) 2017 Sus c Gaud.) popula- population was Glyphosate resis- 8–10 MR2 Lolium rigidum plants. Karthik Putta In 2005, glyphosate-resistant plants Sus c 11 plants 32 h after light pretreatments. MR plants conferred a high level of resistance MR Glyphosate is a non-selective herbicide used to control 7 Correspondence to: PUniversity Tehranchian, of DepartmentE-mail: [email protected] California, of Plant One Sciences, Shields MS4, Department Avenue, of Plant Sciences, Davis, University of California, Davis, CA CA, USA 95616,Crop Production Systems USA. Research Unit, Unitedture, States Stoneville, Department MS, USA of Agricul- Department of Agronomy, Kansas State University, Manhattan, KS, USA ∗ c a b decades. a broad spectrum of annual and perennialplastidic weeds by enzyme inhibiting EPSPS the (EC 2.5.1.19).mate This accumulation inhibition causes in shiki- glyphosate-sensitivearomatic plants, amino acid blocking biosynthesis the pathway. were identified in approximately half of the 118 Italian ryegrass tance was first reportedfailed in to control California a intion rigid 1998 in ryegrass an when ( almond glyphosate orchard. Mithila Jugulam, b Lolium multiflorum ; and 6 population was 45.9-, 122.7- and 20.5-fold, and the It thrives ) are resistant to several herbicides from at least three modes of action. 1 MR2 MR1 C-paraquat to untreated leaves compared to multiflorum , plants was significantly greater than in 14 ) is a major annual ssp. MR1 Sus To date, Italian rye- 2–4 Vijay Nandula, However, evolved multiple Within the USA, resistance 5 multiflorum 5 a a* spp. plants was at least partially due to Pro106-to-Ala and Pro106-to-Thr substitutions at site 106 of Lolium perenne MR : 868–877 www.soci.org © 2017 Society of Chemical Industry populations. An Ile1781-to-Leu substitution in ACCase gene of 74 MR Lolium perenne 2018; and herbicide resistance; resistance mechanism; glyphosate; shikimate accumulation; EPSPS copy number; ACCase; cross-resis- Sus plants had restricted translocation of

MR

In California, glyphosate has been the primary herbicide used Glyphosate resistance in to sethoxydim and cross-resistance to other ACCase-inhibitors.that Radiolabeled herbicide studies and phosphorimaging indicated 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). EPSPS genefrom the copy number and expression level were similar in plants 24.8-, 93.9- and 4.0-foldpopulation. Accumulation less of shikimate susceptible in to glyphosate, sethoxydim and paraquat, respectively, than the susceptible ( Pest Manag Sci Italian ryegrass ( 1 INTRODUCTION grass weed in several cropping systems worldwide.

Abstract BACKGROUND: Glyphosate, paraquat and acetylannual CoA and carboxylase perennial cropping (ACCase)-inhibiting systems. herbicides Recently, are glyphosate,resistance paraquat, widely was and confirmed used ACCase- in and several in Italian acetolactate ryegrass California synthase populations (ALS)-inhibitor fromthe the possible Central Valley mechanisms of of California. This resistance. research characterized RESULTS: Multiple-resistant populations ( confirmation and mechanisms of resistance and Marie Jasieniuk ryegrass populations from California: Parsa Tehranchian, and ACCase-inhibiting herbicides in Italian Multiple resistance to glyphosate, paraquat Dose–response experiments revealed that the (wileyonlinelibrary.com) DOI 10.1002/ps.4774 Research Article Received: 5 September 2017 Revised: 16 October 2017 Accepted article published: 26 October 2017 Published online in Wiley Online Library: 8 December resistance to dissimilar herbicide groups inreported Italian in ryegrass at is least now eight states. for weed control in orchards, vineyards, field edges and ditches for grass populations havemechanisms evolved of resistance action to worldwide. eight herbicide to acetyl CoA carboxylase (ACCase),5-enolpyruvylshikimate-3-phosphate synthase acetolactate (EPSPS), glutamine synthase (ALS), synthetase (GS), microtubule assembly andacid very (VLCFA) inhibitors long-chain has fatty been confirmed infrom several 14 populations states. Inherbicides 1998, was identified multiple in resistance several wheat to fields ACCase in Arkansas and ALS under mild environmentalin regimes several and annual is and highly perennial competitive crops. was the first confirmed caseresistance of to Italian two ryegrass modes populations of with action. Keywords: CONCLUSION: This study shows thatboth multiple target-site herbicide and non-target-site resistance resistance in mechanisms. © Italian 2017 ryegrass Society populations of Chemical in Industry California, USA, is due to tance; paraquat; translocation;

