DOCSLIB.ORG

Annual Report DDUV 2009

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Annual Report DDUV 2009 Research at the de Duve Institute and Brussels Branch of the Ludwig Institute for Cancer Research August 2009 de Duve Institute Introduction 5 Miikka Vikkula 12 Frédéric Lemaigre 20 Annabelle Decottignies and Charles de Smet 25 Emile Vanschaftingen 31 Françoise Bontemps 37 Jean-François Collet 42 Guido Bommer 47 Mark Rider 50 Fred Opperdoes 56 Pierre Courtoy 62 Etienne Marbaix 69 Jean-Baptiste Demoulin 75 Jean-Paul Coutelier 80 Thomas Michiels 84 Pierre Coulie 89 LICR Introduction 95 Benoît Van den Eynde 98 Pierre van der Bruggen 106 Nicolas Van Baren 114 Jean-Christophe Renauld 119 Stefan Constantinescu 125 The de Duve Institute 5 THE DE DUVE INSTITUTE: AN INTERNATIONAL BIOMEDICAL RESEARCH INSTITUTE In 1974, when Christian de Duve founded the Institute of Cellular Pathology (ICP), now rena- med the de Duve Institute, he was acutely aware of the constrast between the enormous progress in biological sciences that had occurred in the 20 preceding years and the modesty of the medical advances that had followed. He therefore crea- ted a research institution based on the principle that basic research in biology would be pursued by the investigators with complete freedom, but that special attention would be paid to the exploi- tation of basic advances for medical progress. It was therefore highly appropriate for the Institute to be located on the campus of the Faculty of Emile Van Schaftingen Medicine of the University of Louvain (UCL). This campus is located in Brussels. The Univer- sity hospital (Clinique St Luc) is located within walking distance of the Institute. The main commitment of the members of the de Duve Institute is research. Discovery is the endpoint of their efforts and the only ele- ment taken into account for their evaluation. The Institute functions in symbiosis with the Faculty of Medicine and many of its senior members hold a Faculty position and have teaching ap- pointments. The influx of doctoral students and postdoctoral fellows from the University is also a key element in the success Benoît Van den Eynde 6 In 1978 the Ludwig Institute for Cancer Research decided to base its Belgian branch within the walls of the de Duve Institute. A fruitful collaboration between the two Institutions has been pur- sued since that time. Even though the two Institutes are completely independent, the collaboration between the scientists of the de Duve Institute and the Ludwig Institute is extremely close and the sharing of resources is considerable. The de Duve Institute is managed by a directorate of three scientists, presently composed of Emile Van Schaftingen, Benoît Van den Eynde, and Miikka Vikkula. The directorate is appointed by the Board of directors, which comprises the Rector of the University of Louvain, one of the Pro- rectors, the General Administrator of the University and the Dean of the Faculty of Medicine. Also present in the Board of directors are eminent members of the business community. About 170 researchers work in the de Duve Institute and in the Ludwig Institute, assisted by a technical and administrative staff of about 80 members. Despite this relatively small size, the de Duve Institute has the ambition of pursuing research projects of high quality under condi- tions that allow original, long-term projects to be pursued. The Institute has a limited endowment, which is a source of key financing for priority is- sues, such as the creation of new laboratories for promising young researchers. We expect that the quality of our researchers, supported by sound organisational approaches, will enable the de Duve Institute to stand at the forefront of Euro- pean Research. Miikka Vikkula 7 8 DIRECTORATE SCIENTIFIC COUNCIL Emile VAN SCHAFTINGEN, Director