DOCSLIB.ORG

Molecular and Evolutionary Investigation of the Phosphoglucomutase Gene Family

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular and Evolutionary Investigation of the Phosphoglucomutase Gene Family Molecular and evolutionary investigation of the phosphoglucomutase gene family. by Janine Tomkins July 1996 A thesis submitted for the degree of Doctor of Philosophy in the University of London MRC Human Biochemical Genetics Unit, Galton Laboratory, University College London. ProQuest Number: 10106760 All rights reserved INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted. In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion. uest. ProQuest 10106760 Published by ProQuest LLC(2016). Copyright of the Dissertation is held by the Author. All rights reserved. This work is protected against unauthorized copying under Title 17, United States Code. Microform Edition © ProQuest LLC. ProQuest LLC 789 East Eisenhower Parkway P.O. Box 1346 Ann Arbor, Ml 48106-1346 ABSTRACT This thesis describes molecular and evolutionary investigations of the phosphoglucomutase (PGM) gene family. The PGM loci {PGM1, PGM2an6 PGM3) widely expressed in man are thought to be the products of a diverged gene family. Following the cloning of PGM1 in 1992, the primary aim of this project was to investigate approaches for cloning the other members of the gene family. The strategies investigated include the use of anti-PGMI antibodies, low stringency PGR, degenerate primer PGR and searching EST databases. A variety of resources were used, including the human cell line K562. This cell line is devoid of PGM1 activity and the deficiency was found to be associated with a marked reduction in PGM1 mRNA, thereby providing a useful resource. Two novel DNA sequences, hyhbfanô human ESTI have been partially characterized. Hyhbf was identified by degenerate primer PGR of human cDNA. Although it is a member of the PGM gene family, no evidence could be obtained to confirm the sequence was human and it is suspected to be of bacterial origin. The human ESTI sequence, however, represents a widely expressed gene, which shows alternative transcripts and a related sequence. Evidence suggests it is a candidate for PGM2. Evolution of the PGM1 gene was investigated in mammals. Nucleotide analysis of the great apes showed the PGM1*1+ is ancestral since the ape homologues have the same characteristic amino acid substitutions as man. Extensive phylogenetic analysis of prokaryotic and eukaryotic sequences identified through conserved functional protein domains was undertaken. Eight distinct evolutionary pathways were identified, two of which, represented by Mycoplasma pirum PMManb Saccharomyces cerevisiae AGM are thought to reflect the divergent evolution of PGM2 and PGM3. ACKNOWLEDGEMENTS I would first like to thank David for all his advice, encouragement and support throughout my PhD, both in his role as a supervisor and a friend. I would also like to thank Hoppy for his ideas and comments, particuarly regarding the production of this thesis. I would like to thank Jenny Farrington and Margaret Fox for carrying out the cytogenetic analysis of K562, and Owen McMillan for his help and advice on the phylogenetic analysis. I thank Jane Sowden for providing the K562 cell line, Ben Carrit for the ROD primers, Kay Taylor for the primate DNA and Michael Miles for the Typanosome cruzi DNA. I am most grateful to Jenny for all the help and support she has provided during the last four years, and also to other members of the Galton, both past and present, who have provided friendship and inspiration, particularly Helen, Alex, Martine, Jane, Alex and Rod. I would also like to thank those in Newcastle who have been supportive over the last few months. I am very