THE ROLE OF PHENOTYPIC PLASTICITY AND LOCAL ADAPTATION IN ALPINE PLANTS FACING CLIMATE CHANGE
INAUGURALDISSERTATION
zur
Erlangung der Würde eines Doktors der Philosophie
vorgelegt der
PHILOSOPHISCH-NATURWISSENSCHAFTLICHEN FAKULTÄT
der Universität Basel
von
ELENA HAMANN
Aus Oldenburg, Deutschland
Basel, 2017
Originaldokument gespeichert auf dem Dokumentenserver der Universität Basel edoc.unibas.ch
Dieses Werk ist unter dem Vertrag „Creative Commons Namensnennung-Keine kommerzielle Nutzung-Keine Bearbeitung 3.0 Schweiz“ (CC BY-NC-ND 3.0 CH) lizenziert. Die vollständige Lizenz kann unter creativecommons.org/licenses/by-nc-nd/3.0/ch/ eingesehen werden.
Genehmigt von der Philosophisch-Naturwissenschaftlichen Fakultät auf Antrag von
Prof. Dr. Jürg Stöcklin
Dr. Andrea Plüss
Basel, den 10. November 2015
Prof. Dr. J. Schibler Dekan
“A garden requires patient labor and attention. Plants do not merely grow to satisfy ambitions or to fulfill good intentions. They thrive because someone expanded effort on them.” - Liberty Hyde Bailey
______
“If we knew what it was we were doing, it would not be called research, would it?” - Albert Einstein
______
“[…] Find out the cause for this effect, / Or rather say, the cause of this defect, / For this effect defective comes by cause. “ – Polonius (Act2, Scene 2, line 104) Hamlet, Shakespeare
Contents Contents
Chapter 1 General Introduction 7
Chapter 2 Lower plasticity exhibited by high- versus mid-elevation species in 21 their phenological responses to manipulated temperature and drought S. Gugger, H. Kesselring, J. Stöcklin, E. Hamann*
Chapter 3 Plant responses to simulated warming and drought: a comparative 45 study of functional plasticity between congeneric mid and high elevation species E. Hamann*, H. Kesselring, J. Stöcklin
Chapter 4 Past selection explains differentiation in flowering phenology of 67 nearby population of a common alpine plant H. Kesselring, G.F.J. Armbruster, E. Hamann, J. Stöcklin
Chapter 5 Evidence of local adaptation to fine- and coarse-grained 91 environmental variability in Poa alpina in the Swiss Alps E. Hamann*, H. Kesselring, G.F.J. Armbruster, J.F. Scheepens, J. Stöcklin
Chapter 6 High intraspecific phenotypic variation, but little evidence for local 111 adaptation in Geum reptans populations in the Central Swiss Alps E. Hamann*, H. Kesselring, G.F.J. Armbruster, J.F. Scheepens, J. Stöcklin
Chapter 7 Spatial patterns of local adaptation in two common herbs from the 133 Central European Alps H. Kesselring, J.F. Scheepens, E. Hamann, G.F.J. Armbruster, J. Stöcklin
Chapter 8 Novel microsatellite markers for the high-alpine Geum reptans 153 (Rosaceae) E. Hamann*, H. Kesselring, J. Stöcklin, G. F. J. Armbruster
Chapter 9 New microsatellite markers for Anthyllis vulneraria (Fabaceae), 163 analyzed with Spreadex gel electrophoresis H. Kesselring, E. Hamann, J. Stöcklin, G. F. J. Armbruster
Chapter 10 General Discussion 173
Acknowledgements 181
Curriculum Vitae 183
5
6 Chapter 1
Chapter 1
General Introduction
7 General Introduction
8 Chapter 1 General Introduction
Lectori salutem, flora clearly distinct of that of lowlands (Chapin and Koerner, 1995). Before introducing the general aims, the Climate change, well illustrated in Europe main research questions, the experimental by increasing temperatures and changes in approach and the outline of this thesis, I precipitation patterns, has been reported by would like to set its research frame, which the IPCC (Kovats et al., 2014) and it has revolves in the scientific field of plant been suggested that these effects are population and evolutionary biology. For this proportionally more pronounced at high purpose, I will first provide information elevation (Beniston et al., 1997). Indeed, in about the environment of the Swiss Alps, its alpine regions the amplitude of temperature flora, and how it is threatened by climate changes are greater then the observed global change. I will then proceed to introduce changes (Beniston et al., 1994). While a terms such as evolution, natural selection, 0.7°C rise in air temperatures has been local adaptation, and phenotypic plasticity. reported globally, a 2°C change in temperature has been recorded in the Alps The Alpine flora and environment is (Auer et al., 2007). Additionally, summer threatened by climate change droughts are predicted to become more frequent in many regions including mountain
areas (Kovats et al., 2014), leaving mountain Alpine biodiversity is particularly rich and biota particularly vulnerable to climate the flora of the Alps comprises about 4’000 change (Theurillat and Guisan, 2001, Körner, species (Aeschimann et al., 2004) and 2003). includes more than five hundred endemic In this context, it becomes increasingly species, i.e. unique to a particularly mountain important to investigate how the alpine flora region, where they have probably evolved. will respond to environmental changes and Plants had to adapt to the particular evolve in a future climate. environmental conditions at high altitude
(Körner, 2003). With increasing elevation, plant life is challenged in many ways, by A brief introduction to local extreme temperatures, a short vegetation adaptation and phenotypic plasticity period, snow, and by a rising number of weather-related extreme events (Körner, Evolution, the heritable change over time 2003). The alpine landscape is also in the phenotype of an organism (Darwin, characterized by great spatial and temporal 1859) and natural selection, the process environmental heterogeneity, creating a which selects for particular phenotypic mosaic of micro-habitats (Scherrer and variants in a population, have led to the Körner, 2010, Scherrer and Körner, 2011). adaptation of plants to their environment. The environmental heterogeneity, along with Within a species, populations may the richness of endemics, highlights the genetically differ through natural selection or strength of selective forces and evolutionary random processes such as genetic drift. In processes in the alpine landscape (Ozenda, widespread plants, the heterogeneity of 1988, Kadereit et al., 2008), making alpine habitat conditions over large spatial scales
9 General Introduction may lead to changes in the selection from local adaptation, phenotypic plasticity pressures acting on functional plant traits and or a combination of both (Conner and Hartl, may thereby result in adaptive genetic 2004, Ghalambor et al., 2007, Franks et al., variation in a way that maximizes fitness in 2014). However, intraspecific differentiation different environments (Briggs and Walters, in alpine plants is also strongly affected by 1997). Indeed, widespread species show high the repeated oscillations during glaciations levels of variation (Bradshaw, 2006), and (Scheepens and Stöcklin, 2011, Scheepens et frequently perform well in a wide range of al., 2015). Thus, to some extent, phenotypic environmental conditions (Joshi et al., 2001, differentiation in alpine plants may be Santamaria et al., 2003). On the one hand, ecologically relevant and adaptive, but to adaptations to climatic variation or other some degree it may result from random conditions that differ at a larger spatial scale evolutionary processes (e.g. genetic drift). (coarse-grained environmental variation) There are not many studies on alpine plants should easily be maintained by natural that have rigorously tested hypotheses selection, while genetic adaptations to concerning local adaptation, either for environmental variability at a more local elevational effects (Galen and Stanton, 1991, scale (fine-grained environmental variation) Byars et al., 2007, Byars and Hoffmann, may be hindered by gene flow (Kawecki and 2009, Hautier et al., 2009), differences in Ebert, 2004). Since the pioneer studies of snow cover (Stanton and Galen, 1997), or Turesson (1922) and Clausen et al. (1941), adaptation to contrasting habitats (McGraw, patterns of intraspecific variability were the 1987, Leinonen et al., 2009). Mostly, local focus of many studies, and specialization to adaptation in these studies was demonstrated particular environmental conditions has been across wide climatic or elevational gradients frequently demonstrated (Van Tienderen, or to contrasting habitats, but populations 1991, Dudley, 1996, Van Tienderen, 1997, were rarely transplanted across their original Pluess and Stöcklin, 2005, Fischer et al., field sites. At the local scale genetic 2008). adaptation to environmental variability may As a result, it is usually assumed that be hampered by gene flow or source sink plants are locally adapted. Local adaptation is relations among nearby populations (Stanton characterized by adaptive differentiation and Galen, 1997, Kawecki and Ebert, 2004). among populations. Plants can be locally Nevertheless, differentiation among alpine adapted either constitutively via genotypic populations has also been demonstrated at differences or via phenotypic plasticity, the micro-scale, indicating the strength of which is the range of phenotypes a single small-scale heterogeneity as a selective force genotype can express as a function of its for local adaptation (Shimono et al., 2009). environment (Bradshaw, 1965). Genotypic In other cases, adaptation to small-scale variability and phenotypic plasticity can be environmental heterogeneity was missing considered as complementary mechanisms (Byars et al., 2009). Furthermore, local adjusting plants to environmental adaptation is also contingent on factors other heterogeneity (Van Tienderen, 1991, Van than spatial scale, such as the plant mating Tienderen, 1997). systems and reproductive mode (i.e. A central goal in ecological genetics has vegetative vs. sexual reproduction) due to been to determine to what extent different their effects o the degree of genetic phenotypes in different environments result differentiation of populations (Kawecki and
10 Chapter 1
Ebert, 2004). in plants, i.e. heterophylly in shallow water Clearly, the generality of local adaptation (Cook and Johnson, 1968), the variability of in alpine plants cannot be concluded based internode length in response to shading on the few studies available (Leimu and (Dudley, 1996), or the variability of leaf Fischer, 2008) and the extent and manner by traits in response to temperature (Scheepens which it is influenced by scale-dependent et al., 2010). Phenotypic plasticity is also environmental heterogeneity of the alpine likely to facilitate adaptive evolution in new landscape is poorly known. Specifically, or changing environments (Ghalambor et al., there is only little knowledge of how alpine 2007). But generally, there is still little plants are adapted to the pronounced empirical knowledge on how much environmental heterogeneity of alpine variability of functional traits in different habitats. Such knowledge is however environments is due to genotypic variability particularly important when trying to predict and how much it is a result of adaptive how plants will react to climate change. plastic adjustments. Furthermore, there is shortage of studies on phenotypic plasticity Phenotypic plasticity in plant species has in the field. received growing attention in the past It is however important to remember that decades (Bradshaw, 1965, Schlichting, 1986, this ability has a genetic basis in itself and is Sultan, 1987, Thompson, 1991). The concept limited by costs and constrains (DeWitt et al., of phenotypic plasticity in evolutionary 1998, Pigliucci, 2001, Givnish, 2002, van biology is widely accepted and there is little Kleunen and Fischer, 2005, Valladares et al., doubt about the important role of plastic 2007). Plant populations and species differ responses of plants in heterogeneous greatly in phenotypic plasticity, mainly environments (Pigliucci 2005). The current because plasticity is advantageous under interest in phenotypic plasticity results in part some conditions and disadvantageous or not from an urgency to predict species responses advantageous under others (Alpert and to global change (Valladares et al., 2006, Simms, 2002). Plasticity is hypothesized to Nicotra et al., 2010). Phenotypic plasticity be favored when an environmental factor may play a crucial role in the short-term varies on the same spatial scale as the plant adjustment to novel conditions and can response unit, when the plant can respond to promote long-term adaptive evolution by an environmental factor faster than the level buffering against rapid change (Price et al., of the factor changes, and when 2003, Nicotra et al., 2010, Richter et al., environmental variation is highly but not 2012). completely predictable (Via and Lande, How much phenotypic plasticity is 1985, Alpert and Simms, 2002). While a adaptive and favored by natural selection, small number of studies have examined the how much do costs and genetic correlations potential for phenotypic plasticity in plant act as a limitation for plasticity, and how populations with varying levels of much plasticity is only a passive response to environmental heterogeneity, the results do environmental cues are intensively discussed generally not align with these predictions research questions (Via and Lande, 1985, van (Heschel et al., 2004, Franks, 2011). Other Kleunen and Fischer, 2005, Bradshaw, authors have examined differences in 2006). Nevertheless, there are well plasticity between population from low and documented examples of adaptive plasticity high elevations. While Vitasse et al. (2013)