868 869 ) ). 1 50 − mol s pop- 𝜇 2 values − Sus 50 ) were placed mol m population. ). The for glyphosate 𝜇 1 − Sus Sus MR2 15 mm) and kept at ) and an alfalfa field and × MR1 MR1 plants were treated with 0, , values of the Sus Sus 50 wileyonlinelibrary.com/journal/ps 4.5 mm diameter) filled with UCD soil × C day/night temperature and 14: 10 h ∘ plants were treated with paraquat at 0, 0.03, plants were treated at 0, 0.25, 0.5, 1, 2, 4, 8, 16 of herbicide solution at a pressure of 296 kPa. for sethoxydim; Sus 1 1 MR − − and populations by the LD MR ). Seedlings were watered daily and fertilized once a week ) containing 1% v/v crop oil concentrate. Treated plants 1 MR 1 − − )inGlennCountyusedinthisstudywereresampledfor s 2 C for 24 h to maximize germination. Subsequently, seeds were − Seeds of the three populations ( ∘ MR2 on moist filter paper4 in Petri dishes (150 ulation was confirmed to beand susceptible ACCase to at the glufosinate, respective paraquat, recommended rates instudy. a greenhouse inoculated with 1% v/vUSA) Captan and 80 incubated WDGphotoperiod at (Agri provided ambient Star, by temperature Ankeny, fluorescent under IA, lights a (160 12: 12 h seed in 2016glyphosate-susceptible and population from retestedCounty a was for used vineyard as the multiple in susceptible population ( resistance. Sonoma A known sethoxydim andpopulationsfromanalmondorchard( paraquat. The( multiple herbicide-resistant 2.2.2 Cross-resistance toThe ACCase-inhibiting herbicides experiment was conducted in aian RCBD factorial ryegrass with populations three by Ital- fivethe herbicide efficacy treatments of to APP evaluate and CHDnia herbicides commonly cropping used systems. in The Califor- experiment was repeated once. Plants mix (1: 1: 1: 3greenhouse sand/compost/peat/dolomite) set and maintained at in 25/18 a Seedlings were transplanted atplastic pots the (50 mm one- height to two-leaf stage into and 515 g ai ha using a water-soluble commercial fertilizer (Miracle-GroMarysville, Products, OH, USA). Plantsindependently from with each different populationto were herbicides four-leaf treated (Table 1) stage at (88.5–110.5spray mm the chamber height) three- equipped usingTechnologies, with Springfield, an IL, a automated USA). The flat-fandeliver sprayer 187 8001E L was ha calibrated nozzle to (TeeJet 0.03, 0.06, 0.12, 0.25, 0.5,these herbicides. 1 All and sethoxydim treatments 2 contained timesOil a the (Integrated Pro Agribusiness Crop labeled Professionals, field Fresno, CA, ratesv/v. USA) Both of at 1% 0.06, 0.12, 0.25, 0.5, 1, 2ai and ha 4 times the labeled field rate (560.4 g were maintained in the greenhouse under thedescribed same above conditions as and planttreatment mortality (DAT). was All recorded data 21 days(ANOVA) were using after the subjected PROC MIXED to procedure in analysis SAStute of (v. Inc., 9.4, variance SAS Cary, Insti- NC, USA).interactions No were observed; significant therefore, treatment the data by obtainedrepeated experiment from experiments the for each herbicidedata were subjected were to probit pooled. analysis using Mortality PROC PROBITevaluate in SAS the to amount of each herbicide required to kill 50% (LD 2.2 Whole-plant bioassays 2.2.1 Dose–responseExperiments experiments were arranged in atorial randomized design complete (RCBD) block with fac- three populationsindividual and seedlings 25 for replications each of herbicide dose. Eachrepeated experiment was twice. and 32 times the labeled field rate of 867 g ae ha of the resistant and susceptibleresistance Italian ratios ryegrass (R/S) populations. were Fold calculated by dividing the LD of the photoperiod provided by high pressurem sodium lights (400 5 5,13 Several 17 75% of the popu- To date, resistance It is an alternative > 19,20 14,18 species was only reported 17 In 2015, To date, resistance to aryloxyphe- 12 Lolium 16 21 Recently, paraquat at the labeled field 5 : 868–877 © 2017 Society of Chemical Industry 74 -bipyridynium dichloride) herbicides with rapid ′ 2018; However, less than a decade after the introduction 14 15 -dimethyl-4,4 ′ In this study, we selected two multiple-resistant populations Paraquat is a fast-acting contact herbicide commonly used For several years, ACCase inhibitors have provided excellent con- In addition to being retested for glyphosate resistance, Italian with negligible/zero glyphosate, sethoxydim andto paraquat injury elucidate the underlyingtives of this resistance study using the mechanisms. two multiple-resistant The populationsone and objec- susceptible population weretance to: to (1) glyphosate, assess sethoxydim and the paraquat;cross-resistance level (2) patterns of determine the resis- to ACCase-inhibitingtwo herbicides different across chemical families;nisms and of (3) resistance to characterize each herbicide. the mecha- to control grass and broadleaf weeds. trol of ryegrass species in bothworldwide. winter cereals and broadleaf crops Pest Manag Sci 2.1 Plant materialsSeeds and growth of conditions 83 Italianas ryegrass part populations were ofresistance collected in a in Italian 2015 survey ryegrass fromCalifornia evaluating a (unpublished). diversity the Seeds of crops were distribution in bulkedindividuals northern from of 30–50 in glyphosate mature eachherbicide-screening experiments (data sampling not shown), location. severalryegrass Italian populations Based exhibited multiple resistance on to glyphosate, preliminary 2 MATERIALS AND METHODS Based on chemical structure,phenylpyrazolin APP, (PPZ) cyclohexanedione herbicides (CHD) specifically and transferase target the domain carboxyl ofACCase the enzyme homomeric (E.C. 6.4.1.2) plastidic in isoform almost of all grass the weeds. Until this study, multiple resistanceACCase-inhibiting herbicides to in glyphosate, paraquat and in Australia. Multiple herbicide resistance in Italian ryegrasspopulations sampled from orchards, vineyards, roadsides and crop fields across the Central Valley. www.soci.org of these herbicides (1980s), diclofop-methyl-resistantgrass was Italian identified in rye- the USA. noxypropionate (APP) herbicidesItalian has ryegrass been biotypes reported in in cropping several regions across the USA. activity in the light and no activity in soil. to paraquat has beenincluding rigid reported ryegrass. in 33 weed species worldwide, molecular and biochemical studies onryegrass ACCase populations inhibitor-resistant from differentworld geographical revealed regions both of enhanced the metabolismations as and the target mechanisms site of resistance. alter- rate also failed toprune control orchard in an California. Italian ryegrass population from a to glyphosate and(1,1 one of the most widely used bipyridylium lations contained glyphosate-resistant plants (unpublishedThe data). increased incidence of glyphosate-resistant ItalianCalifornia ryegrass is in likely in response to the highover grower other use of herbicide glyphosate mechanisms of action. ryegrass populations resampled in 2015 were testedto for resistance glufosinate, paraquat andthe sethoxydim recommended field at rate (unpublished one data).are These and herbicides commonly two used times tobeing resistant to control glyphosate (Brad California Hanson, University of ryegrass California Cooperative suspected Extension of Specialist, pers. commun.).tance to Multiple glyphosate, resis- sethoxydim and/oror paraquat (in three at combinations) least was two confirmed in several populations. (1) and rate et al. ′ × Lreac- ), we fit 𝜇 individu- Mprimer : 868–877 50 C (anneal- 𝜇 ∘ 74 Sus C for 3 min, fol- 2018; ∘ (GeneBank acces- codonoftheEPSPS L GoTaq Green Mas- 𝜇 106 Lofeach10 ) was designed based . ′ 𝜇 ) 50 50 IC b ∕ X Pest Manag Sci a −( e L. multiflorum -AACGGTCGTGGATAACCTGT-3 + 0.05. No significant differences were ′ is maximum shikimate accumulated, 1 individuals that survived the 4 = a 16 ng cDNA, 12.5 𝛼 C (denaturation) for 30 s, 57 = ∘ ∼ y MR2 ) Adjuvant Manufacturer 1 and − C (elongation) for 60 s, and a final elongation ∘ ) of glyphosate 21 DAT. RNA was extracted from six MR1 1 gene sequencing − Field rate -CCAGCCAAGAAATAGCTCGC-3 ′ (g ai/ae ha is shikimate level, M) resulting in 50% shikimate accumulation (IC y C for 5 min. The PCR amplicons were fractioned on 1.5% 𝜇 EPSPS ∘ Polymerase chain reaction (PCR) was performed in 25 ter Mix (Promega, Madison, WI, USA),and 0.5 Nuclease-Free Watercycler (Promega). (Bio-Rad A Laboratories Bio-Radgrammed Inc., T100 as Hercules, follows: Thermo- initial CA,lowed denaturation by USA) 40 at cycles was of 95 95 ing) pro- for 45 s,at 72 72 agarose gel pre-stained by a fluorescent nucleic acid dyeBiotium, (GelRed™, Fermont, CA, USA) and visualized under UV light. PCR and b is the slope of the curve around IC II microplate readerBackground (Magellan absorption Biosciences, (optical Chantilly,trol density) VA, USA). wells measured in wasthe the subtracted glyphosate con- from treated wells. the Allusing absorbances PROC data MIXED were measured in subjected for SAS.ment to using Means ANOVA Fisher’s LSD were at separated forobserved each between treat- runs. Therefore, todose determine ( the glyphosate on EPSPS mRNAsion sequence number of DQ153168.2) using.ncbi.nlm.nih.gov/tools/primer-blast). NCBI/Primer-Blast Primers (http://www wereby Integrated synthesized DNA Technologies (Redwood City, CA, USA). tion mixture containing plants of each populationVenlo, The using Netherlands). RNeasy RNA quantity Plant wasoDrop Mini assessed 1000 using Kit a spectrophotometer (Qiagen, Nan- (ThermoDE, Scientific, USA) and cDNA Wilmington, constructed using Maxima HcDNA Minus First Strand Synthesis Kit (ThermoUSA). To amplify Fisher the region Scientific covering the Inc, Pro Petaluma, CA, gene, a primer pair (forward: 5 where 2.4 reverse: 5 the following three-parameter sigmoidalusing model SigmaPlot (v. to 12.5, Systat pooled Software Inc., data San Jose, CA, USA): als and from Young leaf tissue was harvested from non-treated (3468 g ae h , The and MR2 MR1 22 , Sus and www.soci.org P Tehranchian Sus et al. MR1 , © 2017 Society of Chemical Industry C. After incuba- ∘ M of glyphosate. Sus 𝜇 )at25 1 C freezer and kept frozen − ∘ s 1 20 − , topped with a lid, and sealed − ® mol m 𝜇 M) were added to each plate contain- 𝜇 were conducted to measure the accumulation 90 mm Parafilm 22,23 × List of herbicides and labeled field rates used in dose–response and cross-resistance studies M. Solutions also contained 10 mM ammonium phosphate C for 48 h and weighed. Dry weight reduction percentage ∘ 𝜇 ) as subplots and 12 glyphosate doses as sub-subplots with plants were grown until the three-tiller stage in the green- SethoxydimClethodimFluazifop-P-ethylFenoxaprop-P-ethyl PoastCyhalofop-butyl Fusilade Acclaim DX Extra SelectMax Clincher SF Aryloxyphenoxypropionates Aryloxyphenoxypropionates Cyclohexanediones Cyclohexanediones Aryloxyphenoxypropionates 128 448 313 – 1% COC 515 146 1% Syngenta COC Crop Protection 1% 1% Bayer COC COC CropScience Dow AgroScience BASF Valent Corporation 0.05. ACCase, acetyl CoA carboxylase; COC, crop*Acid oil equivalent. concentrate; NIS, nonionic surfactant. GlyphosateParaquatACCase inhibitors RoundupPowerMax Glycines Gramoxone SL 2.0 Bipyridyliums 867* 560 – 0.25% NIS Syngenta Crop Protection Monsanto Common name Trade name Herbicide family Table 1. = wileyonlinelibrary.com/journal/ps were treated individually with eachommended herbicide rate solution as shown at in the Table rec- 1.Italian Above-ground ryegrass biomass individual of plants all was harvested 21at DAT, oven dried 60 was calculated based on thenormality mean test of was the conducted non-treated usingdata control. PROC were A UNIVARIATE and subjected then toferences were PROC observed MIXED between the indata two SAS. runs; were No therefore, pooled analyzed significant and𝛼 dif- means separated using Fisher’s LSD at 2.3 Shikimate accumulationLeaf assays disc assays tion, plates were transferred to a until further analysis. Subsequent biochemicalperformed experiments based were on procedures described by Shaner monobasic and 0.1% v/vered Tween with 80 120 surfactant.with Plates a were strip cov- of Parafilmby prior fluorescent to the lights light (160 pretreatments provided of shikimate in young leaves of plants from the herbicide concentrations used50, in 100, this 200, assayKnown 400, were amounts 500, 0, of 700, shikimic 5,100, 1000 acid 10, 125, and (i.e. 150 25, 0, 1250 and 1, 175 2.5, 5, 10, 25, 50, 75, ing non-treated leaf discs tolevel develop a was standard spectrophotometrically curve. (380 Shikimate nm)grams determined per as micro- milliliter HCl for each individual using a DYNEX MRX populations. The experiment wasin conducted a in RCBD a with split-split-plot as six the light main pretreatments plots, (0, three 2, Italian 4, ryegrass 8, populations 16 ( and 32 h) MR house under the growing conditions described earlier.three Each of tillers the of eachinto individual new were pots, separated and andstage. allowed transplanted Individuals to were regrow cloned tosue to the for obtain three- each enough to individual youngin four-leaf of leaf diameter) the tis- were same excised genotype.each from clone Leaf the using discs a third (4 single-hole mm fully paperwell puncher expanded of and leaf placed a in of each 96-wellUSA) containing solutions microplate with glyphosate doses (Thermo ranging from 01250 Scientific, to Pittsburgh, PA, MR2 eight replications. The experiment was conducted twice.