grateful. Finally, I would like to thank Kate, Clare, and my family for their patience and understanding throughout it all. This work was funded by an MRC Research Studentship. ABBREVIATIONS A adenine bp base pairs C cytosine cDNA complementary DNA chr chromosome cps counts per second der derivative DNA deoxyribonucleic acid dNTPs 2' deoxyribonucleotide triphosphate EDTA ethylenediaminetetraacetic acid G guanine GDP guanosine diphosphate hnRNP heterogeneous nuclear ribonucleoprotein particles igG immunoglobulin G IVS intervening sequence kb kilobase mRNA messenger RNA mw molecular weight nt nucleotide CD optical density pi isoelectric point RNase ribonuclease RNA ribonucleic acid rRNA ribosomal RNA T thymine Tris tris(hydroxymethyl)aminomethane UDP uridine diphosphate UV ultraviolet CONTENTS Page Number CHAPTER ONE: INTRODUCTION 18-48 1.1 Evolution of proteins 18-21 1.1.1 Gene families 19-20 1.1.2 Gene sharing 20-21 1.1.3 Convergent evolution 21 1.2 Phosphoglucomutase 21-32 1.2.1 Early studies of PGM 21-22 1.2.2 PGM loci in man 22 - 31 1.2.2.1 Polymorphic and variant alleles of PGM 24 - 28 1.2.2.2 Chromosomal localization of the PGM loci 28 1.2.2.3 Properties of the PGM loci 29 - 31 1.2.3 PGM loci in other species 31 - 32 1.3 Molecular analysis of phosphoglucomutase 32-44 1.3.1 PGM1 in man 33-38 1.3.1.1 Cloning of PGM7 33 1.3.1.2 The genomic structure of PGM1 in man 33 1.3.1.3 Molecular basis of the PGM1 protein polymorphism 36 - 37 1.3.1.4 The 3' untranslated region polymorphism 37 1.3.1.5 The Taq\ polymorphism 37 - 38 1.3.2 PGM in other species 38 - 40 1.3.2.1 Isoforms of PGM1 in eukaryotes 38 - 40 1.3.2.2 PGM in bacteria 40 1.3.3 Phosphomannomutase in bacteria 40 - 42 1.3.4 Conservation of protein motifs 42 - 44 1.4 Divergence of function 44 - 46 1.4.1 N-acetylglucosamine-phosphate mutase in S.cerevisiae 44 - 45 1.4.2 Parafusin in Paramecium tetraurelia 45 1.4.3 Aciculin in man 46 1.5 Convergent evolution of phosphomannomutase 46 - 47 1.6 Summary of aims 47-48 CHAPTER TWO: MATERIALS AND METHODS 49-68 2.1 Materials 49-51 2.1.1 General reagents 49 2.1.2 Cell culture 49 2.1.3 Electrophoresis materials 49 2.1.4 Commonly used solutions 49-50 2.1.5 Cell culture media 50 2.1.6 Microbiological media 50 2.1.7 PGM samples 50-51 2.1.8 Bacterial strains 51 2.2 Methods 51-68 2.2.1 Cell Culture 51 2.2.2 Preparation of placental and cell extracts 51 2.2.3 Protein electrophoresis techniques 52 - 53 2.2.3.1 Starch gel electrophoresis of PGM 52 2.2.3.2 Starch gel electrophoresis of PGD 52 2.2.3.3 Isoelectric focusing 52 2.2.3.4 Sodium-dodecyl-sulphate polyacrylamide gel electrophoresis 53 2.2.4 Protein detection methods 53 - 54 2.2.4.1 PGM activity stain 53 2.2.4.2 PGD activity stain 53 - 54 2.2.4.3 Immunoblot detection 54 2.2.4.3.1 Electroblotting of starch and SDS-PAGE gels 54 2.2.4.3.2 Passive blotting of lEF gels 54 2.2.4.3.3 Detection of antigen 54 2.2.5 Preparation of genomic DNA and RNA 56 - 57 2.2.5.1 Preparation of K562 genomic DNA 56 2.2.5.2 Preparation of E co //DNA 56 2.2.5.3 Preparation of total RNA 56 2.2.5.4 Preparation of pA+ RNA 57 2.2.6 Estimation of nucleic acid concentration 57 2.2.6.1 Spectrophotometry 57 2.2.6.2 Molecular weight standards 57 2.2.7 Agarose gel electrophoresis 57 - 58 2.2.7.1 Standard agarose gels 57 2.2.7.2 Nusieve agarose gels 58 2.2.7.3 Hybrid agarose gels 58 2.2.8 Polymerase chain reaction 58 - 62 2.2.8.1 Genomic DNA PCR 58 2.2.8.2 Reverse transcriptase PCR (RT-PGR) of PGM1 58 - 61 2.2.8.3 Low stringency RT-PGR 61 2.2.8.4 Degenerate primer PGR 61 2.2.8.5 Touchdown' PGR 61 - 62 2.2.8.6 Primers 62 2.2.9 Restriction enzyme digests 62 2.2.10 Southern blot analysis 62-64 2.2.10.1 Transfer of DNA to nitrocellulose 62 2.2.10.2 Preparation of hybridization probes 62 - 63 2.2.10.2.1 Electroelution 63 2.2.10.2.2 