DOCSLIB.ORG

Supplementary Tables and Figures

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Tables and Figures SUPPLEMENTARY DATA Supplementary Table 1. SiRNA sequence (5’-3’) Gene Forward Reverse si-HRD1-1# GCAUGGCAGUCCUGUACAU dTdT AUGUACAGGACUGCCAUGC dTdT si-HRD1-2# GAGCCAUCCGCAACAUGAA dTdT UUCAUGUUGCGGAUGGCUC dTdT si-MafA CCAUCGAGUACGUCAACGA dTdT UCGUUGACGUACUCGAUGG dTdT ©2020 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db19-1060/-/DC1 SUPPLEMENTARY DATA Supplementary Table 2. Primer sequences for qRT-PCR (5’-3’) Gene Forward Reverse human HRD1 GCTCACGCCTACTACCTCAAA GCCAGACAAGTCTCTGTGACG mouse mafA AAGCGGCGCACGCTCAAGAA GGTCCCGCTCCTTGGCCAGA mouse insulin1 CACTTCCTACCCCTGCTGG ACCACAAAGATGCTGTTTGACA mouse β-actin AGGCCAACCGTGAAAAGATG AGAGCATAGCCCTCGTAGATGG human β-actin CATGTACGTTGCTATCCAGGC CTCCTTAATGTCACGCACGAT ©2020 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db19-1060/-/DC1 SUPPLEMENTARY DATA Supplementary Table 3. Primer sequences for ChIP (5’-3’) Gene promoter Forward Reverse mouse Insulin1, 2 GGAACTGTGAAACAGTCCAAGG CCCCCTGGACTTTGCTGTTTG ©2020 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db19-1060/-/DC1 SUPPLEMENTARY DATA Supplementary Table 4. Primer sequences for PCR (5’-3’) Gene Forward Reverse HRD1-pDsred CCCAAGCTTATGTTCCGCACCGCAGT GGGGTACCCAGTGGGCAACAGGGG HRD1-pCMV- Flag GGGGTACCATGTTCCGCACCGCAGT CCCAAGCTTGTGGGCAACAGGGGACT C HRD1-pCMV-HA GGCCATGGGCCATATGGGATCCTTCC AGGGATGCCACCCGGGGATCCTCAGT GCACCGCAGTGATG GGGCAACAGGGGAC HRD1-N-HA GGCCATGGGCCATATGGGATCCTTCC AGGGATGCCACCCGGGGATCCGACAT GCACCGCAGTGATG TATCCATTGCCTGGAGC HRD1-N-RING- GGCCATGGGCCATATGGGATCCTTCC AGGGATGCCACCCGGGGATCCGCATG HA GCACCGCAGTGATG TCGGGCAGGTCTGC HRD1-C-HA GGCCATGGGCCATATGGGATCCCGCA AGGGATGCCACCCGGGGATCCTCAGT TGGATGTCCTGCGG GGGCAACAGGGGAC mafA-pCMV-Myc ACAAGATCTGATGGCCGCGGAGCTG AGATAAGCTTATCAGAAAGAAGTCGG G GTGCGCCT mafA-pEGFP CGACTTCTTTCTGATAAGCTTGGTGA TCCTCTGCCATGATCAAGCTCTTGTAC GCAAGGGCGAGG AGCTCGTCCATGCCG ©2020 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db19-1060/-/DC1 SUPPLEMENTARY DATA Supplementary Table 5. List of the interactive proteins of HRD1 in Ad-GFP-transfected MIN6 cells analyzed by mass spectrometry. First protein Gene name Description Q8VDD5 Myh9 Myosin-9 Q3U9N4 Grn Granulins P63268 Actg2 Actin, gamma-enteric smooth muscle P11499 Hsp90ab1 Heat shock protein HSP 90-beta Q5SV64 Myh10 Myosin-10 P01631 Ig kappa chain V-II region 26-10 Q3V117 Acly ATP-citrate synthase A2AL12 Hnrnpa3 Heterogeneous nuclear ribonucleoprotein A3 P03975 Iap IgE-binding protein Q6ZWQ9 Myl12a MCG5400 Q9DBY1-2 Syvn1 Isoform 2 of E3 ubiquitin-protein ligase synoviolin P19157 Gstp1 Glutathione S-transferase P 1 Q8C2Q7 Hnrnph1 Heterogeneous nuclear ribonucleoprotein H Q99K48 Nono Non-POU domain-containing octamer-binding protein P97351 Rps3a 40S ribosomal protein S3a A0A0A6YW67 Gm8797 MCG23377, isoform CRA_b K3W4R2 Myh14 Myosin-14 P14148 Rpl7 60S ribosomal protein L7 A0A0U1RQ71 Rps13 40S ribosomal protein S13 P62264 Rps14 40S ribosomal protein S14 P60867 Rps20 40S ribosomal protein S20 A0A140LI77 Rps3 40S ribosomal protein S3 Q921M3-2 Sf3b3 Isoform 2 of Splicing factor 3B subunit 3 G5E902 Slc25a3 MCG10343, isoform CRA_b