870 871 , 1 − and was mol MR1 𝜇 2 , ) indi- CO MR2 Sus , Sus 14 C-paraquat 14 MR1 (Packard BioScience). 510 bp spanning the + ∼ L volume of the solution 𝜇 Thefirstprimerpair(ACCF1: ) and -susceptible ( 17 C for 48 h. The oven-dried plant ∘ was made by using wileyonlinelibrary.com/journal/ps C-paraquat from the leaf surface. A MR2 1 C-paraquat solution was excised and 14 − , 14 MR1 730 bp spanning the Ile1781 codon. The C] dichloride hydrate, 11.84 MBq mmol ∼ 14 in 190 L ha C-paraquat. The growth chamber was maintained C-paraquat. After removing the treated leaf, each C-paraquat) was applied to the middle 3 cm adaxial 1 14 C with a 14: 10 h light/dark photoperiod (300 − 14 14 ∘ 3 ± C-paraquat absorption, translocation ) provided by fluorescent and incandescent bulbs. 1 14 − s ) were grown in the greenhouse, as described above, and sequences were aligned against blackgrass mRNA for ACCase 2 2.1 kBq of − A solution containing paraquat at a final concentration of ∼ m viduals and cDNAgene synthesized, sequencing. Two as sets describedthe of full primers above chloroplastic were for ACCase designednumber sequence EPSPS based AJ310767) of on to blackgrassall amplify (accession seven the known ACCase gene mutation encompassing sites. and phosphorimaging Two- to three-leaf stage plants of theMR2 three populations ( transferred to a growth chamber for acclimatization 7application days of prior to specific activity; American Radiolabeled Chemicals,MO, Inc., St. USA), Louis, aSL commercial 2.0, formulation Syngenta ofand Crop paraquat 1% Protection, v/v (Gramoxone crop LLC, oil Greensboro, concentrate. A NC, 1 USA), ( at 25/20 (paraquat-methyl-[ 2.6 ACCase gene sequencing RNA wassethoxydim-resistant extracted ( from fresh shoots of six confirmed surface of thea second micro-applicator fully in expandedwere the harvested leaf 5, form 24 of and ofharvest, each 48 hours one the after plant treated or treatment with (HAT). leaf two At3 (TL) cm each droplets. portion was that Plants removed received and only the middle ATGGTAGCCTGGATCTTGGACA and ACCR1: AACTACTGTCTTCGC- CCATCC) amplified second pairTGCATTCTTGGAGTTCCTCTG) (ACCF2: amplified ATCCTCGTGCAGCCATAAGTG and ACCR2: 0.84 kg ai ha 1 mL aliquot of each leafcocktail wash was (Ecolume; mixed with ICN, 10unabsorbed mL Costa scintillation Mesa, CA, USA) to measure the plant was divided into the shoot aboveshoot the below treated leaf the (SATL), treated the leaftranslocation. (SBTL), Each of and the the four plant roots partsroots) for (treated were measuring leaf, SATL, wrapped SBTL, individually in(Kimwipes; a single Kimberly-Clark layer Corp., of Roswell, tissueglass paper GA, vial USA), and oven-dried placedsamples at in were 60 a combusted in aments biological oxidizer Co., (Packard Downers Instru- Grove, IL, USA) and the evolved rinsed in 10 mL ofto 0.1% remove v/v the Triton unabsorbed X-100 (Sigma-Aldrich) for 20 s trapped in 10 mL ofian, Carbosorb CT, E (Packard USA) BioScience and Co.,Levels 10 Merid- of mL radioactivity of from Permaflour thequantified E leaf by washes and using oxidationsTri-Carb were 2100TR; liquid Packard scintillation Instruments). The spectrometry average (Packard recovery of Sus and sequences ofto NCBI. the sethoxydim-resistant plants submitted 2.7 Trp1999, Trp2027, Ile2041, Asp2078, Cys2088 and Gly2096 codons. Primers were designed using NCBI/Primer-Blast program andthesized syn- by IDT. PCR conditions andthe sequencing procedures same were assequence described chromatograms were checked above for potential for sequencing errors and EPSPS trimmed using gene the BioEdit sequencing. software. The All t ′ ′ L 𝜇 for 1 − Cand EPSPS L ∘ EPSPS)] primers ) Italian 𝜇 )were )known t ′ ATGTGGG C Sus ) designed ′ − ′ MR2 LOLR actin mol), and 2 , 𝜇 ,and (accession num- actin MR1 (accession number (accession number MR2 TCCACTCCACAAAGTA , ′ MR1 sequence (GeneBank acces- -tubulin or 𝛽 t -CTGACTGAGGCACCCCTGAA-3 ′ primers (forward: 5 C -CTGATGGCTGCTCCTTTAGCTC-3 ′ = and reverse 5 :5 Populus euphratica ) and -resistant ( ′ Ct F2 Δ [ Sus Sesamum indicum -tubulin L. multiflorum Ct Tarenaya hassleriana 𝛽 Δ C. A melt curve profile was included at the : 868–877 © 2017 Society of Chemical Industry were used to normalize EPSPS copy number, ∘ -CCCAGCTATCAGAATGCTCTGC-3 ′ was included as a positive control. For EPSPS 74 -GCTGACACCATCACCAGAATCCAAC-3 26 were used for the . Results for three replicates (individuals) from ′ ) ′ individuals was determined by the comparative C :5 Sus L. A StepOnePlus™ Real-Time PCR System (Thermo 24,25 primers (forward: 5 24,25 2018; R2 𝜇 genomic copy number and expression MR2 known as 2 L each of forward and reverse primers (5 actin 27 𝜇 and L of Power SYBR green (Life Technologies, Grand Island, NY, EPSPS 𝜇 C for 10 min and 30 cycles of 15 s denaturation at 94 ∘ MR1 gene amplifications. Fisher Scientific) was programmed94 for an initial denaturation at 30 s annealing at 60 end of the cycle toEPSPS determine primer the pair specificity (EPSPS of the reaction. The LOC104823416) sequences obtainedrelative from fold increase NCBI in EPSPS GenBank. copyof number The and gene expression Pest Manag Sci method and reverse: 5 and EPSPS ryegrass. A glyphosate-resistant Italian ryegrass ( Multiple herbicide resistance in Italian ryegrassproducts were purified usinggen) QIAquick according PCR to the Purification manufacturer’s protocol Kit and(Terminator used (Qia- in v. BigDye 3.1 Cycle SequencingWaltham, Kit, Thermo MA, Fisher USA) Scientific, products PCR amplification were reactions. precipitatedand Subsequently, using sodium Applied acetate precipitation Biosystemsan protocol ABI ethanol and 3100 sequenced GeneticCA, with Analyzer USA). (Applied All Biosystems,Sequence sequences Foster Alignment Editor City, were (Ibis editedand Biosciences, www.soci.org aligned Carlsbad, and along CA, with trimmed USA) in BioEdit 2.5 sion number DQ153168.2) using ClustalTools/msa/clustalo). Sequences Omega were (www.ebi.ac.uk/ submitted touals NCBI. with Individ- singlehomozygous peaks for that base at while individuals each with multipleping overlap- base peaks at position a were basethe two position considered bases. were considered heterozygous for of the diluted genomicvolume of DNA 14 or cDNA to make a final reaction whereas GGAAGAGTTCT-3 by Salas et al. ATGCCAAGAACATGATGTG-3 used to normalize EPSPS gene expression. The were designed against the ber LOC105117324), LOC105170653) and copy number analysis, genomic DNA wasDNEasy extracted using Plant Qiagen Miniprotocol. Kit DNA following wastrophotometer. the Genomic quantified DNA manufacturer’s using was provided normalized a to 20 NanoDrop ng 1000 spec- to have increased EPSPSearlier copies studies, and gene expression, based on Quantitative PCRtem, (StepOnePlus™ Thermomine real-time Fisher EPSPSglyphosate-susceptible genomic Scientific) detection ( copy was sys- number performed and expression to in deter- the relative to the each population were usederror to for calculate each reaction. the mean and standard direct use in quantitativeexpression, PCR we (qPCR) used the reactions. cDNA Forthe samples EPSPS that EPSPS were gene gene synthesized sequencing. for Thedirect cDNAs use in were the diluted qPCR 1: reactions.mination 5 The v/v of qPCR for reaction both mix EPSPS forof deter- copy 8 number and expressionUSA), consisted 2 † Sus the et al. )Ital- Sus MR1 MR2 R/S × )and .These 50 MR2 (Table 2). : 868–877 , Sus LD Sus 1 74 − B C MR1 ) tested. Only C 1 − A 2018; plants were con- MR B C 0.05). populations were 20.5- B C = 50 1 individuals at 0.125 𝛼 − population would escape rate of paraquat, whereas MR2 × ) and -resistant ( populations were 122.7- and Sus Pest Manag Sci MR1 B Sus and C MR2 gai/aeha 93.21 (71.67–119) 4280 (3421–5370)2318 (1938–2777) 45.9 24.8 93.74 (80.94–111) 11 503 (8694–16 918)8803 (7069–11 269) 122.7 93.9 25.04 (20.29–30.07) 514.12 (437.05–589.41)103.47 (79.78–133.10) 20.5 4 AA MR1 Herbicide and were 25, 514 and 103 g ai ha A plants showed rapid desiccation 6 h after 50% of the B C MR1 > MR2 A ) Italian ryegrass populations Sus values, the Sus MR1 MR2 Sus MR1 MR2 Sus MR1 MR2 50 MR2 and individuals 21 DAT. Based on the R/S calculated , values, B C C 50 Dose of glyphosate, sethoxydim and paraquat required for ) mortality of the multiple herbicide-susceptible ( individuals survived the 2 MR1 MR1 A MR2 , Percentage of above-ground biomass dry weight reduction 50 plants died. The paraquat rates estimated to achieve 50% Sus MR1 0