Spinning through glass wool 63 2.2.10.2.3 Wizard DNA PCR prep purification kit 63 2.2.10.3 Prehybridization of filter 63 2.2.10.4 Labelling of probe 64 2.2.10.5 Hybridization 64 2.2.10.6 Stringency washes 64 2.2.11 Determination of the PGM1 polymorphism 64 - 65 2.2.11.1 SSCP analysis 64-65 2.2.11.2 Restriction endonuclease analysis 65 2.2.12 Cloning of degenerate primer PCR products 65 2.2.13 Preparation of cloned DNA 65 - 66 2.2.13.1 The "Quick mini-preps" 65-66 2.2.13.2 Preparation of DNA for sequencing 66 2.2.14 Sequencing of PCR products 66-67 2.2.14.1 Sequencing of cloned DNA 66 2.2.14.2 Direct sequencing of PCR products 66-67 2.2.14.3 Polyacrylamide gel electrophoresis 67 2.2.15 Computer analysis 67 - 68 2.2.15.1 GCG 67-68 2.2.15.2 Phylogenetic analysis 68 CHAPTER THREE: CHARACTERIZATION OF THE CELL LINE K562 69 - 94 3.1 Characterization of K562 at the protein level 69 - 79 3.1.1 Detection of PGM activity 69 - 70 3.1.1.1 Starch gel electrophoresis and isoelectric focusing 70 3.1.1.2 Estimation of the sensitivity of the PGM activity stain 70 3.1.2 Detection of PGM antigen 70 - 79 3.1.2.1 Immunoblot detection using anti-rabbit PGM antibodies 74 3.1.2.2 Estimation of the sensitivity of the anti-rabbit PGM 74 3.1.2.3 Immunoblot detection using anti-human PGM1 antibodies 74 - 79 3.2 Characterization of the PGM1 gene 79 - 88 3.2.1 Fluorescence/n-s/Yu hybridization 79 3.2.2 Southern blot analysis 83 3.3 Characterization of PGM1 mRNA 83 3.4 Determination of the PGM1 phenotype in K562 89 3.4.1 SSCP analysis 89 3.4.2 Restriction enzyme analysis 89 3.5 Analysis of PGM1 alleles in K562 mRNA 89-92 3.6 Summary 92 3.7 Conclusions 94 CHAPTER FOUR: PCR-BASED SEARCH FOR MEMBERS OF THE PGM GENE FAMILY 95-119 4.1 Low stringency PCR 95 - 99 4.1.1 Optimization and results of low stringency RT-PCR 97 - 99 4.2 Degenerate primer PCR 99 - 115 4.2.1 Degenerate primer PCR strategy 99 - 100 4.2.2 PGM and PMM sequence based degenerate primer PCR 100 - 113 4.2.2.1 The degenerate primers 103 4.2.2.2 Selection of template DNA samples 106 4.2.2.3
Load more

Recommended publications
  • Annual Report DDUV 2009
    Research at the de Duve Institute and Brussels Branch of the Ludwig Institute for Cancer Research August 2009 de Duve Institute Introduction 5 Miikka Vikkula 12 Frédéric Lemaigre 20 Annabelle Decottignies and Charles de Smet 25 Emile Vanschaftingen 31 Françoise Bontemps 37 Jean-François Collet 42 Guido Bommer 47 Mark Rider 50 Fred Opperdoes 56 Pierre Courtoy 62 Etienne Marbaix 69 Jean-Baptiste Demoulin 75 Jean-Paul Coutelier 80 Thomas Michiels 84 Pierre Coulie 89 LICR Introduction 95 Benoît Van den Eynde 98 Pierre van der Bruggen 106 Nicolas Van Baren 114 Jean-Christophe Renauld 119 Stefan Constantinescu 125 The de Duve Institute 5 THE DE DUVE INSTITUTE: AN INTERNATIONAL BIOMEDICAL RESEARCH INSTITUTE In 1974, when Christian de Duve founded the Institute of Cellular Pathology (ICP), now rena- med the de Duve Institute, he was acutely aware of the constrast between the enormous progress in biological sciences that had occurred in the 20 preceding years and the modesty of the medical advances that had followed. He therefore crea- ted a research institution based on the principle that basic research in biology would be pursued by the investigators with complete freedom, but that special attention would be paid to the exploi- tation of basic advances for medical progress. It was therefore highly appropriate for the Institute to be located on the campus of the Faculty of Emile Van Schaftingen Medicine of the University of Louvain (UCL). This campus is located in Brussels. The Univer- sity hospital (Clinique St Luc) is located within walking distance of the Institute. The main commitment of the members of the de Duve Institute is research.