Q3U7K7 Trim21 E3 ubiquitin-protein ligase TRIM21 M0QWA8 1810046K07Rik RIKEN cDNA 1810046K07 gene (Fragment) Q6P8Q2 Abcc5 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 Q9CQR4 Acot13 Acyl-coenzyme A thioesterase 13 A0A0G2JF20 Alg14 UDP-N-acetylglucosamine transferase subunit ALG14 homolog F8VPQ6 Alpi Alkaline phosphatase Q8C8R3-8 Ank2 Isoform 8 of Ankyrin-2 D3Z482 Ankrd26 Ankyrin repeat domain-containing protein 26 Q91YM2 Arhgap35 Rho GTPase-activating protein 35 Q8BGU5-2 Ccny Isoform 2 of Cyclin-Y P97377-2 Cdk2 Isoform CDK2-alpha of Cyclin-dependent kinase 2 Q924X2 Cpt1b Carnitine O-palmitoyltransferase 1, muscle isoform A0A0A0MQM3 Cyb5r3 NADH-cytochrome b5 reductase 3 (Fragment) Q8JZM4 Dner Delta and Notch-like epidermal growth factor-related receptor P59764 Dock4 Dedicator of cytokinesis protein 4 Q45VK7 Dync2h1 Cytoplasmic dynein 2 heavy chain 1 P62869 Elob Elongin-B A0A087WPE4 Eloc Elongin-C (Fragment) B0QZL1 Eno1 Alpha-enolase (Fragment) ©2020 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db19-1060/-/DC1 SUPPLEMENTARY DATA P84089 Erh Enhancer of rudimentary homolog D6RFC8 Fbxl2 F-box/LRR-repeat protein 2 Q8BMI0 Fbxo38 F-box only protein 38 Q91WF7 Fig4 Polyphosphoinositide phosphatase Q9Z2I2 Fkbp1b Peptidyl-prolyl cis-trans isomerase FKBP1B F7CBR4 Gcnt7 Beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N- acetylglucosaminyltransferase 7 (Fragment) B2FDI6 Ggta1 N-acetyllactosaminide alpha-1,3-galactosyltransferase (Fragment) Q53YU8 Gkn1 Foveolin D3Z5N9 Gm5449 MCG49198 E9Q343 Gpr137c G protein-coupled receptor 137C Q3THK3 Gtf2f1 General transcription factor IIF subunit 1 Q31093 H2-M3 Histocompatibility 2, M region locus 3 P62806 Hist1h4a Histone H4 Q920N2 Hlcs Biotin--protein ligase Q9CX86 Hnrnpa0 Heterogeneous nuclear ribonucleoprotein A0 G3XA10 Hnrnpu Heterogeneous nuclear ribonucleoprotein U P31245 Hoxa2 Homeobox protein Hox-A2 P38533-2 Hsf2 Isoform Beta of Heat shock factor protein 2 A0A0B4J1F7 Igbp1b Immunoglobulin-binding protein 1b D3Z5P5 Ighmbp2 DNA-binding protein SMUBP-2 G3UWZ3 Kmt2c Histone-lysine N-methyltransferase 2C (Fragment) Q8BVP2 Ldhal6b L-lactate dehydrogenase A9DA50 Lingo1 Leucine-rich repeat and immunoglobulin-like domain- containing nogo receptor-interacting protein 1 Q8BM41 Lsm14b Protein LSM14 homolog B Q8CF90 Mafa Transcription factor MafA Q9CQU1 Mfap1 Microfibrillar-associated protein 1 Q9QXP6 Mkrn1 E3 ubiquitin-protein ligase makorin-1 Q8BK72 Mrps27 28S ribosomal protein S27, mitochondrial Q5ND45 Myo1c Unconventional myosin-Ic (Fragment) D3Z3A8 Myo9a Unconventional myosin-IXa Q9D020-1 Nt5c3a Isoform 1 of Cytosolic 5'-nucleotidase 3A G3X9N5 Nxph4 Neurexophilin 4 P00860 Odc1 Ornithine decarboxylase Q7TS32 Olfr213 Olfactory receptor 213 F7A4A7-2 Otogl Isoform 2 of Otogelin-like protein Q5SUR0 Pfas Phosphoribosylformylglycinamidine synthase F6QPR1 Phb2 Prohibitin-2 (Fragment) F7C9H0 Postn Periostin (Fragment) Q5SVM1 Prl2c1 Prolactin family 2, subfamily c, member 1 Q9JIF0-3 Prmt1 Isoform 3 of Protein arginine N-methyltransferase 1 Q9Z1R9 Prss1 MCG124046 Q8BHD7-2 Ptbp3 Isoform 2 of Polypyrimidine tract-binding protein 3 P51150 Rab7a Ras-related protein Rab-7a B2RY56 Rbm25 RNA-binding