DOCSLIB.ORG

University of Oklahoma Graduate College

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
University of Oklahoma Graduate College UNIVERSITY OF OKLAHOMA GRADUATE COLLEGE SEQUENCE AND ANALYSIS OF THE PHYMATOTRICHOPSIS OMNIVORA GENOME AND EXPRESSED SEQUENCE TAGS A DISSERTATION SUBMITTED TO THE GRADUATE FACULTY in partial fulfillment of the requirements for the Degree of DOCTOR OF PHILOSOPHY BY SIMONE MACMIL Norman, Oklahoma 2009 SEQUENCE AND ANALYSIS OF PHYMATOTRICHOPSIS OMNIVORA GENOME AND EXPRESSED SEQUENCE TAGS A DISSERTATION APPROVED FOR THE DEPARTMENT OF CHEMISTRY AND BIOCHEMISTRY By Dr. Bruce A. Roe, Chair Dr. Paul F. Cook Dr. Ann H. West Dr. Kathleen E. Duncan Dr. Charles V. Rice ©Copyright by SIMONE LYNETTE MACMIL 2009 All Rights Reserved. Acknowledgements I wish to express my sincere gratitude to my major advisor Dr. Bruce Roe for accepting me to his lab at the brink of his retirement, giving me the opportunity to work on this challenging yet rewarding project and for cheering me on through the many roadblocks and bumps that I encountered during the course of this study. His scientific accomplishments and discussions have always inspired me and have spurred me to reach higher in my goals and delve deeper in my understanding and it would be impossible to complete this project sans his patience, guidance and encouragement. I am extremely grateful to my advisory committee, Dr. Paul Cook, Dr. Kathleen Duncan, and Dr. Charles Rice for their advice, encouragement and participation in my research and dissertation. I would specially like to thank Dr. Ann West for chairing my committee during my candidacy exam and for her willingness to be present on my doctoral defense committee as well. My special thanks also goes to Dr. Carolyn Young at the Noble Foundation for providing us with chromosomal bands, informative discussions and giving me the opportunity to learn at her lab. I am extremely grateful to Steve Kenton and Dr. Fares Najar for imparting to me some of their bioinformatic skills and for their assistance with the assembly and annotation. I would also like to extend my appreciation to all the members of Dr. Roe’s lab; Graham Wiley, Doug White, Jim White, Yanbo Xing, Chunmei Qu, Ping Wang, Baifang Qin, Keqin Wang, Liping Zhou who worked together with me in processing pyrosequencing experiments on the 454 Genome Sequencer; Jiaxi Quan, Jing Yi, Ruihua Shi, Shaoping Lin, Fu iv Ying, Axin Hua, Ziyun Yao, Limei Yang, Hongshing Lai, Dixie Wishnuck, Jennifer Lewis, Mounir Elharam and the many lab members who have now moved on for collectively making my experience at the lab memorable. I wish to thank my brothers Llewellyn, Lyon, Warren, my friend Sini and my sister Sharon and her family for their love and support. I dedicate this dissertation to my mum Patricia Rowe and dad Albert Macmil for having faith in my abilities and instilling in me a love for learning. Above all, I am eternally grateful to my heavenly Father, who daily loads me with His goodness, mercies and grace. v Table of Contents List of Tables xii List of Figures xiii Abstract xvi Chapter1 Introduction 1 1.1 Fungi and their role in agriculture 1 1.1.1 Introduction to Fungi 1 1.2 Phymatotrichopsis omnivora – the “cotton root rot fungus” 3 1.2.1 Life cycle of Phymatotrichopsis omnivora 4 1.2.2 Habitat of Phymatotrichopsis omnivora 6 1.3 Fungal Genomics 7 1.3.1 Fungal genomes used in this study 8 1.4 The discovery of nucleic acids and elucidation of the Central Dogma 10 1.5 Fungal Expressed Sequence Tags 13 1.6 DNA Sequencing Strategies 16 1.7 Bioinformatic Tools 19 1.7.1 BLAST 19 1.7.2 FgenesH 21 1.7.3 tRNA scan-SE 21 v i 1.7.4 