11 General Introduction found lower phonological plasticity in high change (i.e. warming and drought)? And elevation deciduous tree species, Frei et al. does the capacity for phenotypic plasticity in (2014) found no differences in plasticity alpine species differ from that of lowland between low and high elevation populations. species? (2) To what extent does adaptive These results show that the evolution of genotypic differentiation and phenotypic phenotypic plasticity in response to plasticity influence local adaptation of alpine environmental heterogeneity and its plants? In this second part, the central associated costs and constrains are complex, hypothesis is that in fine-grained and further work is needed to improve our environmental variation, where individuals understanding of these dynamics. experience highly heterogeneous conditions at a small spatial and/or temporal scale, The aim of this thesis natural selection should favor high phenotypic plasticity (Alpert and Simms, The key elements addressed in this thesis 2002), while in the case of coarse-grained are threefold. We aim at (1) examining if environmental variation, where organisms phenotypic plasticity allows alpine plants to experience a more stable environment over buffer the effects of climate change; (2) their life time, natural selection should have comparing the degree of phenotypic led to genetic adaptation among populations plasticity between high and low elevation (Joshi et al., 2001). plants; (3) understanding the mechanism of We addressed the first set of questions in local adaptation in alpine plants through Chapter 2 and 3 on a large number of high genetic and phenotypic differentiation at and low elevation perennial herbaceous different spatial scales. Combining all three species exposed to changes in temperatures elements, the central goal of this thesis is to and water availability. Chapter 4 makes for provide a better understanding of the role of a relevant transition between the two main phenotypic plasticity and/or genetic question as we investigated the flowering differentiation possibly leading to local phenology and biomass allocation patterns to adaptation in alpine species, and in the reproductive structures in a single alpine context of climate change we aim at inferring species, namely Anthyllis vulneraria, and on the adaptive potential of alpine species to inferred on patterns of past diversifying future climate. selection. The second question is considered in Chapter 5, 6, and 7, and in associated Main research questions technical articles related in Chapter 8 and 9. Here, we used four alpine species differing in
life strategies, namely Poa alpina, Geum The central question of this thesis is reptans, Anthyllis vulneraria and Arabis whether genetic and phenotypic differences alpina to examine patterns of local allow alpine species to buffer against climate adaptation to present conditions in the Swiss change. In this context, two main sets of Alps. research questions structure this thesis. (1)
Do alpine species exhibit plastic adjustments in key functional plant traits in response to Experimental approach changes in environmental conditions predicted to be altered by future climate The two essential tools used to address the main questions of this thesis, were common
12 Chapter 1 garden experiments and reciprocal among selected populations, they cannot transplantation experiments. prove whether any observed differentiation is Common garden experiments, used to due to adaptation to current environmental investigate the plastic responses of species to conditions. Reciprocal transplantation changes in environmental conditions, related experiments, in which plants from different in Chapter 2, 3 and 4 are ideal for this source populations are transplanted into purpose as they allow the transplantation of original field sites, can be used to provide study species to sites with a prospective evidence for local adaptation. With warmer or colder climate while keeping other reciprocal transplantation experiments one regional-scale abiotic factors such as can rigorously test for local adaptation using photoperiod and local weather conditions the “home vs. away”, “local vs. foreign” or constant (Haggerty and Galloway, 2011, “sympatric vs. allopatric” criterion (Kawecki Scheepens and Stöcklin, 2013, Frei et al., and Ebert, 2004, Blanquart et al., 2013). 2014). Common garden experiments, where Confounding effects have been suggested to plants from different source populations are induce biases in the first two criteria. Indeed, grown in a single environment, have been the “home vs. away” criterion compares a used in pioneer works (Turesson, 1922, deme’s fitness across habitats, which can be Clausen et al., 1941) to investigate the confounded by habitat quality, and the “local genetically based phenotypic differentiation. vs. foreign” criterion compares deme’s This approach coupled with molecular fitness across habitats, and may be analysis allows the comparison of confounded by population quality (Blanquart quantitative trait differentiation and genetic et al., 2013). A third, meta-population differentiation at neutral marker loci (QST-FST approach, has been suggested to be more comparisons) to test for the role of past adequate for rigorous testing of local selection in shaping observed patterns of adaptation: the “sympatric vs. allopatric” population differentiation (Chapter 4). criterion, which compares the average fitness Moreover, by including treatments in in sympatric combinations (populations at common garden experiments, particular home site) and the average fitness of hypotheses concerning the ability of allopatric combinations (populations in genotypes to respond plastically to foreign site). This method has been applied environmental variation can be tested to investigate local adaptation in the four (Scheepens et al., 2010, Frei et al., 2011). aforementioned alpine species in Chapter 5, Here, we have used this method to examine 6, and 7. the plastic adjustments in key plant Reciprocal transplantation experiments functional traits, such as flowering can than be coupled with molecular analysis, phenology (Chapter 2 and 4), leaf traits, and used to genotype the individuals from biomass allocation (Chapter 3) in response different populations (new microsatellite to changes in temperature and soil water markers were developed Chapter 8 and 9), availability, and one experiment additionally to compare phenotypic differentiation with infers on patterns of past selection (Chapter molecular differentiation and infer patterns of 4). adaptation. While common gardens are ideal to investigate past selection patterns and genetic differentiation in phenotypic plasticity
13 General Introduction
Outline of the thesis
Chapter 1. General Introduction – this chapter.
Chapter 2. Lower plasticity exhibited by high- versus mid-elevation species in their phenological responses to manipulated temperature and drought S. Gugger, H. Kesselring, J. Stöcklin, E. Hamann* *E. Hamann is the corresponding author and wrote the manuscript. The data is derived from S. Gugger’s Master Thesis, supervised by E. Hamann. Annals of Botany (2015) 116: 953-962 (Special issue on Plants and Climate Change) DOI: 10.1093/aob/mcv155, available online at www.aob.oxfordjournals.org
Reproduction is particularly challenging at high elevation, due to the short growing season and low temperatures, and requires fine-tuning to environmental cues. The aim of this study was to examine the shifts in reproductive phenology, the timing of life-history events, exhibited by high-elevation species in response to advanced spring temperatures and limited soil water availability. For this purpose, we reciprocally transplanted 14 perennial herbaceous high elevation species to common gardens at 1000 and 2000 m.a.s.l that mimic prospective climates. A drought treatment was implemented to assess the combined effects of temperature and precipitation changes on the onset and duration of reproductive phenophases. This design was replicated with congeneric mid-elevation species to evaluate if mid- and high- elevation species harbor the same potential for plasticity in their reproductive phenology, which could be constrained for high elevation species by their specific adaptation to the alpine environment.
Chapter 3. Plant responses to simulated warming and drought: a comparative study of functional plasticity between congeneric mid and high elevation species E. Hamann, H. Kesselring, J. Stöcklin Journal of Plant Ecology (2017) DOI:10.1093/jpe/rtx023, available online at www.jpe.oxfordjournals.org
Alpine regions are frequently considered as being at risk from warming temperatures and drough. Phenotypic plasticity could help species limit the negative effects of environmental variations and buffer against climate change. 14 congeneric mid- and high elevation species were transplanted to two common gardens (1000 and 2000 m.a.s.l.) with differing watering regimes and we examined whether key functional plant traits, such as leaf traits and biomass allocation adjusted plastically to changes in temperature and soil water availability. A comparative approach between mid- and high-elevation species was used to infer on the consistency of species’ responses to climate change and a phenotypic plasticity index was used to compare the degree of phenotypic plasticity between species’ origin, to assess if high elevation species harbor the same potential for phenotypic plasticity as their lower elevation congeners.
14 Chapter 1
Chapter 4. Past selection explains differentiation in flowering phenology of nearby population of a common alpine plant H. Kesselring, G.F.J. Armbruster, E. Hamann, J. Stöcklin Alpine Botany (2015) 125: 113-124 DOI: 10.1007/s00035-015-0157-z, available online at www.springer.com
The timing of and relative investment in reproductive events are crucial fitness determinants for alpine plants, which have limited opportunities for reproduction in the col and short growing season at high elevations. We used Anthyllis vulneraria to study whether flowering phenology and reproductive allocation have been under diversifying selection, and to assess genetic diversity and plastic responses to drought in these traits. Open-pollinated maternal families from three populations in each of two regions from the Swiss Alps with contrasting precipitation were grown in low and high soil moisture in a common garden. We measured onset, peak, and end of flowering, as well as vegetative and reproductive aboveground biomass.
Population differentiation for each character (QST) was compared to differentiation at neutral microsatellite loci (FST) to test for past selection.