and 80 60 40 20

100

individuals were effectively controlled with essentially 100% w y g i t c u d e r % ( r D e t h n o i Resistant/susceptible ratio. ) MR2 Paraquat controlled 100% of the Herbicide Population LD -resistant ( *Acid equivalent. Table 2. Glyphosate* Values in parentheses are 95% fiducial† limits. 50% (LD Sethoxydim Paraquat labeled field rate. treatment and were killedtrolled within at the 24 h. highest All paraquat rate (2240 g ai ha from the LD ian ryegrass populations in21 days response after to treatment. ACCase-inhibiting Meanferent herbicides letters values indicate at for significant differences each ( herbicide followed by dif- and 4.1-fold less responsive toresults paraquat suggest compared that to the labeled field rate of the herbicide. 3.2 Cross-resistance toSus ACCase-inhibiting herbicides reduction in above-ground biomassrates (Fig. 1) of at all the labeled ACCase-inhibiting field herbicides used in this study 93.9-fold, respectively, less susceptible to sethoxydim than the population. Figure 1. of plants from herbicide-susceptible ( MR1 BasedontheLD afew of the all C ∘ Sus and Sus www.soci.org P Tehranchian C-paraquat C-paraquat populations, populations, 14 14 C until drying. © 2017 Society of Chemical Industry ∘ C and expressed MR2 MR2 20 14 values were 93.21, − 0.05) were detected 50 values were 93.74, 11 and and < populations were 45.9- individuals, all P 50 individuals at the labeled MR1 MR2 MR1 MR1 , C-paraquat. The experiment , Sus 14 and Sus Sus 0.05. = populations exhibited high levels of P MR1 for the 40 cm exposure cassette (GE Healthcare MR C), based on the sum of the radioactivity 1 × , for the − 14 1 − ) tested. The resistance index (R/S) calculated from 1 − C-paraquat was 96% (absorption, expressed as a per- 14 individuals were killed at the highest rate of glyphosate values revealed that the 21.25 cm piece of plain white paper. Shoot parts were spread ) used in the dose–response experiment did not kill 90% of population. 1 × 50 − All experiments were conducted using a completely random- Sethoxydim, at the labeled field rate, controlled 100% of the For each experiment, population and harvest time, the fourth MR2 (27744 g ae ha respectively. Even theha highest rate of sethoxydim (16 800 g ai wileyonlinelibrary.com/journal/ps field rate. In contrast, bothof MR populations resistance exhibited to a glyphosate. high level Glyphosate LD 3RESULTS 3.1 Resistance levels Glyphosate controlled 100% of the the applied respectively (Table 2). In contrast to and to develop an image.were carefully After dismounted image and dried development, in plant anoxidation oven using parts in the preparation methods for described above. ized design (CRD). DataGLM in were SAS. analyzed No by significant ANOVA differences using ( PROC Plant samples were dried in a gravity convection oven at 60 Bio-Sciences Corp., Piscataway, NJ, USA) andwith brought into a contact storage phosphor screenBio-Sciences) (BAS under IPSR diffused 2025 lighting. E;in The GE a apparatus Healthcare dark was cabinet for placed 24GE h. Healthcare) was A used phosphorimager to (Typhoon detect the FLA distribution 7000; of between experiments therefore datawere from pooled. the Differences two among experiments Fisher’s populations Protected LSD were test at tested using solution was excised and rinsed in(Sigma-Aldrich) 10 for mL 20 of s 0.1% to v/vand Triton remove X-100 set any unabsorbed aside. radioactivity, Thereplicate remaining plant above-ground part was of27 excised each from fourth theout roots evenly and and mounted kept inThe on washed place treated leaf a with was also thin mounted. Care was stripscontact taken of to of avoid the washed clear treated leaf office with the tape. Prior other parts to of the mounting plant. withwater the to shoot, remove roots the were soilmounted gently and rinsed plant blotted with parts dry were withof pressed paper towels. between newspaper, The one bound ortogether with more with large layers two binder clips hard and stored cardboard at sections, held for 1 h. After coolingplant the was dried placed in sample a to 20 room temperature, the LD as a percentage of the absorbed centage of the applied individuals whereas both and 24.8-fold, respectively, less susceptible to glyphosateSus than the 503 and 8803 g ai ha that was measured in all thelevel plant parts of and leaf radioactivity washes. The recoveredtreated total leaf, from was designated all as the translocated plant parts, except the 4280 and 2318 g ae ha was conducted twice withpopulation for four each experiment. replicates per harvest time per replicate was usedthe for treated phosphorimaging. leaf Asremoved, from described the each above, middle of 3 cm the portion fourth that replicate received plants was resistance to this herbicide (Table 2). LD