Jean-Charles CEROTTINI, Lausanne Branch of the Ludwig Institute for Cancer Research, Miikka VIKKULA Switzerland Benoît VAN DEN EYNDE Philip COHEN, University of Dundee, UK Daniel LOUVARD, UMR144 CNRS/Institut Curie, France BOARD OF DIRECTORS Gilbert VASSART, Université Libre de Bruxelles, Belgium Norbert MARTIN, President Henri BEAUFAY ADMINISTRATION AND Luc BERTRAND GENERAL SERVICES Thierry BOON-FALLEUR Philippe PENNINCKX, Finance and Admi- Alfred BOUCKAERT nistration Manager Yolande de SELLIERS, External Relations François CASIER Manager Bernard COULIE Lydia HAUBOLD, Accountant Etienne DAVIGNON Delphine LEBBE, Executive Secretary Emmanuel de BEUGHEM Alain BUISSERET, Technical Manager Christian de DUVE Jean-Pierre SZIKORA, Informatics Support Jean-François DENEF Roland KEUNINGS Christian VAN LANGENHOVE, Workshop Dan COMAN, Workshop Anne-Marie KUMPS Jean PETERBROECK Maurice VELGE de Duve Institute Avenue Hippocrate 74-75 1200 Brussels, Belgium [T] +32 (02) 764 75 50 [F] +32 (02) 764 75 73 [W] www.deduveinstitute.be 9 DEVELOPMENT AND EXPANSION COUNCIL (DEC) President : Baron BERTRAND Members Mr E. van BAREN Honorary Presidents Mr J. BERTEAU Me P. HOURDEAU Mr & Mrs R. BOON-FALLEUR Baron PETERBROECK Mr. M. BRAGARD Baron van der REST (†) Mr V. BRUNEAU Baron de TILLESSE, Honorary President Mrs G. van CUTSEM-STAES POLET of the Board of Directors Vicomtesse de DUVE (†) Baron S. EMSENS Honorary Vice-Presidents Vicomte della FAILLE de WAERLOOS Mr A. LAGASSE de LOCHT (†) Baronne de GERLACHE de GOMERY Baronne M. VELGE Mr P. GUILMOT Mr V. JACOBS van MERLEN (†) Fellowship and/or Laboratory Sponsors Mr F. JAMAR Mr & Mrs A. BOUCKAERT Mr L. LHOIST Mrs C. DELORI Comte J. de LIEDEKERKE Mrs G. DELORI (†) Dr J. MAILLET Mrs H. DELORI Mrs O. MAIRLOT Mr P. DELORI Mr B. MATTLET Mrs L. DRESSE de LEBIOLES Mrs de MOREAU de GERBEHAYE Mrs Ph. FABRI Mrs A. PIERON Comte B. de GRUNNE Mr J. SAMAIN Baron van GYSEL de MEISE Mr & Mrs SOLVAY de LA HULPE Mr P. HOLLENFELTZ du TREUX Baronne H. van der STRATEN WAILLET Mr & Mrs M. HUYNEN Dr E. VAN ASSCHE Mr & Mrs A. LACROIX Mr E. VAN CAMPENHOUT Mrs M. LHOIST Dr P. VAN HONSEBROUCK Mr & Mrs D. MATHIEU Mr Ph. de VISSCHER Mr E. MOREL de BOUCLE ST DENIS Baron & Baronne PETERBROECK AXA Mr M. RUIZ de ARCAUTE ING Vicomte P. de SPOELBERCH BEKAERT Dr J. TROQUET CABLERIE D’EUPEN Mrs J. VAN CAUWENBERGHE CARLSBERG IMPORTERS Baron M. VELGE CARMEUSE Mrs M. de VISSCHER CHEMITEX FONDS JACQUES GOOR FONDATION M. et R. de HOVRE UMICORE GENZYME BELGIUM ACKERMANS & VAN HAAREN GBL ASCO INDUSTRIES GROUPE LHOIST PFIZER SIBEKA 10 ACKNOWLEDGMENTS In 2008, the de Duve Institute has attracted major gifts from several foundations, companies and individuals who have been very generous. These sponsors are providing the resources that enable our scientists to better understand and treat diseases that afflict people around the world. Gifts are the lifeblood of new research initiatives and private resources are crucial in underwriting the costs of new laboratories. On an annual basis, fund-raising from private sources has increased during the past decade over levels achieved previously and now supports about 10 % of the Institute’s budget. The appeal for sponsoring postdoctoral fellowships was also widely followed. In 2008 the Institute has been able to allocate the following fellowships, entirely supported by our donors : The «Haas-Teichen» fellowship was attributed to Jhansi KOTA, the «Pierre Lacroix» fellowship to Shreedhara GUPTA, the «Maurange» fellowship to Sandrine MEDVES, another fellowship was recently awarded by the Institute to Reece MARILLIER. We express our gratitude to all who contributed to the financing of post-doctoral fellows and state- of-the art research laboratories at the de Duve Institute, ensuring that this institute will remain at the top of the field in biomedical