Chapter 5. Evidence of local adaptation to fine- and coarse-grained environmental variability in Poa alpina in the Swiss Alps E. Hamann, H. Kesselring, G.F.J. Armbruster, J.F. Scheepens, J. Stöcklin Journal of Ecology (2016) 104: 1627-1637 DOI: 10.1111/1365-2745.12628, available at www.wiley.com
In the Alpine landscape, characterized by high spatiotemporal heterogeneity, intraspecific plant variation is high and can arise from divergent selection leading to genetic differentiation among populations, or adaptive phenotypic plasticity. The relative importance of these processes is likely to be related to the spatial scale of environmental heterogeneity and gene flow among populations. In this study we reciprocally transplanted the widespread alpine grass, Poa alpina, within and across regions in the Swiss Alps. Using fitness-related traits investigated across the sympatric vs. near- or far allopatric contrast, we infer on patterns of local adaptation across two spatial scales. Additionally, we measured specific leaf area to investigate potential selection on phenotypic plasticity. In parallel, all populations were genotyped with neutral microsatellite markers to assess molecular differentiation.
Chapter 6. High intrascpecific phenotypic variation, but little evidence of local adaptation in Geum reptans populations in the Central Swiss Alps E. Hamann, H. Kesselring, G.F.J. Armbruster, J.F. Scheepens, J. Stöcklin Alpine Botany (2017) 127: 121-132 DOI: 10.1007/s00035-017-0185-y, available at www.springer.com
Intraspecific phenotypic variation is frequent in plant populations widespread across the heterogeneous and fragmented Alpine landscape. In this context, divergent selection can
15 General Introduction
lead to local adaptation, contingent however on several factors such as the spatial distance between populations, gene flow, and species’ reproductive mode (i.e. clonality). Here, we reciprocally transplanted 3 populations of the high-alpine clonal Geum reptans, growing at close or far geographical distance from each other, and compared growth- and fitness-related traits across sympatric and near- or far-allopatric transplant combinations to investigate patterns of local adaptation. We further measured leaf morphology traits known to be particularly plastic in response to environmental variation. For all traits, we quantified the importance of genetic vs. environmental variation (i.e. phenotypic plasticity), and for leaf traits we assessed potential selection on mean trait value at field sites. Additionally, among and within population genetic differentiation was analyzed using microsatellite markers.
Chapter 7. Spatial patterns of local adaptation in two common herbs from the Central European Alps H. Kesselring, J. Scheepens, E. Hamann, G. Armbruster, J. Stöcklin In preparation for Plant Ecology
Spatially variable selection is considered to result in local adaptation. Yet the generality of local adaptation of populations remains debated, and we know little about the spatial patterns of local adaptation. We conducted reciprocal transplantations among six populations each of two common and well-studied herbaceous plants, Anthyllis vulneraria and Arabis alpina. We measured aboveground biomass, reproductive allocation and flowering propensity to test for local adaptation at two spatial scales: within and between the Eastern and Western Swiss Alps. Additionally, populations were genotyped using microsatellite markers to assess neutral differentiation and historic inbreeding.
Chapter 8. Novel microsatellite markers for the high-alpine Geum reptans E. Hamann, H. Kesselring, J. Stöcklin, G. F. J. Armbruster Applications in Plant Sciences 2(6), 2014 DOI: 10.3732/apps.1400021, available at www.bioone.org
Geum reptans, a species that reproduces by outcrossing or by the formation of stolons, was genotyped to assess the genotypic differentiation between populations. For that purpose, novel microsatellite primers had to be developed for this species, which will be used in a study about local adaptation, phenotypic plasticity, and molecular differentiation of alpine plants.
Chapter 9. New microsatellite markers for Anthyllis vulneraria (Fabaceae), analyzed with Spreadex gel electrophoresis H. Kesselring, E. Hamann, J. Stöcklin, G. F. J. Armbruster Applications in Plant Sciences 1(12), 2013 DOI: 10.3732/apps.1300054, avaible at www.bioone.org
16 Chapter 1
New microsatellite primers were developed for the diploid herb Anthyllis vulneraria. These primers will be used in upcoming studies focusing on random genetic variation, local adaptation, and phenotypic plasticity in alpine plants. Our preliminary results showed that the three studied alpine populations are predominantly outcrossing, but include variable levels of self-fertilization.
Chapter 10. General Discussion
References alpine plant, Poa hiemata, along a narrow altitudinal gradient. Evolution, 61: 2925- 2941. Aeschimann L, Lauber K, Moser DM, Theurillat Byars SG, Parsons Y, Hoffmann AA. 2009. Effect JP. 2004. Flora alpina: Haupt, Bern. of altitude on the genetic structure of an Alpert P, Simms EL. 2002. The relative advantages Alpine grass, Poa hiemata. Annals of Botany, of plasticity and fixity in different 103: 885-899. environments: when is it good for a plant to Chapin FS, Koerner C. 1995. Arctic and alpine adjust? Evolutionary Ecology, 16: 285-297. biodiversity: patterns, causes and ecosystem Auer I, Boehm R, Jurkovic A, Lipa W, Orlik A, consequences. Ecological Studies 113. Potzmann R, Schoener W, Ungersboeck Clausen J, Keck WM, Hiesey WM. 1941. Regional M, Matulla C, Briffa K, Jones P, differentiation in plant species. American Efthymiadis D, Brunetti M, Nanni T, Naturalist, 75: 231-250. Maugeri M, Mercalli L, Mestre O, Conner JK, Hartl DL. 2004. A primer of ecological Moisselin J-M, Begert M, Mueller- genetics. MA, USA: Sinauer Associates. Westermeier G, Kveton V, Bochnicek O, Cook SA, Johnson MP. 1968. Adaptation to Stastny P, Lapin M, Szalai S, Szentimrey heterogeneous environments. I Variation in T, Cegnar T, Dolinar M, Gajic-Capka M, heterophylly in Ranunculus flammula L. Zaninovic K, Majstorovic Z, Nieplova E. Evolution, 22: 278-299. 2007. HISTALP - historical instrumental Darwin C. 1859. The origin of species by means of climatological surface time series of the natural selection. London: John Murray. Greater Alpine Region. International Journal DeWitt TJ, Sih A, Wilson DS. 1998. Costs and limits of Climatology, 27: 17-46. of phenotypic plasticity. Trends in Ecology & Beniston M, Diaz HF, Bradley RS. 1997. Climatic Evolution, 13: 77-81. change at high elevation sites: An overview. Dudley SA. 1996. Differing selection on plant Climatic Change, 36: 233-251. physiological traits in response to Beniston M, Rebetez M, Giorgi F, Marinucci MR. environmental water availability: A test of 1994. An analysis of regional climate change adaptive hypotheses. Evolution, 50: 92-102. in Switzerland. Theoretical and Applied Fischer M, Rudmann-Maurer K, Weyand A, Climatology, 49: 135-159. Stoecklin J. 2008. Agricultural land use and Blanquart F, Kaltz O, Nuismer SL, Gandon S. biodiversity in the Alps - How cultural 2013. A practical guide to measuring local tradition and socioeconomically motivated adaptation. Ecology Letters, 16: 1195-1205. changes are shaping grassland biodiversity in Bradshaw AD. 1965. Evolutionary significance of the Swiss Alps. Mountain Research and phenotypic plasticity in plants. Advances in Development, 28: 148-155. Genetics, 13: 115-155. Franks SJ. 2011. Plasticity and evolution in drought Bradshaw AD. 2006. Unravelling phenotypic avoidance and escape in the annual plant plasticity - why should we bother? New Brassica rapa. New Phytologist, 190: 249- Phytologist, 170. 257. Briggs D, Walters SM. 1997. Plant variation and Franks SJ, Weber JJ, Aitken SN. 2014. evolution: University Press, Cambridge, Evolutionary and plastic responses to climate United Kingdom. change in terrestrial plant populations. Byars SG, Hoffmann AA. 2009. Lack of strong local Evolutionary Applications, 7: 123-139. adaptation in the alpine forb craspedia Frei ER, Ghazoul J, Matter P, Heggli M, Pluess lamicola in southeastern Australia. AR. 2014. Plant population differentiation International Journal of Plant Sciences, 170: and climate change: responses of grassland 906-917. species along an elevational gradient. Global Byars SG, Papst W, Hoffmann AA. 2007. Local Change Biology, 20: 441-455. adaptation and cogradient selection in the
17 General Introduction
Frei ES, Scheepens JF, Armbruster GFJ, Stöcklin M.D. Mastrandrea, K.J. Mach, T.E. Bilir, M. J. 2011. Phenotypic differentiation in a Chatterjee, K.L. Ebi, Y.O. Estrada, R.C. common garden reflects the phylogeography Genova, B. Girma, E.S. Kissel, A.N. Levy, S. of a widespread Alpine plant. Journal of MacCracken, P.R. Mastrandrea, and L.L. Ecology: no-no. White (eds.)]. Cambridge University Press, Galen C, Stanton ML. 1991. Consequences of Cambridge, United Kingdom and New York, emergence phenology for reproductive NY, USA. success in anunculus adoneus Leimu R, Fischer M. 2008. A Meta-Analysis of (Ranunculaceae). American Journal of Local Adaptation in Plants. PLoS ONE, 3. Botany, 78: 978-988. Leinonen PH, Sandring S, Quilot B, Clauss MJ, Ghalambor CK, McKay JK, Carroll SP, Reznick Mitchell-Ods T, Agren J, Savolainen O. DN. 2007. Adaptive versus non-adaptive 2009. Local adaptation in European phenotypic plasticity and the potential for populations of Arabidopsis lrata contemporary adaptation in new (Brassicaceae). American Journal of Botany, environments. Functional Ecology, 21: 394- 96: 1129-1137. 407. McGraw JB. 1987. Experimental ecology of Dryas Givnish TJ. 2002. Ecological constraints on the octopetala ecotypes. 4. Fitness response to evolution of plasticity in plants. Evolutionary reciprocal transplantating in ecotypes with Ecology, 16: 213-242. different plasticity. Oecologia, 73: 465-468. Haggerty BP, Galloway LF. 2011. Response of Nicotra AB, Atkin OK, Bonser SP, Davidson AM, individual components of reproductive Finnegan EJ, Mathesius U, Poot P, phenology to growing season length in a Purugganan MD, Richards CL, Valladares monocarpic herb. Journal of Ecology, 99: F, van Kleunen M. 2010. Plant phenotypic 242-253. plasticity in a changing climate. Trends in Hautier Y, Randin CF, Stocklin J, Guisan A. 2009. Plant Science, 15: 684-692. Changes in reproductive investment with Ozenda P. 1988. Die Vegetation der Alpen. Stuttgart, altitude in an alpine plant. Journal of Plant Germany: Fischer Verlag. Ecology, 2: 125-134. Pigliucci M. 2001. Phenotypic Plasticity: Beyond Heschel MS, Sultan SE, Glover S, Sloan D. 2004. Nature and Nurture: John Hopkins Population differentiation and plastic University Press. responses to drought stress in the generalist Pluess AR, Stöcklin J. 2005. The importance of annual Polygonum persicaria. International population origin and environment on clonal Journal of Plant Sciences, 165: 817-824. and sexual reproduction in the alpine plant Joshi J, Schmid B, Caldeira MC, Dimitrakopoulos Geum reptans. Functional Ecology, 19: 228- PG, Good J, Harris R, Hector A, Huss- 237. Danell K, Jumpponen A, Minns A, Mulder Price TD, Qvarnstrom A, Irwin DE. 2003. The role CPH, Pereira JS, Prinz A, Scherer- of phenotypic plasticity in driving genetic Lorenzen M, Siamantziouras ASD, Terry evolution. Proceedings of the Royal Society AC, Troumbis AY, Lawton JH. 2001. of London Series B-Biological Sciences, 270: Local adaptation enhances performance of 1433-1440. common plant species. Ecology Letters, 4: Richter S, Kipfer T, Wohlgemuth T, Guerrero CC, 536-544. Ghazoul J, Moser B. 2012. Phenotypic Kadereit JW, Licht W, Uhink C. 2008. Asian plasticity facilitates resistance to climate relationship of the flora of the European change in a highly variable environment. Alps. Plant Ecol Divers, 1: 171-179. Oecologia, 169: 269-279. Kawecki TJ, Ebert D. 2004. Conceptual issues in Santamaria L, Figuerola J, Pilon JJ, Mjelde M, local adaptation. Ecology Letters, 7: 1225- Green AJ, De Boer T, King RA, Gornall 1241. RJ. 2003. Plant performance across latitude: Körner C. 2003. Alpine plant life: functional plant The role of plasticity and local adaptation in ecology of high mountain ecosystems. an aquatic plant. Ecology, 84: 2454-2461. Germany: Springer Verlag. Scheepens JF, Frei ES, Stöcklin J. 2010. Genotypic Kovats RS, Valentini R, Bouwer LM, and environmental variation in specific leaf Georgopoulou E, Jacob D, Martin E, area in a widespread Alpine plant after Rounsevell M, Soussana J-F. 2014. Europe. transplantation to different altitudes. In: Climate Change 2014: Impacts, Oecologia, 164: 141-150. Adaptation, and vulberability. Part B: Scheepens JF, Frei ES, Stöcklin J. 2015. Regional Aspects. Contribution of Working Relationship between phenotypic Group II to the Fifth Assessment Report of differentiation and glacial history in a the Intergovernmental Panel on Climate widespread Alpine grassland herb. Alpine Change.[Barros VR, C.B. Field, D.J. Dokken, Botany, 125: 11-20.
