<<

SUPPLEMENTARY DATA Supplementary Table 1. SiRNA sequence (5’-3’)

Gene Forward Reverse

si-HRD1-1# GCAUGGCAGUCCUGUACAU dTdT AUGUACAGGACUGCCAUGC dTdT si-HRD1-2# GAGCCAUCCGCAACAUGAA dTdT UUCAUGUUGCGGAUGGCUC dTdT si-MafA CCAUCGAGUACGUCAACGA dTdT UCGUUGACGUACUCGAUGG dTdT

©2020 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db19-1060/-/DC1 SUPPLEMENTARY DATA Supplementary Table 2. Primer sequences for qRT-PCR (5’-3’)

Gene Forward Reverse

human HRD1 GCTCACGCCTACTACCTCAAA GCCAGACAAGTCTCTGTGACG

mouse mafA AAGCGGCGCACGCTCAAGAA GGTCCCGCTCCTTGGCCAGA

mouse insulin1 CACTTCCTACCCCTGCTGG ACCACAAAGATGCTGTTTGACA

mouse β-actin AGGCCAACCGTGAAAAGATG AGAGCATAGCCCTCGTAGATGG

human β-actin CATGTACGTTGCTATCCAGGC CTCCTTAATGTCACGCACGAT

©2020 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db19-1060/-/DC1 SUPPLEMENTARY DATA Supplementary Table 3. Primer sequences for ChIP (5’-3’)

Gene promoter Forward Reverse mouse Insulin1, 2 GGAACTGTGAAACAGTCCAAGG CCCCCTGGACTTTGCTGTTTG

©2020 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db19-1060/-/DC1 SUPPLEMENTARY DATA Supplementary Table 4. Primer sequences for PCR (5’-3’)

Gene Forward Reverse

HRD1-pDsred CCCAAGCTTATGTTCCGCACCGCAGT GGGGTACCCAGTGGGCAACAGGGG HRD1-pCMV- Flag GGGGTACCATGTTCCGCACCGCAGT CCCAAGCTTGTGGGCAACAGGGGACT C HRD1-pCMV-HA GGCCATGGGCCATATGGGATCCTTCC AGGGATGCCACCCGGGGATCCTCAGT GCACCGCAGTGATG GGGCAACAGGGGAC HRD1-N-HA GGCCATGGGCCATATGGGATCCTTCC AGGGATGCCACCCGGGGATCCGACAT GCACCGCAGTGATG TATCCATTGCCTGGAGC HRD1-N-RING- GGCCATGGGCCATATGGGATCCTTCC AGGGATGCCACCCGGGGATCCGCATG HA GCACCGCAGTGATG TCGGGCAGGTCTGC HRD1-C-HA GGCCATGGGCCATATGGGATCCCGCA AGGGATGCCACCCGGGGATCCTCAGT TGGATGTCCTGCGG GGGCAACAGGGGAC mafA-pCMV-Myc ACAAGATCTGATGGCCGCGGAGCTG AGATAAGCTTATCAGAAAGAAGTCGG G GTGCGCCT mafA-pEGFP CGACTTCTTTCTGATAAGCTTGGTGA TCCTCTGCCATGATCAAGCTCTTGTAC GCAAGGGCGAGG AGCTCGTCCATGCCG

©2020 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db19-1060/-/DC1 SUPPLEMENTARY DATA Supplementary Table 5. List of the interactive proteins of HRD1 in Ad-GFP-transfected MIN6 cells analyzed by mass spectrometry.