research. Luc BERTRAND, President of the Development and Expansion Council 11 Nicole REVENCU, Pediatrician, Genetician Arash GHALAMKARPOUR, M.D., Graduate Student Virginie AERTS, Graduate Student Mélanie UEBELHOER, Graduate Student Thomas PALM, Graduate Student Laurence DESMYTER, Graduate Student Anne Van EGEREN, Technician Dominique COTTEM, Technician Annette MARCELIS, Technician (since 1.10.2008) Antonella MENDOLA, Technician (till Miikka VIKKULA, Member 30.09.2008) Antonella MENDOLA, (since 1.10.2008) Laurence BOON, Plastic Surgeon, Part-time Research Assistant Research Associate Nicolas WARNIER, Part-time Technical Mustapha AMYERE, Postdoctoral Fellow Assistant Pascal BROUILLARD, Postdoctoral Fellow CLAUDE MAUYEN, Part-time Technical Nisha LIMAYE, Postdoctoral Fellow Assistant Michella GHASSIBE, Postdoctoral Fellow Liliane NICULESCU, Secretary GENETICS OF HUMAN CARDIOVASCULAR ANOMALIES, CLEFT LIP PALATE AND CEREBRAL TUMORS The basic aim of our research is to get insights into the molecular mechanisms underlying a variety of disorders of cardiovascular and skeletal systems, as well as certain cancers. We are especially interested in evaluating the importance of genetic variation in human disease development. The precise cause of many disorders remains unknown, and current treatments are therefore aimed at alleviating symptoms. Identification of the primary causes as well as modulating factors would allow for the development of treatments that are more “curative” and specific. As this research is based on human DNA extracted from blood and tissue samples obtained from patients, the group works tightly together with several clinicians and multidiciplinary centers worldwide (e.g. Centre des Malformations Vasculaires, Cliniques universitaires St-Luc; Vascular Anomalies Center, Children’s Hospital, Boston, USA; Consultation des Angiomes, Hôpital Lariboisière, Paris, and Centre labiopalatin, Cliniques Universitaires St-Luc). VENOUS MALFORMATIONS AND Enjolras, Hôpital Lariboisière, Paris, France; A.
Load more

Recommended publications
  • Articles Catalytic Cycling in Β-Phosphoglucomutase: a Kinetic
    9404 Biochemistry 2005, 44, 9404-9416 Articles Catalytic Cycling in â-Phosphoglucomutase: A Kinetic and Structural Analysis†,‡ Guofeng Zhang, Jianying Dai, Liangbing Wang, and Debra Dunaway-Mariano* Department of Chemistry, UniVersity of New Mexico, Albuquerque, New Mexico 87131-0001 Lee W. Tremblay and Karen N. Allen* Department of Physiology and Biophysics, Boston UniVersity School of Medicine, Boston, Massachusetts 02118-2394 ReceiVed March 26, 2005; ReVised Manuscript ReceiVed May 18, 2005 ABSTRACT: Lactococcus lactis â-phosphoglucomutase (â-PGM) catalyzes the interconversion of â-D-glucose 1-phosphate (â-G1P) and â-D-glucose 6-phosphate (G6P), forming â-D-glucose 1,6-(bis)phosphate (â- G16P) as an intermediate. â-PGM conserves the core domain catalytic scaffold of the phosphatase branch of the HAD (haloalkanoic acid dehalogenase) enzyme superfamily, yet it has evolved to function as a mutase rather than as a phosphatase. This work was carried out to identify the structural basis underlying this diversification of function. In this paper, we examine â-PGM activation by the Mg2+ cofactor, â-PGM activation by Asp8 phosphorylation, and the role of cap domain closure in substrate discrimination. First, the 1.90 Å resolution X-ray crystal structure of the Mg2+-â-PGM complex is examined in the context of + + previously reported structures of the Mg2 -R-D-galactose-1-phosphate-â-PGM, Mg2 -phospho-â-PGM, and Mg2+-â-glucose-6-phosphate-1-phosphorane-â-PGM complexes to identify conformational changes that occur during catalytic turnover. The essential role of Asp8 in nucleophilic catalysis was confirmed by demonstrating that the D8A and D8E mutants are devoid of catalytic activity.