    [Show full text]
  • Articles Catalytic Cycling in Β-Phosphoglucomutase: a Kinetic
    9404 Biochemistry 2005, 44, 9404-9416 Articles Catalytic Cycling in â-Phosphoglucomutase: A Kinetic and Structural Analysis†,‡ Guofeng Zhang, Jianying Dai, Liangbing Wang, and Debra Dunaway-Mariano* Department of Chemistry, UniVersity of New Mexico, Albuquerque, New Mexico 87131-0001 Lee W. Tremblay and Karen N. Allen* Department of Physiology and Biophysics, Boston UniVersity School of Medicine, Boston, Massachusetts 02118-2394 ReceiVed March 26, 2005; ReVised Manuscript ReceiVed May 18, 2005 ABSTRACT: Lactococcus lactis â-phosphoglucomutase (â-PGM) catalyzes the interconversion of â-D-glucose 1-phosphate (â-G1P) and â-D-glucose 6-phosphate (G6P), forming â-D-glucose 1,6-(bis)phosphate (â- G16P) as an intermediate. â-PGM conserves the core domain catalytic scaffold of the phosphatase branch of the HAD (haloalkanoic acid dehalogenase) enzyme superfamily, yet it has evolved to function as a mutase rather than as a phosphatase. This work was carried out to identify the structural basis underlying this diversification of function. In this paper, we examine â-PGM activation by the Mg2+ cofactor, â-PGM activation by Asp8 phosphorylation, and the role of cap domain closure in substrate discrimination. First, the 1.90 Å resolution X-ray crystal structure of the Mg2+-â-PGM complex is examined in the context of + + previously reported structures of the Mg2 -R-D-galactose-1-phosphate-â-PGM, Mg2 -phospho-â-PGM, and Mg2+-â-glucose-6-phosphate-1-phosphorane-â-PGM complexes to identify conformational changes that occur during catalytic turnover. The essential role of Asp8 in nucleophilic catalysis was confirmed by demonstrating that the D8A and D8E mutants are devoid of catalytic activity.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Transcriptomic and Proteomic Profiling Provides Insight Into
    BASIC RESEARCH www.jasn.org Transcriptomic and Proteomic Profiling Provides Insight into Mesangial Cell Function in IgA Nephropathy † † ‡ Peidi Liu,* Emelie Lassén,* Viji Nair, Celine C. Berthier, Miyuki Suguro, Carina Sihlbom,§ † | † Matthias Kretzler, Christer Betsholtz, ¶ Börje Haraldsson,* Wenjun Ju, Kerstin Ebefors,* and Jenny Nyström* *Department of Physiology, Institute of Neuroscience and Physiology, §Proteomics Core Facility at University of Gothenburg, University of Gothenburg, Gothenburg, Sweden; †Division of Nephrology, Department of Internal Medicine and Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, Michigan; ‡Division of Molecular Medicine, Aichi Cancer Center Research Institute, Nagoya, Japan; |Department of Immunology, Genetics and Pathology, Uppsala University, Uppsala, Sweden; and ¶Integrated Cardio Metabolic Centre, Karolinska Institutet Novum, Huddinge, Sweden ABSTRACT IgA nephropathy (IgAN), the most common GN worldwide, is characterized by circulating galactose-deficient IgA (gd-IgA) that forms immune complexes. The immune complexes are deposited in the glomerular mesangium, leading to inflammation and loss of renal function, but the complete pathophysiology of the disease is not understood. Using an integrated global transcriptomic and proteomic profiling approach, we investigated the role of the mesangium in the onset and progression of IgAN. Global gene expression was investigated by microarray analysis of the glomerular compartment of renal biopsy specimens from patients with IgAN (n=19) and controls (n=22). Using curated glomerular cell type–specific genes from the published literature, we found differential expression of a much higher percentage of mesangial cell–positive standard genes than podocyte-positive standard genes in IgAN. Principal coordinate analysis of expression data revealed clear separation of patient and control samples on the basis of mesangial but not podocyte cell–positive standard genes.
