DOCSLIB.ORG

Suberin Biosynthesis and Deposition in the Wound-Healing Potato (Solanum Tuberosum L.) Tuber Model

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Suberin Biosynthesis and Deposition in the Wound-Healing Potato (Solanum Tuberosum L.) Tuber Model Western University Scholarship@Western Electronic Thesis and Dissertation Repository 12-4-2018 2:30 PM Suberin Biosynthesis and Deposition in the Wound-Healing Potato (Solanum tuberosum L.) Tuber Model Kathlyn Natalie Woolfson The University of Western Ontario Supervisor Bernards, Mark A. The University of Western Ontario Graduate Program in Biology A thesis submitted in partial fulfillment of the equirr ements for the degree in Doctor of Philosophy © Kathlyn Natalie Woolfson 2018 Follow this and additional works at: https://ir.lib.uwo.ca/etd Part of the Plant Biology Commons Recommended Citation Woolfson, Kathlyn Natalie, "Suberin Biosynthesis and Deposition in the Wound-Healing Potato (Solanum tuberosum L.) Tuber Model" (2018). Electronic Thesis and Dissertation Repository. 5935. https://ir.lib.uwo.ca/etd/5935 This Dissertation/Thesis is brought to you for free and open access by Scholarship@Western. It has been accepted for inclusion in Electronic Thesis and Dissertation Repository by an authorized administrator of Scholarship@Western. For more information, please contact [email protected]. Abstract Suberin is a heteropolymer comprising a cell wall-bound poly(phenolic) domain (SPPD) covalently linked to a poly(aliphatic) domain (SPAD) that is deposited between the cell wall and plasma membrane. Potato tuber skin contains suberin to protect against water loss and microbial infection. Wounding triggers suberin biosynthesis in usually non- suberized tuber parenchyma, providing a model system to study suberin production. Spatial and temporal coordination of SPPD and SPAD-related metabolism are required for suberization, as the former is produced soon after wounding, and the latter is synthesized later into wound-healing. Many steps involved in suberin biosynthesis remain uncharacterized, and the mechanism(s) that regulate and coordinate SPPD and SPAD production and assembly are not understood. To explore the role of abscisic acid (ABA) in the differential regulation of SPPD and SPAD biosynthesis, I subjected wounded tubers to exogenous treatments including additional ABA, or the ABA biosynthesis inhibitor fluridone. Quantitative reverse transcription polymerase chain reaction (RT-qPCR) expression analysis of SPPD and SPAD biosynthetic genes, coupled with metabolite analyses, revealed that ABA positively influenced SPAD-, but not SPPD- associated, transcript and metabolite accumulation, indicating a role for ABA in the differential induction of wound-induced phenolic and aliphatic metabolism. I took an RNA-seq approach to study broader transcriptional changes that occur during wound- healing. The wound-healing transcriptome time-course illustrated that wounding leads to a substantial reconfiguration of transcription, followed by fine-tuning of responses dominated by suberization. Transcriptome analysis revealed that primary metabolic pathways demonstrate similar temporal expression patterns during wound-healing, but suberin-specific steps display distinct patterns at entire pathway and sub-branch levels. The observed transcriptional changes support a model in which wounding initially alters primary metabolism required to fuel SPPD, and subsequent SPAD, production. This investigation also provided support for uncharacterized biosynthetic steps, and highlighted putative transcription factors and suberin polymer assembly genes (Casparian strip membrane domain proteins and GDSL lipase/esterases) that may play i key roles in the regulation and coordination of SPPD and SPAD monomer biosynthesis, polymer assembly and deposition. Overall, my findings offer further insight into the coordination and timing of metabolic and regulatory events involved in wound-healing and associated suberization. Keywords Solanum tuberosum, wound-induced suberization, plant stress response, suberin poly(aliphatic) domain, suberin poly(phenolic) domain, abscisic acid, transcription factors, gene expression, RT-qPCR, RNA-seq, differential expression analysis, gene ontology, gene set analysis ii Co-Authorship Statement Chapter 2 was published as an open access article in The Plant Journal (Woolfson, K.N., Haggitt, M.L., Zhang, Y., Kachura, A., Bjelica, A., Rey Rincon, M.A., Kaberi, K.M. and Bernards, M.A. (2018) Differential induction of polar and non‐polar metabolism during wound‐induced suberization in potato (Solanum tuberosum L.) tubers. The Plant Journal, 93(5), 931-942). I am a co-first author with Meghan L. Haggitt (MLH), and Yanni Zhang (YZ), Alexandra Kachura (AK), Anica Bjelica (AB), M. Alejandra Rey Rincon (MARR), Karina M. Kaberi (KMK) and Mark A. Bernards (MAB) were co-authors. MLH, YZ and AB conducted preliminary studies on suberin metabolism and abscisic acid. I set up largescale experiments to include additional treatments and genes of interest. I conducted RT-qPCR and aided in polar metabolite extractions. AK, KMK and MARR helped with sample preparation, polar and non-polar metabolite extractions