    [Show full text]
  • PMM2 Gene Phosphomannomutase 2
    PMM2 gene phosphomannomutase 2 Normal Function The PMM2 gene provides instructions for making an enzyme called phosphomannomutase 2 (PMM2). This enzyme is involved in a process called glycosylation, which attaches groups of sugar molecules (oligosaccharides) to proteins. Oligosaccharides are made up of many small sugar molecules that are attached to one another in a long chain. Glycosylation modifies proteins so they can perform a wider variety of functions. In one of the early steps of glycosylation, the PMM2 enzyme converts a molecule called mannose-6-phosphate to mannose-1-phosphate. Subsequently, mannose-1-phosphate is converted into GDP-mannose, which can transfer its small sugar molecule called mannose to the growing oligosaccharide chain. Once the correct number of small sugar molecules are linked together to form the oligosaccharide, it can be attached to a protein. Health Conditions Related to Genetic Changes PMM2-congenital disorder of glycosylation More than 115 mutations in the PMM2 gene have been found to cause PMM2- congenital disorder of glycosylation (PMM2-CDG, also known as congenital disorder of glycosylation type Ia). This is a severe condition that is characterized by developmental delay, weak muscle tone (hypotonia), abnormal distribution of fat, and various other signs and symptoms. The mutations that cause PMM2-CDG change the structure of the PMM2 enzyme in different ways; however, all of the mutations appear to result in reduced enzyme activity. Decreased activity of the PMM2 enzyme leads to a shortage of GDP-mannose within cells. As a result, there is not enough activated mannose to form oligosaccharides. Glycosylation cannot proceed normally because incorrect oligosaccharides are produced.
    [Show full text]
  • 'Improvement of Dolichol-Linked Oligosaccharide Biosynthesis by The
    IMPROVEMENT OF DOLICHOL-LINKED OLIGOSACCHARIDE BIOSYNTHESIS BY THE SQUALENE SYNTHASE INHIBITOR ZARAGOZIC ACID Micha A. Haeuptle1,3, Michael Welti1,3, Heinz Troxler2, Andreas J. Hülsmeier1, Timo Imbach1, and Thierry Hennet1 1Institute of Physiology, University of Zürich, Zürich, Switzerland; 2Division of Clinical Chemistry and Biochemistry, Children Hospital Zurich, Switzerland 3These authors contributed equally Running head: Zaragozic acid improves N-glycosylation Address correspondence to: Thierry Hennet, Institute of Physiology, University of Zürich, Winterthurerstrasse 190, CH-8057 Zürich, Switzerland. Phone: +41-44-635-5080. Fax: +41-44-635-6814. E-mail: [email protected] The majority of Congenital Disorders of involved in biosynthesis of lipid-linked Glycosylation (CDG) are caused by defects of oligosaccharide (LLO) required for N- dolichol (Dol)-linked oligosaccharide assembly, glycosylation (2) or proteins involved in glycan which lead to under-occupancy of N- processing (3,4) or transport of N-glycoproteins (5) glycosylation sites. Most mutations encountered form the molecular basis of CDG. The majority of in CDG are hypomorphic, thus leaving residual CDG encompass disorders affecting the assembly activity to the affected biosynthetic enzymes. We of the LLO precursor dolichol-pyrophosphate (Dol- hypothesized that increased cellular levels of PP)-GlcNAc2Man9Glc3, which leads to under- Dol-linked substrates might compensate for the occupancy of N-glycosylation sites (6). The low biosynthetic activity and thereby improve stepwise biosynthesis of the LLO precursor begins the output of protein N-glycosylation in CDG. at the cytosolic side of the endoplasmic reticulum To this end, we have investigated the potential of (ER) membrane by transfer of GlcNAc-P to the squalene synthase inhibitor zaragozic acid to dolichol-P (Dol-P) and completes at the luminal redirect the flow of the poly-isoprene pathway side of the ER membrane.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Transcriptomic and Proteomic Profiling Provides Insight Into