Databases 22 Chapter2 Material and Methods 25 2.1 Construction of Shotgun Library for Sanger Sequencing and Paired-end Pyrosequencing 25 2.1.1 Fragmentation of Genomic DNA for both Sanger and Paired-end Pyrosequencing 26 2.2 Sanger Sequencing 26 2.2.1 End Repair and Size Selection for Sanger sequencing 26 2.2.2 Ligation of DNA fragements with pUC 18 27 2.2.3 Transformation 28 2.2.4 Automatic Isolation of Subclone DNA 29 2.2.5 Reaction and Clean Up 30 2.2.6 Sequencing on the ABI 3730 31 2.3 Pyrosequencing on the 454 31 2.3.1 DNA fragmentation, SPRI bead purification and size selection 33 2.3.2 Methylation of the EcoRI site, shearing and blunt-ending 34 2.3.3 Hairpin adaptor ligation, exonuclease and EcoR1 digestion 35 2.3.4 DNA circularization, DNA Nebulization and Concentration 36 2.3.5 Adaptor Ligation and Quantitation 37 2.4 Emulsion PCR 38 vi i 2.4.1 Bead recovery, enrichment and sequencing primer annealing 39 2.4.2 Loading the PicoTiterPlate for Sequencing 40 2.4.3 Sequencing and signal processing on the 454 Genome Sequencer. 41 2.5 Assembling the massively parallel pyrosequencing data for cDNA and genomic DNA 42 2.6 Isolation of Individual P. omnivora Chromosomes 43 2.7 Analysis of cDNAs 44 2.7.1 Biological function assignments 44 2.7.2 Determining EST abundance in each library 45 2.8 Analysis of the P. omnivora genome 46 2.8.1 Gene prediction and annotation 46 2.8.2 Comparison of P. omnivora predicted proteins with that of other fungi 47 Chapter3 Results and Discussion 48 3.1 Sequencing and analyzing the ESTs from three different life stages of P. omnivora and after exposure to different environmental conditions. 48 3.1.1.1 Assembly of ESTs 49 3.1.1.2 The possible role of Tar 1p ESTs in P. omnivora cDNA libraries 52 3.1.2 EST Sequencing of mycelia grown on M1078 medium 53 3.1.3 EST Sequencing of Sclerotia 57 3.1.4 EST Sequencing of Conidial Spore mat 61 vii i 3.1.5 EST Sequencing of Carbon and Nitrogen Starved mycelia 65 3.1.6 EST Sequencing of mycelia exposed to host root exudates 68 3.1.7 EST Sequencing of mycelia exposed to non-host root exudates 71 3.2 Comparative analysis of P. omnivora EST libraries 75 3.2.1 Comparison of metabolic profile of ESTs derived from different life stages and environments 75 3.2.2 Does oxidative stress trigger metamorphosis in P. omnivora? 80 3.3 The P. omnivora genome and assembly 82 3.3.1 Sequencing individual P. omnivora chromosomes 83 3.4 Predicted protein profile of P. omnivora 86 3.4.1 Analysis of P. omnivora predicted proteins 88 3.4.1.1 Comparison of P. omnivora predicted proteins with that of other fungi 88 3.4.1.2 Metabolism in P. omnivora 90 3.4.1.2.1 Glycolysis, the pentose phosphate pathway and gluconeogenesis. 90 3.4.1.2.2 Tricarboxylic Acid (TCA) cycle and the glyoxylate shunt 94 3.4.1.2.3 Fructose, mannose and Galactose metabolism 95 3.4.1.2.4 Oxidative phosphorylation 96 3.4.1.2.5 Lipid metabolism 97 3.4.1.2.6 Amino acid biosynthesis 99 3.4.1.2.7 Nucleotide biosynthesis 106 ix 3.4.1.2.8 Storage polysaccharides 108 3.4.1.3 Analysis of predicted transporters in the P. omnivora genome 109 3.4.1.4 Putative pathogenesis genes of P. omnivora 111 Chapter4 Conclusions 115 References 121 Appendix Table 1. Putative identification and classification of EST’s from the vegetative mycelia based on blast homology searches in KEGG, COG and COGEME databases. 138 Table 2. Putative identification and classification of EST’s from sclerotia based on blast homology searches in KEGG, COG and COGEME databases. 158 Table 3.Putative identification and classification of EST’s from spore mats based on blast homology searches in KEGG, COG and COGEME databases. 