872 873 MR B )and plants, C D Sus A MR ) amino acid C D and Consistent with D MR2 M glyphosate. The (accession num- B 0.05). Sus 𝜇 24,25 = (accession number Genomic EPSPS copy 𝛼 Two fragments of the C D MR2 D MR1 C D resistant individuals (Fig. 5). , Italian ryegrass populations is populations. Sus MR2 C D MR MR wileyonlinelibrary.com/journal/ps and D populations via Sanger sequencing. ) and Pro106-to-Ala ( glyphosate-resistant individuals, which Hours after treatment Hours after genomic copy number. Similarly, all MR1 D Sus MR1 MR (accession number MF163395) individuals in D positive control with increased EPSPS copies ) leaf discs inoculated in 500 plants ranged from 0.95 to 1.2, based on the -tubulin 65 copies) in previous studies. MR2 𝛽 MR2 Sus ∼ Sus MR1 MR2 , LOLR were amplified and sequenced in six plants from 02481632 gene copy number results, there was no difference in 17 MR1 Accumulation of shikimate in herbicide-susceptible ( 0 (accession number MF163392), plant (positive control) that was shown to have increased 80 60 40 20

140 120 100

individuals, which were homozygous. Based on our results, EPSPS HCl mL µg Shikimate –1 amount of shikimate was averagedby over the seven same replicates. letters Means are followed not significantly different ( Figure 3. MR1 the 660 bp fragment. Nucleotideto polymorphisms TTA) were at found in Ile1781 all (ATA each of the three populations. Sequences were(including trimmed Ile1781codon) to and 660 490 bp bp (including Trp1999,Ile2041, Trp2027, Asp2078,revealed Cys2088, no insertionsever, Gly2096). or sequences did deletions Sequencepolymorphisms reveal in alignment non-synonymous either (SNPs) single fragment.MF163394) among nucleotide and How- the -resistant ( ber MF163393), and Sequences were trimmed andagainst 506 the bp available EPSPS of sequence of each Italian ryegrassnumber sequence (accession aligned DQ153168.2) in.nih.gov/genbank/). NCBI Missense GenBank mutationswere (https://www.ncbi.nlm detected at in the all Pro106 codon glyphosate resistance in both due, or at least partially due,ing to to target site Pro106-to-Thr mutations ( correspond- substitutions (Fig. 4). 3.3.1.3 EPSPS copynumber number and in expression. all relative EPSPS: were heterozygous at theSus first base of the codon in contrast to plants also had aLOLR single EPSPS copy (TableEPSPS copies 3) ( in contrast to the relative EPSPS: actin gene expression between whereas the showed increased expression of theresults suggest EPSPS that gene EPSPS gene (Table amplification 3). doesto These not glyphosate contribute resistance in the 3.3.2 Sethoxydim 3.3.2.1 Partial ACCase gene sequencing. plastidic ACCase genemutations are spanning known seven toherbicides confer codons resistance to where ACCase-inhibiting point exp Sus leaf MR1 MR1 MR2 + Sus Sus MR1 MR2 1200 MR1 and leaf discs -ethyl and 34.2/(1 P /1804.2)/314), 0.05). At the x = Sus ( Mfor = y MR1 : 𝜇 0.95. 𝛼 − values calculated leaf discs reached population plants = Sus 2 50 R Sus MR exp ( plants over a range of + Partial EPSPS sequences 99% (Fig. 1). MR < . individuals were effectively 92/(1 plants were 20.5- and 4-fold Shikimate accumulation was and = -ethyl, fenoxaprop- leaf discs, 1010 leaf discs (Fig. 3). At 16 HAT, y P ) were similar over all six light MR2 /613.2)/267.8), : Sus x ( Glyphosate µM Sus Sus MR2 − MR1 ) Italian ryegrass populations over a range leaf discs. and and exp ( Mfor MR2 , 0.92; 𝜇 + gene sequencing : 868–877 © 2017 Society of Chemical Industry MR2 M glyphosate (Fig. 2). IC MR1 and MR2 = MR2 𝜇 74 2 MR1 MR1 R , 21/(1 Mfor EPSPS plants was considerably lower ranging from 3% leaf discs, respectively. At 32 HAT, = 𝜇 Sus 2018; y : individuals whereas MR2 MR2 plants. Shikimate accumulation in MR2 , respectively. This difference in shikimate accumulation Shikimate accumulation of leaf discs from herbicide-susceptible Partial 0 150 300 450 600 750 900 1050 MR1 5 0 and and Sus 40 35 30 25 20 15 10

MR2

0.97;

