Molecular and Evolutionary Investigation of the Phosphoglucomutase Gene Family
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Annual Report DDUV 2009
Research at the de Duve Institute and Brussels Branch of the Ludwig Institute for Cancer Research August 2009 de Duve Institute Introduction 5 Miikka Vikkula 12 Frédéric Lemaigre 20 Annabelle Decottignies and Charles de Smet 25 Emile Vanschaftingen 31 Françoise Bontemps 37 Jean-François Collet 42 Guido Bommer 47 Mark Rider 50 Fred Opperdoes 56 Pierre Courtoy 62 Etienne Marbaix 69 Jean-Baptiste Demoulin 75 Jean-Paul Coutelier 80 Thomas Michiels 84 Pierre Coulie 89 LICR Introduction 95 Benoît Van den Eynde 98 Pierre van der Bruggen 106 Nicolas Van Baren 114 Jean-Christophe Renauld 119 Stefan Constantinescu 125 The de Duve Institute 5 THE DE DUVE INSTITUTE: AN INTERNATIONAL BIOMEDICAL RESEARCH INSTITUTE In 1974, when Christian de Duve founded the Institute of Cellular Pathology (ICP), now rena- med the de Duve Institute, he was acutely aware of the constrast between the enormous progress in biological sciences that had occurred in the 20 preceding years and the modesty of the medical advances that had followed. He therefore crea- ted a research institution based on the principle that basic research in biology would be pursued by the investigators with complete freedom, but that special attention would be paid to the exploi- tation of basic advances for medical progress. It was therefore highly appropriate for the Institute to be located on the campus of the Faculty of Emile Van Schaftingen Medicine of the University of Louvain (UCL). This campus is located in Brussels. The Univer- sity hospital (Clinique St Luc) is located within walking distance of the Institute. The main commitment of the members of the de Duve Institute is research. -
Articles Catalytic Cycling in Β-Phosphoglucomutase: a Kinetic
9404 Biochemistry 2005, 44, 9404-9416 Articles Catalytic Cycling in â-Phosphoglucomutase: A Kinetic and Structural Analysis†,‡ Guofeng Zhang, Jianying Dai, Liangbing Wang, and Debra Dunaway-Mariano* Department of Chemistry, UniVersity of New Mexico, Albuquerque, New Mexico 87131-0001 Lee W. Tremblay and Karen N. Allen* Department of Physiology and Biophysics, Boston UniVersity School of Medicine, Boston, Massachusetts 02118-2394 ReceiVed March 26, 2005; ReVised Manuscript ReceiVed May 18, 2005 ABSTRACT: Lactococcus lactis â-phosphoglucomutase (â-PGM) catalyzes the interconversion of â-D-glucose 1-phosphate (â-G1P) and â-D-glucose 6-phosphate (G6P), forming â-D-glucose 1,6-(bis)phosphate (â- G16P) as an intermediate. â-PGM conserves the core domain catalytic scaffold of the phosphatase branch of the HAD (haloalkanoic acid dehalogenase) enzyme superfamily, yet it has evolved to function as a mutase rather than as a phosphatase. This work was carried out to identify the structural basis underlying this diversification of function. In this paper, we examine â-PGM activation by the Mg2+ cofactor, â-PGM activation by Asp8 phosphorylation, and the role of cap domain closure in substrate discrimination. First, the 1.90 Å resolution X-ray crystal structure of the Mg2+-â-PGM complex is examined in the context of + + previously reported structures of the Mg2 -R-D-galactose-1-phosphate-â-PGM, Mg2 -phospho-â-PGM, and Mg2+-â-glucose-6-phosphate-1-phosphorane-â-PGM complexes to identify conformational changes that occur during catalytic turnover. The essential role of Asp8 in nucleophilic catalysis was confirmed by demonstrating that the D8A and D8E mutants are devoid of catalytic activity. -
Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase -
Transcriptomic and Proteomic Profiling Provides Insight Into