169 Table 4. Putative identification and classification of EST’s from the carbon, nitrogen starved mycelia based on blast homology searches in KEGG, COG and COGEME databases. 180 Table 5.Putative identification and classification of EST’s from the mycelia exposed to host root exudate based on blast homology searches in KEGG, COG and COGEME databases 185 Table 6. Putative identification and classification of EST’s from the mycelia exposed to non-host root exudate based on blast homology searches in KEGG, COG x and COGEME databases 193 x i List of Tables Table 1. Plant diseases caused by filamentous fungi. 3 Table 2. List of selected completed and draft fungal genomes 8 Table 3. Assembly statistics of P. omnivora cDNA libraries by Newbler 49 Table 4. Description of top 20 most highly expressed transcripts in vegetative mycelia with homology in GenBank 56 Table 5. Description of top 20 most highly expressed transcripts in sclerotia with homology in GenBank 59 Table 6. Description of top 20 most highly expressed transcripts in spore mats with homology in GenBank. 63 Table 7. Description of top 20 most highly expressed transcripts in carbon/nitrogen starved mycelia with homology in GenBank 67 Table 8. Description of top 20 most highly expressed transcripts in mycelia exposed to host root exudate with homology in GenBank 70 Table 9. Description of top 20 most highly expressed transcripts in mycelia exposed to non-host root exudate with homology in GenBank 73 Table 10. P. omnivora whole genome shotgun sequencing and assembly statistics 83 Table 11. Preliminary sequencing results of P. omnivora amplified chromosomes 86 xi i List of Figures Figure 1. Life cycle of P. ominvora as it passes through the vegative, sclerotial and conidial stages. 5 Figure 2. Reported distribution of Phymatotrichopsis omnivora in North America. Adapted from map by Streets and Bloss (1973). 6 Figure 3: The structure of DNA (Watson and Crick, 1953) 13 Figure 4.
Load more

Recommended publications
  • Annual Report DDUV 2009
    Research at the de Duve Institute and Brussels Branch of the Ludwig Institute for Cancer Research August 2009 de Duve Institute Introduction 5 Miikka Vikkula 12 Frédéric Lemaigre 20 Annabelle Decottignies and Charles de Smet 25 Emile Vanschaftingen 31 Françoise Bontemps 37 Jean-François Collet 42 Guido Bommer 47 Mark Rider 50 Fred Opperdoes 56 Pierre Courtoy 62 Etienne Marbaix 69 Jean-Baptiste Demoulin 75 Jean-Paul Coutelier 80 Thomas Michiels 84 Pierre Coulie 89 LICR Introduction 95 Benoît Van den Eynde 98 Pierre van der Bruggen 106 Nicolas Van Baren 114 Jean-Christophe Renauld 119 Stefan Constantinescu 125 The de Duve Institute 5 THE DE DUVE INSTITUTE: AN INTERNATIONAL BIOMEDICAL RESEARCH INSTITUTE In 1974, when Christian de Duve founded the Institute of Cellular Pathology (ICP), now rena- med the de Duve Institute, he was acutely aware of the constrast between the enormous progress in biological sciences that had occurred in the 20 preceding years and the modesty of the medical advances that had followed. He therefore crea- ted a research institution based on the principle that basic research in biology would be pursued by the investigators with complete freedom, but that special attention would be paid to the exploi- tation of basic advances for medical progress. It was therefore highly appropriate for the Institute to be located on the campus of the Faculty of Emile Van Schaftingen Medicine of the University of Louvain (UCL). This campus is located in Brussels. The Univer- sity hospital (Clinique St Luc) is located within walking distance of the Institute. The main commitment of the members of the de Duve Institute is research.