and analyses with MAB. MAB supervised the lab work, contributed to experimental conception and design. I drafted the first version of the published work, based on preliminary work in MLH’s thesis, with contributions from MAB and other authors. The majority of data in the published article stems from my work, with 8-month old tuber data and some supplementary material from MLH’s thesis. Chapter 3 is being prepared for publication. I will be the first author, with MAB as co- author. MAB contributed to experimental conception, design, and supervision. I contributed to experimental conception and finalized experimental design, executed all experiments and analyses, and drafted the manuscript, with contributions from MAB. Biosynthetic pathway map figures were prepared by MAB; I identified the corresponding genes for each step and generated the heatmaps. iii Dedication This thesis is dedicated in loving memory to my late grandparents, Dora and Willie Woznica. They came to Canada after World War II in 1951 with nothing, and built a beautiful life here. They only had the chance to complete an elementary school education, but were both incredibly wise and I can only speculate what they could have achieved had they been granted the opportunity. Their inconceivable sacrifices made it possible for me to have the privilege to grow up in Canada and obtain a high level of education in a field that I am passionate about. I remember their emphasis on potatoes as an important food source in their unimaginable tales of survival, and the significance of my study organism is not lost on me. They imparted on me a love and appreciation for food and plants, and I often reflect on their optimistic outlook, resilience and joie de vivre to motivate me during challenging times. iv Acknowledgments Studying the “long and winding road to suberin production” seems like a fitting way to conclude the many years I have spent in school. It would not have been possible for me to reach this point without the support of my family, friends, and peers. To my supervisor, Mark Bernards – I am incredibly fortunate to have pursued my PhD in your lab, and to have had the opportunity to learn so much from you during this time. I am particularly appreciative of your endless support and encouragement, which has driven me to achieve more than I initially thought was possible. Your mentorship has positively influenced my growth and self-confidence as a scientist. I would also like to thank my advisory committee members, Susanne Kohalmi and Frédéric Marsolais, for their constructive guidance along the way. I also appreciate Susanne letting me use her lab facilities and equipment. So much of my thesis work was supported by the technical help and training provided by my peers. Thanks to Trish Tully for teaching me many important protocols, including the two-day long intensive RNA extractions that laid the foundation of my entire PhD thesis. Anica Bjelica – I am incredibly grateful for all of the times you made yourself available to give me technical advice and guidance. I especially acknowledge the invaluable help I received from Tian Wu and Vladimir Zhurov throughout my RNA-seq project – I would still be deep in the weeds if not for your insights and assistance. Thank you to the undergraduate students who worked with me – Alexandra Kachura, Alejandra Rey Rincon, and Karina Kaberi. My lab and office mates, including Dimitre Ivanov, Scarlett Puebla Barragan, Christine Dulal-Whiteway, Mali Mehdizadeh and Kevin Erratt, all provided me with moral support and made my time spent in NCB enjoyable. To my first lab mate and lab mentor, my soulmate and husband, Brendan Walshe-Roussel – I am so grateful that our shared love of plants and mutual research pursuits put us on a path that led us to each other. Thank you for the lessons you have taught me throughout my academic experiences and your unwavering patience and calming influence. I am especially appreciative of the many times you helped me to realize my own growth, that v in turn allowed me to develop confidence in myself and my abilities as a scientist. You have supported and guided me in ways that are unique to our relationship as both lab mates and life mates. You have played such an integral role in so many aspects of my life that I cannot imagine doing any part of this without you. To my parents, Frances and Ken Woolfson, thank you for your encouragement to explore my interests and pursue what I am most passionate about. You have always taught me that I could achieve my goals with hard work and perseverance, but there is no denying how privileged I am to have been born into such a loving and supportive family. I also want to acknowledge my sisters, Jess and Hayley Woolfson, who are the epitome of role models for a budding scientist, and who inspired me to pursue my BSc in Biology in the first place. My sisters and my brother-in-law Dave Dubiner have offered guidance and encouragement over the years as family and as fellow biologists. I am very excited to join the club as the fourth Dr. Woolfson! I am lucky to have grandparents, Molly and Sid Woolfson, who have always been excited to hear my work updates and share how proud they are.