protein 25 A0A140LIN5 Rfpl4 Ret finger protein-like 4 ©2020 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db19-1060/-/DC1 SUPPLEMENTARY DATA P35979 Rpl12 60S ribosomal protein L12 Q9CR57 Rpl14 60S ribosomal protein L14 A0A1D5RMC7 Rpl18a 60S ribosomal protein L18a P41105 Rpl28 60S ribosomal protein L28 Q6ZWV7 Rpl35 60S ribosomal protein L35 P61514 Rpl37a 60S ribosomal protein L37a P62892 Rpl39 60S ribosomal protein L39 P63325 Rps10 40S ribosomal protein S10 A0A1B0GRR3 Rps11 40S ribosomal protein S11 P62242 Rps8 40S ribosomal protein S8 Q7M732 Rtl1 Retrotransposon-like protein 1 Q6V4S5 Sdk2 Protein sidekick-2 A0A0N4SUQ1 Serbp1 Plasminogen activator inhibitor 1 RNA-binding protein G5E866 Sf3b1 Splicing factor 3B subunit 1 Q8VIJ6 Sfpq Splicing factor, proline- and glutamine-rich Q9DB41-2 Slc25a18 Isoform 2 of Mitochondrial glutamate carrier 2 P62320 Snrpd3 Small nuclear ribonucleoprotein Sm D3 E9Q0W8 Snrpe Small nuclear ribonucleoprotein E G3UXB6 Snx14 Sorting nexin-14 F8WI90 Src Tyrosine-protein kinase H7BX95 Srsf1 Serine/arginine-rich-splicing factor 1 Q8C8J0 Stpg2 Sperm-tail PG-rich repeat-containing protein 2 F7AGT6 Tacc3 Transforming acidic coiled-coil-containing protein 3 (Fragment) F8VQE6 Tatdn2 TatD DNase domain-containing 2 Q9CQT0 Thg1l tRNA(His) guanylyltransferase D3Z6I8 Tpm3 Tropomyosin alpha-3 chain Q8VIG6 Traip E3 ubiquitin-protein ligase TRAIP Q9JJH7-3 Trpm5 Isoform 3 of Transient receptor potential cation channel subfamily M member 5 Q497K6 Ttc6 Tetratricopeptide repeat domain 6 Q6P3Y6 Ttc9c Tetratricopeptide repeat protein 9C A6PWR8 Usp43 Ubiquitin carboxyl-terminal hydrolase 43 Q8BGQ1-2 Vipas39 Isoform 2 of Spermatogenesis-defective protein 39 homolog B9EI21 Zmat3 Zinc finger matrin type 3 ©2020 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db19-1060/-/DC1 SUPPLEMENTARY DATA Supplementary Table 6. List of the interactive proteins of HRD1 in Ad-HRD1-transfected MIN6 cells analyzed by mass spectrometry. First protein Gene name Description Q8VDD5 Myh9 Myosin-9 P01868 Ighg1 Ig gamma-1 chain C region secreted form Q3U9N4 Grn Granulins P63268 Actg2 Actin, gamma-enteric smooth muscle P11499 Hsp90ab1 Heat shock protein HSP 90-beta P48962 Slc25a4 ADP/ATP translocase 1 P01631 Ig kappa chain V-II region 26-10 P68372 Tubb4b Tubulin beta-4B chain Q3V117 Acly ATP-citrate synthase A2AL12 Hnrnpa3 Heterogeneous nuclear ribonucleoprotein A3 P03975 Iap IgE-binding protein Q9DBY1-2 Syvn1 Isoform 2 of E3 ubiquitin-protein ligase synoviolin P19157 Gstp1 Glutathione S-transferase P 1 Q8C2Q7 Hnrnph1 Heterogeneous nuclear ribonucleoprotein H Q99K48 Nono Non-POU domain-containing octamer-binding protein P97351 Rps3a 40S ribosomal protein S3a Q6P5D4 Cep135 Centrosomal protein of 135 kDa P45878 Fkbp2 Peptidyl-prolyl cis-trans isomerase FKBP2 A0A0A6YW67 Gm8797 MCG23377, isoform CRA_b Q3TML0 Pdia6 Protein disulfide-isomerase A6 P14148 Rpl7 60S ribosomal protein L7 A0A0U1RQ71 Rps13 40S
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Electronic Supplementary Material (ESI) for Molecular Biosystems
    Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is © The Royal Society of Chemistry 2015 Table S5 Mass data of proteins identified with label free shotgun proteomics a #Alt. Proteins; b Scores; c #Peptides; d SC [%]; e RMS90 [ppm]; f Rank; g Median(Controls:GLP1); h #(Controls:GLP1); i CV [%](Controls:GLP1); l Median(Controls:Palmitate); m #(Controls:Palmitate) ; n CV [%](Controls:Palmitate); o Median(Controls:GLP1 + Palmitate); p #(Controls:GLP1 + Palmitate); q CV [%](Controls:GLP1 + Palmitate) MW OK Accession Protein pI a b c d e f g h i l m n o p q [kDa] 78 kDa glucose-regulated protein OS=Rattus 1672.6 true GRP78_RAT 72.3 4.9 1 22 39 1.48 1 1.16 6 20.53 1.18 9 9.56 1.24 10 13.52 norvegicus GN=Hspa5 PE=1 SV=1 (M:1672.6) Endoplasmin OS=Rattus norvegicus 1253.0 true ENPL_RAT 92.7 4.6 1 23 29 3.34 2 0.85 8 33.34 1.19 6 39.58 1.18 10 28.11 GN=Hsp90b1 PE=1 SV=2 (M:1253.0) Stress-70 protein, mitochondrial OS=Rattus 1138.8 true GRP75_RAT 73.8 5.9 1 17 28.7 1.18 3 1.21 5 7.62 0.78 1 1.1 8 8.04 norvegicus GN=Hspa9 PE=1 SV=3 (M:1138.8) Protein disulfide-isomerase A3 OS=Rattus 1035.4 true PDIA3_RAT 56.6 5.8 1 16 35.2 2.84 4 0.94 3 17.22 1.15 4 26.62 1.25 4 7.86 norvegicus GN=Pdia3 PE=1 SV=2 (M:1035.4) Aconitate hydratase, mitochondrial 983.8 true ACON_RAT OS=Rattus norvegicus GN=Aco2 PE=1 85.4 8.7 1 19 31.4 2.72 5 0.89 2 23.6 1.21 2 9.25 0.89 3 32.87 (M:983.8) SV=2 60 kDa heat shock protein, mitochondrial 906.9 true CH60_RAT OS=Rattus norvegicus GN=Hspd1 PE=1 60.9 5.8 1 13 32.5 3.26 6 1.05 5 13.15 1.01 2 32.54 1.01
    [Show full text]
  • CYB5R3 Gene Cytochrome B5 Reductase 3
    CYB5R3 gene cytochrome b5 reductase 3 Normal Function The CYB5R3 gene provides instruction for making an enzyme called cytochrome b5 reductase 3. This enzyme is involved in transferring negatively charged particles called electrons from one molecule to another. Two versions (isoforms) of this enzyme are produced from the CYB5R3 gene. The soluble isoform is present only in red blood cells, and the membrane-bound isoform is found in all other cell types. Normal red blood cells contain molecules of iron-containing hemoglobin, which deliver oxygen to the body's tissues. The iron in hemoglobin is ferrous (Fe2+), but it can spontaneously become ferric (Fe3+). Hemoglobin that contains ferric iron is called methemoglobin, and it cannot deliver oxygen. The soluble isoform of cytochrome b5 reductase 3 changes ferric iron back to ferrous iron so hemoglobin can function. Normally, red blood cells contain less than 2 percent methemoglobin. The membrane-bound isoform is embedded in the membranes of various cellular compartments and is widely used in the body. This isoform is necessary for many chemical reactions, including the breakdown and formation of fatty acids, the formation of cholesterol, and the breakdown of various molecules and drugs. Health Conditions Related to Genetic Changes Autosomal recessive congenital methemoglobinemia More than 65 mutations in the CYB5R3 gene have been found to cause autosomal recessive congenital methemoglobinemia types I and II. Most of these CYB5R3 gene mutations cause autosomal recessive congenital methemoglobinemia type I, which is characterized by a lack of oxygen in the body's tissues and bluish appearance of the skin, lips, and nails (cyanosis).