    [Show full text]
  • Articles Catalytic Cycling in Β-Phosphoglucomutase: a Kinetic
    9404 Biochemistry 2005, 44, 9404-9416 Articles Catalytic Cycling in â-Phosphoglucomutase: A Kinetic and Structural Analysis†,‡ Guofeng Zhang, Jianying Dai, Liangbing Wang, and Debra Dunaway-Mariano* Department of Chemistry, UniVersity of New Mexico, Albuquerque, New Mexico 87131-0001 Lee W. Tremblay and Karen N. Allen* Department of Physiology and Biophysics, Boston UniVersity School of Medicine, Boston, Massachusetts 02118-2394 ReceiVed March 26, 2005; ReVised Manuscript ReceiVed May 18, 2005 ABSTRACT: Lactococcus lactis â-phosphoglucomutase (â-PGM) catalyzes the interconversion of â-D-glucose 1-phosphate (â-G1P) and â-D-glucose 6-phosphate (G6P), forming â-D-glucose 1,6-(bis)phosphate (â- G16P) as an intermediate. â-PGM conserves the core domain catalytic scaffold of the phosphatase branch of the HAD (haloalkanoic acid dehalogenase) enzyme superfamily, yet it has evolved to function as a mutase rather than as a phosphatase. This work was carried out to identify the structural basis underlying this diversification of function. In this paper, we examine â-PGM activation by the Mg2+ cofactor, â-PGM activation by Asp8 phosphorylation, and the role of cap domain closure in substrate discrimination. First, the 1.90 Å resolution X-ray crystal structure of the Mg2+-â-PGM complex is examined in the context of + + previously reported structures of the Mg2 -R-D-galactose-1-phosphate-â-PGM, Mg2 -phospho-â-PGM, and Mg2+-â-glucose-6-phosphate-1-phosphorane-â-PGM complexes to identify conformational changes that occur during catalytic turnover. The essential role of Asp8 in nucleophilic catalysis was confirmed by demonstrating that the D8A and D8E mutants are devoid of catalytic activity.
    [Show full text]
  • Precursor of Ether Phospholipids Is Synthesized by a Flavoenzyme
    Precursor of ether phospholipids is synthesized by a flavoenzyme through covalent catalysis Simone Nencia, Valentina Pianoa, Sara Rosatib, Alessandro Alivertic, Vittorio Pandinic, Marco W. Fraaijed, Albert J. R. Heckb, Dale E. Edmondsone, and Andrea Mattevia,1 aDepartment of Biology and Biotechnology, University of Pavia, 27100 Pavia, Italy; bBiomolecular Mass Spectrometry and Proteomics Group, Bijvoet Center for Biomolecular Research and Utrecht Institute for Pharmaceutical Sciences, Utrecht University and Netherlands Proteomics Centre, 3584 CH Utrecht, The Netherlands; cDepartment of Biosciences, University of Milan, 20133 Milan, Italy; dMolecular Enzymology Group, University of Groningen, 9747 AG Groningen, The Netherlands; and eDepartment of Biochemistry, Emory University, Atlanta, GA 30322 Edited by Emil F. Pai, Ontario Cancer Institute/Princess Margaret Hospital, Toronto, ON, Canada, and accepted by the Editorial Board October 5, 2012 (received for review August 31, 2012) The precursor of the essential ether phospholipids is synthesized ADPS enzymes, whereas type 1 arises from mutations in PEX7, by a peroxisomal enzyme that uses a flavin cofactor to catalyze the protein mediating the peroxisomal import of ADPS (9–12). a reaction that does not alter the redox state of the substrates. Here we report a structural and mechanistic investigation of The enzyme crystal structure reveals a V-shaped active site with mammalian ADPS in WT and mutated forms. The biochemical a narrow constriction in front of the prosthetic group. Mutations hallmark of the enzyme is that it uses a redox cofactor, flavin causing inborn ether phospholipid deficiency, a very severe adenine dinucleotide (FAD), to catalyze a reaction that does not genetic disease, target residues that are part of the catalytic alter the redox state of the substrates (10, 13).