plants. Shikimate µg mL µg Shikimate HCl /141.5)/121.6), ) and -resistant ( –1 x = ( Shikimate levels detected in untreated leaf discs from the three 2 − Sus of 540–590 bp were obtained for six individuals from the respectively less responsive to glyphosate at theSus labeled rate than 3.3.1.2 was consistent with the resultsexperiments of the where glyphosate dose–response accumulated 19.6 and 3.9 times more shikimate than the and pretreatments (0, 2, 4, 8,differed 16 in and shikimate 32 h). accumulation However, among treatedleaf populations leaf discs with discs exhibiting shikimate levels significantlypretreatments lower than at all light leaf discs accumulated 35.2-MR1 and 3.7-fold more shikimate than populations ( to 14% andment 3.2% with sethoxydim, to fluazifor- 12%, respectively, in response to treat- of glyphosate doses. Eachshikimate data accumulation from point two indicates runsted the pooled lines over averaged seven are amount leaf predicted of discs. from Plot- equation 1 as follows: discs, and 570 Pest Manag Sci ( labeled field rate, clethodim resulted in only ation 14% in biomass reduc- controlled with a biomass reduction of (Table 1). In contrast,MR1 the above-ground biomass reduction of Figure 2. ( cyhalofop-butyl. Interestingly, theplants response to clethodim of was significantly different ( Multiple herbicide resistance in Italian ryegrass www.soci.org at this dose were 142 3.3 Resistance mechanisms 3.3.1 Glyphosate 3.3.1.1 Shikimateobserved accumulation. in leaf discs of both R glyphosate doses although leaf discsrevealed from significantly lower shikimate accumulationsthan at all doses a maximum at 500 ) 4) 24, MR Sus fol- and > MR2 et al. > MR2 Lolium Sus individ- Sus and : 868–877 and plants, but 74 45 and MR2 MR1 > MR1 Sus 93, respectively) plants at 48 HAT. 2018; > plants retained more MR2 exhibited a low (R/S and MR2 122 and MR2 > Sus and Pest Manag Sci individuals, whereas mutations MR1 also exhibited a high level of resis- plants only. MR1 plants at 24 and 48 HAT with the fol- Italian ryegrass populations examined MR1 but there were no differences in the root MR2 MR plants at both 24 and 48 HAT. Consequently, MR2 and MR2 Sus ) Italian ryegrass populations in California with populations is due, at least partially, to target and Sus and MR2 , MR2 20) to paraquat, whereas MR1 C-paraquat remained in the treated leaf of plants from > 14 MR1 MR1 and plants at 24 HAT, and in SBTL of populations to APP and CHD ACCase-inhibitors but a slightly MR1 We did not find evidence for a single, common mechanism of The phosphorimaging results (Fig. 7) were consistent with the C-paraquat than C-paraquat levels were higher in the SATL and SBTL tissues of uals (Fig. 4). The differencespendent between evolutionary populations origins point of target-site to glyphosate inde- resistance plants. However, by 48leaves and HAT, growing paraquat points of translocated plants from tothe all roots three youngest of populations but the lowed by MR1 lowing exceptions. Paraquat levels were similar in SATL of populations. Treated leaves of 4Resistance DISCUSSION in the two in this studymultiple from herbicide the modes of Central action (MOAs), ValleyACCase including inhibiting glyphosate, herbicides of and paraquat. California Both the existspopulations exhibited across a high level of resistance (R/S resistance level. Results further indicatedMR cross-resistance of both different cross-resistance pattern inThis the two is populations the (Fig. 1). Italian first ryegrass populations report in ofAPP California and with ACCase-inhibiting CHD cross-resistance herbicides. herbicide-resistant to multiple resistance in Italian ryegrass. Rather, results indicated sim- ilar mechanisms of resistance topopulations, each albeit herbicide with MOA internal in variation that both dent points evolutionary to origins indepen- of resistanceon in each the population. results Based ofin EPSPS gene sequencing, glyphosatesite resistance mutations leading to106 amino acid of substitutions EPSPS. at Mutationsin codon resulting site in EPSPS Pro106-to-Thr were substitutions detectedcausing Pro106-to-Ala in substitutions were detected in 14 14 respectively) to glyphosate and (R/S tance (R/S all three populations. At 24 HAT, paraquatin movement the was youngest evident leaves as wellnot as in in the the youngest roots leaves of or the roots of the resistant ( distribution levels of paraquat between48 the HAT. three populations at translocation pattern for theabsorbed most part. At 5 HAT, most of the Paraquat distribution in the roots at 24 HAT was greatest in plants than to sethoxydim (Table 2). , ) and -resistant ( Sus Sus MR2 pop- Lolium and www.soci.org P Tehranchian MR2 individuals MR1 and © 2017 Society of Chemical Industry , MR2 ) Italian ryegrass Sus MR1 Paraquat absorption MR2 , ). Values are averages of MR1 C-paraquat movement out genes, respectively, for the LOLR 14 C-paraquat in actin 14 genomic copy no. gene expression and ) and -resistant ( 0.05). where a resistant rigid ryegrass ( -tubulin = individual with a SNP at Leu1742 resulting 𝛽 actin Sus 28 𝛼 , -tubulin MR1 𝛽 1.030.58 b0.49 bc c 0.84 0.49 1.88 0.48 1.44 1.72 0.32 0.29 0.41 2.101.43 b2.24 b b 0.10 0.15 0.18 1.92 1.17 1.94 2.3 1.73 2.5 et al. 75.41 a 58.94 64.06 4.86 plants transported more paraquat out of the EPSPS: EPSPS: 104.42 a 12.75 84.25 100.96 populations and harvest times. Translocation of Sus Relative EPSPS genomic copy number and expression (GeneBank accession number DQ153168.2) around EPSPS codon Pro106. The black arrow shows the amino acid substitutions at Pro106. C-paraquat accumulation in all tissues among the three MR2 Sequence comparison of plants from herbicide-susceptible ( 14 Gaud.) population had less and The distribution of absorbed three replicates.* Population Mean Min Max SE populations, and the positive control ( herbicide-susceptible ( Sus 1 MR1.1 MR 2.1 LOLR *Means for eachsignificantly different population ( followed by the same letter are not Table 3. compared with Sus 1 MR1.3 MR 2.2 LOLR C-paraquat was similar in all three populations at 5 HAT (Fig. 6). ulations (3.69% and 0.9% of3.44% absorbed of at absorbed 24 at HAT,reported and 48 1.48% by HAT, and respectively). Yu Similar results were treated leaves atabsorbed, both respectively) than 24 plants from and the 48 HAT (8.84% and 8.45% of wileyonlinelibrary.com/journal/ps ranged from 98% to 99%14 of applied radioactivity across 3.3.3 Paraquat 3.3.3.1 Paraquat uptake and translocation. in a substitution ofidentified Leu1742-to-Pro in (data the not 490 shown).associated bp with The have resistance to SNPs not ACCase-inhibiting herbicides. been previously shown to be Chromatograms revealed an A/T overlappingfirst double peak base at of the theindividuals, indicating Ile1781 heterozygosity at codon this codon. inthe Sequences 490 some of bp sequences fragment revealed ofwith some, resistant non-synonymous but not SNPs all, atHis1741, and Cys1709, one Trp 1712, Ile1715 and MR1 Figure 4. of the treated leaf compared to a48 susceptible HAT. population at 24 and Thereafter, rigidum plants is summarized inences Table in 4. At 5 HAT, there were no differ- multiflorum

874 875 MR2 but the and Based on Nevertheless, MR1 14,40–42 Italian ryegrass 17,36,37 17 MR gene regions revealed ACCase a mutant Asp2078-to-Gly allele 42–44 39 , wileyonlinelibrary.com/journal/ps where an Asp2078-to-Gly substitution et al. 38 ) Italian ryegrass populations in California with MR2 , MR1 11,35 population. This result is similar to earlier findings on the 0.05). = MR2 𝛼 Sequencing of two chloroplastidic Varying levels of cross-resistance to sethoxydim and clethodim % absorbed which indicates that EPSPSresistance gene to glyphosate in amplification the populations is examined in notAltered this study. conferring glyphosate translocation wasnism not of found glyphosate to resistance beryegrass, in a but remains early mecha- to studies be investigated ofpopulations. in California the rigid did not result inHowever, according resistance to to Yu either sethoxydim or clethodim. the cross-resistance results obtainedIle1781-to-Leu in substitution did our not study, causethe however, clethodim the resistance in genetic basis of ACCasezon inhibiting sprangletop biotypes herbicide resistance in Ama- endows cross-resistance to APPpopulations and in Australia. CHD herbicides in ryegrass have been reported in ryegrass species worldwide, metabolism-based cross-resistance to low-dosethe same herbicides site with of actionwild in oat, grass have weeds, been such documented. as rigid ryegrass and nucleotide polymorphisms at Ile1781resistant (ATA to to ACCase-inhibiting TTA) herbicides in from both individuals populations (Fig. 5). The target siteacid mutation substitution and have resulting previously amino beenrelated shown with to a high be level directly ofin cor- several resistance weed to species, APP including and Italian CHD ryegrass. herbicides underlying genetic basis of the phenotypicto variation in the resistance two herbicides,ing when previous it studies occurs, onweeds is several in different not ACCase cropping inhibitor-resistant known. systems,CHD cross-resistance grass Consider- to herbicides APP and isdomain generally of due the to plastidicacid ACCase point gene, residues mutations resulting on in the at altered binding the amino site CT of the enzyme. ) and -resistant ( Sus * plants (Table 3), Sus However, despite the It has been suggested 33,34 30–32 * TL SATL SBTL Root Non-synonymous EPSPS gene muta- Hours after treatment after Hours C-paraquat in plants from resistant and susceptible Italian ryegrass populations* C-paraquat in plants from resistant and sus- 14 14 12,29 plants compared with : 868–877 © 2017 Society of Chemical Industry (GeneBank accession number AJ310767) around ACCase codon Ile1781. The black arrow shows the amino acid substitutions ) within the harvest time according to Fisher’s LSD 74 MR2 MR2 MR2 MR2 MR1 MR1 99.61 a99.54 a 91.55 a99.29 a 96.31 b 91.16 a 99.10 b 98.52 b 0.00 a 96.56 b 0.05 a 1.81 b 0.02 a 1.32 b 2.50 b 0.02 a 0.16 a 0.00 a 0.49 a 0.04 a 4.65 b 0.11 a 0.85 a 3.66 b 0.48 a 0.54 a 0.39 a 1.2a b 0.37 a 1.99 b 0.58 a 1.52 ab 2.67 0.40 a a 0.77 a 1.74 a , Sus Sus 2018; and MR1 Distribution of Sequence comparison of plants from herbicide-susceptible ( Translocation of 01020304050 MR1