    BASIC RESEARCH www.jasn.org Transcriptomic and Proteomic Profiling Provides Insight into Mesangial Cell Function in IgA Nephropathy † † ‡ Peidi Liu,* Emelie Lassén,* Viji Nair, Celine C. Berthier, Miyuki Suguro, Carina Sihlbom,§ † | † Matthias Kretzler, Christer Betsholtz, ¶ Börje Haraldsson,* Wenjun Ju, Kerstin Ebefors,* and Jenny Nyström* *Department of Physiology, Institute of Neuroscience and Physiology, §Proteomics Core Facility at University of Gothenburg, University of Gothenburg, Gothenburg, Sweden; †Division of Nephrology, Department of Internal Medicine and Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, Michigan; ‡Division of Molecular Medicine, Aichi Cancer Center Research Institute, Nagoya, Japan; |Department of Immunology, Genetics and Pathology, Uppsala University, Uppsala, Sweden; and ¶Integrated Cardio Metabolic Centre, Karolinska Institutet Novum, Huddinge, Sweden ABSTRACT IgA nephropathy (IgAN), the most common GN worldwide, is characterized by circulating galactose-deficient IgA (gd-IgA) that forms immune complexes. The immune complexes are deposited in the glomerular mesangium, leading to inflammation and loss of renal function, but the complete pathophysiology of the disease is not understood. Using an integrated global transcriptomic and proteomic profiling approach, we investigated the role of the mesangium in the onset and progression of IgAN. Global gene expression was investigated by microarray analysis of the glomerular compartment of renal biopsy specimens from patients with IgAN (n=19) and controls (n=22). Using curated glomerular cell type–specific genes from the published literature, we found differential expression of a much higher percentage of mesangial cell–positive standard genes than podocyte-positive standard genes in IgAN. Principal coordinate analysis of expression data revealed clear separation of patient and control samples on the basis of mesangial but not podocyte cell–positive standard genes.
    [Show full text]
  • The Analysis of Variants in the General Population Reveals That PMM2 Is Extremely Tolerant to Missense Mutations and That Diagno
    International Journal of Molecular Sciences Article The Analysis of Variants in the General Population Reveals That PMM2 Is Extremely Tolerant to Missense Mutations and That Diagnosis of PMM2-CDG Can Benefit from the Identification of Modifiers Valentina Citro 1, Chiara Cimmaruta 1, Maria Monticelli 1, Guglielmo Riccio 1, Bruno Hay Mele 1,2, Maria Vittoria Cubellis 1,* ID and Giuseppina Andreotti 3 ID 1 Dipartimento di Biologia, Università Federico II, 80126 Napoli, Italy; [email protected] (V.C.); [email protected] (C.C.); [email protected] (M.M.); [email protected] (G.R.); [email protected] (B.H.M.) 2 Dipartimento di Scienze Agrarie ed Agroalimentari, Università Federico II, 80055 Napoli, Italy 3 Istituto di Chimica Biomolecolare—CNR, 80078 Pozzuoli, Italy; [email protected] * Correspondence: [email protected]; Tel.: +39-081-679118; Fax: +39-081-679233 Received: 30 May 2018; Accepted: 26 July 2018; Published: 30 July 2018 Abstract: Type I disorders of glycosylation (CDG), the most frequent of which is phosphomannomutase 2 (PMM2-CDG), are a group of diseases causing the incomplete N-glycosylation of proteins. PMM2-CDG is an autosomal recessive disease with a large phenotypic spectrum, and is associated with mutations in the PMM2 gene. The biochemical analysis of mutants does not allow a precise genotype–phenotype correlation for PMM2-CDG. PMM2 is very tolerant to missense and loss of function mutations, suggesting that a partial deficiency of activity might be beneficial under certain circumstances. The patient phenotype might be influenced by variants in other genes associated with the type I disorders of glycosylation in the general population.