    [Show full text]
  • Fungal Planet Description Sheets: 716–784 By: P.W
    Fungal Planet description sheets: 716–784 By: P.W. Crous, M.J. Wingfield, T.I. Burgess, G.E.St.J. Hardy, J. Gené, J. Guarro, I.G. Baseia, D. García, L.F.P. Gusmão, C.M. Souza-Motta, R. Thangavel, S. Adamčík, A. Barili, C.W. Barnes, J.D.P. Bezerra, J.J. Bordallo, J.F. Cano-Lira, R.J.V. de Oliveira, E. Ercole, V. Hubka, I. Iturrieta-González, A. Kubátová, M.P. Martín, P.-A. Moreau, A. Morte, M.E. Ordoñez, A. Rodríguez, A.M. Stchigel, A. Vizzini, J. Abdollahzadeh, V.P. Abreu, K. Adamčíková, G.M.R. Albuquerque, A.V. Alexandrova, E. Álvarez Duarte, C. Armstrong-Cho, S. Banniza, R.N. Barbosa, J.-M. Bellanger, J.L. Bezerra, T.S. Cabral, M. Caboň, E. Caicedo, T. Cantillo, A.J. Carnegie, L.T. Carmo, R.F. Castañeda-Ruiz, C.R. Clement, A. Čmoková, L.B. Conceição, R.H.S.F. Cruz, U. Damm, B.D.B. da Silva, G.A. da Silva, R.M.F. da Silva, A.L.C.M. de A. Santiago, L.F. de Oliveira, C.A.F. de Souza, F. Déniel, B. Dima, G. Dong, J. Edwards, C.R. Félix, J. Fournier, T.B. Gibertoni, K. Hosaka, T. Iturriaga, M. Jadan, J.-L. Jany, Ž. Jurjević, M. Kolařík, I. Kušan, M.F. Landell, T.R. Leite Cordeiro, D.X. Lima, M. Loizides, S. Luo, A.R. Machado, H. Madrid, O.M.C. Magalhães, P. Marinho, N. Matočec, A. Mešić, A.N. Miller, O.V. Morozova, R.P. Neves, K. Nonaka, A. Nováková, N.H.
    [Show full text]
  • 2010 Physical Biosciences Research Meeting
    2010 Physical Biosciences Research Meeting Sheraton Inner Harbor Hotel Baltimore, MD October 17-20, 2010 Office of Basic Energy Sciences Chemical Sciences, Geosciences & Biosciences Division 2010 Physical Biosciences Research Meeting Program and Abstracts Sheraton Inner Harbor Hotel Baltimore, MD October 17-20, 2010 Chemical Sciences, Geosciences, and Biosciences Division Office of Basic Energy Sciences Office of Science U.S. Department of Energy i Cover art is taken from the public domain and can be found at: http://commons.wikimedia.org/wiki/File:Blue_crab_on_market_in_Piraeus_-_Callinectes_sapidus_Rathbun_20020819- 317.jpg This document was produced under contract number DE-AC05-060R23100 between the U.S. Department of Energy and Oak Ridge Associated Universities. The research grants and contracts described in this document are, unless specifically labeled otherwise, supported by the U.S. DOE Office of Science, Office of Basic Energy Sciences, Chemical Sciences, Geosciences, and Biosciences Division. ii Foreword This volume provides a record of the 2nd biennial meeting of the Principal Investigators (PIs) funded by the Physical Biosciences program, and is sponsored by the Chemical Sciences, Geosciences, and Biosciences Division of the Office of Basic Energy Sciences (BES) in the U.S. Department of Energy (DOE). Within DOE-BES there are two programs that fund basic research in energy-relevant biological sciences, Physical Biosciences and Photosynthetic Systems. These two Biosciences programs, along with a strong program in Solar Photochemistry, comprise the current Photo- and Bio- Chemistry Team. This meeting specifically brings together under one roof all of the PIs funded by the Physical Biosciences program, along with Program Managers and staff not only from DOE-BES, but also other offices within DOE, the national labs, and even other federal funding agencies.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Transcriptomic and Proteomic Profiling Provides Insight Into