BASIC RESEARCH www.jasn.org Transcriptomic and Proteomic Profiling Provides Insight into Mesangial Cell Function in IgA Nephropathy † † ‡ Peidi Liu,* Emelie Lassén,* Viji Nair, Celine C. Berthier, Miyuki Suguro, Carina Sihlbom,§ † | † Matthias Kretzler, Christer Betsholtz, ¶ Börje Haraldsson,* Wenjun Ju, Kerstin Ebefors,* and Jenny Nyström* *Department of Physiology, Institute of Neuroscience and Physiology, §Proteomics Core Facility at University of Gothenburg, University of Gothenburg, Gothenburg, Sweden; †Division of Nephrology, Department of Internal Medicine and Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, Michigan; ‡Division of Molecular Medicine, Aichi Cancer Center Research Institute, Nagoya, Japan; |Department of Immunology, Genetics and Pathology, Uppsala University, Uppsala, Sweden; and ¶Integrated Cardio Metabolic Centre, Karolinska Institutet Novum, Huddinge, Sweden ABSTRACT IgA nephropathy (IgAN), the most common GN worldwide, is characterized by circulating galactose-deficient IgA (gd-IgA) that forms immune complexes. The immune complexes are deposited in the glomerular mesangium, leading to inflammation and loss of renal function, but the complete pathophysiology of the disease is not understood. Using an integrated global transcriptomic and proteomic profiling approach, we investigated the role of the mesangium in the onset and progression of IgAN. Global gene expression was investigated by microarray analysis of the glomerular compartment of renal biopsy specimens from patients with IgAN (n=19) and controls (n=22). Using curated glomerular cell type–specific genes from the published literature, we found differential expression of a much higher percentage of mesangial cell–positive standard genes than podocyte-positive standard genes in IgAN. Principal coordinate analysis of expression data revealed clear separation of patient and control samples on the basis of mesangial but not podocyte cell–positive standard genes. -
The Analysis of Variants in the General Population Reveals That PMM2 Is Extremely Tolerant to Missense Mutations and That Diagno
International Journal of Molecular Sciences Article The Analysis of Variants in the General Population Reveals That PMM2 Is Extremely Tolerant to Missense Mutations and That Diagnosis of PMM2-CDG Can Benefit from the Identification of Modifiers Valentina Citro 1, Chiara Cimmaruta 1, Maria Monticelli 1, Guglielmo Riccio 1, Bruno Hay Mele 1,2, Maria Vittoria Cubellis 1,* ID and Giuseppina Andreotti 3 ID 1 Dipartimento di Biologia, Università Federico II, 80126 Napoli, Italy; [email protected] (V.C.); [email protected] (C.C.); [email protected] (M.M.); [email protected] (G.R.); [email protected] (B.H.M.) 2 Dipartimento di Scienze Agrarie ed Agroalimentari, Università Federico II, 80055 Napoli, Italy 3 Istituto di Chimica Biomolecolare—CNR, 80078 Pozzuoli, Italy; [email protected] * Correspondence: [email protected]; Tel.: +39-081-679118; Fax: +39-081-679233 Received: 30 May 2018; Accepted: 26 July 2018; Published: 30 July 2018 Abstract: Type I disorders of glycosylation (CDG), the most frequent of which is phosphomannomutase 2 (PMM2-CDG), are a group of diseases causing the incomplete N-glycosylation of proteins. PMM2-CDG is an autosomal recessive disease with a large phenotypic spectrum, and is associated with mutations in the PMM2 gene. The biochemical analysis of mutants does not allow a precise genotype–phenotype correlation for PMM2-CDG. PMM2 is very tolerant to missense and loss of function mutations, suggesting that a partial deficiency of activity might be beneficial under certain circumstances. The patient phenotype might be influenced by variants in other genes associated with the type I disorders of glycosylation in the general population. -
Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays
Supplemental Table S1. Primers for SYBRGreen quantitative RT-PCR assays. Gene Accession Primer Sequence Length Start Stop Tm GC% GAPDH NM_002046.3 GAPDH F TCCTGTTCGACAGTCAGCCGCA 22 39 60 60.43 59.09 GAPDH R GCGCCCAATACGACCAAATCCGT 23 150 128 60.12 56.52 Exon junction 131/132 (reverse primer) on template NM_002046.3 DNAH6 NM_001370.1 DNAH6 F GGGCCTGGTGCTGCTTTGATGA 22 4690 4711 59.66 59.09% DNAH6 R TAGAGAGCTTTGCCGCTTTGGCG 23 4797 4775 60.06 56.52% Exon junction 4790/4791 (reverse primer) on template NM_001370.1 DNAH7 NM_018897.2 DNAH7 F TGCTGCATGAGCGGGCGATTA 21 9973 9993 59.25 57.14% DNAH7 R AGGAAGCCATGTACAAAGGTTGGCA 25 10073 10049 58.85 48.00% Exon junction 9989/9990 (forward primer) on template NM_018897.2 DNAI1 NM_012144.2 DNAI1 F AACAGATGTGCCTGCAGCTGGG 22 673 694 59.67 59.09 DNAI1 R TCTCGATCCCGGACAGGGTTGT 22 822 801 59.07 59.09 Exon junction 814/815 (reverse primer) on template NM_012144.2 RPGRIP1L NM_015272.2 RPGRIP1L F TCCCAAGGTTTCACAAGAAGGCAGT 25 3118 3142 58.5 48.00% RPGRIP1L R TGCCAAGCTTTGTTCTGCAAGCTGA 25 3238 3214 60.06 48.00% Exon junction 3124/3125 (forward primer) on template NM_015272.2 Supplemental Table S2. Transcripts that differentiate IPF/UIP from controls at 5%FDR Fold- p-value Change Transcript Gene p-value p-value p-value (IPF/UIP (IPF/UIP Cluster ID RefSeq Symbol gene_assignment (Age) (Gender) (Smoking) vs. C) vs. C) NM_001178008 // CBS // cystathionine-beta- 8070632 NM_001178008 CBS synthase // 21q22.3 // 875 /// NM_0000 0.456642 0.314761 0.418564 4.83E-36 -2.23 NM_003013 // SFRP2 // secreted frizzled- 8103254 NM_003013 -
Ureaplasma Urealyticum and Ureaplasma Parvum
The Journal of Molecular Diagnostics, Vol. 13, No. 2, March 2011 Copyright © 2011 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved. DOI: 10.1016/j.jmoldx.2010.10.007 Modified Real-Time PCR for Detecting, Differentiating, and Quantifying Ureaplasma urealyticum and Ureaplasma parvum Ellen Vancutsem,* Oriane Soetens,* microbiological methods and are, therefore, usually re- Maria Breugelmans,† Walter Foulon,† ferred to as Ureaplasma species. They are found in the and Anne Naessens* lower genital tract of nearly 50% of pregnant women as part of the normal vaginal flora. However, in some cases, From the Departments of Microbiology and Infection Control* Ureaplasma species have interfered with normal fetal de- and Obstetrics,† Universitair Ziekenhuis Brussel, Brussels, velopment by causing an ascending infection.2–7 The Belgium reason for this infection is not fully understood but may be associated with the virulence of the microorganism, the host immune system, or local factors present in the lower We evaluated a previously described quantitative real- genital tract. Species differentiation might be important time PCR (qPCR) for quantifying and differentiating because previous studies2,8,9 suggest that nongonococ- Ureaplasma parvum and U. urealyticum. Because of cal urethritis and an adverse pregnancy outcome with nonspecific reactions with Staphylococcus aureus respect to birth weight, gestational age, and preterm DNA in the U. parvum PCR, we developed a modified delivery are implicated with the presence of U. urealyti- qPCR and designed new primers. These oligonucleo- cum and not with U. parvum. tides eradicated cross-reactions, indicating higher Because strains can only be differentiated with la- specificity. -
Mycoplasma Pirum Sp. Nov. a Terminal Structured Mollicute from Cell Cultures
INTERNATIONALJOURNAL OF SYSTEMATICBACTERIOLOGY, July 1985, p. 285-291 Vol. 35, No. 3 0020-7713/85/030285-07$02.00/0 Copyright 0 1985, International Union of Microbiological Societies Mycoplasma pirum sp. nov. a Terminal Structured Mollicute from Cell Cultures RICHARD A. DEL GIUDICE,'" JOSEPH G. TULLY,* DAVID L. ROSE,2 AND ROGER M. COLE3? Diagnostic Microbiology Laboratory, National Cancer Institute-Frederick Cancer Research Facility,' and Laboratory of Molecular Microbiology, National Institute of Allergy and Infectious Diseases,2 Frederick, Maryland 21 701 and Laboratory of Streptococcal Diseases, National Institute of Allergy and Infectious Diseases, Bethesda, Maryland 202053 More than 200 mycoplasma isolates recovered from a variety of contaminated cell cultures from 1968 to the present were found to belong to a distinct serological group (serogroup 38). An analysis of representative strains of this collection showed that they possessed all of the characteristics of organisms belonging to the genus Mycoplasma. These organisms were capable of fermenting glucose and of hydrolyzing