    [Show full text]
  • Congenital Disorders of Glycosylation Type Ia)
    European Journal of Human Genetics (2000) 8, 367–371 © 2000 Macmillan Publishers Ltd All rights reserved 1018–4813/00 $15.00 y www.nature.com/ejhg ARTICLE Lack of Hardy-Weinberg equilibrium for the most prevalent PMM2 mutation in CDG-Ia (congenital disorders of glycosylation type Ia) Els Schollen1, Susanne Kjaergaard2, Eric Legius1, Marianne Schwartz2 and Gert Matthijs1 1Center for Human Genetics, University of Leuven, Belgium; 2Department of Clinical Genetics, Rigshospitalet, Copenhagen, Denmark The R141H mutation in the PMM2 gene is the most frequent mutation in type Ia of the congenital disorders of glycosylation (formerly carbohydrate-deficient glycoprotein syndromes)(CDG-Ia). However, it has never been observed in the homozygous state. Homozygosity for this mutation is probably incompatible with life. In this study, we determined the frequency of R141H in two normal populations: in neonates of Dutch origin 1/79 were carriers, whilst in the Danish population, a carrier frequency of 1/60 was found. These figures are clearly in disequilibrium with the frequency of CDG-Ia that has been estimated at 1/80 000 to 1/40 000 in these populations. Haplotype analysis of 43 patients with the R141H mutation of different geographic origins indicated that the R141H is an old mutation in the Caucasian population. Based on the new data, the disease frequency has been calculated at 1/20 000 in these populations. It is concluded that the disease is probably underdiagnosed. European Journal of Human Genetics (2000) 8, 367–371. Keywords: N-glycosylation; carrier frequency; heterozygote advantage; phosphomannomutase; foetal wastage; recessive mutation Introduction mutations that retain residual enzymatic activity are tol- Congenital disorders of glycosylation type Ia (CDG-Ia, for- erated in patients.
    [Show full text]
  • Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays
    Supplemental Table S1. Primers for SYBRGreen quantitative RT-PCR assays. Gene Accession Primer Sequence Length Start Stop Tm GC% GAPDH NM_002046.3 GAPDH F TCCTGTTCGACAGTCAGCCGCA 22 39 60 60.43 59.09 GAPDH R GCGCCCAATACGACCAAATCCGT 23 150 128 60.12 56.52 Exon junction 131/132 (reverse primer) on template NM_002046.3 DNAH6 NM_001370.1 DNAH6 F GGGCCTGGTGCTGCTTTGATGA 22 4690 4711 59.66 59.09% DNAH6 R TAGAGAGCTTTGCCGCTTTGGCG 23 4797 4775 60.06 56.52% Exon junction 4790/4791 (reverse primer) on template NM_001370.1 DNAH7 NM_018897.2 DNAH7 F TGCTGCATGAGCGGGCGATTA 21 9973 9993 59.25 57.14% DNAH7 R AGGAAGCCATGTACAAAGGTTGGCA 25 10073 10049 58.85 48.00% Exon junction 9989/9990 (forward primer) on template NM_018897.2 DNAI1 NM_012144.2 DNAI1 F AACAGATGTGCCTGCAGCTGGG 22 673 694 59.67 59.09 DNAI1 R TCTCGATCCCGGACAGGGTTGT 22 822 801 59.07 59.09 Exon junction 814/815 (reverse primer) on template NM_012144.2 RPGRIP1L NM_015272.2 RPGRIP1L F TCCCAAGGTTTCACAAGAAGGCAGT 25 3118 3142 58.5 48.00% RPGRIP1L R TGCCAAGCTTTGTTCTGCAAGCTGA 25 3238 3214 60.06 48.00% Exon junction 3124/3125 (forward primer) on template NM_015272.2 Supplemental Table S2. Transcripts that differentiate IPF/UIP from controls at 5%FDR Fold- p-value Change Transcript Gene p-value p-value p-value (IPF/UIP (IPF/UIP Cluster ID RefSeq Symbol gene_assignment (Age) (Gender) (Smoking) vs. C) vs. C) NM_001178008 // CBS // cystathionine-beta- 8070632 NM_001178008 CBS synthase // 21q22.3 // 875 /// NM_0000 0.456642 0.314761 0.418564 4.83E-36 -2.23 NM_003013 // SFRP2 // secreted frizzled- 8103254 NM_003013
    [Show full text]
  • Downloaded from the App Store and Nucleobase, Nucleotide and Nucleic Acid Metabolism 7 Google Play