9 8 7 6 5 4 3 2 1 0

0.05. 15 14 13 12 11 10

d e b r o s b a f o % ( n o i t a c o l s n a r t t a u q a r a p - C

) = 4 1 𝛼 MR1 MR2 SATL, shoot above treated leaf; SBTL,*Similar shoot letters below indicate treated no leaf; difference TL, between treated means leaf. within the same column ( PopulationSus 5 h 24 h 48 h 5 h 24 h 48 h 5 h 24 h 48 h 5 h 24 h 48 h Table 4. at Alopecurus myosuroides at Ile1781. ceptible Italian ryegrass populations. Ansignificant difference asterisk between the at susceptible population a and data thepopulations resistant point ( indicates Pest Manag Sci in each population. Thesubstitutions specific were previously gene detected mutations in EPSPS and sequencesifornia of associated Cal- Italian ryegrass. Figure 6. Figure 5. Multiple herbicide resistance in Italian ryegrass www.soci.org high levels of glyphosate resistanceno detected (Table evidence 2), of we found increasedsion EPSPS in gene copy numbers or expres- tions were also identified inryegrass glyphosate-resistant Italian in and areas rigid outside California. that EPSPS point mutationsprovide conferring only a resistance moderate to level glyphosate amplification of and resistance, whereas altered EPSPS glyphosate gene translocationlevels confer of glyphosate higher resistance in weeds. ) ). MR Hort mul- et al. MR2 Lolium Weed Sci Weed Sci ssp. : 868–877 and 74 Weed Technol Annu Rev Plant Lolium rigidum MR1 J Agric Food Chem :1–16 (2012). 2018; 7 45 :412–419. around the world: mech- Lolium perenne 48 :123–131 (2009). Lolium Pest Manag Sci Curr Bioinform 31 Weed Sci :142–152 (2014). spp. 68 , Glyphosate-resistant Italian ryegrass ( Seed Technol :473–503 (1999). Lolium 50 et al. Calif Agric :678–682 (2003). ) in California: distribution, response to glyphosate, Proceedings of the 57th Weed Science Society of America 51 , Tucson, AZ, p. 26 (2017). ) control with fall-applied residual herbicides. , Herbicide-resistant weeds challenge some signature crop- :377–430 (1987). 9 et al. :435–441 (2009). :361–370 (2014). :4406–4412 (1998). :496–502 (2008). Rev 57 A decade of glyphosate-resistant anisms, genes, fitness, and agronomic management. ences between glyphosate-resistant andgrass populations. -susceptible Italian rye- tiflorum 28 [Online]. Available: http://www.weedscience.com/ [4 August 2017]. diclofop-resistant Glyphosate-resistant Italian ryegrass ( Physiol Mol Biol JA ping systems. a technique for screening46 glyphosate efficacy. multiflorum and molecular evidence56 for an altered target enzyme. resistance in Italian ryegrass populationsCalifornia. from the Central Valley of Meeting enzymes of shikimate pathway. glyphosate resistance in California rigid ryegrass ( Weed Sci A, Lanini WT In summary, we have shown that multiple resistance to 2 Hogue EJ and Neilsen GH, Orchard floor vegetation management. 1 Preston C, Wakelin AM, Dolman FD, Bostamam Y and Boutsalis B, 3 Nandula VK, Poston DH and Reddy KN, Seed germination differ- 5 Heap I, The6 International Kuk Survey Y, of Burgos NR Herbicide and Talbert Resistant RE, Weeds. Cross- and multiple resistance of 4 Bond JA, Eubank TW, Bond RC, Golden BR and Edwards HM, 7 Hanson BD, Wright S, Sosnoskie LM, Fischer AJ, Jasieniuk M, Roncoroni 8 Harring T, Streibig JC and Husted S, Accumulation of9 shikimic Herrmann acid: KM and Weaver LM, The shikimate pathway. 13 Tehranchian P, Heap I, Deveaud T and Jasieniuk M, Multiple herbicide 10 Dev A, Tapas S, Pratap S and Kumar P, Structure and function of 11 Simarmata M, Kaufmann JE and Penner D, Potential basis of 12 Jasieniuk M, Ahmad R, Sherwood AM, Firestone JL, Perez-Jones current study. Various levels ofhave field-evolved been reported paraquat for resistance several weed species. populations. Given theto independent glyphosate, mechanisms ACCase of inhibitors,populations and resistance paraquat and identified the in bicides temporal in pattern California of orchardsused usage to and control vineyards of ryegrass (e.g. theseglyphosate), after paraquat it it her- is was became likely difficultsequentially that to resistance control within to with each eachresistant herbicide populations evolved population we have today. to produce the multiple glyphosate, ACCase-inhibiting herbicides and paraquat isin present some Italiansingle, ryegrass common mechanism populations does ofmultiple not underlie California, herbicide resistance and MOAs. togroup the Rather, that appears resistance a to tomechanisms have each identified, evolved herbicide and independently,and the variation based differences observed in in on eachmutations) resistance mechanism the (e.g. levels between different specific the two multiple-resistant ( REFERENCES ACKNOWLEDGEMENTS This research2015-67013-22949. was The authors fundedFautt would also and by like Lena toassistance, USDA-NIFA-AFRI and thank Ian El-Mahmoud Baker Chad for Award for greenhouse maintenance. greenhouse No. and laboratory MR1 20-fold) www.soci.org P Tehranchian > 30-fold) in ( = : lower) popula- © 2017 Society of Chemical Industry MR2 where a resistant MR2 populations in the MR 14,28 , : middle; C-paraquat movement out et al. 14 MR1 did not observe wilting and/or population (data not shown). The 28 Sus plants (Table 4 and Fig. 6) pointing to Sus C-paraquat at 5, 24 and 48 HAT (left to right). Arrows 14 The level of paraquat resistance (RI : upper) and resistant ( 21 4-fold) populations, but we could not determine the Sus > plants than ( Phosphorimages of Italian ryegrass plants from the herbicide- MR2 MR1 Substantially more paraquat was retained in, and substantially this population was higher than that of the indicate the treated area of the second fully expanded leaf. underlying reason forresistance the was difference. confirmed Moreian in ryegrass recently, a population multiple paraquat fromvacuolar herbicide-resistant a sequestration prune Ital- of orchard paraquat inof as California resistance. the with probable mechanism and reduced paraquat translocationSimilar as results a were mechanism reported of by resistance. Yu less paraquat was translocated out of treated leaves of wileyonlinelibrary.com/journal/ps susceptible ( Figure 7. tions treated with rigid ryegrass population had less of the treated leaf comparedand with 48 a susceptible HAT. These population at researchers 24 and desiccation of either treatedpopulation, or whereas untreated we leaves did in observepopulations, the in such particular, the resistant symptoms in all three level of paraquat resistance differed between the

