Gothenburg, University of Gothenburg, Gothenburg, Sweden; †Division of Nephrology, Department of Internal Medicine and Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, Michigan; ‡Division of Molecular Medicine, Aichi Cancer Center Research Institute, Nagoya, Japan; |Department of Immunology, Genetics and Pathology, Uppsala University, Uppsala, Sweden; and ¶Integrated Cardio Metabolic Centre, Karolinska Institutet Novum, Huddinge, Sweden ABSTRACT IgA nephropathy (IgAN), the most common GN worldwide, is characterized by circulating galactose-deficient IgA (gd-IgA) that forms immune complexes. The immune complexes are deposited in the glomerular mesangium, leading to inflammation and loss of renal function, but the complete pathophysiology of the disease is not understood. Using an integrated global transcriptomic and proteomic profiling approach, we investigated the role of the mesangium in the onset and progression of IgAN. Global gene expression was investigated by microarray analysis of the glomerular compartment of renal biopsy specimens from patients with IgAN (n=19) and controls (n=22). Using curated glomerular cell type–specific genes from the published literature, we found differential expression of a much higher percentage of mesangial cell–positive standard genes than podocyte-positive standard genes in IgAN. Principal coordinate analysis of expression data revealed clear separation of patient and control samples on the basis of mesangial but not podocyte cell–positive standard genes.
    [Show full text]
  • The Analysis of Variants in the General Population Reveals That PMM2 Is Extremely Tolerant to Missense Mutations and That Diagno
    International Journal of Molecular Sciences Article The Analysis of Variants in the General Population Reveals That PMM2 Is Extremely Tolerant to Missense Mutations and That Diagnosis of PMM2-CDG Can Benefit from the Identification of Modifiers Valentina Citro 1, Chiara Cimmaruta 1, Maria Monticelli 1, Guglielmo Riccio 1, Bruno Hay Mele 1,2, Maria Vittoria Cubellis 1,* ID and Giuseppina Andreotti 3 ID 1 Dipartimento di Biologia, Università Federico II, 80126 Napoli, Italy; [email protected] (V.C.); [email protected] (C.C.); [email protected] (M.M.); [email protected] (G.R.); [email protected] (B.H.M.) 2 Dipartimento di Scienze Agrarie ed Agroalimentari, Università Federico II, 80055 Napoli, Italy 3 Istituto di Chimica Biomolecolare—CNR, 80078 Pozzuoli, Italy; [email protected] * Correspondence: [email protected]; Tel.: +39-081-679118; Fax: +39-081-679233 Received: 30 May 2018; Accepted: 26 July 2018; Published: 30 July 2018 Abstract: Type I disorders of glycosylation (CDG), the most frequent of which is phosphomannomutase 2 (PMM2-CDG), are a group of diseases causing the incomplete N-glycosylation of proteins. PMM2-CDG is an autosomal recessive disease with a large phenotypic spectrum, and is associated with mutations in the PMM2 gene. The biochemical analysis of mutants does not allow a precise genotype–phenotype correlation for PMM2-CDG. PMM2 is very tolerant to missense and loss of function mutations, suggesting that a partial deficiency of activity might be beneficial under certain circumstances. The patient phenotype might be influenced by variants in other genes associated with the type I disorders of glycosylation in the general population.