    [Show full text]
  • The Analysis of Variants in the General Population Reveals That PMM2 Is Extremely Tolerant to Missense Mutations and That Diagno
    International Journal of Molecular Sciences Article The Analysis of Variants in the General Population Reveals That PMM2 Is Extremely Tolerant to Missense Mutations and That Diagnosis of PMM2-CDG Can Benefit from the Identification of Modifiers Valentina Citro 1, Chiara Cimmaruta 1, Maria Monticelli 1, Guglielmo Riccio 1, Bruno Hay Mele 1,2, Maria Vittoria Cubellis 1,* ID and Giuseppina Andreotti 3 ID 1 Dipartimento di Biologia, Università Federico II, 80126 Napoli, Italy; [email protected] (V.C.); [email protected] (C.C.); [email protected] (M.M.); [email protected] (G.R.); [email protected] (B.H.M.) 2 Dipartimento di Scienze Agrarie ed Agroalimentari, Università Federico II, 80055 Napoli, Italy 3 Istituto di Chimica Biomolecolare—CNR, 80078 Pozzuoli, Italy; [email protected] * Correspondence: [email protected]; Tel.: +39-081-679118; Fax: +39-081-679233 Received: 30 May 2018; Accepted: 26 July 2018; Published: 30 July 2018 Abstract: Type I disorders of glycosylation (CDG), the most frequent of which is phosphomannomutase 2 (PMM2-CDG), are a group of diseases causing the incomplete N-glycosylation of proteins. PMM2-CDG is an autosomal recessive disease with a large phenotypic spectrum, and is associated with mutations in the PMM2 gene. The biochemical analysis of mutants does not allow a precise genotype–phenotype correlation for PMM2-CDG. PMM2 is very tolerant to missense and loss of function mutations, suggesting that a partial deficiency of activity might be beneficial under certain circumstances. The patient phenotype might be influenced by variants in other genes associated with the type I disorders of glycosylation in the general population.