    [Show full text]
  • Murine Neonatal Ketogenesis Preserves Mitochondrial Energetics by Preventing Protein Hyperacetylation
    ARTICLES https://doi.org/10.1038/s42255-021-00342-6 Murine neonatal ketogenesis preserves mitochondrial energetics by preventing protein hyperacetylation Yuichiro Arima 1,2,13 ✉ , Yoshiko Nakagawa3,13, Toru Takeo 3,13, Toshifumi Ishida 1, Toshihiro Yamada1, Shinjiro Hino4, Mitsuyoshi Nakao4, Sanshiro Hanada 2, Terumasa Umemoto 2, Toshio Suda2, Tetsushi Sakuma 5, Takashi Yamamoto5, Takehisa Watanabe6, Katsuya Nagaoka6, Yasuhito Tanaka6, Yumiko K. Kawamura7,8, Kazuo Tonami7, Hiroki Kurihara7, Yoshifumi Sato9, Kazuya Yamagata9,10, Taishi Nakamura 1,11, Satoshi Araki1, Eiichiro Yamamoto1, Yasuhiro Izumiya1,12, Kenji Sakamoto1, Koichi Kaikita1, Kenichi Matsushita 1, Koichi Nishiyama2, Naomi Nakagata3 and Kenichi Tsujita1,10 Ketone bodies are generated in the liver and allow for the maintenance of systemic caloric and energy homeostasis during fasting and caloric restriction. It has previously been demonstrated that neonatal ketogenesis is activated independently of starvation. However, the role of ketogenesis during the perinatal period remains unclear. Here, we show that neonatal ketogen- esis plays a protective role in mitochondrial function. We generated a mouse model of insufficient ketogenesis by disrupting the rate-limiting hydroxymethylglutaryl-CoA synthase 2 enzyme gene (Hmgcs2). Hmgcs2 knockout (KO) neonates develop microvesicular steatosis within a few days of birth. Electron microscopic analysis and metabolite profiling indicate a restricted energy production capacity and accumulation of acetyl-CoA in Hmgcs2 KO mice. Furthermore,
    [Show full text]
  • FKBP52 Regulates TRPC3-Dependent Ca<Sup>
    © 2019. Published by The Company of Biologists Ltd | Journal of Cell Science (2019) 132, jcs231506. doi:10.1242/jcs.231506 RESEARCH ARTICLE FKBP52 regulates TRPC3-dependent Ca2+ signals and the hypertrophic growth of cardiomyocyte cultures Sandra Bandleon1, Patrick P. Strunz1, Simone Pickel2, Oleksandra Tiapko3, Antonella Cellini1, Erick Miranda-Laferte2 and Petra Eder-Negrin1,* ABSTRACT A single TRPC subunit is composed of six transmembrane The transient receptor potential (TRP; C-classical, TRPC) channel domains with a pore-forming loop connecting the transmembrane ‘ ’ TRPC3 allows a cation (Na+/Ca2+) influx that is favored by the domains 5 and 6, a preserved 25 amino acid sequence called a TRP domain and two cytosolic domains, an N-terminal ankyrin repeat stimulation of Gq protein-coupled receptors (GPCRs). An enhanced TRPC3 activity is related to adverse effects, including pathological domain and a C-terminal coiled-coil domain (Eder et al., 2007; Fan hypertrophy in chronic cardiac disease states. In the present study, et al., 2018). The cytosolic domains mediate ion channel formation we identified FK506-binding protein 52 (FKBP52, also known as and are implicated in ion channel regulation and plasma membrane FKBP4) as a novel interaction partner of TRPC3 in the heart. FKBP52 targeting (Eder et al., 2007). Among several protein interaction sites, was recovered from a cardiac cDNA library by a C-terminal TRPC3 the C-terminus of all TRPC subunits harbors a highly conserved fragment (amino acids 742–848) in a yeast two-hybrid screen. proline-rich sequence that corresponds to the binding domain in the Drosophila Downregulation of FKBP52 promoted a TRPC3-dependent photoreceptor channel TRPL for the FK506-binding hypertrophic response in neonatal rat cardiomyocytes (NRCs).
    [Show full text]
  • Genome-Wide Analysis of Epigenetic Silencing Identifies BEX1 and BEX2 As Candidate Tumor Suppressor Genes in Malignant Glioma
    Research Article Genome-Wide Analysis of Epigenetic Silencing Identifies BEX1 and BEX2 as Candidate Tumor Suppressor Genes in Malignant Glioma Greg Foltz,1,3 Gi-Yung Ryu,1 Jae-Geun Yoon,1 Timothy Nelson,1 Jessica Fahey,1 Amanda Frakes,1 Hwahyung Lee,1 Lorie Field,1 Kaitlin Zander,1 Zita Sibenaller,1 Timothy C. Ryken,1 Rajeev Vibhakar,2 Leroy Hood,3 and Anup Madan1,3 1Neurogenomic Research Laboratory, Department of Neurosurgery; 2Department of Pediatrics, University of Iowa Carver College of Medicine, Iowa City, Iowa; and 3Institute for Systems Biology, Seattle, Washington Abstract common underlying epigenetic mechanisms, such as promoter hypermethylation, histone deacetylation, histone methylation, Promoter hypermethylation and histone deacetylation are and other histone modifications, which directly or indirectly common epigenetic mechanisms implicated in the transcrip- alter chromatin structure (3–5). When combined with microarray tional silencing of tumor suppressor genes in human cancer. analysis, the pharmacologic reversal of one or more of these We treated two immortalized glioma cell lines, T98 and U87, common underlying epigenetic mechanisms provides a powerful and 10patient-derived primary glioma cell lines with screening tool for the comprehensive identification of epigenet- trichostatin A (TSA), a histone deacetylase inhibitor, or 5- ically silenced genes on a global scale. Several recent studies aza-2¶-deoxycytidine (5-AzaC), a DNA methyltransferase in- have validated this large-scale approach using DNA methyltrans- hibitor, to comprehensively identify the cohort of genes ferase and histone deacetylase (HDAC) inhibitors, either alone or reactivated through the pharmacologic reversal of these in combination, in a variety of human cancers, including distinct but related epigenetic processes.