arginine, and they required cholesterol or serum for growth. These organisms were unusual in that they possessed an organized terminal structure or tip, a morphological structure which has been found in at least six other species in the genus Mycoplasma. These organisms were also serologically distinct from all previously established species in the genus Mycoplasma and the genus Acholeplasma. On the basis of these findings and other morphological, biological, and serological characteristics of the strains recovered, we propose that mycoplasmas with these properties belong to a new species, Mycoplasma pirum sp. nov. Strain HRC 70-159 (= ATCC 25960) is the type strain of this species. -
Invivogen Insight Newsletter: Mycoplasma
November/December 2005 An Insightful Look At InvivoGen’s Innovative Products Mycoplasma contamination remains a significant problem to Mycoplasma: The Insidious Invader of Cell Cultures the culture of mammalian cells. Mycoplasmas are the smallest and simplest and enzymatic procedures. However, none of these self-replicating organisms. Due to their seriously methods is 100% reliable. Direct growth methods are The detection of mycoplasma degraded genome they cannot perform many relatively sensitive to most species but the overall contamination is an important metabolic functions, such as cell wall production or procedure is lengthy (3 weeks), costly and less synthesis of nucleotides and amino acids. sensitive to noncultivable species. The PCR method, part of mycoplasma control and Mycoplasmas are strictly parasites. They parasitize a although rather fast and inexpensive, is limited by its should be an established wide range of organisms including humans, animals, sensitivity and the risk of positive and false negative method in every cell culture insects, and plants. results. Mycoplasma and Acholeplasma are Mollicutes, that InvivoGen has developed a new mycoplasma detection laboratory. InvivoGen is pleased comprise together more than 100 recognized species. method that promises to resolve these issues. This to introduce PlasmoTest™, a Among them, about 20 species have been described as method is based on the detection of mycoplasmas by contaminants of eukaryotic cell cultures. However engineered cells that express Toll-like receptor 2, a Mycoplasma detection kit based 5 species (Mycoplasma (M.) arginini, M. fermentans, pathogen recognition receptor that detects mycoplasmas. on a brand new technology. M. orale, M. hyorhinis and Acholeplasma laidlawii) PlasmoTest™, InvivoGen’s new mycoplasma detection are isolated in 90-95% of contaminated cell cultures1. -
Successes and Challenges in Functional Assignment in a Superfamily of Phosphatases
99 Experimental Standard Conditions of Enzyme Characterization Beilstein-Institut September 12th –16th, 2011, Ru¨desheim/Rhein, Germany Successes and Challenges in Functional Assignment in a Superfamily of Phosphatases Karen N. Allen1,* and Debra Dunaway-Mariano2,# 1Department of Chemistry, Boston University, 590 Commonwealth Avenue, Boston, MA 02215 – 2521, U.S.A. 2Department of Chemistry and Chemical Biology, University of New Mexico, Albuquerque, NM, 87131, U.S.A. E-Mail: *[email protected] and #[email protected] Received: 17th September 2012/Published: 15th February 2013 Abstract The explosion of protein sequence information from genome sequen- cing efforts requires that current experimental strategies for function assignment must evolve into computationally-based function predic- tion. This necessitates the development of new strategies based, in part, on the identification of sequence markers, including residues that sup- port structure and specificity as well as a more informed definition of orthologues. We have undertaken the function assignment of unknown members of the haloalkanoate dehalogenase superfamily using an in- tegrated bioinformatics/structure/mechanism approach. Notably, a number of members show ‘‘substrate blurring’’, with activity toward a number of substrates and significant substrate overlap between para- logues. Other family members have been honed to a specific substrate with high catalytic efficiency and proficiency. Our findings highlight the use of the cap domain structure and enzyme conformational dy- namics in delineating specificity. http://www.beilstein-institut.de/escec2011/Proceedings/Allen/Allen.pdf 100 Allen, K.N. and Dunaway-Mariano, D. The Haloalkanoate Dehalogenase Superfamily (HADSF) The ‘‘central dogma’’ of protein structure/function studies is that protein sequence dictates protein structure which, in turn defines protein function. -