    [Show full text]
  • Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays
    Supplemental Table S1. Primers for SYBRGreen quantitative RT-PCR assays. Gene Accession Primer Sequence Length Start Stop Tm GC% GAPDH NM_002046.3 GAPDH F TCCTGTTCGACAGTCAGCCGCA 22 39 60 60.43 59.09 GAPDH R GCGCCCAATACGACCAAATCCGT 23 150 128 60.12 56.52 Exon junction 131/132 (reverse primer) on template NM_002046.3 DNAH6 NM_001370.1 DNAH6 F GGGCCTGGTGCTGCTTTGATGA 22 4690 4711 59.66 59.09% DNAH6 R TAGAGAGCTTTGCCGCTTTGGCG 23 4797 4775 60.06 56.52% Exon junction 4790/4791 (reverse primer) on template NM_001370.1 DNAH7 NM_018897.2 DNAH7 F TGCTGCATGAGCGGGCGATTA 21 9973 9993 59.25 57.14% DNAH7 R AGGAAGCCATGTACAAAGGTTGGCA 25 10073 10049 58.85 48.00% Exon junction 9989/9990 (forward primer) on template NM_018897.2 DNAI1 NM_012144.2 DNAI1 F AACAGATGTGCCTGCAGCTGGG 22 673 694 59.67 59.09 DNAI1 R TCTCGATCCCGGACAGGGTTGT 22 822 801 59.07 59.09 Exon junction 814/815 (reverse primer) on template NM_012144.2 RPGRIP1L NM_015272.2 RPGRIP1L F TCCCAAGGTTTCACAAGAAGGCAGT 25 3118 3142 58.5 48.00% RPGRIP1L R TGCCAAGCTTTGTTCTGCAAGCTGA 25 3238 3214 60.06 48.00% Exon junction 3124/3125 (forward primer) on template NM_015272.2 Supplemental Table S2. Transcripts that differentiate IPF/UIP from controls at 5%FDR Fold- p-value Change Transcript Gene p-value p-value p-value (IPF/UIP (IPF/UIP Cluster ID RefSeq Symbol gene_assignment (Age) (Gender) (Smoking) vs. C) vs. C) NM_001178008 // CBS // cystathionine-beta- 8070632 NM_001178008 CBS synthase // 21q22.3 // 875 /// NM_0000 0.456642 0.314761 0.418564 4.83E-36 -2.23 NM_003013 // SFRP2 // secreted frizzled- 8103254 NM_003013
    [Show full text]
  • Successes and Challenges in Functional Assignment in a Superfamily of Phosphatases
    99 Experimental Standard Conditions of Enzyme Characterization Beilstein-Institut September 12th –16th, 2011, Ru¨desheim/Rhein, Germany Successes and Challenges in Functional Assignment in a Superfamily of Phosphatases Karen N. Allen1,* and Debra Dunaway-Mariano2,# 1Department of Chemistry, Boston University, 590 Commonwealth Avenue, Boston, MA 02215 – 2521, U.S.A. 2Department of Chemistry and Chemical Biology, University of New Mexico, Albuquerque, NM, 87131, U.S.A. E-Mail: *[email protected] and #[email protected] Received: 17th September 2012/Published: 15th February 2013 Abstract The explosion of protein sequence information from genome sequen- cing efforts requires that current experimental strategies for function assignment must evolve into computationally-based function predic- tion. This necessitates the development of new strategies based, in part, on the identification of sequence markers, including residues that sup- port structure and specificity as well as a more informed definition of orthologues. We have undertaken the function assignment of unknown members of the haloalkanoate dehalogenase superfamily using an in- tegrated bioinformatics/structure/mechanism approach. Notably, a number of members show ‘‘substrate blurring’’, with activity toward a number of substrates and significant substrate overlap between para- logues. Other family members have been honed to a specific substrate with high catalytic efficiency and proficiency. Our findings highlight the use of the cap domain structure and enzyme conformational dy- namics in delineating specificity. http://www.beilstein-institut.de/escec2011/Proceedings/Allen/Allen.pdf 100 Allen, K.N. and Dunaway-Mariano, D. The Haloalkanoate Dehalogenase Superfamily (HADSF) The ‘‘central dogma’’ of protein structure/function studies is that protein sequence dictates protein structure which, in turn defines protein function.