    [Show full text]
  • KENNETH B. STOREY and ERNEST BAILEY Department of Biochemistry, University of Sheffield, Sheffield SI0 2TN, U.K
    Insect Biochem.,. 1978, Vol. 8, pp. 125 to 131. Peroamon Press. Printed in Great Britain INTRACELLULAR DISTRIBUTION OF ENZYMES ASSOCIATED WITH LIPOGENESIS AND GLUCONEOGENESIS IN FAT BODY OF THE ADULT COCKROACH, PERIPLANETA KENNETH B. STOREY and ERNEST BAILEY Department of Biochemistry, University of Sheffield, Sheffield SI0 2TN, U.K. (Received 30 April 1977) Abstract--The intracellular distribution and maximal activities of some enzymes associated with lipo- genesis, gluconeogenesis and fatty acid oxidation have been determined in the fat body of the adult male cockroach Periplaneta americana. Of the enzymes of lipogenesis, acetyl-CoA synthase, acetyl-CoA carboxylase, glucose 6-phosphate dehydrogenase, and ATP citrate lyase are located entirely in the cytosol. Of the other enzymes of citrate metabolism studied, citrate synthase and NAD-dependent isocitrate dehydrogenase are almost exclusively mitochondrial, whereas NADP-dependent isocitrate dehydrogenase and aconitase are predominantly cytosolic although significant mitochondrial activity is also present. The latter subeellular distribution is also observed for 'malic enzyme' and NAD and NADP dependent malate dehydrogenase. The enzyme of fatty acid oxidation studied, 3-hydroxyacyl- CoA dehydrogenase is entirely mitochondrial. Of the enzymes possibly involved in glueoneogenesis, glucose 6-phosphate is microsomal, fructose 1,6-diphosphatase cytosolic, pyruvate carboxylase mito- chondrial and phosphoenolpyruvate carboxykinase predominantly eytosolic. Of the enzymes of amino acid metabolism studied, glutamate dehydrogenase is NAD-dependent and located in the mitochondria whereas glutamate/oxalacetate and glutamate/pyruvate transaminases are predominantly cytosolic but with significant activity in the mitochondria. Glycerol kinase and sorbitol dehydrogenase are cytosolic and the glyoxylate cycle enzymes malate synthetase and isocitrate lyase are not detected in the fat body.
    [Show full text]
  • Bioinformatics Analysis Based on Gene Expression Omnibus
    ANTICANCER RESEARCH 39 : 1689-1698 (2019) doi:10.21873/anticanres.13274 Chemo-resistant Gastric Cancer Associated Gene Expression Signature: Bioinformatics Analysis Based on Gene Expression Omnibus JUN-BAO LIU 1* , TUNYU JIAN 2* , CHAO YUE 3, DAN CHEN 4, WEI CHEN 5, TING-TING BAO 6, HAI-XIA LIU 7, YUN CAO 8, WEI-BING LI 6, ZHIJIAN YANG 9, ROBERT M. HOFFMAN 9 and CHEN YU 6 1Traditional Chinese Medicine Department, People's Hospital of Henan Province, People's Hospital of Zhengzhou University, Zhengzhou, P.R. China; 2Institute of Botany, Jiangsu Province and Chinese Academy of Sciences, Nanjing, P.R. China; 3Department of general surgery, Jiangsu Cancer Hospital & Jiangsu Institute of Cancer Research & The Affiliated Cancer Hospital of Nanjing Medical University, Nanjing, P.R. China; 4Research Center of Clinical Oncology, Jiangsu Cancer Hospital & Jiangsu Institute of Cancer Research & The Affiliated Cancer Hospital of Nanjing Medical University, Nanjing, P.R. China; 5Department of Head and Neck Surgery, Jiangsu Cancer Hospital & Jiangsu Institute of Cancer Research & The Affiliated Cancer Hospital of Nanjing Medical University, Nanjing, P.R. China; 6Department of Integrated TCM & Western Medicine, Jiangsu Cancer Hospital & Jiangsu Institute of Cancer Research & The Affiliated Cancer Hospital of Nanjing Medical University, Nanjing, P.R. China; 7Emergency Department, The Second Affiliated Hospital of Nanjing University of Chinese Medicine, Nanjing, P.R. China; 8Master candidate of Oncology, Nanjing University of Chinese Medicine, Nanjing, P.R. China; 9AntiCancer, Inc., San Diego, CA, U.S.A. Abstract. Background/Aim: This study aimed to identify identified, including 13 up-regulated and 1,473 down-regulated biomarkers for predicting the prognosis of advanced gastric genes.