    Hoytema van Konijnenburg et al. Orphanet J Rare Dis (2021) 16:170 https://doi.org/10.1186/s13023-021-01727-2 REVIEW Open Access Treatable inherited metabolic disorders causing intellectual disability: 2021 review and digital app Eva M. M. Hoytema van Konijnenburg1†, Saskia B. Wortmann2,3,4†, Marina J. Koelewijn2, Laura A. Tseng1,4, Roderick Houben6, Sylvia Stöckler‑Ipsiroglu5, Carlos R. Ferreira7 and Clara D. M. van Karnebeek1,2,4,8* Abstract Background: The Treatable ID App was created in 2012 as digital tool to improve early recognition and intervention for treatable inherited metabolic disorders (IMDs) presenting with global developmental delay and intellectual disabil‑ ity (collectively ‘treatable IDs’). Our aim is to update the 2012 review on treatable IDs and App to capture the advances made in the identifcation of new IMDs along with increased pathophysiological insights catalyzing therapeutic development and implementation. Methods: Two independent reviewers queried PubMed, OMIM and Orphanet databases to reassess all previously included disorders and therapies and to identify all reports on Treatable IDs published between 2012 and 2021. These were included if listed in the International Classifcation of IMDs (ICIMD) and presenting with ID as a major feature, and if published evidence for a therapeutic intervention improving ID primary and/or secondary outcomes is avail‑ able. Data on clinical symptoms, diagnostic testing, treatment strategies, efects on outcomes, and evidence levels were extracted and evaluated by the reviewers and external experts. The generated knowledge was translated into a diagnostic algorithm and updated version of the App with novel features. Results: Our review identifed 116 treatable IDs (139 genes), of which 44 newly identifed, belonging to 17 ICIMD categories.
    [Show full text]
  • Pseudouridylation Defect Due to DKC1 and NOP10 Mutations Causes Nephrotic Syndrome with Cataracts, Hearing Impairment, and Enterocolitis
    Pseudouridylation defect due to DKC1 and NOP10 mutations causes nephrotic syndrome with cataracts, hearing impairment, and enterocolitis Eszter Balogha,b,1, Jennifer C. Chandlerc,1, Máté Vargaa,d,1,2, Mona Tahounc,e,1, Dóra K. Menyhárdf,g, Gusztáv Schaya,h, Tomas Goncalvesi, Renáta Hamard, Regina Légrádia,b, Ákos Szekeresb, Olivier Gribouvalj, Robert Kletak,l, Horia Stanescuk,l, Detlef Bockenhauerk, Andrea Kertia,b, Hywel Williamsm, Veronica Kinslern, Wei-Li Dio, David Curtisp, Maria Kolatsi-Joannouc, Hafsa Hammidc, Anna Szocs} q, Kristóf Perczela,b, Erika Makar, Gergely Toldib, Florentina Savaa, Christelle Arrondelj, Magdolna Kardoss, Attila Finthas, Ahmed Hossaint, Felipe D’Arcou, Mario Kaliakatsosv, Jutta Koeglmeierw, William Mifsudx, Mariya Moosajeey, Ana Faroz, Eszter Jávorszkya,b, Gábor Rudasq, Marwa H. Saiede, Salah Marzouke, Kata Kelenb, Judit Götzeb, George Reuszb, Tivadar Tulassayb, François Dragont,aa, Géraldine Molletj, Susanne Motamenybb, Holger Thielebb,cc, Guillaume Dorvalj, Peter Nürnbergbb,cc, András Perczelf,g, Attila J. Szabób,dd, David A. Longc, Kazunori Tomitai,ee, Corinne Antignacj,ff, Aoife M. Watersc,3,2, and Kálmán Torya,b,3,2 aMTA-SE Lendület Nephrogenetic Laboratory, Semmelweis University, HU 1083 Budapest, Hungary; bFirst Department of Pediatrics, Semmelweis University, HU 1083 Budapest, Hungary; cDevelopmental Biology and Cancer Programme, University College London Great Ormond Street Institute of Child Health, WC1N 1EH London, United Kingdom; dDepartment of Genetics, Eötvös Loránd University, HU 1117 Budapest,
    [Show full text]