    [Show full text]
  • Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays
    Supplemental Table S1. Primers for SYBRGreen quantitative RT-PCR assays. Gene Accession Primer Sequence Length Start Stop Tm GC% GAPDH NM_002046.3 GAPDH F TCCTGTTCGACAGTCAGCCGCA 22 39 60 60.43 59.09 GAPDH R GCGCCCAATACGACCAAATCCGT 23 150 128 60.12 56.52 Exon junction 131/132 (reverse primer) on template NM_002046.3 DNAH6 NM_001370.1 DNAH6 F GGGCCTGGTGCTGCTTTGATGA 22 4690 4711 59.66 59.09% DNAH6 R TAGAGAGCTTTGCCGCTTTGGCG 23 4797 4775 60.06 56.52% Exon junction 4790/4791 (reverse primer) on template NM_001370.1 DNAH7 NM_018897.2 DNAH7 F TGCTGCATGAGCGGGCGATTA 21 9973 9993 59.25 57.14% DNAH7 R AGGAAGCCATGTACAAAGGTTGGCA 25 10073 10049 58.85 48.00% Exon junction 9989/9990 (forward primer) on template NM_018897.2 DNAI1 NM_012144.2 DNAI1 F AACAGATGTGCCTGCAGCTGGG 22 673 694 59.67 59.09 DNAI1 R TCTCGATCCCGGACAGGGTTGT 22 822 801 59.07 59.09 Exon junction 814/815 (reverse primer) on template NM_012144.2 RPGRIP1L NM_015272.2 RPGRIP1L F TCCCAAGGTTTCACAAGAAGGCAGT 25 3118 3142 58.5 48.00% RPGRIP1L R TGCCAAGCTTTGTTCTGCAAGCTGA 25 3238 3214 60.06 48.00% Exon junction 3124/3125 (forward primer) on template NM_015272.2 Supplemental Table S2. Transcripts that differentiate IPF/UIP from controls at 5%FDR Fold- p-value Change Transcript Gene p-value p-value p-value (IPF/UIP (IPF/UIP Cluster ID RefSeq Symbol gene_assignment (Age) (Gender) (Smoking) vs. C) vs. C) NM_001178008 // CBS // cystathionine-beta- 8070632 NM_001178008 CBS synthase // 21q22.3 // 875 /// NM_0000 0.456642 0.314761 0.418564 4.83E-36 -2.23 NM_003013 // SFRP2 // secreted frizzled- 8103254 NM_003013
    [Show full text]
  • Ureaplasma Urealyticum and Ureaplasma Parvum
    The Journal of Molecular Diagnostics, Vol. 13, No. 2, March 2011 Copyright © 2011 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved. DOI: 10.1016/j.jmoldx.2010.10.007 Modified Real-Time PCR for Detecting, Differentiating, and Quantifying Ureaplasma urealyticum and Ureaplasma parvum Ellen Vancutsem,* Oriane Soetens,* microbiological methods and are, therefore, usually re- Maria Breugelmans,† Walter Foulon,† ferred to as Ureaplasma species. They are found in the and Anne Naessens* lower genital tract of nearly 50% of pregnant women as part of the normal vaginal flora. However, in some cases, From the Departments of Microbiology and Infection Control* Ureaplasma species have interfered with normal fetal de- and Obstetrics,† Universitair Ziekenhuis Brussel, Brussels, velopment by causing an ascending infection.2–7 The Belgium reason for this infection is not fully understood but may be associated with the virulence of the microorganism, the host immune system, or local factors present in the lower We evaluated a previously described quantitative real- genital tract. Species differentiation might be important time PCR (qPCR) for quantifying and differentiating because previous studies2,8,9 suggest that nongonococ- Ureaplasma parvum and U. urealyticum. Because of cal urethritis and an adverse pregnancy outcome with nonspecific reactions with Staphylococcus aureus respect to birth weight, gestational age, and preterm DNA in the U. parvum PCR, we developed a modified delivery are implicated with the presence of U. urealyti- qPCR and designed new primers. These oligonucleo- cum and not with U. parvum. tides eradicated cross-reactions, indicating higher Because strains can only be differentiated with la- specificity.
    [Show full text]
  • Mycoplasma Pirum Sp. Nov. a Terminal Structured Mollicute from Cell Cultures
    INTERNATIONALJOURNAL OF SYSTEMATICBACTERIOLOGY, July 1985, p. 285-291 Vol. 35, No. 3 0020-7713/85/030285-07$02.00/0 Copyright 0 1985, International Union of Microbiological Societies Mycoplasma pirum sp. nov. a Terminal Structured Mollicute from Cell Cultures RICHARD A. DEL GIUDICE,'" JOSEPH G. TULLY,* DAVID L. ROSE,2 AND ROGER M. COLE3? Diagnostic Microbiology Laboratory, National Cancer Institute-Frederick Cancer Research Facility,' and Laboratory of Molecular Microbiology, National Institute of Allergy and Infectious Diseases,2 Frederick, Maryland 21 701 and Laboratory of Streptococcal Diseases, National Institute of Allergy and Infectious Diseases, Bethesda, Maryland 202053 More than 200 mycoplasma isolates recovered from a variety of contaminated cell cultures from 1968 to the present were found to belong to a distinct serological group (serogroup 38). An analysis of representative strains of this collection showed that they possessed all of the characteristics of organisms belonging to the genus Mycoplasma. These organisms were capable of fermenting glucose and of hydrolyzing arginine, and they required cholesterol or serum for growth. These organisms were unusual in that they possessed an organized terminal structure or tip, a morphological structure which has been found in at least six other species in the genus Mycoplasma. These organisms were also serologically distinct from all previously established species in the genus Mycoplasma and the genus Acholeplasma. On the basis of these findings and other morphological, biological, and serological characteristics of the strains recovered, we propose that mycoplasmas with these properties belong to a new species, Mycoplasma pirum sp. nov. Strain HRC 70-159 (= ATCC 25960) is the type strain of this species.