    [Show full text]
  • Candidate Genes Linked to QTL Regions Associated with Fatty Acid
    1 Candidate genes linked to QTL regions associated with fatty acid composition in oil palm 2 3 Abstract 4 5 The present study searched for candidate genes in five linkage groups (LGs) - T2, T3, OT4, OT6 and T9 hosting the QTLs 6 associated with iodine value (IV) and fatty acid composition (FAC) in an oil palm interspecific hybrid population. Each 7 of the five LGs was successfully anchored to its corresponding chromosomal segment where, a wider repertoire of 8 candidate genes was identified. This study further revealed a total of 19 candidate genes and four transcription factors 9 involved in biosynthesis of fatty acids, lipids (including triacylglycerol) and acetyl-CoA, glycosylation and degradation 10 of fatty acids. Their possible involvement in regulating the levels of saturation are discussed. In addition, 22 candidate 11 genes located outside the QTL intervals were also identified across the interspecific hybrid genome. A total of 92 SSR 12 markers were developed to tag the presence of these candidate genes and 50 were successfully mapped onto their 13 respective positions on the genome. The data obtained here complements the previous studies, and collectively, these 14 QTL-linked candidate gene markers could help breeders in more precisely selecting palms with the desired FAC. 15 16 Keywords 17 18 Elaeis guineensis, interspecific hybrid, fatty acid biosynthesis, triacylglycerol biosynthesis, transcription factors, genetic 19 linkage map 20 21 Abbreviations 22 23 4CLL1 4-coumarate--CoA ligase 1 24 AACT acetoacetyl-CoA thiolase 25 acbd4 acyl-CoA-binding domain-containing protein 4 26 ACX4 acyl-CoA oxidase 4 27 C14:0 myristic acid 28 C16:0 palmitic acid 29 C16:1 palmitoleic acid 30 C18:0 stearic acid 31 C18:1 oleic acid 32 C18:2 linoleic acid 33 CHR pseudo-chromosome 34 cM centiMorgan 35 CP cross pollinator 36 CPO crude palm oil 37 CTAB cetyltriammonium bromide 38 DNA deoxyribonucleic acid 39 EG5 E.
    [Show full text]
  • Senescence Inhibits the Chaperone Response to Thermal Stress
    SUPPLEMENTAL INFORMATION Senescence inhibits the chaperone response to thermal stress Jack Llewellyn1, 2, Venkatesh Mallikarjun1, 2, 3, Ellen Appleton1, 2, Maria Osipova1, 2, Hamish TJ Gilbert1, 2, Stephen M Richardson2, Simon J Hubbard4, 5 and Joe Swift1, 2, 5 (1) Wellcome Centre for Cell-Matrix Research, Oxford Road, Manchester, M13 9PT, UK. (2) Division of Cell Matrix Biology and Regenerative Medicine, School of Biological Sciences, Faculty of Biology, Medicine and Health, Manchester Academic Health Science Centre, University of Manchester, Manchester, M13 9PL, UK. (3) Current address: Department of Biomedical Engineering, University of Virginia, Box 800759, Health System, Charlottesville, VA, 22903, USA. (4) Division of Evolution and Genomic Sciences, School of Biological Sciences, Faculty of Biology, Medicine and Health, Manchester Academic Health Science Centre, University of Manchester, Manchester, M13 9PL, UK. (5) Correspondence to SJH ([email protected]) or JS ([email protected]). Page 1 of 11 Supplemental Information: Llewellyn et al. Chaperone stress response in senescence CONTENTS Supplemental figures S1 – S5 … … … … … … … … 3 Supplemental table S6 … … … … … … … … 10 Supplemental references … … … … … … … … 11 Page 2 of 11 Supplemental Information: Llewellyn et al. Chaperone stress response in senescence SUPPLEMENTAL FIGURES Figure S1. A EP (passage 3) LP (passage 16) 200 µm 200 µm 1.5 3 B Mass spectrometry proteomics (n = 4) C mRNA (n = 4) D 100k EP 1.0 2 p < 0.0001 p < 0.0001 LP p < 0.0001 p < 0.0001 ) 0.5 1 2 p < 0.0001 p < 0.0001 10k 0.0 0 -0.5 -1 Cell area (µm Cell area fold change vs. EP fold change vs.