18 Chapter 1
Scheepens JF, Stöcklin J. 2011. Glacial history and Alps: A review. Climatic Change, 50: 77- local adaptation explain differentiation in 109. phenotypic traits in the Alpine grassland herb Thompson JD. 1991. Phenotypic plasticity as a Campanula barbata. Plant Ecology & component of evolutionary change. Trends in Diversity, 4: 403-413. Ecology & Evolution, 6: 246-249. Scheepens JF, Stöcklin J. 2013. Flowering Turesson G. 1922. The plant species in relation to phenology and reproductive fitness along a habitat and climate. Hereditas, 6: 147-236. mountain slope: maladaptive responses to Valladares F, Gianoli E, Gomez JM. 2007. transplantation to a warmer climate in Ecological limits to plant phenotypic Campanula thyrsoides. Oecologia, 171: 679- plasticity. New Phytologist, 176: 749-763. 691. Valladares F, Sanchez-Gomez D, Zavala MA. 2006. Scherrer D, Körner C. 2010. Infra-red thermometry Quantitative estimation of phenotypic of alpine landscapes challenges climatic plasticity: bridging the gap between the warming projections. Global Change evolutionary concept and its ecological Biology, 16: 2602-2613. applications. Journal of Ecology, 94: 1103- Scherrer D, Körner C. 2011. Topographically 1116. controlled thermal-habitat differentiation van Kleunen M, Fischer M. 2005. Constraints on the buffers alpine plant diversity against climate evolution of adaptive phenotypic plasticity in warming. Journal of Biogeography, 38: 406- plants. New Phytologist, 166: 49-60. 416. Van Tienderen PH. 1991. Evolution of generalists Schlichting CD. 1986. The evolution of phenotypic and specialists in spatially heterogeneous plasticity in plants. In: Johnston, R. F. environments. Evolution, 45: 1317-1331. Shimono Y, Watanabe M, Hirao AS, Wada N, Van Tienderen PH. 1997. Generalists, specialists, Kudo G. 2009. Morphological and genetic and the evolution in sympatric populations of variations of Potentilla matsumurae disctinct species. Evolution, 51: 1372-1380. (Rosaceae) between fellfield and snowbed Via S, Lande R. 1985. Genotype-environment populations. American Journal of Botany, 96: interaction and the evolution of phenotypic 728-737. plasticity. Evolution, 39: 505-522. Stanton ML, Galen C. 1997. Life on the edge: Vitasse Y, Hoch G, Randin CF, Lenz A, Kollas C, Adaptation versus environmentally mediated Scheepens JF, Korner C. 2013. Elevational gene flow in the snow buttercup, Ranunculus adaptation and plasticity in seedling adoneus. American Naturalist, 150: 143-178. phenology of temperate deciduous tree Sultan SE. 1987. Evolutionary implications of species. Oecologia, 171: 663-67. phenotypic plasticity in plants. Evolutionary Biology, 21: 127-178. Theurillat JP, Guisan A. 2001. Potential impact of climate change on vegetation in the European
19 General Introduction
20 Chapter 2
Chapter 2
Lower plasticity exhibited by high- versus mid-elevation species in their phenological responses to manipulated temperature and drought
Simona Gugger, Halil Kesselring, Jürg Stöcklin and Elena Hamann * *E. Hamann is the corresponding author and wrote the manuscript. The data is derived from S. Gugger’s Master Thesis, supervised by E. Hamann.
Annals of Botany (2015) 116: 953-962 DOI: 10.1093/aob/mcv155, available online at www.aob.oxfordjournals.org
21 Flowering phenology in mid- vs. high-elevation species
22 Chapter 2
Lower plasticity exhibited by high- versus mid-elevation species in their phenological responses to manipulated temperature and drought
Simona Gugger, Halil Kesselring, Jürg Stöcklin and Elena Hamann*
Institute of Botany, Department of Environmental Sciences, Section Plant Ecology, University of Basel, Schönbeinstrasse 6, CH-4056 Basel, Switzerland
* For correspondence: [email protected]
Abstract
• Recent global changes, particularly warming and drought, have had worldwide repercussions on the timing of flowering events for many plant species. Phenological shifts have also been reported in alpine environments, where short growing seasons and low temperatures make reproduction particularly challenging, requiring fine-tuning to environmental cues. However, it remains unclear if species from such habitats, with their specific adaptations, harbour the same potential for phenological plasticity as species from less demanding habitats. • Fourteen congeneric species pairs originating from mid and high elevation were reciprocally transplanted to common gardens at 1050 and 2000 m a.s.l. that mimic prospective climates and natural field conditions. A drought treatment was implemented to assess the combined effects of temperature and precipitation changes on the onset and duration of reproductive phenophases. A phenotypic plasticity index was calculated to evaluate if mid- and high-elevation species harbour the same potential for plasticity in reproductive phenology. • Transplantations resulted in considerable shifts in reproductive phenology, with highly advanced initiation and shortened phenophases at the lower (and warmer) site for both mid- and high-elevation species. Drought stress amplified these responses and induced even further advances and shortening of phenophases, a response consistent with an ‘escape strategy’. The observed phenological shifts were generally smaller in number of days for high- elevation species and resulted in a smaller phenotypic plasticity index, relative to their mid- elevation congeners. • While mid- and high-elevation species seem to adequately shift their reproductive phenology to track ongoing climate changes, high-elevation species were less capable of doing so and appeared more genetically constrained to their specific adaptations to an extreme environment (i.e. a short, cold growing season).
Keywords: Climate change, flowering phenology, phenotypic plasticity, global warming, drought, common garden, mid-elevation and high-elevation species, Swiss Alps.
23 Flowering phenology in mid- vs. high-elevation species
Introduction earlier snowmelt and spring warming have been documented worldwide (Abu-Asab et In seasonal climates, the timing of al., 2001, Fitter and Fitter, 2002, Cleland et flowering is crucial for plant reproductive al., 2007, Vitasse et al., 2013). success. Premature or late flowering can In Europe, springtime has advanced by 2.5 expose plants to adverse environmental d per decade since the 1970s and delayed conditions such as frost events (Inouye, autumn events have led to an extension of 2008), can disrupt plant-pollinator the annual growing season (Menzel et al., interactions (Memmott et al., 2007) and can 2006). Longer and warmer growing seasons lead to failures in seed set or maturation. could be associated with enhanced plant The timing of seasonal activities in plants growth (Hudson et al., 2011), although has thus evolved to be triggered by reliable limiting factors such as reduced water environmental cues such as date of availability in summer could have negative snowmelt, photoperiod, temperature or soil effects. Indeed, summers in Switzerland have moisture to guarantee reproductive success become drier over the past 30 years (Rathcke and Lacey, 1985). Recent global (Beniston et al., 1994, Kovats et al., 2014), change has led to increased temperatures and drought stress is known to influence and to more frequent and more extreme plant growth, performance and reproductive floods and droughts in some areas success (Levitt, 1980) and is likely to also (Hartmann et al., 2013) with repercussions affect plant phenology (Peñuelas et al., on these environmental cues. Shifts in 2004). While some studies report on phenological events have been used as advanced flowering dates in response to ‘fingerprints’ of ongoing climate change drought (Jentsch et al., 2009, Bernal et al., (Walther et al., 2002, Jentsch et al., 2009) 2011, Franks, 2011) others found delayed and are well documented in numerous flowering (Llorens and Peñuelas, 2005). global-scale studies (Parmesan and Yohe, Phenological responses to drought appear to 2003, Peñuelas et al., 2004, Menzel et al., be highly species specific (Bernal et al., 2006, Cleland et al., 2007). 2011) as well as dependent upon the specific Phenotypic plasticity may play a crucial ecosystem (Peñuelas et al., 2004), and to role in the short-term adjustment to novel follow complex spatiotemporal patterns conditions and can promote long-term (Peñuelas et al., 2004). Furthermore, little is adaptive evolution by buffering against rapid known about the combined effect of change (Price et al., 2003, Nicotra et al., warming and drought on flowering 2010, Richter et al., 2012). Although a phenology (Dunne et al., 2003, Bloor et al., potential for rapid adaptive evolution in 2010). flowering phenology has been found In the Swiss Alps, the increase in (Franks et al., 2007, Haggerty and temperature has been shown to be twice as Galloway, 2011, Anderson et al., 2012) it high as that reported globally (Beniston et remains unclear if natural selection can keep al., 1994), and summer droughts are pace with the speed of ongoing changes predicted to become more frequent (Visser, 2008, Shaw and Etterson, 2012). (Beniston et al., 1997, Kovats et al., 2014) Alternatively, numerous plastic adjustments making mountain biota in this region to current climate change such as advanced particularly exposed to climate change and accelerated phenophases in response to (Theurillat and Guisan, 2001, Körner, 2003).