876 877 , et al. Lolium Lolium Lolium Weed Sci PLoS ONE :181–188 :603–608 Weed Res . Pest Manag :3–9 (2012). 56 72 Plant Physiol Physiol Planta 68 :932–941 (2011). :3227–3233 (2011). 67 Weed Sci 59 population. Pest Manag Sci . Pest Manag Sci Lolium multiflorum :79–84 (2016). 133 Pest Manag Sci :1154–1166 (2005). ) from California. spp. wileyonlinelibrary.com/journal/ps J Agric Food Chem Avena fatua 110 Lolium rigidum :440–448 (2005). :1367–1377 (2014). 45 :317–347 (2010). 70 Lolium 61 population. Lolium rigidum Weed Res populations: evaluation using clethodim. . Pestic Biochem Physiol biotype is endowed by multiple mechanisms: isolation Theor Appl Genet . Pest Manag Sci Lolium :1316–1323 (2014). :547–558 (2007). 4 :432–440 (2006). :488–494 (1994). :311–318 (2000). :e39759 (2012). (2008). resistance to the cyclohexanedione herbicide sethoxydim in multiflorum the ACCase gene and responsepinoxaden-resistant to ACCase-inhibiting herbicides in 46 A novel P106L mutationact in additively EPSPS to and confer an resistanceLolium to unknown rigidum glyphosate mechanism(s) in a South African a glyphosate-resistant edge. Annu Rev Plant Biol of resistance to glyphosate taught us? rigid ryegrass ( Scott RC, ResistanceAmazon to sprangletop: confirmation, aryloxyphenoxypropionate control, and herbicides molecularresistance. basis in of Diversity of acetyl-coenzymetant a carboxylase145 mutations in resis- (2016). Sci rigidum of a subset91 with resistant acetyl-CoA carboxylase. wald JWcarboxylase-inhibiting and herbicides Giménez-Espinosa in 48 R, Resistance to acetylto ACCase inhibiting CoA herbicides in a ryegrassto population a is cysteine due only to arginine7 mutation in the target enzyme. selection in self-pollinated rates results in the rapid evolutionrigidum of herbicide resistance in 36 White GM, Moss SR and Karp A, Differences in the molecular37 basis of Scarabel L, Panozzo S, Varotto S and Sattin M, Allelic variation of 31 Kaundun SS, Dale RP, Zelaya IA, Dinelli G, Marotti I, McIndoe E 30 Wakelin AM and Preston C, A target-site mutation is present in 32 Sammons RD and Gaines TA, Glyphosate resistance: state of knowl- 33 Powles SB and Yu Q, Evolution in action: plants34 resistant to herbicides. Shaner DL, Lindenmeyer RB and Ostlie MH, What have the mechanisms 35 Simarmata M and Penner D, The basis for glyphosate resistance in 38 Tehranchian P, Norsworthy JK, Korres NE, McElroy S, Chen S and 39 Yu Q, Collavo A, Zheng MQ, Owen M, Sattin M and Powles SB, 45 Hawkes TR, Mechanism of resistance to paraquat in plants. 40 Tardif FJ and Powles SB, Herbicide multiple-resistance in a 41 De Prado RD, González-Gutiérrez J, Menéndez J, Gasquez J, Gron- 42 Kaundun SS, Hutchings AJ, Dale RP and Mclndoe E, Broad resistance 44 Busi R, Girotto M and Powles SB, Response to low-dose herbicide 43 Neve P and Powles SB, Recurrent selection with reduced herbicide , , ) in :777 et al. et al. Weed 8 Lolium L. spp. Conyza multiflo- Weed Sci Amaranthus ssp. biotype. Pest Manag Sci Ann Appl Biol J Agric Food Chem ) to mesotrione at Lolium multiflorum Front Plant Sci :97–109 (1993). Lolium perenne : e0126731 (2015). :350–353 (1989). 31 3 10 Lolium perenne Herbicide Resistance in Plants: Lolium rigidum :1029–1034 (2010). from California indicates multiple ) from Arkansas. Weed Sci 107 PLoS One Amaranthus palmeri Aus J Soil Res :1485 (2017). : 247–254 (2004). 8 :233–241 (2012). , ed. by Powles SB and Holtum JAM. CRC 31 :1405–1417 (2014). 52 multiflorum multiflorum 70 -dipyridylium dibromide. , Italian ryegrass control with paraquat herbicides. : 868–877 © 2017 Society of Chemical Industry ssp. ′ L. ssp. 74 Weed Res et al. and relative transcript levels of EPSPS and ABC trans- :268–274 (2001). 5 Funct Plant Biol Proc Natl Acad Sci USA 2018; . . :499–513 (2007). Pest Manag Sci shikimate accumulation assay with excised leaf discs. ) populations from Arkansas (United States). -ethylene-2,2 225 ′ :5885–5893 (2015). :1223–1230 (2012). :769–774 (2005). :601–612 (1960). Lolium perenne 63 lam M, Physiological and molecular mechanismssitivity of differential of sen- Palmer amaranth ( varying growth temperatures. Gene amplification conferspalmeri glyphosate resistance in Lolium perenne evolutionary origins of herbicide resistance. rum rigidum (2017). multiflorum. Front Plant Sci vivo 68 in glyphosate-resistant Italian ryegrass ( involved in the resistance mechanism in 53 leaf disc assay for early detection ofcanadensis glyphosate resistance in porter genes. EPSPS gene amplification( in glyphosate-resistant Italian ryegrass 48 paraquat herbicides in soils. ple herbicide resistance evolved in a Sci Press, Boca Raton, FL, pp. 141–169 (1994). carboxylase inhibiting herbicides, in Biology and Biochemistry accessions tolerant to diclofop. cides. Crawford SH Weed Sci 1,1 27 Gaines TA, Zhang W, Wang D, Bukun B, Chrisholm ST, Shaner DL 26 Godar AS, Varanasi VK, Nakka S, Prasad PV, Thompson CR and Jugu- 29 Karn E and Jasieniuk M, Nucleotide diversity at site 106 of EPSPS in 28 Yu Q, Cairns A and Powles SB, Paraquat resistance in a biotype of 22 Shaner DL, Nadler-Hassat T, Henry WB and Koger CH, A rapid 25 Salas RA, Scott RC, Dayan FE and Burgos NR, EPSPS gene amplification 21 Brunharo C and Hanson BD, Vacuolar sequestration of paraquat is 23 Nol N, Tsikou D, Eid M, Livieratos IC and Giannopolitis CN, Shikimate 24 Salas RA, Dayan FE, Pan Z, Watson SB, Dickson JW, Scott RC 20 Kookana RS and Aylmore LAG, Retention and release of diquat and 14 Yu Q, Cairns A and Powles S, Glyphosate, paraquat and ACCase multi- 16 Stanger CE and Appleby AP, Italian ryegrass ( 15 Devine MD and Shimabukuro RH, Resistance to acetyl coenzyme A 17 Kaundun SS, Resistance to acetyl-CoA carboxylase-inhibiting herbi- 18 Jordan DL, Warren Jr LS, Miller DK, Cade Smith M, Reynolds DB, 19 Mees GC, Experiments on the herbicidal action of Pest Manag Sci Multiple herbicide resistance in Italian ryegrass www.soci.org