    BASIC RESEARCH www.jasn.org Transcriptomic and Proteomic Profiling Provides Insight into Mesangial Cell Function in IgA Nephropathy † † ‡ Peidi Liu,* Emelie Lassén,* Viji Nair, Celine C. Berthier, Miyuki Suguro, Carina Sihlbom,§ † | † Matthias Kretzler, Christer Betsholtz, ¶ Börje Haraldsson,* Wenjun Ju, Kerstin Ebefors,* and Jenny Nyström* *Department of Physiology, Institute of Neuroscience and Physiology, §Proteomics Core Facility at University of Gothenburg, University of Gothenburg, Gothenburg, Sweden; †Division of Nephrology, Department of Internal Medicine and Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, Michigan; ‡Division of Molecular Medicine, Aichi Cancer Center Research Institute, Nagoya, Japan; |Department of Immunology, Genetics and Pathology, Uppsala University, Uppsala, Sweden; and ¶Integrated Cardio Metabolic Centre, Karolinska Institutet Novum, Huddinge, Sweden ABSTRACT IgA nephropathy (IgAN), the most common GN worldwide, is characterized by circulating galactose-deficient IgA (gd-IgA) that forms immune complexes. The immune complexes are deposited in the glomerular mesangium, leading to inflammation and loss of renal function, but the complete pathophysiology of the disease is not understood. Using an integrated global transcriptomic and proteomic profiling approach, we investigated the role of the mesangium in the onset and progression of IgAN. Global gene expression was investigated by microarray analysis of the glomerular compartment of renal biopsy specimens from patients with IgAN (n=19) and controls (n=22). Using curated glomerular cell type–specific genes from the published literature, we found differential expression of a much higher percentage of mesangial cell–positive standard genes than podocyte-positive standard genes in IgAN. Principal coordinate analysis of expression data revealed clear separation of patient and control samples on the basis of mesangial but not podocyte cell–positive standard genes.
    [Show full text]
  • Downloaded from by IP: 199.133.24.106 On: Mon, 18 Sep 2017 10:43:32 Spatafora Et Al
    UC Riverside UC Riverside Previously Published Works Title The Fungal Tree of Life: from Molecular Systematics to Genome-Scale Phylogenies. Permalink https://escholarship.org/uc/item/4485m01m Journal Microbiology spectrum, 5(5) ISSN 2165-0497 Authors Spatafora, Joseph W Aime, M Catherine Grigoriev, Igor V et al. Publication Date 2017-09-01 DOI 10.1128/microbiolspec.funk-0053-2016 License https://creativecommons.org/licenses/by-nc-nd/4.0/ 4.0 Peer reviewed eScholarship.org Powered by the California Digital Library University of California The Fungal Tree of Life: from Molecular Systematics to Genome-Scale Phylogenies JOSEPH W. SPATAFORA,1 M. CATHERINE AIME,2 IGOR V. GRIGORIEV,3 FRANCIS MARTIN,4 JASON E. STAJICH,5 and MEREDITH BLACKWELL6 1Department of Botany and Plant Pathology, Oregon State University, Corvallis, OR 97331; 2Department of Botany and Plant Pathology, Purdue University, West Lafayette, IN 47907; 3U.S. Department of Energy Joint Genome Institute, Walnut Creek, CA 94598; 4Institut National de la Recherche Agronomique, Unité Mixte de Recherche 1136 Interactions Arbres/Microorganismes, Laboratoire d’Excellence Recherches Avancés sur la Biologie de l’Arbre et les Ecosystèmes Forestiers (ARBRE), Centre INRA-Lorraine, 54280 Champenoux, France; 5Department of Plant Pathology and Microbiology and Institute for Integrative Genome Biology, University of California–Riverside, Riverside, CA 92521; 6Department of Biological Sciences, Louisiana State University, Baton Rouge, LA 70803 and Department of Biological Sciences, University of South Carolina, Columbia, SC 29208 ABSTRACT The kingdom Fungi is one of the more diverse INTRODUCTION clades of eukaryotes in terrestrial ecosystems, where they In 1996 the genome of Saccharomyces cerevisiae was provide numerous ecological services ranging from published and marked the beginning of a new era in decomposition of organic matter and nutrient cycling to beneficial and antagonistic associations with plants and fungal biology (1).