    [Show full text]
  • The Effects of Genetic Variants on Protein Structure and Their Associations with Preeclampsia
    The Effects of Genetic Variants on Protein Structure and their Associations with Preeclampsia Elizabeth Geena Woo Undergraduate Honors Thesis April 20, 2020 Thesis Advisor: Alper Uzun, PhD Second Reader: James Padbury, MD A thesis submitted in partial fulfillment for the degree of Bachelor of Arts With Honors in Computational Biology 1 Table of Contents Introduction......................................................................................................................................3 Methods and Materials.....................................................................................................................4 Results and Discussion....................................................................................................................8 Conclusion.....................................................................................................................................28 References......................................................................................................................................32 2 Introduction Preeclampsia is a complex pregnancy-specific disorder characterized by the onset of maternal hypertension and proteinuria.1,2 This multifactorial disorder complicates 2-8% of US deliveries and is a major cause of maternal and fetal morbidity and mortality.3 Preeclamptic pregnancies are associated with long-term outcomes for both the mother and offspring. Stroke, cardiovascular disease, diabetes, and premature mortality are linked to preeclampsia in affected mothers
    [Show full text]
  • Induction of Therapeutic Tissue Tolerance Foxp3 Expression Is
    Downloaded from http://www.jimmunol.org/ by guest on October 2, 2021 is online at: average * The Journal of Immunology , 13 of which you can access for free at: 2012; 189:3947-3956; Prepublished online 17 from submission to initial decision 4 weeks from acceptance to publication September 2012; doi: 10.4049/jimmunol.1200449 http://www.jimmunol.org/content/189/8/3947 Foxp3 Expression Is Required for the Induction of Therapeutic Tissue Tolerance Frederico S. Regateiro, Ye Chen, Adrian R. Kendal, Robert Hilbrands, Elizabeth Adams, Stephen P. Cobbold, Jianbo Ma, Kristian G. Andersen, Alexander G. Betz, Mindy Zhang, Shruti Madhiwalla, Bruce Roberts, Herman Waldmann, Kathleen F. Nolan and Duncan Howie J Immunol cites 35 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription http://www.jimmunol.org/content/suppl/2012/09/17/jimmunol.120044 9.DC1 This article http://www.jimmunol.org/content/189/8/3947.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2012 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of October 2, 2021.
    [Show full text]
  • University of Oklahoma Graduate College
    UNIVERSITY OF OKLAHOMA GRADUATE COLLEGE SEQUENCE AND ANALYSIS OF THE PHYMATOTRICHOPSIS OMNIVORA GENOME AND EXPRESSED SEQUENCE TAGS A DISSERTATION SUBMITTED TO THE GRADUATE FACULTY in partial fulfillment of the requirements for the Degree of DOCTOR OF PHILOSOPHY BY SIMONE MACMIL Norman, Oklahoma 2009 SEQUENCE AND ANALYSIS OF PHYMATOTRICHOPSIS OMNIVORA GENOME AND EXPRESSED SEQUENCE TAGS A DISSERTATION APPROVED FOR THE DEPARTMENT OF CHEMISTRY AND BIOCHEMISTRY By Dr. Bruce A. Roe, Chair Dr. Paul F. Cook Dr. Ann H. West Dr. Kathleen E. Duncan Dr. Charles V. Rice ©Copyright by SIMONE LYNETTE MACMIL 2009 All Rights Reserved. Acknowledgements I wish to express my sincere gratitude to my major advisor Dr. Bruce Roe for accepting me to his lab at the brink of his retirement, giving me the opportunity to work on this challenging yet rewarding project and for cheering me on through the many roadblocks and bumps that I encountered during the course of this study. His scientific accomplishments and discussions have always inspired me and have spurred me to reach higher in my goals and delve deeper in my understanding and it would be impossible to complete this project sans his patience, guidance and encouragement. I am extremely grateful to my advisory committee, Dr. Paul Cook, Dr. Kathleen Duncan, and Dr. Charles Rice for their advice, encouragement and participation in my research and dissertation. I would specially like to thank Dr. Ann West for chairing my committee during my candidacy exam and for her willingness to be present on my doctoral defense committee as well. My special thanks also goes to Dr.