Load more

Recommended publications
  • ATP-Citrate Lyase Has an Essential Role in Cytosolic Acetyl-Coa Production in Arabidopsis Beth Leann Fatland Iowa State University
    Iowa State University Capstones, Theses and Retrospective Theses and Dissertations Dissertations 2002 ATP-citrate lyase has an essential role in cytosolic acetyl-CoA production in Arabidopsis Beth LeAnn Fatland Iowa State University Follow this and additional works at: https://lib.dr.iastate.edu/rtd Part of the Molecular Biology Commons, and the Plant Sciences Commons Recommended Citation Fatland, Beth LeAnn, "ATP-citrate lyase has an essential role in cytosolic acetyl-CoA production in Arabidopsis " (2002). Retrospective Theses and Dissertations. 1218. https://lib.dr.iastate.edu/rtd/1218 This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. ATP-citrate lyase has an essential role in cytosolic acetyl-CoA production in Arabidopsis by Beth LeAnn Fatland A dissertation submitted to the graduate faculty in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY Major: Plant Physiology Program of Study Committee: Eve Syrkin Wurtele (Major Professor) James Colbert Harry Homer Basil Nikolau Martin Spalding Iowa State University Ames, Iowa 2002 UMI Number: 3158393 INFORMATION TO USERS The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleed-through, substandard margins, and improper alignment can adversely affect reproduction. In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted.
    [Show full text]
  • Electronic Supplementary Material (ESI) for Molecular Biosystems
    Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is © The Royal Society of Chemistry 2015 Table S5 Mass data of proteins identified with label free shotgun proteomics a #Alt. Proteins; b Scores; c #Peptides; d SC [%]; e RMS90 [ppm]; f Rank; g Median(Controls:GLP1); h #(Controls:GLP1); i CV [%](Controls:GLP1); l Median(Controls:Palmitate); m #(Controls:Palmitate) ; n CV [%](Controls:Palmitate); o Median(Controls:GLP1 + Palmitate); p #(Controls:GLP1 + Palmitate); q CV [%](Controls:GLP1 + Palmitate) MW OK Accession Protein pI a b c d e f g h i l m n o p q [kDa] 78 kDa glucose-regulated protein OS=Rattus 1672.6 true GRP78_RAT 72.3 4.9 1 22 39 1.48 1 1.16 6 20.53 1.18 9 9.56 1.24 10 13.52 norvegicus GN=Hspa5 PE=1 SV=1 (M:1672.6) Endoplasmin OS=Rattus norvegicus 1253.0 true ENPL_RAT 92.7 4.6 1 23 29 3.34 2 0.85 8 33.34 1.19 6 39.58 1.18 10 28.11 GN=Hsp90b1 PE=1 SV=2 (M:1253.0) Stress-70 protein, mitochondrial OS=Rattus 1138.8 true GRP75_RAT 73.8 5.9 1 17 28.7 1.18 3 1.21 5 7.62 0.78 1 1.1 8 8.04 norvegicus GN=Hspa9 PE=1 SV=3 (M:1138.8) Protein disulfide-isomerase A3 OS=Rattus 1035.4 true PDIA3_RAT 56.6 5.8 1 16 35.2 2.84 4 0.94 3 17.22 1.15 4 26.62 1.25 4 7.86 norvegicus GN=Pdia3 PE=1 SV=2 (M:1035.4) Aconitate hydratase, mitochondrial 983.8 true ACON_RAT OS=Rattus norvegicus GN=Aco2 PE=1 85.4 8.7 1 19 31.4 2.72 5 0.89 2 23.6 1.21 2 9.25 0.89 3 32.87 (M:983.8) SV=2 60 kDa heat shock protein, mitochondrial 906.9 true CH60_RAT OS=Rattus norvegicus GN=Hspd1 PE=1 60.9 5.8 1 13 32.5 3.26 6 1.05 5 13.15 1.01 2 32.54 1.01
    [Show full text]