24 Chapter 2
For alpine plants, reproduction is especially reciprocal transplant experiment with three challenging and the timing of flowering even grassland species revealed no difference in more central to reproductive success as the plasticity between low- and high-elevation timeframe for growth and reproduction populations (Frei et al., 2014a). However, to becomes progressively shorter with our knowledge no study has examined if increasing elevation (Billings and Mooney, mid- and high-elevation herbaceous species 1968, Körner, 2003). Few studies have harbour the same potential for phenotypic examined the effect of drought on the plasticity in flowering phenology on a larger phenology of alpine vegetation and scale. generally found no shifts (Bloor et al., 2010, To examine how the combined effects of Cornelius et al., 2013). However, advanced warming and drought affect the flowering flowering was found when plants were phenology of mid- and high- elevation grown in warmer conditions (Scheepens and species as well as to examine whether Stöcklin, 2013, Frei et al., 2014a), and other phenotypic plasticity in flowering studies with similar findings debated whether phenology differs between species origin, phenological shifts were triggered by higher we reciprocally transplanted 14 congeneric air temperatures or advanced snowmelt pairs of herbaceous perennial mid- and high- (Price and Waser, 1998, Dunne et al., 2003, elevation species between common gardens Cornelius et al., 2013). at 1050 and 2000 m a.s.l. Rain-shelters were Furthermore, photoperiod plays a key role used at each site to control the water input in protecting plants from hazardous to our system to mimic severe drought sprouting before the typical last date of events in summer. The study examined severe spring frosts. Keller and Körner whether transplantation and drought events (2003) found that half of 23 study species induced shifts in the flowering phenology of were highly sensitive to photoperiod, and a mid- and high-elevation species. Specifically, later publication from Basler and Koerner we tested the following expectations: (1) (2012) specified that particularly late- earlier onsets and expanded durations of successional species are photoperiod phenophases at the lower (warmer) site sensitive, and may not react to periods of taking advantage of a longer growing earlier snowmelt or higher temperatures. season, (2) delayed and shortened durations This high level of adaptation to the at the high-elevation site in accordance with particular alpine conditions raises the later snowmelt and a shorter growing season, question of whether high-elevation species (3) earlier onsets and shortened durations of harbour the same potential for phenological phenological stages in response to drought plasticity as mid- elevation species. As high- which acts to shorten the growing season, elevation species are adapted to short and (4) a lower phenological plasticity in growing seasons and have evolved to avoid high-elevation species, stemming from frost damage, the onset of flowering putative constrained adaptations to cold phenology is likely to be genetically fixed environments. (Keller and Körner, 2003), constraining their capacity to respond plastically to changes in Material and Methods external conditions. While Vitasse et al. (2013) found lower phenological plasticity in Common gardens and study species high-elevation deciduous tree species, a
25 Flowering phenology in mid- vs. high-elevation species
Two common gardens (Supplementary Experimental design Data Fig. S1) were established in the In spring 2012, seeds were germinated Bernese Highlands in Switzerland, each on moist blotting pa- per in the glasshouse accommodating four beddings delimited by of the Botanical Institute in Basel, a wooden frame (1 x 3 m). The high-elevation Switzerland. Seedlings were individually common garden is situated on the Schynige transferred into multi-trays (4 cm diameter, 6 Platte (46° 39’ 03.63’’ N, 7° 54’ 32.76’’ E) x 9 = 54 pots) filled with low-nutrient soil at 2000 m a.s.l. on a southern slope. The (Anzuchterde Ökohum, Herrenhof, snow-free period generally starts in June Switzerland). In mid June, plants were and lasts until October (approx. 150 d). The brought outside in the garden of the average annual temperature is 1° C and the Botanical Institute to allow acclimation to average annual amount of precipitation is outdoor conditions. At the beginning of approx. 1600–2000 mm, of which half falls July, plants were transported to the common as snow (MeteoSwiss, 2014). The lower gardens and transplanted into bigger pots elevation common garden is situated in (11.5 x 11.5 x 21.5 cm) filled with the Zweilu¨tschinen (46° 38’ 26.55’’ N, 7° 54 ‘ same potting soil. At each site, 12 15.20’’ E). This was at 1050 m a.s.l. with a individuals of each species were randomized south/south-western slope. The snow-free in the beddings previously enriched with period usually lasts from mid-April to potting soil and sunk to one-third depth into December (approx. 250 d). The average the soil. This design was systematically annual temperature is 7.2° C and average replicated in the beddings receiving rain- annual precipitation is approx. 1100 mm, of shelters, resulting in an experiment including which a quarter falls as snow (MeteoSwiss, a total of 1344 individuals across both sites 2014). and treatments (12 replicates x 2 sites x 2 Twenty-eight perennial herbaceous treatments x 28 species = 1344 individuals; species were included in this study, Fig. S1). The rain-shelters were installed represented by 14 congeneric pairs of mid- after a week of acclimation and consisted and high- elevation species (Table 1). The of a triangular aluminium frame covered by species pairs were selected to cover a broad an UV-B-transmissible greenhouse film range of taxonomic groups and growth (Luminance AF Window, Folitec, Germany) forms while avoiding an overlap in their with a base area of 2.4 x 3.0m and a height altitudinal range of distribution. The ranges of 1·2 m. The tunnel shape with large of mid-elevation species lie between approx. openings al- lowed for constant wind flow 300 and 1000 m.a.s.l, while the ranges of preventing warming beneath the shelters. high-elevation species are mostly between To minimize edge effects, the sheltered base approx. 1600 and 2400 m.a.s.l. (Table 1; was larger than the central 1 x 2.5 -m area Lauber and Wagner, 2001, Aeschimann et al., occupied by plants. To avoid lethal 2004). Seeds collected from flowers from consequences of the drought treatment, a wild populations were purchased from Swiss minimal water input was provided. Twenty seed producers (Samen & Pflanzen AG liters of rainwater was distributed per Schutz, Filisur; UFA-Samen, fenaco bedding every 2 weeks (approx. 0.12 L per Genossenschaft, Winterthur; individual). Accordingly, the difference in Wildstaudenga¨rtnerei, Eschenbach). water availability between the beddings with and without rain-shelter equals the
26 Chapter 2 amount of precipitation. At the end of the removed and plants overwintered under first growing season, rain-shelters were snow.
Table 1 Overview of the congeneric pairs of mid- and high elevation species included in our study with their main range limits in the literature having only been given in terms of altitudinal zonations as defined for the European Alps by Lauber and Wagner (2001) and Aeschiman et al. (2004): "colline" = 300 m to 900 m; "montane" = 900 m to 1500 m; "subalpine" = 1600 m to 2300 m; "alpine" = 2300 m to 3000 m. "Mid-elevation" species mainly ranged from the colline to the lower montane zones, while "high elevation" species mainly ranged from the subalpine to the alpine zones. Family Mid elevation species High elevation species Acinos arvensis (Lam.) Dandy Acinos alpinus (L.) Moench Lamiaceae colline-montane subalpine Anthoxanthum odoratum L. Anthoxanthum alpinum Löve Poaceae colline-alpine subalpine-alpine Anthyllis vulneraria ssp. vulneraria Anthyllis vulneraria ssp. alpéstris Fabaceae L. s.l. colline-montane Schult subalpine-alpine Arabis hirsuta L. Arabis alpina L. s.l. Brassicaceae colline-montane montane-alpine Campanula rotundifolia L. Campanula scheuchzeri Vill. Campanulaceae colline-subalpine subalpine-alpine Centaurea scabiosa L. s.l. Centaurea montana L. Asteraceae colline-montane montane-subalpine Dianthus deltoides L. Dianthus sylvestris Wulfen Caryophyllaceae colline-montane colline-subalpine Geum urbanum L. Geum montanum L. Rosaceae colline-montane subalpine-alpine Lotus corniculatus L. Lotus alpinus Ramond Fabaceae colline-subalpine alpine Onobrychis viccifolia Scop. Onobrychis montana DC. Fabaceae colline-montane subalpine Phleum phleoides (L.) Karsten Phleum alpinum L. Poaceae colline-montane subalpine-alpine Plantago lanceolata L. Plantago alpina L. Plantaginaceae colline-subalpine subalpine-alpine Silene vulgaris ssp. vulgaris Silene vulgaris ssp. glareosa (Jord.) Caryophyllaceae (Moench) Garcke s.l. Marsd.-Jon & Turill colline-subalpine alpine Trifolium pratense ssp. nivale Trifolium pratense ssp. pratense L. Fabaceae (Koch) colline-subalpine alpine
27 Flowering phenology in mid- vs. high-elevation species
In Spring 2013, rain-shelters were beddings and 15.9° C in beddings topped by reinstalled right after snowmelt (early May at rain-shelters. In the high-elevation common the low common garden and mid-June at the garden, the average daily temperature was high common garden) initiating the start of 11.2° C in control beddings and 11.4° C in phenological recordings (plants did not beddings topped by rain-shelters. While reproduce in the first year). Air temperature there was a significant temperature difference was recorded hourly in each common garden between both common gardens, the rain- and treatment at 0·5 m above the ground shelters increased the temperature at ground using sheltered data loggers (TidBit v.2 level only marginally by 0.25° C. UTBI-001; Onset Computer Corp., Bourne, The recorded light intensity (measured in MA, USA). Similarly, light intensity loggers lux at 13:00 h) was higher at the high- (Hobo pendant light data logger 64 K-UA- elevation common garden and was 002-64; Onset Computer) were installed in significantly reduced by rain-shelters (Table each common garden at 1 m above the 2). At both common gardens, the rain- ground in both treat- ments. The drought shelters intercepted approx. 30 % of light treatment consisted of a minimal water in- but these values were not limiting for plant put as in the previous year. Once a month, growth (see fig 11.11 in Körner, 2003). the volumetric soil moisture content VSMC (Table 2) differed significantly (VSCM; m3 m-3) was measured randomly in between the control and the drought 30 pots of each bedding with an HH2 treatment in both the common gardens (W = Moisture Meter and a Theta Probe type 900, P = 10-4; W = 844.5, P =10-4, ML2x (Delta-T Devices, Cambridge, UK). respectively). At the mid-elevation site, the average VSMC of control pots equaled 0.40 Abiotic treatment effect ± 0.08 m3 m-3, while dry pots had a VSMC Averaged over the experimental period of 0.06 ± 0.02 m3 m-3. At the high-elevation (May–October, Table 2), at the mid- site, control pots had an average VSMC of elevation common garden, the daily 0.48 ± 0.1 m3 m-3, while dry pots had an temperature was 15.5° C in control average VSMC of 0.08 ± 0.02 m3 m-3.