    [Show full text]
  • Invivogen Insight Newsletter: Mycoplasma
    November/December 2005 An Insightful Look At InvivoGen’s Innovative Products Mycoplasma contamination remains a significant problem to Mycoplasma: The Insidious Invader of Cell Cultures the culture of mammalian cells. Mycoplasmas are the smallest and simplest and enzymatic procedures. However, none of these self-replicating organisms. Due to their seriously methods is 100% reliable. Direct growth methods are The detection of mycoplasma degraded genome they cannot perform many relatively sensitive to most species but the overall contamination is an important metabolic functions, such as cell wall production or procedure is lengthy (3 weeks), costly and less synthesis of nucleotides and amino acids. sensitive to noncultivable species. The PCR method, part of mycoplasma control and Mycoplasmas are strictly parasites. They parasitize a although rather fast and inexpensive, is limited by its should be an established wide range of organisms including humans, animals, sensitivity and the risk of positive and false negative method in every cell culture insects, and plants. results. Mycoplasma and Acholeplasma are Mollicutes, that InvivoGen has developed a new mycoplasma detection laboratory. InvivoGen is pleased comprise together more than 100 recognized species. method that promises to resolve these issues. This to introduce PlasmoTest™, a Among them, about 20 species have been described as method is based on the detection of mycoplasmas by contaminants of eukaryotic cell cultures. However engineered cells that express Toll-like receptor 2, a Mycoplasma detection kit based 5 species (Mycoplasma (M.) arginini, M. fermentans, pathogen recognition receptor that detects mycoplasmas. on a brand new technology. M. orale, M. hyorhinis and Acholeplasma laidlawii) PlasmoTest™, InvivoGen’s new mycoplasma detection are isolated in 90-95% of contaminated cell cultures1.
    [Show full text]
  • Successes and Challenges in Functional Assignment in a Superfamily of Phosphatases
    99 Experimental Standard Conditions of Enzyme Characterization Beilstein-Institut September 12th –16th, 2011, Ru¨desheim/Rhein, Germany Successes and Challenges in Functional Assignment in a Superfamily of Phosphatases Karen N. Allen1,* and Debra Dunaway-Mariano2,# 1Department of Chemistry, Boston University, 590 Commonwealth Avenue, Boston, MA 02215 – 2521, U.S.A. 2Department of Chemistry and Chemical Biology, University of New Mexico, Albuquerque, NM, 87131, U.S.A. E-Mail: *[email protected] and #[email protected] Received: 17th September 2012/Published: 15th February 2013 Abstract The explosion of protein sequence information from genome sequen- cing efforts requires that current experimental strategies for function assignment must evolve into computationally-based function predic- tion. This necessitates the development of new strategies based, in part, on the identification of sequence markers, including residues that sup- port structure and specificity as well as a more informed definition of orthologues. We have undertaken the function assignment of unknown members of the haloalkanoate dehalogenase superfamily using an in- tegrated bioinformatics/structure/mechanism approach. Notably, a number of members show ‘‘substrate blurring’’, with activity toward a number of substrates and significant substrate overlap between para- logues. Other family members have been honed to a specific substrate with high catalytic efficiency and proficiency. Our findings highlight the use of the cap domain structure and enzyme conformational dy- namics in delineating specificity. http://www.beilstein-institut.de/escec2011/Proceedings/Allen/Allen.pdf 100 Allen, K.N. and Dunaway-Mariano, D. The Haloalkanoate Dehalogenase Superfamily (HADSF) The ‘‘central dogma’’ of protein structure/function studies is that protein sequence dictates protein structure which, in turn defines protein function.