  • Accumulation and Secretion of Coumarinolignans and Other Coumarins in Arabidopsis Thaliana Roots in Response to Iron Deficiency
    Accumulation and Secretion of Coumarinolignans and other Coumarins in Arabidopsis thaliana Roots in Response to Iron Deficiency at High pH Patricia Siso-Terraza, Adrian Luis-Villarroya, Pierre Fourcroy, Jean-Francois Briat, Anunciacion Abadia, Frederic Gaymard, Javier Abadia, Ana Alvarez-Fernandez To cite this version: Patricia Siso-Terraza, Adrian Luis-Villarroya, Pierre Fourcroy, Jean-Francois Briat, Anunciacion Aba- dia, et al.. Accumulation and Secretion of Coumarinolignans and other Coumarins in Arabidopsis thaliana Roots in Response to Iron Deficiency at High pH. Frontiers in Plant Science, Frontiers, 2016, 7, pp.1711. 10.3389/fpls.2016.01711. hal-01417731 HAL Id: hal-01417731 https://hal.archives-ouvertes.fr/hal-01417731 Submitted on 15 Dec 2016 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. fpls-07-01711 November 21, 2016 Time: 15:23 # 1 ORIGINAL RESEARCH published: 23 November 2016 doi: 10.3389/fpls.2016.01711 Accumulation and Secretion of Coumarinolignans and other Coumarins in Arabidopsis thaliana Roots in Response to Iron Deficiency at
    [Show full text]
  • Murine Neonatal Ketogenesis Preserves Mitochondrial Energetics by Preventing Protein Hyperacetylation
    ARTICLES https://doi.org/10.1038/s42255-021-00342-6 Murine neonatal ketogenesis preserves mitochondrial energetics by preventing protein hyperacetylation Yuichiro Arima 1,2,13 ✉ , Yoshiko Nakagawa3,13, Toru Takeo 3,13, Toshifumi Ishida 1, Toshihiro Yamada1, Shinjiro Hino4, Mitsuyoshi Nakao4, Sanshiro Hanada 2, Terumasa Umemoto 2, Toshio Suda2, Tetsushi Sakuma 5, Takashi Yamamoto5, Takehisa Watanabe6, Katsuya Nagaoka6, Yasuhito Tanaka6, Yumiko K. Kawamura7,8, Kazuo Tonami7, Hiroki Kurihara7, Yoshifumi Sato9, Kazuya Yamagata9,10, Taishi Nakamura 1,11, Satoshi Araki1, Eiichiro Yamamoto1, Yasuhiro Izumiya1,12, Kenji Sakamoto1, Koichi Kaikita1, Kenichi Matsushita 1, Koichi Nishiyama2, Naomi Nakagata3 and Kenichi Tsujita1,10 Ketone bodies are generated in the liver and allow for the maintenance of systemic caloric and energy homeostasis during fasting and caloric restriction. It has previously been demonstrated that neonatal ketogenesis is activated independently of starvation. However, the role of ketogenesis during the perinatal period remains unclear. Here, we show that neonatal ketogen- esis plays a protective role in mitochondrial function. We generated a mouse model of insufficient ketogenesis by disrupting the rate-limiting hydroxymethylglutaryl-CoA synthase 2 enzyme gene (Hmgcs2). Hmgcs2 knockout (KO) neonates develop microvesicular steatosis within a few days of birth. Electron microscopic analysis and metabolite profiling indicate a restricted energy production capacity and accumulation of acetyl-CoA in Hmgcs2 KO mice. Furthermore,
    [Show full text]
  • Supplementary Tables and Figures