APUTS) Reporting Terminology and Codes Microbiology (V1.0
AUSTRALIAN PATHOLOGY UNITS AND TERMINOLOGY (APUTS) Reporting Terminology and Codes Microbiology (v1.0) 1 12/02/2013 APUTS Report Information Model - Urine Microbiology Page 1 of 1 Specimen Type Specimen Macro Time Glucose Bilirubin Ketones Specific Gravity pH Chemistry Protein Urobilinogen Nitrites Haemoglobin Leucocyte Esterases White blood cell count Red blood cells Cells Epithelial cells Bacteria Microscopy Parasites Microorganisms Yeasts Casts Crystals Other elements Antibacterial Activity No growth Mixed growth Urine MCS No significant growth Klebsiella sp. Bacteria ESBL Klebsiella pneumoniae Identification Virus Fungi Growth of >10^8 org/L 10^7 to 10^8 organism/L of mixed Range or number Colony Count growth of 3 organisms 19090-0 Culture Organism 1 630-4 LOINC >10^8 organisms/L LOINC Significant growth e.g. Ampicillin 18864-9 LOINC Antibiotics Susceptibility Method Released/suppressed None Organism 2 Organism 3 Organism 4 None Consistent with UTI Probable contamination Growth unlikely to be significant Comment Please submit a repeat specimen for testing if clinically indicated Catheter comments Sterile pyuria Notification to infection control and public health departments PUTS Urine Microbiology Information Model v1.mmap - 12/02/2013 - Mindjet 12/02/2013 APUTS Report Terminology and Codes - Microbiology - Urine Page 1 of 3 RCPA Pathology Units and Terminology Standardisation Project - Terminology for Reporting Pathology: Microbiology : Urine Microbiology Report v1 LOINC LOINC LOINC LOINC LOINC LOINC LOINC Urine Microbiology Report -
Moving Beyond Serovars
ABSTRACT Title of Document: MOLECULAR AND BIOINFORMATICS APPROACHES TO REDEFINE OUR UNDERSTANDING OF UREAPLASMAS: MOVING BEYOND SEROVARS Vanya Paralanov, Doctor of Philosophy, 2014 Directed By: Prof. Jonathan Dinman, Cell Biology and Molecular Genetics, University of Maryland College Park Prof. John I. Glass, Synthetic Biology, J. Craig Venter Institute Ureaplasma parvum and Ureaplasma urealyticum are sexually transmitted, opportunistic pathogens of the human urogenital tract. There are 14 known serovars of the two species. For decades, it has been postulated that virulence is related to serotype specificity. Understanding of the role of ureaplasmas in human diseases has been thwarted due to two major barriers: (1) lack of suitable diagnostic tests and (2) lack of genetic manipulation tools for the creation of mutants to study the role of potential pathogenicity factors. To address the first barrier we developed real-time quantitative PCRs (RT-qPCR) for the reliable differentiation of the two species and 14 serovars. We typed 1,061 ureaplasma clinical isolates and observed about 40% of isolates to be genetic mosaics, arising from the recombination of multiple serovars. Furthermore, comparative genome analysis of the 14 serovars and 5 clinical isolates showed that the mba gene, used for serotyping ureaplasmas was part of a large, phase variable gene system, and some serovars shown to express different MBA proteins also encode mba genes associated with other serovars. Together these data suggests that differential pathogenicity and clinical outcome of an ureaplasmal infection is most likely due to the presence or absence of potential pathogenicity factors in individual ureaplasma clinical isolates and/or patient to patient differences in terms of autoimmunity and microbiome.