    [Show full text]
  • A Higher-Level Phylogenetic Classification of the Fungi
    mycological research 111 (2007) 509–547 available at www.sciencedirect.com journal homepage: www.elsevier.com/locate/mycres A higher-level phylogenetic classification of the Fungi David S. HIBBETTa,*, Manfred BINDERa, Joseph F. BISCHOFFb, Meredith BLACKWELLc, Paul F. CANNONd, Ove E. ERIKSSONe, Sabine HUHNDORFf, Timothy JAMESg, Paul M. KIRKd, Robert LU¨ CKINGf, H. THORSTEN LUMBSCHf, Franc¸ois LUTZONIg, P. Brandon MATHENYa, David J. MCLAUGHLINh, Martha J. POWELLi, Scott REDHEAD j, Conrad L. SCHOCHk, Joseph W. SPATAFORAk, Joost A. STALPERSl, Rytas VILGALYSg, M. Catherine AIMEm, Andre´ APTROOTn, Robert BAUERo, Dominik BEGEROWp, Gerald L. BENNYq, Lisa A. CASTLEBURYm, Pedro W. CROUSl, Yu-Cheng DAIr, Walter GAMSl, David M. GEISERs, Gareth W. GRIFFITHt,Ce´cile GUEIDANg, David L. HAWKSWORTHu, Geir HESTMARKv, Kentaro HOSAKAw, Richard A. HUMBERx, Kevin D. HYDEy, Joseph E. IRONSIDEt, Urmas KO˜ LJALGz, Cletus P. KURTZMANaa, Karl-Henrik LARSSONab, Robert LICHTWARDTac, Joyce LONGCOREad, Jolanta MIA˛ DLIKOWSKAg, Andrew MILLERae, Jean-Marc MONCALVOaf, Sharon MOZLEY-STANDRIDGEag, Franz OBERWINKLERo, Erast PARMASTOah, Vale´rie REEBg, Jack D. ROGERSai, Claude ROUXaj, Leif RYVARDENak, Jose´ Paulo SAMPAIOal, Arthur SCHU¨ ßLERam, Junta SUGIYAMAan, R. Greg THORNao, Leif TIBELLap, Wendy A. UNTEREINERaq, Christopher WALKERar, Zheng WANGa, Alex WEIRas, Michael WEISSo, Merlin M. WHITEat, Katarina WINKAe, Yi-Jian YAOau, Ning ZHANGav aBiology Department, Clark University, Worcester, MA 01610, USA bNational Library of Medicine, National Center for Biotechnology Information,
    [Show full text]
  • The Analysis of Variants in the General Population Reveals That PMM2 Is Extremely Tolerant to Missense Mutations and That Diagno
    International Journal of Molecular Sciences Article The Analysis of Variants in the General Population Reveals That PMM2 Is Extremely Tolerant to Missense Mutations and That Diagnosis of PMM2-CDG Can Benefit from the Identification of Modifiers Valentina Citro 1, Chiara Cimmaruta 1, Maria Monticelli 1, Guglielmo Riccio 1, Bruno Hay Mele 1,2, Maria Vittoria Cubellis 1,* ID and Giuseppina Andreotti 3 ID 1 Dipartimento di Biologia, Università Federico II, 80126 Napoli, Italy; [email protected] (V.C.); [email protected] (C.C.); [email protected] (M.M.); [email protected] (G.R.); [email protected] (B.H.M.) 2 Dipartimento di Scienze Agrarie ed Agroalimentari, Università Federico II, 80055 Napoli, Italy 3 Istituto di Chimica Biomolecolare—CNR, 80078 Pozzuoli, Italy; [email protected] * Correspondence: [email protected]; Tel.: +39-081-679118; Fax: +39-081-679233 Received: 30 May 2018; Accepted: 26 July 2018; Published: 30 July 2018 Abstract: Type I disorders of glycosylation (CDG), the most frequent of which is phosphomannomutase 2 (PMM2-CDG), are a group of diseases causing the incomplete N-glycosylation of proteins. PMM2-CDG is an autosomal recessive disease with a large phenotypic spectrum, and is associated with mutations in the PMM2 gene. The biochemical analysis of mutants does not allow a precise genotype–phenotype correlation for PMM2-CDG. PMM2 is very tolerant to missense and loss of function mutations, suggesting that a partial deficiency of activity might be beneficial under certain circumstances. The patient phenotype might be influenced by variants in other genes associated with the type I disorders of glycosylation in the general population.