    SUPPLEMENTARY DATA Supplementary Table 1. SiRNA sequence (5’-3’) Gene Forward Reverse si-HRD1-1# GCAUGGCAGUCCUGUACAU dTdT AUGUACAGGACUGCCAUGC dTdT si-HRD1-2# GAGCCAUCCGCAACAUGAA dTdT UUCAUGUUGCGGAUGGCUC dTdT si-MafA CCAUCGAGUACGUCAACGA dTdT UCGUUGACGUACUCGAUGG dTdT ©2020 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db19-1060/-/DC1 SUPPLEMENTARY DATA Supplementary Table 2. Primer sequences for qRT-PCR (5’-3’) Gene Forward Reverse human HRD1 GCTCACGCCTACTACCTCAAA GCCAGACAAGTCTCTGTGACG mouse mafA AAGCGGCGCACGCTCAAGAA GGTCCCGCTCCTTGGCCAGA mouse insulin1 CACTTCCTACCCCTGCTGG ACCACAAAGATGCTGTTTGACA mouse β-actin AGGCCAACCGTGAAAAGATG AGAGCATAGCCCTCGTAGATGG human β-actin CATGTACGTTGCTATCCAGGC CTCCTTAATGTCACGCACGAT ©2020 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db19-1060/-/DC1 SUPPLEMENTARY DATA Supplementary Table 3. Primer sequences for ChIP (5’-3’) Gene promoter Forward Reverse mouse Insulin1, 2 GGAACTGTGAAACAGTCCAAGG CCCCCTGGACTTTGCTGTTTG ©2020 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db19-1060/-/DC1 SUPPLEMENTARY DATA Supplementary Table 4. Primer sequences for PCR (5’-3’) Gene Forward Reverse HRD1-pDsred CCCAAGCTTATGTTCCGCACCGCAGT GGGGTACCCAGTGGGCAACAGGGG HRD1-pCMV- Flag GGGGTACCATGTTCCGCACCGCAGT CCCAAGCTTGTGGGCAACAGGGGACT C HRD1-pCMV-HA GGCCATGGGCCATATGGGATCCTTCC AGGGATGCCACCCGGGGATCCTCAGT GCACCGCAGTGATG GGGCAACAGGGGAC HRD1-N-HA GGCCATGGGCCATATGGGATCCTTCC
    [Show full text]
  • Supplementary Information
    Supplementary Information Table S1. Pathway analysis of the 1246 dwf1-specific differentially expressed genes. Fold Change Fold Change Fold Change Gene ID Description (dwf1/WT) (XL-5/WT) (XL-6/WT) Carbohydrate Metabolism Glycolysis/Gluconeogenesis POPTR_0008s11770.1 Glucose-6-phosphate isomerase −1.7382 0.512146 0.168727 POPTR_0001s47210.1 Fructose-bisphosphate aldolase, class I 1.599591 0.044778 0.18237 POPTR_0011s05190.3 Probable phosphoglycerate mutase −2.11069 −0.34562 −0.9738 POPTR_0012s01140.1 Pyruvate kinase −1.25054 0.074697 −0.16016 POPTR_0016s12760.1 Pyruvate decarboxylase 2.664081 0.021062 0.371969 POPTR_0012s08010.1 Aldehyde dehydrogenase (NAD+) −1.41556 0.479957 −0.21366 POPTR_0014s13710.1 Acetyl-CoA synthetase −1.337 0.154552 −0.26532 POPTR_0017s11660.1 Aldose 1-epimerase 2.770518 0.016874 0.73016 POPTR_0010s11970.1 Phosphoglucomutase −1.25266 −0.35581 0.074064 POPTR_0012s14030.1 Phosphoglucomutase −1.15872 −0.68468 −0.93596 POPTR_0002s10850.1 Phosphoenolpyruvate carboxykinase (ATP) 1.489119 0.967284 0.821559 Citrate cycle (TCA cycle) 2-Oxoglutarate dehydrogenase E2 component POPTR_0014s15280.1 −1.63733 0.076435 0.170827 (dihydrolipoamide succinyltransferase) POPTR_0002s26120.1 Succinyl-CoA synthetase β subunit −1.29244 −0.38517 −0.3497 POPTR_0007s12750.1 Succinate dehydrogenase (ubiquinone) flavoprotein subunit −1.83751 0.519356 0.309149 POPTR_0002s10850.1 Phosphoenolpyruvate carboxykinase (ATP) 1.489119 0.967284 0.821559 Pentose phosphate pathway POPTR_0008s11770.1 Glucose-6-phosphate isomerase −1.7382 0.512146 0.168727 POPTR_0013s00660.1 Glucose-6-phosphate 1-dehydrogenase −1.26949 −0.18314 0.374822 POPTR_0015s00960.1 6-Phosphogluconolactonase 2.022223 0.168877 0.971431 POPTR_0010s11970.1 Phosphoglucomutase −1.25266 −0.35581 0.074064 POPTR_0012s14030.1 Phosphoglucomutase −1.15872 −0.68468 −0.93596 POPTR_0001s47210.1 Fructose-bisphosphate aldolase, class I 1.599591 0.044778 0.18237 S2 Table S1.