    [Show full text]
  • Supplemental Figures 04 12 2017
    Jung et al. 1 SUPPLEMENTAL FIGURES 2 3 Supplemental Figure 1. Clinical relevance of natural product methyltransferases (NPMTs) in brain disorders. (A) 4 Table summarizing characteristics of 11 NPMTs using data derived from the TCGA GBM and Rembrandt datasets for 5 relative expression levels and survival. In addition, published studies of the 11 NPMTs are summarized. (B) The 1 Jung et al. 6 expression levels of 10 NPMTs in glioblastoma versus non‐tumor brain are displayed in a heatmap, ranked by 7 significance and expression levels. *, p<0.05; **, p<0.01; ***, p<0.001. 8 2 Jung et al. 9 10 Supplemental Figure 2. Anatomical distribution of methyltransferase and metabolic signatures within 11 glioblastomas. The Ivy GAP dataset was downloaded and interrogated by histological structure for NNMT, NAMPT, 12 DNMT mRNA expression and selected gene expression signatures. The results are displayed on a heatmap. The 13 sample size of each histological region as indicated on the figure. 14 3 Jung et al. 15 16 Supplemental Figure 3. Altered expression of nicotinamide and nicotinate metabolism‐related enzymes in 17 glioblastoma. (A) Heatmap (fold change of expression) of whole 25 enzymes in the KEGG nicotinate and 18 nicotinamide metabolism gene set were analyzed in indicated glioblastoma expression datasets with Oncomine. 4 Jung et al. 19 Color bar intensity indicates percentile of fold change in glioblastoma relative to normal brain. (B) Nicotinamide and 20 nicotinate and methionine salvage pathways are displayed with the relative expression levels in glioblastoma 21 specimens in the TCGA GBM dataset indicated. 22 5 Jung et al. 23 24 Supplementary Figure 4.
    [Show full text]
  • Supplemental Tables.Pdf
    Table S1. Genes associated with H4K20me1, me2 and me3 H4K20 mitochondrial TOM complex subunit Systematic name Description me1 SPAC17H9.16 Tom22 (predicted) 1.54 SPBC1348.10c phospholipase (predicted) 3.81 SPAC17A2.07c sequence orphan 1.54 SPCC4B3.12 histone lysine methyltransferase Set9 2.69 RNase P and RNase MRP subunit p30 retrotransposable element/transposon Tf2- SPAC3A12.04c (predicted) 1.53 SPBC9B6.02c type 2.55 SPAC17G8.05 mediator complex subunit Med20 1.49 TIM22 inner membrane protein import mitochondrial translation elongation factor SPAC13G6.04 complex subunit Tim8 (predicted) 2.51 SPBC9B6.04c EF-Tu Tuf1 1.47 SPBC29A10.13 F0-ATPase subunit D (predicted) 2.16 superoxide dismutase%2C mitochondrial SPBC3B9.10 SNARE Vti1 (predicted) 1.99 SPBC16A3.14 ribosomal protein subunit (predicted) 1.45 mitotic spindle organizing protein Mzt1 guanyl-nucleotide exchange factor SPAC9G1.15c (predicted) 1.98 SPBC4C3.04c (predicted) 1.43 SPAC11E3.04c ubiquitin conjugating enzyme Ubc13 1.96 SPAC3C7.14c ubiquitinated histone-like protein Uhp1 1.43 SPAC26A3.11 amidohydrolase 1.94 SPAC20G8.07c C-8 sterol isomerase Erg2 1.41 SPBC3B9.22c DASH complex subunit Dad4 1.89 isopentenyl-diphosphate delta-isomerase oligosaccharyltransferase complex zeta SPBC106.15 Idi1 1.40 SPCC18.19c subunit Ost5 (predicted) 1.89 19S proteasome regulatory subunit Rpn2 SPAC22F3.15 GatB/YqeY domain protein 1.78 SPBC17D11.07c (predicted) 1.39 RNA polymerase I transcription factor glucan endo-1%2C3-alpha-glucosidase SPBC725.17c subunit Rrn11 (predicted) 1.77 SPBC646.06c Agn2 1.37
    [Show full text]