First protein Gene name Description Q8VDD5 Myh9 Myosin-9 Q3U9N4 Grn Granulins P63268 Actg2 Actin, gamma-enteric smooth muscle P11499 Hsp90ab1 Heat shock protein HSP 90-beta Q5SV64 Myh10 Myosin-10 P01631 Ig kappa chain V-II region 26-10 Q3V117 Acly ATP- A2AL12 Hnrnpa3 Heterogeneous nuclear ribonucleoprotein A3 P03975 Iap IgE-binding protein Q6ZWQ9 Myl12a MCG5400 Q9DBY1-2 Syvn1 Isoform 2 of E3 ubiquitin-protein synoviolin P19157 Gstp1 Glutathione S- P 1 Q8C2Q7 Hnrnph1 Heterogeneous nuclear ribonucleoprotein H Q99K48 Nono Non-POU domain-containing octamer-binding protein P97351 Rps3a 40S ribosomal protein S3a A0A0A6YW67 Gm8797 MCG23377, isoform CRA_b K3W4R2 Myh14 Myosin-14 P14148 Rpl7 60S ribosomal protein L7 A0A0U1RQ71 Rps13 40S ribosomal protein S13 P62264 Rps14 40S ribosomal protein S14 P60867 Rps20 40S ribosomal protein S20 A0A140LI77 Rps3 40S ribosomal protein S3 Q921M3-2 Sf3b3 Isoform 2 of Splicing factor 3B subunit 3 G5E902 Slc25a3 MCG10343, isoform CRA_b Q3U7K7 Trim21 E3 ubiquitin-protein ligase TRIM21 M0QWA8 1810046K07Rik RIKEN cDNA 1810046K07 gene (Fragment) Q6P8Q2 Abcc5 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 Q9CQR4 Acot13 Acyl- thioesterase 13 A0A0G2JF20 Alg14 UDP-N-acetylglucosamine transferase subunit ALG14 homolog F8VPQ6 Alpi Alkaline phosphatase Q8C8R3-8 Ank2 Isoform 8 of Ankyrin-2 D3Z482 Ankrd26 Ankyrin repeat domain-containing protein 26 Q91YM2 Arhgap35 Rho GTPase-activating protein 35 Q8BGU5-2 Ccny Isoform 2 of Cyclin-Y P97377-2 Cdk2 Isoform CDK2-alpha of Cyclin-dependent kinase 2 Q924X2 Cpt1b Carnitine O-palmitoyltransferase 1, muscle isoform A0A0A0MQM3 Cyb5r3 NADH- 3 (Fragment) Q8JZM4 Dner Delta and Notch-like epidermal growth factor-related receptor P59764 Dock4 Dedicator of cytokinesis protein 4 Q45VK7 Dync2h1 Cytoplasmic dynein 2 heavy chain 1 P62869 Elob Elongin-B A0A087WPE4 Eloc Elongin-C (Fragment) B0QZL1 Eno1 Alpha-enolase (Fragment)

©2020 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db19-1060/-/DC1 SUPPLEMENTARY DATA P84089 Erh Enhancer of rudimentary homolog D6RFC8 Fbxl2 F-box/LRR-repeat protein 2 Q8BMI0 Fbxo38 F-box only protein 38 Q91WF7 Fig4 Polyphosphoinositide phosphatase Q9Z2I2 Fkbp1b Peptidyl-prolyl cis-trans FKBP1B F7CBR4 Gcnt7 Beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N- acetylglucosaminyltransferase 7 (Fragment) B2FDI6 Ggta1 N-acetyllactosaminide alpha-1,3-galactosyltransferase (Fragment) Q53YU8 Gkn1 Foveolin D3Z5N9 Gm5449 MCG49198 E9Q343 Gpr137c G protein-coupled receptor 137C Q3THK3 Gtf2f1 General transcription factor IIF subunit 1 Q31093 H2-M3 Histocompatibility 2, M region 3 P62806 Hist1h4a Histone H4 Q920N2 Hlcs Biotin--protein ligase Q9CX86 Hnrnpa0 Heterogeneous nuclear ribonucleoprotein A0 G3XA10 Hnrnpu Heterogeneous nuclear ribonucleoprotein U P31245 Hoxa2 Homeobox protein Hox-A2 P38533-2 Hsf2 Isoform Beta of Heat shock factor protein 2 A0A0B4J1F7 Igbp1b Immunoglobulin-binding protein 1b D3Z5P5 Ighmbp2 DNA-binding protein SMUBP-2 G3UWZ3 Kmt2c Histone-lysine N-methyltransferase 2C (Fragment) Q8BVP2 Ldhal6b L-lactate dehydrogenase A9DA50 Lingo1 Leucine-rich repeat and immunoglobulin-like domain- containing nogo receptor-interacting protein 1 Q8BM41 Lsm14b Protein LSM14 homolog B Q8CF90 Mafa Transcription factor MafA Q9CQU1 Mfap1 Microfibrillar-associated protein 1 Q9QXP6 Mkrn1 E3 ubiquitin-protein ligase makorin-1 Q8BK72 Mrps27 28S ribosomal protein S27, mitochondrial Q5ND45 Myo1c Unconventional myosin-Ic (Fragment) D3Z3A8 Myo9a Unconventional myosin-IXa Q9D020-1 Nt5c3a Isoform 1 of Cytosolic 5'-nucleotidase 3A G3X9N5 Nxph4 Neurexophilin 4 P00860 Odc1 Ornithine decarboxylase Q7TS32 Olfr213 Olfactory receptor 213 F7A4A7-2 Otogl Isoform 2 of Otogelin-like protein Q5SUR0 Pfas Phosphoribosylformylglycinamidine synthase F6QPR1 Phb2 Prohibitin-2 (Fragment) F7C9H0 Postn Periostin (Fragment) Q5SVM1 Prl2c1 Prolactin family 2, subfamily c, member 1 Q9JIF0-3 Prmt1 Isoform 3 of Protein arginine N-methyltransferase 1 Q9Z1R9 Prss1 MCG124046 Q8BHD7-2 Ptbp3 Isoform 2 of Polypyrimidine tract-binding protein 3 P51150 Rab7a Ras-related protein Rab-7a B2RY56 Rbm25 RNA-binding protein 25 A0A140LIN5 Rfpl4 Ret finger protein-like 4