    [Show full text]
  • KENNETH B. STOREY and ERNEST BAILEY Department of Biochemistry, University of Sheffield, Sheffield SI0 2TN, U.K
    Insect Biochem.,. 1978, Vol. 8, pp. 125 to 131. Peroamon Press. Printed in Great Britain INTRACELLULAR DISTRIBUTION OF ENZYMES ASSOCIATED WITH LIPOGENESIS AND GLUCONEOGENESIS IN FAT BODY OF THE ADULT COCKROACH, PERIPLANETA KENNETH B. STOREY and ERNEST BAILEY Department of Biochemistry, University of Sheffield, Sheffield SI0 2TN, U.K. (Received 30 April 1977) Abstract--The intracellular distribution and maximal activities of some enzymes associated with lipo- genesis, gluconeogenesis and fatty acid oxidation have been determined in the fat body of the adult male cockroach Periplaneta americana. Of the enzymes of lipogenesis, acetyl-CoA synthase, acetyl-CoA carboxylase, glucose 6-phosphate dehydrogenase, and ATP citrate lyase are located entirely in the cytosol. Of the other enzymes of citrate metabolism studied, citrate synthase and NAD-dependent isocitrate dehydrogenase are almost exclusively mitochondrial, whereas NADP-dependent isocitrate dehydrogenase and aconitase are predominantly cytosolic although significant mitochondrial activity is also present. The latter subeellular distribution is also observed for 'malic enzyme' and NAD and NADP dependent malate dehydrogenase. The enzyme of fatty acid oxidation studied, 3-hydroxyacyl- CoA dehydrogenase is entirely mitochondrial. Of the enzymes possibly involved in glueoneogenesis, glucose 6-phosphate is microsomal, fructose 1,6-diphosphatase cytosolic, pyruvate carboxylase mito- chondrial and phosphoenolpyruvate carboxykinase predominantly eytosolic. Of the enzymes of amino acid metabolism studied, glutamate dehydrogenase is NAD-dependent and located in the mitochondria whereas glutamate/oxalacetate and glutamate/pyruvate transaminases are predominantly cytosolic but with significant activity in the mitochondria. Glycerol kinase and sorbitol dehydrogenase are cytosolic and the glyoxylate cycle enzymes malate synthetase and isocitrate lyase are not detected in the fat body.
    [Show full text]
  • Regulation of a Plant Aquaporin by a Casparian Strip Membrane Domain Protein-Like
    Regulation of a plant aquaporin by a Casparian strip membrane domain protein-like Chloé Champeyroux, Jorge Bellati, Marie Barberon, Valerie Rofidal, Christophe Maurel, Veronique Santoni To cite this version: Chloé Champeyroux, Jorge Bellati, Marie Barberon, Valerie Rofidal, Christophe Maurel, et al.. Reg- ulation of a plant aquaporin by a Casparian strip membrane domain protein-like. Plant, Cell and Environment, Wiley, 2019, 42 (6), pp.1788-1801. 10.1111/pce.13537. hal-02054482 HAL Id: hal-02054482 https://hal.archives-ouvertes.fr/hal-02054482 Submitted on 26 May 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Santoni Veronique (Orcid ID: 0000-0002-1437-0921) Amtmann Anna (Orcid ID: 0000-0001-8533-121X) Title Regulation of a plant aquaporin by a Casparian strip membrane domain protein-like Running title Plant aquaporin regulation Authors Chloé Champeyroux1, Jorge Bellati1, Marie Barberon2, Valérie Rofidal1, Christophe Maurel1, Véronique Santoni1,3 Institute Version postprint 1BPMP, Univ Montpellier, CNRS, INRA, Montpellier SupAgro, Montpellier, France 2 Department of Botany and Plant Biology, Quai Ernest-Ansermet 30 Sciences III CH-1211 Genève 4 Switzerland 3Corresponding author Véronique Santoni BPMP, Univ Montpellier, CNRS, INRA, Montpellier SupAgro, F-34060 Montpellier cedex 2, France.