Table 2: Mean temperature, light intensity and volumetric soil moisture content (VSMC) for each treatment averaged over the experimental period (May-September). Temprature Light Intensity VSMC (°C) (lux) (m3 m-3) Low site / Control 15.5 115323.5 0.4 Low site / Dry 15.9 84554.8 0.06 High site / Control 11.2 139846.9 0.48 High site / Dry 11.4 101209.8 0.08
Phenology monitoring forbs: unopened buds, opened buds, opened Phenological stages were defined after flowers, old flowers, initiated fruits, enlarged Price and Waser (1998), Dunne et al. (2003). fruits and dehisced fruit. For grasses, five Different stages were used for forbs and stages were defined: beginning of heading, grasses to account for their morphological end of heading, exerted anthers or styles, differences. Seven stages were defined for dried and broken-off anthers/styles, and
28 Chapter 2 disarticulated seeds. species level rather than at the genotype level All observed stages were recorded weekly to compare the degree of plasticity between per individual and when 50 % or more of the mid- and high-elevation species. flowers or inflorescences were in a particular stage it was identified as dominant. Once all Statistical analysis plants had completed their reproductive cycle To test treatment effects, a linear mixed- and the growing season came to an end, all effect model was used for all eight plants were harvested. Above-ground phenological variables. ‘Elevation’ (mid- or biomass was cut at soil level and individuals high-elevation site), ‘drought’ (control or were stored in parchment bags and drought treatment), ‘origin’ of species (mid- transported to the laboratory within 24 h, elevation or high-elevation) and their dried for 72 h at 80° C and weighed. respective interactions were computed as fixed effects. To account for variances Phenological variables between species, they were nested in their Eight phenological variables were derived respective genus and computed as random from the weekly recordings: onset of effects. The effects of ‘elevation’ and/or budding, onset of flowering, onset of fruiting, ‘drought’ indicate trait variation due to midpoint of flowering, duration of budding, different environmental conditions (i.e. duration of flowering, duration of fruiting phenotypic plasticity), while the ‘origin’ of and total duration of all three phenophases species effect indicates differences between combined. Onset of budding, flowering and mid- and high-elevation species. The fruiting were defined as the date (day of the interaction between ‘origin’ of species and year) when the first bud, flower or fruit was ‘elevation’ and/or ‘drought’ indicates a observed. Midpoint of flowering was defined difference in the responses to treatment as the average date when opened flowers or conditions between mid- and high-elevation exerted anthers/styles (for forbs and grasses, species. Aboveground dry mass was used respectively) were dominant. The duration of as a covariate to correct for size effects on a phenophase was defined as the number of phenology, but was removed as it did not days between the onset of said phenophase change the results or add value to the model. and the dominance of the following All linear mixed-effect models were phenophase. implemented with the ‘lmerTest’ package for R software (Kuznetsova et al., 2013), Phenotypic plasticity in flowering phenology based on type 3 errors and Satterthwaite The degree of phenotypic plasticity in approximation for denominator degrees of response to warming and drought was freedom. Post-hoc Tukey’s HSD tests for calculated as a phenotypic plasticity index multiple comparisons were performed using (Piv) (Valladares et al., 2006). This index the ‘multcomp’ package (Hothorn et al., was calculated as the difference between the 2014) for R software. maximum and the minimum mean value of a To test for differences in the degree of given trait and species over all treatments phenotypic plasticity of flowering divided by the maximum mean, which phenology between mid- and high-elevation serves to standardize the index ranging from species, the Piv calculated for each species 0 (no plasticity) to 1 (maximum plasticity). was analysed with a paired Wilcoxon Note that plasticity was considered at the signed rank test. All the analyses were
29 Flowering phenology in mid- vs. high-elevation species performed in R version 3.0.2 software (R response to transplantations. While the Development Core Team, 2013; differences between mid- and high-elevation https://www.r-project.org/). species in phenological onsets were not always revealed by post-hoc multiple Results comparisons (Fig. 1), they were highly significant overall, as indicated by the Many individuals died over winter, were significant interaction between elevation and subjected to herbivory or were not origin treatments (Table 3; budding F = 7.64, -4 reproductive, leading to the total exclusion P = 0.006; flowering F = 16.27, P < 10 ; -4 of four genera (Centaurea, Geum, fruiting F = 15.48, P < 10 , respectively). Onobrychis and Trifolium) from the Indeed, high-elevation species analysis. For the remaining species, an consistently initiated the onset of budding, average of 8.3 replicates per treatment flowering and fruiting earlier than mid- combination were included in the final elevation species, and these differences were analysis with a total of 667 individuals (i.e. particularly pronounced at the high-elevation 20 out of 28 initial species and approx. 50 site (Table 3; F = 7.64, P = 0.006; F = 16.27, -4 -4 % of the initial sample size). Mortality, P < 10 ; F = 15.48, P < 10 , respectively). however, was independent of species’ origin High-elevation species started budding 8.4 ± and treatment combinations (Fisher’s exact 2.2 d earlier than mid-elevation species when test for count data: P = 0.85). In 2013, the grown at the high-elevation site and 5.5 ± 2.2 average temperature during the growing d earlier when grown at the mid-elevation season differed by 4.4° C between common site (Fig. 1, Table S1). High-elevation gardens and on average the drought species also started flowering and fruiting treatment reduced VSMC by 0.37 m3 m-3. earlier than mid-elevation species, with These changes in abiotic conditions induced strongest responses at the high elevation-site highly species-specific shifts in the onsets (Fig. 1). The same was found for the and durations of phenophases but important midpoint of flowering, which was always patterns emerged when groups of mid- and reached earlier by high-elevation species high-elevation species were considered. To relative to their lower elevation congeners, enhance clarity, we first report results from especially at the high-elevation site (Table 3; -4 the control treatment, describing the shifts F = 29.47, P < 10 ). Midpoint of flowering in reproductive phenology in response to was recorded 12.9 ± 2.3 d earlier for high- temperature for mid- and high-elevation elevation species grown at the high-elevation species and second drought effects. site and 5.7 ± 2.6 d earlier when grown at the mid-elevation site (Fig. 1, Table S1). Transplantation effect The reciprocal transplantation of species to a warmer or colder prospective climate induced major shifts in the time of initiation and the duration of reproductive phenology. The onsets of budding, flowering and fruiting were always initiated earlier at the low- elevation site by at least a month, but mid- and high-elevation species differed in their
30 Chapter 2 they they are idpoint idpoint of
ars) and high elevation species (black bars) to transplantational elevation and drought treatment Tukey Tukey tests for multiple comparisons. While they often provide detailed information about the
hoc - post absolute absolute days of the year, while the average durations of phenophases are shown in number of days. The letters above
Responses of mid elevation (white b : ifferences between treatment combinations, some interactions between main effects are not revealed by the analysis, although Fig. 1 (mean ± s.e.) in onset, midpoint and duration flowering are of shown in phenophases. The average onsets of budding, fruiting each and bar flowering represent and the the results m of d powerful ANOVA more the in analysis. on average significant ! 31 Flowering phenology in mid- vs. high-elevation species
treatment treatment
4 4 - -
P P
0.07 0.01 0.64 0.64 0.95 0.03 0.49 0.01 0.62 <10 <10 0.003 0.0007 0.0008 on and and their respective
F F 8.80 4.30 6.51 0.22 0.22 0.00 4.80 0.48 6.43 0.25 29.47 11.53 11.39 1099.4
Total durati Total
1 1 1 1 1 1 1 1 1 1 1 1 1 1 Midpoint ofMidpoint flowering NumDf NumDf
4 4 4 4 - - - -
P P
0.06 0.10 0.33 0.49 0.65 0.06 1.00 0.01 0.85 <10 <10 <10 <10 0.048
values are shown bold. are in values - F F 3.53 3.57 3.92 0.94 0.49 0.22 3.45 0.00 6.27 0.03 15.48 44.87 15.94 1191.1
Onset of fruiting 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Duration ofDuration fruiting NumDf NumDf
4 4
- -
P P 0.07 0.12 0.14 0.36 0.13 0.83 0.22 0.70 0.54 0.08 0.39 <10 <10 0.008
F F 3.20 2.97 7.15 2.16 0.83 2.29 0.04 1.80 0.15 3.73 3.09 0.75 and and durations of phenological stages to the elevation (mid elevation vs. high 16.27
1206.9
1 1 1 1 1 1 1 1 1 1 1 1 1 1 Onset of flowering Duration ofDuration flowering NumDf NumDf
4 4 - -
P P 0.06 0.14 0.16 0.70 0.81 0.81 0.01 0.11 0.21 <10 <10 0.006 0.006 0.047
F F .06 3.53 2.62 7.55 7.64 1.95 0.15 3.96 0.06 0 6.03 2.63 1.61 37.63 1293.8
Onset of budding 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Duration ofDuration budding NumDf NumDf interactions were removed from the final model. The significant p significant The model. final from the removed were interactions
origin origin
significant significant
mixed mixed effect model for the responses of onsets - -
drought origin : drought drought origin
origin origin Linear
Table Table 3: elevation site) and drought (control vs. dry) treatment, the origin of the species (mid elevation Non interactions. vs. high elevation species) Elevation Drought Origin : Elevation : Elevation Drought : : Elevation Elevation Drought Origin : Elevation : Elevation Drought : : drought : Elevation * ANOVA was calculated on a total of 667 individuals combination. including 20 species with an average number of 8.3 ± 2.85 ! replicates per
32 Chapter 2