©2020 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db19-1060/-/DC1 SUPPLEMENTARY DATA P35979 Rpl12 60S ribosomal protein L12 Q9CR57 Rpl14 60S ribosomal protein L14 A0A1D5RMC7 Rpl18a 60S ribosomal protein L18a P41105 Rpl28 60S ribosomal protein L28 Q6ZWV7 Rpl35 60S ribosomal protein L35 P61514 Rpl37a 60S ribosomal protein L37a P62892 Rpl39 60S ribosomal protein L39 P63325 Rps10 40S ribosomal protein S10 A0A1B0GRR3 Rps11 40S ribosomal protein S11 P62242 Rps8 40S ribosomal protein S8 Q7M732 Rtl1 Retrotransposon-like protein 1 Q6V4S5 Sdk2 Protein sidekick-2 A0A0N4SUQ1 Serbp1 Plasminogen activator inhibitor 1 RNA-binding protein G5E866 Sf3b1 Splicing factor 3B subunit 1 Q8VIJ6 Sfpq Splicing factor, proline- and glutamine-rich Q9DB41-2 Slc25a18 Isoform 2 of Mitochondrial glutamate carrier 2 P62320 Snrpd3 Small nuclear ribonucleoprotein Sm D3 E9Q0W8 Snrpe Small nuclear ribonucleoprotein E G3UXB6 Snx14 Sorting nexin-14 F8WI90 Src Tyrosine-protein kinase H7BX95 Srsf1 Serine/arginine-rich-splicing factor 1 Q8C8J0 Stpg2 Sperm-tail PG-rich repeat-containing protein 2 F7AGT6 Tacc3 Transforming acidic coiled-coil-containing protein 3 (Fragment) F8VQE6 Tatdn2 TatD DNase domain-containing 2 Q9CQT0 Thg1l tRNA(His) guanylyltransferase D3Z6I8 Tpm3 Tropomyosin alpha-3 chain Q8VIG6 Traip E3 ubiquitin-protein ligase TRAIP Q9JJH7-3 Trpm5 Isoform 3 of Transient receptor potential cation channel subfamily M member 5 Q497K6 Ttc6 Tetratricopeptide repeat domain 6 Q6P3Y6 Ttc9c Tetratricopeptide repeat protein 9C A6PWR8 Usp43 Ubiquitin carboxyl-terminal 43 Q8BGQ1-2 Vipas39 Isoform 2 of Spermatogenesis-defective protein 39 homolog B9EI21 Zmat3 Zinc finger matrin type 3

©2020 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db19-1060/-/DC1 SUPPLEMENTARY DATA Supplementary Table 6. List of the interactive proteins of HRD1 in Ad-HRD1-transfected MIN6 cells analyzed by mass spectrometry.