    [Show full text]
  • Engineering a Monolignol 4-O-Methyltransferase with High Selectivity for the Condensed Lignin Precursor Coniferyl Alcohol
    BNL-111732-2016-JA Engineering a monolignol 4-O-methyltransferase with high selectivity for the condensed lignin precursor coniferyl alcohol Y. Cai, M-W Bhuiya, J. Shanklin, C-J Liu Brookhaven National Laboratory, Upton, NY 11973 USA Submitted to the Journal of Biological Chemistry September 2015 Biology Department Brookhaven National Laboratory U.S. Department of Energy DOE Office of Basic Energy Sciences Notice: This manuscript has been co-authored by employees of Brookhaven Science Associates, LLC under Contract No. DE-SC0012704 with the U.S. Department of Energy. The publisher by accepting the manuscript for publication acknowledges that the United States Government retains a non-exclusive, paid-up, irrevocable, world-wide license to publish or reproduce the published form of this manuscript, or allow others to do so, for United States Government purposes. This preprint is intended for publication in a journal or proceedings. Since changes may be made before publication, it may not be cited or reproduced without the author’s permission. DISCLAIMER This report was prepared as an account of work sponsored by an agency of the United States Government. Neither the United States Government nor any agency thereof, nor any of their employees, nor any of their contractors, subcontractors, or their employees, makes any warranty, express or implied, or assumes any legal liability or responsibility for the accuracy, completeness, or any third party’s use or the results of such use of any information, apparatus, product, or process disclosed, or represents that its use would not infringe privately owned rights. Reference herein to any specific commercial product, process, or service by trade name, trademark, manufacturer, or otherwise, does not necessarily constitute or imply its endorsement, recommendation, or favoring by the United States Government or any agency thereof or its contractors or subcontractors.
    [Show full text]
  • Functional and Evolutionary Analysis of the CASPARIAN STRIP MEMBRANE DOMAIN PROTEIN Family1[C][W]
    Functional and Evolutionary Analysis of the CASPARIAN STRIP MEMBRANE DOMAIN PROTEIN Family1[C][W] Daniele Roppolo *, Brigitte Boeckmann, Alexandre Pfister, Emmanuel Boutet, Maria C. Rubio, Valérie Dénervaud-Tendon, Joop E.M. Vermeer, Jacqueline Gheyselinck, Ioannis Xenarios, and Niko Geldner Department of Plant Molecular Biology, University of Lausanne, Quartier Sorge, Lausanne 1015, Switzerland (D.R., A.P., M.C.R., V.D.-T., J.E.M.V., N.G.); Swiss Institute of Bioinformatics, Centre Médical Universitaire, 1211 Geneva 4, Switzerland (B.B., E.B., I.X.); Departamento de Nutrición Vegetal, Estación Experimental de Aula Dei, Consejo Superior de Investigaciones Científicas, 50080 Zaragoza, Spain (M.C.R.); Vital-IT Group and University of Lausanne, Quartier Sorge, Bâtiment Génopode, Lausanne 1015, Switzerland (I.X.); and Institute of Plant Sciences, University of Bern, 3013 Bern, Switzerland (D.R., J.G.) CASPARIAN STRIP MEMBRANE DOMAIN PROTEINS (CASPs) are four-membrane-span proteins that mediate the deposition of Casparian strips in the endodermis by recruiting the lignin polymerization machinery. CASPs show high stability in their membrane domain, which presents all the hallmarks of a membrane scaffold. Here, we characterized the large family of CASP- like (CASPL) proteins. CASPLs were found in all major divisions of land plants as well as in green algae; homologs outside of the plant kingdom were identified as members of the MARVEL protein family. When ectopically expressed in the endodermis, most CASPLs were able to integrate the CASP membrane domain, which suggests that CASPLs share with CASPs the propensity to form transmembrane scaffolds. Extracellular loops are not necessary for generating the scaffold, since CASP1 was still able to localize correctly when either one of the extracellular loops was deleted.