Furthermore, differences in responses elevation site for mid-elevation species, and between mid- and high-elevation species are 8.1 ± 1.3 d less for high-elevation species also revealed in the fact that advancement of (Fig. 1, Table S1). the onset of phenophases in response to Note that mid-elevation species had a transplantation between sites was particularly long duration of fruiting when consistently greater for mid-elevation species grown at high elevation (Fig. 1). The total relative to high-elevation species (again, not duration of reproductive phenology was also revealed by post-hoc tests). For mid- shortened at the mid-elevation site. However, elevation species, the onset of budding at the this effect was only significant for mid- mid- and the high-elevation sites differed by elevation species, which had a 7.5 ± 1.6-d 32.5 ± 2.0 d, whereas for high-elevation shorter duration of reproduction when grown species the difference was less (29.5 ± 2.1 d; at the lower site. The effects of Fig. 1). Similar trends were found for the transplantation on the total duration of onset of flowering and fruiting. The reproductive phenology were similar to those differences in responses between mid- and on the duration of fruiting (Fig. 1), reflecting high-elevation species were particularly that this last stage was proportionally the pronounced for advancement in midpoint of longest. flowering. Going from the 2000 -m site Finally, it is important to note that at the down to the 1050 -m site, mid-elevation mid-elevation common garden, all species advanced midpoint of flowering by reproductive individuals from mid- and high- 31.2 ± 2.4 d (Table 3; F = 29.47, P < 10-4), elevation species reached the final fruit whereas high-elevation species advanced this maturation stage (defined as 50% or more stage by only 23.7 ± 2.2 d (Fig. 1, Table S1). flowers of one individual having reached The duration of phenophases responded to stage 7: dehisced fruits for forbs and stage 5: transplantations, with the exception of the disarticulated seeds for grasses). At the high- duration of flowering (Table 3). A elevation common garden, 99% of high- significant interaction between elevation and elevation species finished fruit maturation origin was found for the duration of budding but only 85% of mid-elevation individuals (Table 3; F = 6.03, P = 0.01), indicating a reached the final fruit maturation stage difference in response between mid- and before final harvest. high-elevation species. The duration of budding was generally shortened at the high- Drought effect elevation site compared with the mid- Drought had a tendency to advance elevation site, but this was significant only phenophases, but had the greatest effect at for high-elevation species, for which a the low-elevation site. Drought consistently contraction of 6.8 ± 1.1 d was recorded (Fig. led to smaller advancement of phenophases 1, Table S1). For mid-elevation species, by than did transplantation to the warmer site contrast, this contraction was only of 0.5 ± (Fig. 1). Effects of drought on onset of 1.4 d. The duration of fruiting was budding, flowering, fruiting and midpoint of significantly shorter at the mid-elevation site flowering varied depending on whether for both mid- and high-elevation species plants were grown at the mid- or high- (Table 3; F = 44.87, P < 10-4). The elevation sites, as indicated by a significant maturation of fruits took 9.8 ± 1.3 d less at interaction between elevation and drought the mid-elevation site compared to the high- (Table 3; ExD for budding P = 0.006;
33 Flowering phenology in mid- vs. high-elevation species flowering P = 0.008; fruiting P = 0.048; and the duration of fruiting only marginally for flowering mid-point P = 0.01). Drought mid- and high-elevation species (Fig. 1). By initiated earlier phenophases at both sites but contrast, at the high-elevation site, the this effect was significant only at the mid- duration of fruiting was significantly elevation site for high-elevation species (Fig. shortened by 6.4 ± 1.4 d for mid-elevation 1). At the mid-elevation site, drought- species under drought stress but only stressed high-elevation species initiated marginally by 2.1 ± 1.3 d for high-elevation budding 6.1 ± 2.1 d earlier than individuals species (Fig. 1, Table S1). under control conditions, while drought- For the total duration, a significant stressed mid-elevation species started interaction was found between drought and budding only 2.1 ± 2.3 d earlier. In contrast, elevation, as well as between drought and at high elevation, the onset of budding was origin (Table 3, F = 4.8, P = 0.03; F = 6.3, P only marginally advanced in the drought = 0.01, respectively). Drought-induced shifts treatment, namely by 0.2 ± 1.7 d for mid- in the total duration of reproductive elevation species and by 0.9 ± 1.1 d for high- phenology were more pronounced at the elevation species (Fig. 1, Table S1). The high-elevation site than at the mid-elevation same results were found for the onset of site and in mid-elevation species compared to flowering and fruiting, and for the midpoint high-elevation species. Drought significantly of flowering (Table 3), although the shortened total duration of reproduction for difference between mid- and high-elevation mid-elevation species when growing at the species was not revealed by post-hoc high-elevation site, namely by 7.5 ± 1.7 d, comparisons for the onset of flowering (Fig. however this effect was only marginal for 1). mid-elevation species when grown at the The durations of phenophases were lower elevation site and for high-elevation unequally affected by drought and only the species at both sites (Fig. 1). duration of flowering did not change in response to drought (Table 3, Fig. 1). The Piv of mid- and high-elevation species duration of budding was significantly shorter A significant difference in the Piv was on average under dry conditions (Table 3; F found for the midpoint of flowering (Fig. 2; = 3.96, P = 0.047), but this was not revealed V = 40, P = 0.03). Mid-elevation species had by the post-hoc multiple comparisons (Fig. a greater Piv than high-elevation species, 1). For mid-elevation species, drought indicating that the shift in midpoint of reduced the duration of budding by 3.3 ± 1.3 flowering in response to elevation and d at the mid-elevation site, and by 3.8 ± 1.2 drought was greater for mid-elevation at the high-elevation site. This effect was less species than for high-elevation species (0.19 pronounced and less consistent in high- ± 0.04 and 0.15 ± 0.05, respectively). These elevation species (Fig. 1, Table S1). results are consistent with the previously While the duration of fruiting was also reported shifts in number of days. generally shortened by drought at the lower Furthermore, as the Piv of mid-elevation site, a significant interaction between drought species was systematically greater (Fig. 2) and origin was found (Table 3; F = 6.27, P = we also compared the mean Piv across all 0.01) meaning that mid- and high-elevation traits between mid- and high-elevation species responded differently to the drought species and found a significantly higher treatment. At the lower site, drought affected mean value for mid-elevation species (PivMid
34 Chapter 2
= 0.31 ± 0.1, PivHigh = 0.26 ± 0.1; V = 36, P = reproductive phenology than high-elevation 0.01). This overall result indicates that mid- species and hence a greater capacity to adjust elevation species tended to have a greater these traits to environmental changes in degree of phenotypic plasticity in their temperature and water availability.
Fig. 2: Phenotypic Plasticity Index (Piv) of mid elevation (white bars) and high elevation species (black bars) calculated across all treatments for onsets and durations of phenophases. The error bars denote s.e. *, P<0.05.
Discussion al., 2014a, Frei et al., 2014b). However, in those studies, experimental gardens were Responses to transplantation and drought situated at lower elevations relative to our study sites (at 514 and 600 m compared Transplantation of high-elevation species with ours at 1050 m). This resulted in high- to a site with earlier springtime resulted in elevation populations in prior studies being advanced onset of reproductive phenology, exposed earlier in the year to days with an overall pattern in agreement with existing higher temperatures, yet relatively shorter literature (Price and Waser, 1998, Dunne et photoperiods than in our study, and may al., 2003, Scheepens and Stöcklin, 2013). have driven the observed differences in Mid- and high-elevation species initiated all results among our studies. As photoperiod is reproductive phenophases approx. 1 month also a fundamental cue for a frost risk-free earlier at the lower elevation site, indicating initiation of growth and reproduction for the important role of temperature for some alpine plants (Keller and Körner, 2003, phenophases. Interestingly, high-elevation Körner, 2003, Basler and Koerner, 2012), it is species initiated budding prior to mid- likely that high-elevation populations in the elevation species at both sites, on average by prior studies waited for days with a 10 d at the high site and by 5 d at the low site. sufficiently long photoperiod and did not rely In contrast, other studies found that solely on temperature to initiate reproduction. reproduction was always initiated first by However, in our study, photoperiod was low-elevation populations at the low-elevation similar between both common gardens at the sites (Haggerty and Galloway, 2011, Frei et
35 Flowering phenology in mid- vs. high-elevation species time of reproductive onset. Hence, advanced fast maturation rates under higher initiation of reproductive phenology in high- temperatures. As this last stage was elevation species at both of our study sites proportionally the longest it resulted in a probably reflects other adaptations to cold shorter total reproductive duration at the low- climates and short growing seasons, for elevation site, which suggests that plants example low growing degree day were not able to consistently prolong their requirements (Haggerty and Galloway, 2011) reproductive cycle to take advantage of a (Haggerty and Galloway, 2011) and longer growing season. preformation of buds (Sørensen, 1941, Limited water availability had considerable Billings and Mooney, 1968, Bliss, 1971). effects on plant reproductive phenology but At the mid-elevation site, most drought-induced shifts were less extensive phenophases were shortened, which is in than those in response to temperature agreement with previous studies (Sherry et changes (shifts in the order of magnitude of a al., 2007, Post et al., 2008, Steltzer and Post, few days against a month, respectively). 2009). However, the duration of budding was However, when drought stress was combined longer at the lower, warmer site relative to with higher temperatures, it generally the high-elevation site, which highlights the emphasized the responses of species and contrasting effects of warming on individual consistently led to further advancements and phenophases (Post et al., 2008, Haggerty and shortenings of phenophases for mid-elevation Galloway, 2011, Cornelius et al., 2013). species in responses to drought. This result is Contracted phenophases have generally been in line with a 4-d advancement in mid- explained as resulting from increased flowering date recorded after a simulated developmental rates in warm conditions drought in Central Europe (Jentsch et al., (Sherry et al., 2007, Haggerty and Galloway, 2009) and with a study which revealed that 2011). Alternatively, extended reproductive an ‘escape strategy’ inducing earlier durations are often linked to an expanded flowering was selected for in Brassica rapa growing season (Dunne et al., 2003). In our following a natural drought (Franks et al., study, the average daily temperature during 2007, Franks, 2011). In our study, species the budding phase was higher at the mid- responded to drought by plastic shifts than at the high-elevation site (14.1 and 12.3° congruent with such an ‘escape strategy’. C, respectively). Thus, temperature alone When the growing season is shortened by cannot explain expanded budding duration, drought, plants with late reproductive which is in contradiction with fast initiations might be unable to mature seeds developmental rates expected under warm before conditions become lethal. Hence, conditions. This result might be related when water availability is limited, a shift mainly to the fact that high-elevation species towards rapid development and maturation of significantly contracted this phenophase at flowers is advantageous and allows the high-elevation sites (Fig. 1) to guarantee maintenance of reproductive success (Vasek sufficient time for flowering and fruit and Sauer, 1971, Franks, 2011). maturation, but it is also possible that plants Mid- and high-elevation species generally tried to take advantage of a longer growing advanced phenophases in response to season at the lower site with advanced spring. drought but changes in the duration of The duration of fruiting was, however, highly phenophases were less pronounced in high- accelerated for both groups of species by elevation species. While the total duration