First protein Gene name Description Q8VDD5 Myh9 Myosin-9 P01868 Ighg1 Ig gamma-1 chain C region secreted form Q3U9N4 Grn Granulins P63268 Actg2 Actin, gamma-enteric smooth muscle P11499 Hsp90ab1 Heat shock protein HSP 90-beta P48962 Slc25a4 ADP/ATP 1 P01631 Ig kappa chain V-II region 26-10 P68372 Tubb4b Tubulin beta-4B chain Q3V117 Acly ATP-citrate synthase A2AL12 Hnrnpa3 Heterogeneous nuclear ribonucleoprotein A3 P03975 Iap IgE-binding protein Q9DBY1-2 Syvn1 Isoform 2 of E3 ubiquitin-protein ligase synoviolin P19157 Gstp1 Glutathione S-transferase P 1 Q8C2Q7 Hnrnph1 Heterogeneous nuclear ribonucleoprotein H Q99K48 Nono Non-POU domain-containing octamer-binding protein P97351 Rps3a 40S ribosomal protein S3a Q6P5D4 Cep135 Centrosomal protein of 135 kDa P45878 Fkbp2 Peptidyl-prolyl cis-trans isomerase FKBP2 A0A0A6YW67 Gm8797 MCG23377, isoform CRA_b Q3TML0 Pdia6 Protein disulfide-isomerase A6 P14148 Rpl7 60S ribosomal protein L7 A0A0U1RQ71 Rps13 40S ribosomal protein S13 P62264 Rps14 40S ribosomal protein S14 P60867 Rps20 40S ribosomal protein S20 A0A140LI77 Rps3 40S ribosomal protein S3 Q921M3-2 Sf3b3 Isoform 2 of Splicing factor 3B subunit 3 G5E902 Slc25a3 MCG10343, isoform CRA_b F6QCI0 Taf15 TATA-box-binding protein-associated factor 15 (Fragment) Q3U7K7 Trim21 E3 ubiquitin-protein ligase TRIM21 A2AFH2 Ube2dnl2 Similar to ubiquitin-conjugating E2D 2 Q9CPN7 1810009J06Rik Putative uncharacterized protein Q8R0Y6 Aldh1l1 Cytosolic 10-formyltetrahydrofolate dehydrogenase F8VPQ6 Alpi Alkaline phosphatase G3X9I4 Alyref2 Aly/REF export factor 2 Q8C8R3-8 Ank2 Isoform 8 of Ankyrin-2 E9Q4F7 Ankrd11 Ankyrin repeat domain-containing protein 11 Q8BZ05-2 Arap2 Isoform 2 of Arf-GAP with Rho-GAP domain, ANK repeat and PH domain- containing protein 2 A0A1B0GQY8 Arfip2 Arfaptin-2 (Fragment) A2A652 Bptf Bromodomain PHD finger transcription factor (Fragment) Q80UW5 Cdc42bpg Serine/threonine-protein kinase MRCK gamma Q9QZE2-2 Clnk Isoform 2 of Cytokine-dependent hematopoietic cell linker Q5SXR6 Cltc Clathrin heavy chain