  • Diseases Catalogue
    Diseases catalogue AA Disorders of amino acid metabolism OMIM Group of disorders affecting genes that codify proteins involved in the catabolism of amino acids or in the functional maintenance of the different coenzymes. AA Alkaptonuria: homogentisate dioxygenase deficiency 203500 AA Phenylketonuria: phenylalanine hydroxylase (PAH) 261600 AA Defects of tetrahydrobiopterine (BH 4) metabolism: AA 6-Piruvoyl-tetrahydropterin synthase deficiency (PTS) 261640 AA Dihydropteridine reductase deficiency (DHPR) 261630 AA Pterin-carbinolamine dehydratase 126090 AA GTP cyclohydrolase I deficiency (GCH1) (autosomal recessive) 233910 AA GTP cyclohydrolase I deficiency (GCH1) (autosomal dominant): Segawa syndrome 600225 AA Sepiapterin reductase deficiency (SPR) 182125 AA Defects of sulfur amino acid metabolism: AA N(5,10)-methylene-tetrahydrofolate reductase deficiency (MTHFR) 236250 AA Homocystinuria due to cystathionine beta-synthase deficiency (CBS) 236200 AA Methionine adenosyltransferase deficiency 250850 AA Methionine synthase deficiency (MTR, cblG) 250940 AA Methionine synthase reductase deficiency; (MTRR, CblE) 236270 AA Sulfite oxidase deficiency 272300 AA Molybdenum cofactor deficiency: combined deficiency of sulfite oxidase and xanthine oxidase 252150 AA S-adenosylhomocysteine hydrolase deficiency 180960 AA Cystathioninuria 219500 AA Hyperhomocysteinemia 603174 AA Defects of gamma-glutathione cycle: glutathione synthetase deficiency (5-oxo-prolinuria) 266130 AA Defects of histidine metabolism: Histidinemia 235800 AA Defects of lysine and
    [Show full text]
  • Successes and Challenges in Functional Assignment in a Superfamily of Phosphatases
    99 Experimental Standard Conditions of Enzyme Characterization Beilstein-Institut September 12th –16th, 2011, Ru¨desheim/Rhein, Germany Successes and Challenges in Functional Assignment in a Superfamily of Phosphatases Karen N. Allen1,* and Debra Dunaway-Mariano2,# 1Department of Chemistry, Boston University, 590 Commonwealth Avenue, Boston, MA 02215 – 2521, U.S.A. 2Department of Chemistry and Chemical Biology, University of New Mexico, Albuquerque, NM, 87131, U.S.A. E-Mail: *[email protected] and #[email protected] Received: 17th September 2012/Published: 15th February 2013 Abstract The explosion of protein sequence information from genome sequen- cing efforts requires that current experimental strategies for function assignment must evolve into computationally-based function predic- tion. This necessitates the development of new strategies based, in part, on the identification of sequence markers, including residues that sup- port structure and specificity as well as a more informed definition of orthologues. We have undertaken the function assignment of unknown members of the haloalkanoate dehalogenase superfamily using an in- tegrated bioinformatics/structure/mechanism approach. Notably, a number of members show ‘‘substrate blurring’’, with activity toward a number of substrates and significant substrate overlap between para- logues. Other family members have been honed to a specific substrate with high catalytic efficiency and proficiency. Our findings highlight the use of the cap domain structure and enzyme conformational dy- namics in delineating specificity. http://www.beilstein-institut.de/escec2011/Proceedings/Allen/Allen.pdf 100 Allen, K.N. and Dunaway-Mariano, D. The Haloalkanoate Dehalogenase Superfamily (HADSF) The ‘‘central dogma’’ of protein structure/function studies is that protein sequence dictates protein structure which, in turn defines protein function.
    [Show full text]