    [Show full text]
  • FABP7 Regulates Acetyl-Coa Metabolism Through the Interaction with ACLY in the Nucleus of Astrocytes
    Molecular Neurobiology (2020) 57:4891–4910 https://doi.org/10.1007/s12035-020-02057-3 FABP7 Regulates Acetyl-CoA Metabolism Through the Interaction with ACLY in the Nucleus of Astrocytes Yoshiteru Kagawa1 & Banlanjo Abdulaziz Umaru1 & Hiroki Shima2 & Ryo Ito3 & Ryo Zama1 & Ariful Islam1 & Shin-ichiro Kanno4 & Akira Yasui4 & Shun Sato5 & Kosuke Jozaki5 & Subrata Kumar Shil1 & Hirofumi Miyazaki1 & Shuhei Kobayashi1 & Yui Yamamoto1 & Hiroshi Kogo6 & Chie Shimamoto-Mitsuyama7 & Akira Sugawara3 & Norihiro Sugino5 & Masayuki Kanamori8 & Teiji Tominaga8 & Takeo Yoshikawa7 & Kohji Fukunaga9 & Kazuhiko Igarashi2 & Yuji Owada1 Received: 27 April 2020 /Accepted: 7 August 2020 / Published online: 19 August 2020 # The Author(s) 2020 Abstract Fatty acid binding protein 7 (FABP7) is an intracellular fatty acid chaperon that is highly expressed in astrocytes, oligodendrocyte-precursor cells, and malignant glioma. Previously, we reported that FABP7 regulates the response to extracel- lular stimuli by controlling the expression of caveolin-1, an important component of lipid raft. Here, we explored the detailed mechanisms underlying FABP7 regulation of caveolin-1 expression using primary cultured FABP7-KO astrocytes as a model of loss of function and NIH-3T3 cells as a model of gain of function. We discovered that FABP7 interacts with ATP-citrate lyase (ACLY) and is important for acetyl-CoA metabolism in the nucleus. This interaction leads to epigenetic regulation of several genes, including caveolin-1. Our novel findings suggest that FABP7-ACLY modulation of nuclear acetyl-CoA has more influence on histone acetylation than cytoplasmic acetyl-CoA. The changes to histone structure may modify caveolae-related cell activity in astrocytes and tumors, including malignant glioma. Keywords Fatty acid–binding protein (FABP) .
    [Show full text]
  • Epigenetic Regulation of Developmental Expression of Cyp2d Genes in Mouse Liver
    CORE Metadata, citation and similar papers at core.ac.uk Provided by Elsevier - Publisher Connector Acta Pharmaceutica Sinica B 2012;2(2):146–158 Institute of Materia Medica, Chinese Academy of Medical Sciences Chinese Pharmaceutical Association Acta Pharmaceutica Sinica B www.elsevier.com/locate/apsb www.sciencedirect.com ORIGINAL ARTICLE Epigenetic regulation of developmental expression of Cyp2d genes in mouse liver Ye Lia, Xiao-bo Zhongb,n aDepartment of Pharmacology, School of Chemical Biology and Pharmaceutical Sciences, Capital Medical University, Beijing 100069, China bDepartment of Pharmacology, Toxicology, and Therapeutics, University of Kansas Medical Center, Kansas City, KS 66160, USA Received 28 November 2011; revised 26 December 2011; accepted 10 January 2012 KEY WORDS Abstract CYP2D6 expression in liver is age-dependent. Because epigenetic mechanisms, such as DNA methylation and histone modifications, modulate age-related gene expression during develop- Cyp2d; ment, and are highly conserved among species, the current study examined the epigenetic regulation of DNA methylation; age-related expression of the Cyp2d genes in mouse liver. DNA methylation (DNAme), histone 3 Histone methylation; lysine 4 dimethylation (H3K4me2), and histone 3 lysine 27 trimethylation (H3K27me3) was Liver development established by ChIP-on-chip tiling microarrays from mouse livers at prenatal, neonatal, and adult stages. Levels of DNAme, H3K4me2, and H3K27me3 were analyzed in a genomic region containing the Cyp2d clustering genes and their surrounding genes. Gradually increased expression levels of the Cyp2d9, Cyp2d10, Cyp2d22,andCyp2d26 genes from prenatal, through neonatal, to adult are associated with gradually increased levels of H3K4me2 in the nucleosomes associated with these genes. Gene expression patterns during liver development in several Cyp2d surrounding genes, such as Srebf2, Sept3, Ndufa6, Tcf2, Nfam1,andCyb5r3, could be also explained by changes of DNA methylation, H3K4me2, or H3K27me3 in those genes.
    [Show full text]