©2020 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db19-1060/-/DC1 SUPPLEMENTARY DATA Q9WUM3 Coro1b Coronin-1B E9Q7P0 Dnah17 Dynein heavy chain 17, axonemal D3Z3Z7 Dnase1l2 Deoxyribonuclease-1-like 2 (Fragment) A0A087WPE4 Eloc Elongin-C (Fragment) H9KV13 Etnk2 Ethanolamine kinase 2 Q9Z2I2 Fkbp1b Peptidyl-prolyl cis-trans isomerase FKBP1B B1AXN3 Gm382 MCG56945 Q3THK3 Gtf2f1 General transcription factor IIF subunit 1 Q31093 H2-M3 Histocompatibility 2, M region locus 3 P62806 Hist1h4a Histone H4 Q920N2 Hlcs Biotin--protein ligase G3XA10 Hnrnpu Heterogeneous nuclear ribonucleoprotein U F7C312 Hsp90b1 Endoplasmin (Fragment) A0A0B4J1F7 Igbp1b Immunoglobulin-binding protein 1b Q8CID0 Kat14 Cysteine-rich protein 2-binding protein F8VPT3 Lct Lactase D3Z005 Lrif1 Ligand-dependent nuclear receptor-interacting factor 1 (Fragment) A0A0G2JG33 Lrig2 Leucine-rich repeats and immunoglobulin-like domains protein 2 (Fragment) O88978 Lrrc6 Protein tilB homolog E9Q715 Luc7l2 Putative RNA-binding protein Luc7-like 2 Q8CF90 Mafa Transcription factor MafA Q61532 Mapk6 Mitogen-activated protein kinase 6 Q9WTZ2 Mbtps1 Membrane-bound transcription factor site-1 protease E9Q3B9 Mgll Monoglyceride lipase A2A9P8 Mib2 E3 ubiquitin-protein ligase MIB2 (Fragment) V9GX81 Mroh6 Maestro heat-like repeat family member 6 Q8BK72 Mrps27 28S ribosomal protein S27, mitochondrial E9QLE4 Nalcn Sodium leak channel non-selective protein P09103 P4hb Protein disulfide-isomerase F6QPR1 Phb2 Prohibitin-2 (Fragment) Q8BFY0 Pirt Phosphoinositide-interacting protein P24369 Ppib Peptidyl-prolyl cis-trans isomerase B Q9JIF0-3 Prmt1 Isoform 3 of Protein arginine N-methyltransferase 1 H3BK80 Psd2 PH and SEC7 domain-containing protein 2 A0A087WRE1 R3hdm1 R3H domain-containing 1 (Fragment) B2RY56 Rbm25 RNA-binding protein 25 B1ARA3 Rpl26 60S ribosomal protein L26 (Fragment) Q6ZWV7 Rpl35 60S ribosomal protein L35 P63325 Rps10 40S ribosomal protein S10 P62242 Rps8 40S ribosomal protein S8 Q99M03 Rwdd2b RWD domain-containing protein 2B Q99M85 Scrt1 Transcriptional repressor scratch 1 Q8K2B3 Sdha Succinate dehydrogenase [ubiquinone] subunit, mitochondrial A0A0N4SUQ1 Serbp1 Plasminogen activator inhibitor 1 RNA-binding protein D6RCY2 Serf2 Small EDRK-rich factor 2 Q8K4Z5 Sf3a1 Splicing factor 3A subunit 1 G5E866 Sf3b1 Splicing factor 3B subunit 1

©2020 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db19-1060/-/DC1 SUPPLEMENTARY DATA Q8VIJ6 Sfpq Splicing factor, proline- and glutamine-rich P62320 Snrpd3 Small nuclear ribonucleoprotein Sm D3 A2AKI2 Stard9 Kinesin-like protein (Fragment) Q9D495 Syce1 Synaptonemal complex central element protein 1 F6YCE8 Tex43 Testis-expressed protein 43 (Fragment) Q9CQT0 Thg1l tRNA(His) guanylyltransferase A0A0A0MQK8 Tmem53 Transmembrane protein 53 (Fragment) Q61033-2 Tmpo Isoform Zeta of Lamina-associated polypeptide 2, isoforms alpha/zeta H7BXC3 Tpi1 Triosephosphate isomerase Q9R0T7 Try4 MCG15085 Q9QZM0 Ubqln2 Ubiquilin-2 Q8BS74 Xlr MCG115120, isoform CRA_b F6YY69 Ywhaq 14-3-3 protein theta (Fragment) B1AQG7 Zfp207 Zinc finger protein 207 (Fragment) A2AVM0 Zfp341 Zinc finger protein 341 B9EI21 Zmat3 Zinc finger matrin type 3

©2020 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db19-1060/-/DC1 SUPPLEMENTARY DATA Supplementary Figure 1. HRD1 expression in pancreatic α-cells (A) and PP cells (B) in db/db mice and their littermate controls was detected via the immunofluorescence of glucagon or panoreatio polypeptide (PPY) (green), HRD1 (red) and DAPI (blue). Scale bar = 100 μm. (C) Mouse primary islets were precultured in RPMI 1640 with 5.5 mmol/l glucose for 24 h and then incubated with 25 mmol/l glucose and/or 1 mmol/l N-acetylcysteine (NAC) for an additional 48 h. MIN6 cells were precultured in DMEM with 5.5 mmol/l glucose for 24 h and then incubated with 33.3 mmol/l glucose and/or 1 mmol/l NAC for an additional 48 h. HRD1 expression was measured through Western blot analysis. (D) MIN6 cells and primary mouse islets were treated with 100 μmol/l H2O2 for 2 h, and HRD1 expression was measured through Western blot analysis. For C and D, GAPDH was used as internal standard.