    [Show full text]
  • APUTS) Reporting Terminology and Codes Microbiology (V1.0
    AUSTRALIAN PATHOLOGY UNITS AND TERMINOLOGY (APUTS) Reporting Terminology and Codes Microbiology (v1.0) 1 12/02/2013 APUTS Report Information Model - Urine Microbiology Page 1 of 1 Specimen Type Specimen Macro Time Glucose Bilirubin Ketones Specific Gravity pH Chemistry Protein Urobilinogen Nitrites Haemoglobin Leucocyte Esterases White blood cell count Red blood cells Cells Epithelial cells Bacteria Microscopy Parasites Microorganisms Yeasts Casts Crystals Other elements Antibacterial Activity No growth Mixed growth Urine MCS No significant growth Klebsiella sp. Bacteria ESBL Klebsiella pneumoniae Identification Virus Fungi Growth of >10^8 org/L 10^7 to 10^8 organism/L of mixed Range or number Colony Count growth of 3 organisms 19090-0 Culture Organism 1 630-4 LOINC >10^8 organisms/L LOINC Significant growth e.g. Ampicillin 18864-9 LOINC Antibiotics Susceptibility Method Released/suppressed None Organism 2 Organism 3 Organism 4 None Consistent with UTI Probable contamination Growth unlikely to be significant Comment Please submit a repeat specimen for testing if clinically indicated Catheter comments Sterile pyuria Notification to infection control and public health departments PUTS Urine Microbiology Information Model v1.mmap - 12/02/2013 - Mindjet 12/02/2013 APUTS Report Terminology and Codes - Microbiology - Urine Page 1 of 3 RCPA Pathology Units and Terminology Standardisation Project - Terminology for Reporting Pathology: Microbiology : Urine Microbiology Report v1 LOINC LOINC LOINC LOINC LOINC LOINC LOINC Urine Microbiology Report
    [Show full text]
  • Moving Beyond Serovars
    ABSTRACT Title of Document: MOLECULAR AND BIOINFORMATICS APPROACHES TO REDEFINE OUR UNDERSTANDING OF UREAPLASMAS: MOVING BEYOND SEROVARS Vanya Paralanov, Doctor of Philosophy, 2014 Directed By: Prof. Jonathan Dinman, Cell Biology and Molecular Genetics, University of Maryland College Park Prof. John I. Glass, Synthetic Biology, J. Craig Venter Institute Ureaplasma parvum and Ureaplasma urealyticum are sexually transmitted, opportunistic pathogens of the human urogenital tract. There are 14 known serovars of the two species. For decades, it has been postulated that virulence is related to serotype specificity. Understanding of the role of ureaplasmas in human diseases has been thwarted due to two major barriers: (1) lack of suitable diagnostic tests and (2) lack of genetic manipulation tools for the creation of mutants to study the role of potential pathogenicity factors. To address the first barrier we developed real-time quantitative PCRs (RT-qPCR) for the reliable differentiation of the two species and 14 serovars. We typed 1,061 ureaplasma clinical isolates and observed about 40% of isolates to be genetic mosaics, arising from the recombination of multiple serovars. Furthermore, comparative genome analysis of the 14 serovars and 5 clinical isolates showed that the mba gene, used for serotyping ureaplasmas was part of a large, phase variable gene system, and some serovars shown to express different MBA proteins also encode mba genes associated with other serovars. Together these data suggests that differential pathogenicity and clinical outcome of an ureaplasmal infection is most likely due to the presence or absence of potential pathogenicity factors in individual ureaplasma clinical isolates and/or patient to patient differences in terms of autoimmunity and microbiome.
    [Show full text]