    [Show full text]
  • Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays
    Supplemental Table S1. Primers for SYBRGreen quantitative RT-PCR assays. Gene Accession Primer Sequence Length Start Stop Tm GC% GAPDH NM_002046.3 GAPDH F TCCTGTTCGACAGTCAGCCGCA 22 39 60 60.43 59.09 GAPDH R GCGCCCAATACGACCAAATCCGT 23 150 128 60.12 56.52 Exon junction 131/132 (reverse primer) on template NM_002046.3 DNAH6 NM_001370.1 DNAH6 F GGGCCTGGTGCTGCTTTGATGA 22 4690 4711 59.66 59.09% DNAH6 R TAGAGAGCTTTGCCGCTTTGGCG 23 4797 4775 60.06 56.52% Exon junction 4790/4791 (reverse primer) on template NM_001370.1 DNAH7 NM_018897.2 DNAH7 F TGCTGCATGAGCGGGCGATTA 21 9973 9993 59.25 57.14% DNAH7 R AGGAAGCCATGTACAAAGGTTGGCA 25 10073 10049 58.85 48.00% Exon junction 9989/9990 (forward primer) on template NM_018897.2 DNAI1 NM_012144.2 DNAI1 F AACAGATGTGCCTGCAGCTGGG 22 673 694 59.67 59.09 DNAI1 R TCTCGATCCCGGACAGGGTTGT 22 822 801 59.07 59.09 Exon junction 814/815 (reverse primer) on template NM_012144.2 RPGRIP1L NM_015272.2 RPGRIP1L F TCCCAAGGTTTCACAAGAAGGCAGT 25 3118 3142 58.5 48.00% RPGRIP1L R TGCCAAGCTTTGTTCTGCAAGCTGA 25 3238 3214 60.06 48.00% Exon junction 3124/3125 (forward primer) on template NM_015272.2 Supplemental Table S2. Transcripts that differentiate IPF/UIP from controls at 5%FDR Fold- p-value Change Transcript Gene p-value p-value p-value (IPF/UIP (IPF/UIP Cluster ID RefSeq Symbol gene_assignment (Age) (Gender) (Smoking) vs. C) vs. C) NM_001178008 // CBS // cystathionine-beta- 8070632 NM_001178008 CBS synthase // 21q22.3 // 875 /// NM_0000 0.456642 0.314761 0.418564 4.83E-36 -2.23 NM_003013 // SFRP2 // secreted frizzled- 8103254 NM_003013
    [Show full text]
  • Morchella Esculenta</Em>
    Journal of Bioresource Management Volume 3 Issue 1 Article 6 In Vitro Propagation of Morchella esculenta and Study of its Life Cycle Nazish Kanwal Institute of Natural and Management Sciences, Rawalpindi, Pakistan Kainaat William Bioresource Research Centre, Islamabad, Pakistan Kishwar Sultana Institute of Natural and Management Sciences, Rawalpindi, Pakistan Follow this and additional works at: https://corescholar.libraries.wright.edu/jbm Part of the Biodiversity Commons, and the Biology Commons Recommended Citation Kanwal, N., William, K., & Sultana, K. (2016). In Vitro Propagation of Morchella esculenta and Study of its Life Cycle, Journal of Bioresource Management, 3 (1). DOI: https://doi.org/10.35691/JBM.6102.0044 ISSN: 2309-3854 online This Article is brought to you for free and open access by CORE Scholar. It has been accepted for inclusion in Journal of Bioresource Management by an authorized editor of CORE Scholar. For more information, please contact [email protected]. In Vitro Propagation of Morchella esculenta and Study of its Life Cycle © Copyrights of all the papers published in Journal of Bioresource Management are with its publisher, Center for Bioresource Research (CBR) Islamabad, Pakistan. This permits anyone to copy, redistribute, remix, transmit and adapt the work for non-commercial purposes provided the original work and source is appropriately cited. Journal of Bioresource Management does not grant you any other rights in relation to this website or the material on this website. In other words, all other rights are reserved. For the avoidance of doubt, you must not adapt, edit, change, transform, publish, republish, distribute, redistribute, broadcast, rebroadcast or show or play in public this website or the material on this website (in any form or media) without appropriately and conspicuously citing the original work and source or Journal of Bioresource Management’s prior written permission.
    [Show full text]