    [Show full text]
  • On the Determínation of Suberin and Other Structural Components in Cork from Quercus Suber L
    Recebido em 14 de Dezembro de 1987 On the determínation of suberin and other structural components in cork from Quercus suber L. by A. VELEZ MARQUES Dep. Quím. Org., Instituto Superior de Engenharia de Lisboa and HELENA PEREIRA Dep. Eng. Florestal, Instituto Superior de Agronomia RESUMO Estudou-se a despolimerização da suberina na cortiça de Quercus suber L. em relação à influência da concentração de reagente e tempo de reacção, utilizando uma transesterificação com metóxido de sódio em metanol. A de­ terminação da lenhina e dos polisacáridos foi feita em cortiça dessuberinizada. A quantidade de suberina aumenta com a concentração de metóxido, ao contrário do que se passa para os outros componentes; o mesmo se observa com o aumento do tempo da reacção. A composição monomérica dos polisacáridos mantém-se sensivelmente constante para todas as condições de metanólise. Propõe-se um método de despolimerização de suberina utilizando metóxido de sódio a 3% em metanol, em refluxo durante 3h, para uma amostra de l,5g de cortiça livre de extractivos, de modo a maximizar a despolimerização da suberina mas com menores efeitos nas determinações subsequentes dos outros componentes estruturais. 322 ANAIS DO INSTITUTO SUPERIOR DE AGRONOMIA SYNOPSIS The depolymerization of suberin in cork from Quercus suber L. was stu- died in relation to the effect of reagent concentration and reaction time, using a transesterification witli sodium methoxide in methanol. Lignin and carbohy- drates were determined in the desuberinised cork samples. The amount of suberin increases with the concentration of methoxide con- trarily to the other componentes; the same effect is observed with an increase of reaction time.
    [Show full text]
  • The Age of Coumarins in Plant–Microbe Interactions Pca Issue Special Ioannis A
    The Age of Coumarins in Plant–Microbe Interactions Special Issue Ioannis A. Stringlis *, Ronnie de Jonge and Corne´ M. J. Pieterse Plant-Microbe Interactions, Department of Biology, Science4Life, Utrecht University, Padualaan 8, Utrecht, 3584 CH, The Netherlands *Corresponding author: E-mail, [email protected]; Fax,+31 30 253 2837. (Received February 9, 2019; Accepted April 23, 2019) Coumarins are a family of plant-derived secondary metab- For example, the cell wall-fortifying compounds lignin, cutin olites that are produced via the phenylpropanoid pathway. and suberin form structural barriers that inhibit pathogen in- In the past decade, coumarins have emerged as iron-mobi- vasion (Doblas et al. 2017). Other phenylpropanoid derivatives – Review lizing compounds that are secreted by plant roots and aid in such as flavonoids, anthocyanins and tannins participate in iron uptake from iron-deprived soils. Members of the cou- other aspects of environmental stress adaptation, or in plant marin family are found in many plant species. Besides their growth and physiology (Vogt 2010). More specifically, flavon- role in iron uptake, coumarins have been extensively studied oids emerged as important mediators of the chemical commu- for their potential to fight infections in both plants and nication between leguminous plants and beneficial nitrogen- animals. Coumarin activities range from antimicrobial and fixing rhizobia. In this mutualistic interaction, root-secreted fla- antiviral to anticoagulant and anticancer. In recent years, vonoids act as chemoattractants for rhizobia and activate genes studies in the model plant species tobacco and required for nodulation, which established the initial paradigm Arabidopsis have significantly increased our understanding for the role phenylpropanoid-derived metabolites in beneficial of coumarin biosynthesis, accumulation, secretion, chemical plant–microbe interactions (Fisher and Long 1992, Phillips modification and their modes of action against plant patho- 1992).
    [Show full text]