©2020 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db19-1060/-/DC1 SUPPLEMENTARY DATA Supplementary Figure 2. (A) AAV-vector expression in pancreatic β-cells was confirmed via the immunofluorescence of GFP (green), insulin (red), DAPI (blue). Scale bar = 20 μm. (B) Body weight was measured in AAV-shHRD1- or shNC-infused mice fed on chow or HFD. (C) IPITT was performed in AAV-shHRD1- or shNC-infused mice fed on chow or HFD. (D) Body weight was measured in AAV- shHRD1- or shNC-infused lean or db/db mice. (E) IPITT was performed in AAV-shHRD1- or shNC- infused lean or db/db mice. Data are presented as mean ± SEM. n = 5 for each group. For C and E, **P < 0.01, *** P < 0.001 vs. chow or lean aav8-shNC.

©2020 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db19-1060/-/DC1 SUPPLEMENTARY DATA Supplementary Figure 3. HRD1 overexpression was confirmed in MIN6 cells (A), mouse islets (B) and human islets (C) through Western blot analysis. Ca2+ currents evoked by membrane depolarizations from −70 mV to 0 mV in human β-cells from the Ad-GFP-infected group (D, n = 8) and Ad-HRD1- infected group (E, n = 9). (F) Current (I)–voltage (V) relationships of Ca2+ currents recorded in human β-cells infected with Ad-GFP (n = 20) or Ad-HRD1 (n = 17). Currents were normalized to the initial cell size. (G) Gradient infection (5–200 MOI) of Ad-HRD1 was performed on MIN6 cells for 48 h followed by GSIS assay (n = 6). (H) HRD1 overexpression in MIN6 cells in G was detected through Western blot analysis. For A-C and H, GAPDH was used as internal standard. Data are presented as mean ± SEM. *P < 0.05, *** P < 0.001 vs. Ad-GFP.

©2020 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db19-1060/-/DC1 SUPPLEMENTARY DATA Supplementary Figure 4. (A) DAVID Bioinformatics Resources 6.7 was used to perform GO analysis of the HRD1-binding proteins investigated by mass spectrometry in Ad-HRD1-infected MIN6 cells. Relative cellular processes were sorted by −log (P value). P value < 0.05; −log (P value) > 1.3.

©2020 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db19-1060/-/DC1 SUPPLEMENTARY DATA Supplementary Figure 5. After being infected with Ad-MafA for 12 h, MIN6 cells were infected with Ad-HRD1 for another 48 h. (A) The expression levels of HRD1 and MafA were confirmed by Western blot analysis. (B) GSIS and KSIS indices in MIN6 cells in A were measured. Data are presented as mean ± SEM. n = 6 for each group. *** P < 0.001 vs. Ad-GFP group; †† P < 0.01 vs. Ad-HRD1 group. (C) MIN6 cells were infected with si-NC or si-HRD1 for 24 h and then treated with 33.3 mmol/l glucose for 72 h (chronic HG). HRD1 and MafA protein levels were measured through Western blot analysis. (D) GSIS and KSIS indices in MIN6 cells in C were measured. Data are presented as mean ± SEM. n = 6 for each group. ** P < 0.01 vs. normal glucose group; †† P < 0.01 vs. chronic HG group. For A and C, GAPDH was used as internal control.

©2020 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db19-1060/-/DC1 SUPPLEMENTARY DATA Supplementary Figure 6. (A) HEK293A cells were transfected with MafA-EGFP along with or without HRD1-DsRed for 48 h. ER in the living cells were then labeled with ER tracker Blue-White DPX (Introvigon) and immediately photographed using a laser confocal microscope. Scale bar = 50 μm. (B) HRD1 overexpression was confirmed in MIN6 cells following transfection for 24, 36, 48 h through Western blot analysis. (C) MIN6 cells were infected with si-NC or si-HRD1 for 24 h and then treated with 25 mmol/l glucose along with 0.5 mmol/l palmitate for 48 h (HG+palmitate). Immunofluorescence staining was performed for MafA (red), HRD1 (green), and DAPI (blue). Scale bars = 30 μm.

©2020 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db19-1060/-/DC1