36 Chapter 2 of reproductive phenology was mainly particularly interesting that high-elevation shortened for high-elevation species, a species were found to have a lower Piv slight extension of budding and of fruiting specifically for the midpoint of flowering. was recorded at high- and mid-elevation The exact timing of flowering might be the sites, respectively. This result highlights the most crucial phenophase for successful divergent effects of drought on certain reproduction. The timing of flowering is phenophases (Peñuelas et al., 2004, Llorens even more crucial in cold environments, and Peñuelas, 2005). In our case, high- where short growing seasons (Billings and elevation species are normally less exposed Mooney, 1968, Körner, 2003) and adverse to drought periods than their congeners conditions such as frost events (Inouye, from lower elevations (Vasek and Sauer, 2008) pose additional challenges to 1971). Precipitation tends to increase with reproductive success. Consequently, strong elevation and evapo-transpiration tends to directional selection decreasing temperature decrease with elevation. Accordingly soil sensitivity and increasing photoperiodic moisture availability generally increases with control (Basler and Koerner, 2012, Vitasse elevation (Körner, 2003). Consequently, the and Basler, 2013) may have shaped the inconsistent responses of high-elevation evolution of reproductive phenology of species to drought at both sites suggest that high- elevation species to coincide with although high-elevation species also tended favourable environmental conditions, towards an ‘escape strategy’ when facing presumably contributing to local adaptation drought, they might be less efficient in in heterogeneous landscapes (Hall and doing so then their mid-elevation Willis, 2006, Verhoeven et al., 2008, congeners. Anderson et al., 2011). The selective pressures controlling timing Constrained degree of phenotypic plasticity of reproduction become increasingly strong in high-elevation species with elevation and thus we hypothesize that In line with our hypothesis, the the difference in phenological plasticity differences between herbaceous mid- and would have been more pronounced if more high-elevation species affected their strictly alpine species, from above treeline- potential for phenological plasticity, as elevation, had been chosen. This would have previously found for low- and high- provided a more extreme contrast with elevation populations of deciduous tree congeneric mid- elevation species. Here, our species (Vitasse et al., 2013). Our results results indicate that adaptation to short revealed that herbaceous high-elevation growing seasons in the alpine environment species tended to have a lower Piv than limits the potential for phenotypic plasticity mid-elevation species for flowering in the reproductive phenology of high- phenology even though this difference was elevation species in response to only significant for the midpoint of environmental changes, leading to a higher flowering and when averaged over all genetic canalization of the timing of peak phonological variables. Nevertheless, both flowering (Price et al., 2003, Pigliucci et al., mid- and high-elevation species showed a 2006, Ghalambor et al., 2007). notable capacity of tracking environmental changes through phenological shifts while maintaining a high performance. It is
37 Flowering phenology in mid- vs. high-elevation species
Consequences of phenological shifts efficient ‘escape strategy’ than their high- For high-elevation species, transplantation elevation congeners. Phenotypic plasticity to a lower elevation resulted in advanced has been suggested to be adaptive only when phenophases, suggesting adaptive tracking of the environmental fluctuations experienced an advanced growing season (Cleland et al., by populations do not fall outside their native 2012). However, higher temperatures also range (Ghalambor et al., 2007). While mid- accelerated developmental rates and led to elevation species are frequently exposed to shortened phenophases, indicating that high- dry summer periods, high-elevation species elevation plants were unable to take have rarely experienced such environmental advantage of a longer growing season. conditions in the past (Körner, 2003), which Furthermore, in advanced growing seasons, could explain why they were unable to the time frame for resource acquisition is produce an ‘escape strategy’ as efficient as abbreviated before environmental cues their mid-elevation congeners. initiate reproduction. Consequently, We conclude that while the direction of advanced flowering could potentially lead to plastic responses in reproductive phenology decreased fitness (Post et al., 2008, tended to track environmental changes, Scheepens and Stöcklin, 2013). adaptation of species to their native range Alternatively, for mid-elevation species, seem to constrain adaptive plasticity in novel the upward transplantation resulted in delayed conditions and could potentially lead to initiation and prolonged phenophases. While maladaptive responses (Ghalambor et al., the later initiation of reproduction at the 2007). higher site might be adaptive, the prolonged phenophases suggest an entirely passive Supplementary Data response to slower developmental rates in cold conditions (Sherry et al., 2007). At the Supplementary data are available online at final harvest in late autumn 15 % of mid- www.aob.oxford-journals.org and consist of elevation plants had not yet started to the following. Figure S1: schematic overview disperse their seeds and we estimate that in of the experimental design. Table S1: total approx. 30 % of flowers from mid- average day of the year of initiation and elevation species would not have completed midpoint of phenological stages, and fruit maturation (E. Hamann, pers. obs.). A durations of phenophases reported for mid- prolonged reproductive period of upward and high-elevation species and treatment migrated mid-elevation species could thus combinations. have fitness costs if associated with uncompleted seed maturation before winter Acknowledgements fall. Limited water availability advanced and We thank Samuel Schmid and Michael shortened phenophases, a result congruent Scherer-Lorenzen from the Agroscope, with the aforementioned ‘escape strategy’ Switzerland, for the loan of the rain- limiting the negative impact of drought stress shelters. We also thank the Schynige Platte on plant fitness (Franks, 2011). However, Alpine Botanical Garden, Sophie Schmid, drought-induced phenological shifts were Georg Armbruster and Guy Villaume for greater for mid-elevation species, suggesting technical support. We thank one that they were more capable of adopting an
38 Chapter 2 anonymous reviewer and the handling Science Foundation (project no. 3100A- editor for thorough revisions that 135611). considerably improved the manuscript. This work was supported by the Swiss National
References Cleland EE, Chuine I, Menzel A, Mooney HA, Schwartz MD. 2007. Shifting plant phenology in response to global change. Abu-Asab MS, Peterson PM, Shetler SG, Orli SS. Trends in Ecology & Evolution, 22: 357-365. 2001. Earlier plant flowering in spring as a Cornelius C, Leingartner A, Hoiss B, Krauss J, response to global warming in the Steffan-Dewenter I, Menzel A. 2013. Washington, DC, area. Biodiversity and Phenological response of grassland species to Conservation, 10: 597-612. manipulative snowmelt and drought along an Aeschimann L, Lauber K, Moser DM, Theurillat altitudinal gradient. Journal of Experimental JP. 2004. Flora alpina: Haupt, Bern. Botany, 64: 241-251. Anderson JT, Inouye DW, McKinney AM, Colautti Dunne JA, Harte J, Taylor KJ. 2003. Subalpine RI, Mitchell-Olds T. 2012. Phenotypic meadow flowering phenology responses to plasticity and adaptive evolution contribute to climate change: Integrating experimental and advancing flowering phenology in response gradient methods. Ecological Monographs, to climate change. Proceedings of the Royal 73: 69-86. Society B-Biological Sciences, 279: 3843- Fitter AH, Fitter RSR. 2002. Rapid changes in 3852. flowering time in British plants. Science, Anderson JT, Willis JH, Mitchell-Olds T. 2011. 296: 1689-1691. Evolutionary genetics of plant adaptation. Franks SJ. 2011. Plasticity and evolution in drought Trends in Genetics, 27: 258-266. avoidance and escape in the annual plant Basler D, Koerner C. 2012. Photoperiod sensitivity Brassica rapa. New Phytologist, 190: 249- of bud burst in 14 temperate forest tree 257. species. Agricultural and Forest Franks SJ, Sim S, Weis AE. 2007. Rapid evolution Meteorology, 165: 73-81. of flowering time by an annual plant in Beniston M, Diaz HF, Bradley RS. 1997. Climatic response to a climate fluctuation. change at high elevation sites: An overview. Proceedings of the National Academy of Climatic Change, 36: 233-251. Sciences of the United States of America, Beniston M, Rebetez M, Giorgi F, Marinucci MR. 104: 1278-1282. 1994. An analysis of regional climate change Frei ER, Ghazoul J, Matter P, Heggli M, Pluess in Switzerland. Theoretical and Applied AR. 2014a. Plant population differentiation Climatology, 49: 135-159. and climate change: responses of grassland Bernal M, Estiarte M, Penuelas J. 2011. Drought species along an elevational gradient. Global advances spring growth phenology of the Change Biology, 20: 441-455. Mediterranean shrub Erica multiflora. Plant Frei ER, Ghazoul J, Pluess AR. 2014b. Plastic Biology, 13: 252-257. Responses to Elevated Temperature in Low Billings WD, Mooney HA. 1968. Ecology of arctic and High Elevation Populations of Three and alpine plants. Biological Reviews of the Grassland Species. PLoS ONE, 9. Cambridge Philosophical Society, 43: 481- Ghalambor CK, McKay JK, Carroll SP, Reznick 529. DN. 2007. Adaptive versus non-adaptive Bliss LC. 1971. Arctic and alpine plant life cycles. phenotypic plasticity and the potential for Annual Review of Ecology and Systematics, contemporary adaptation in new 2: 405-438. environments. Functional Ecology, 21: 394- Bloor JMG, Pichon P, Falcimagne R, Leadley P, 407. Soussana J-F. 2010. Effects of Warming, Haggerty BP, Galloway LF. 2011. Response of Summer Drought, and CO2 Enrichment on individual components of reproductive Aboveground Biomass Production, phenology to growing season length in a Flowering Phenology, and Community monocarpic herb. Journal of Ecology, 99: Structure in an Upland Grassland Ecosystem. 242-253. Ecosystems, 13: 888-900. Hall MC, Willis JH. 2006. Divergent selection on Cleland EE, Allen JM, Crimmins TM, Dunne JA, flowering time contributes to local adaptation Pau S, Travers SE, Zavaleta ES, in Mimulus guttatus populations. Evolution, Wolkovich EM. 2012. Phenological tracking 60: 2466-2477. enables positive species responses to climate change. Ecology, 93: 1765-1771.
39 Flowering phenology in mid- vs. high-elevation species
Hartmann DL, Klein Tank AMG, Rusticucci M, objects of lme4 package) http://cran.r- Alexander LV, Brönnimann S, Charabi Y, project.org/package=lmerTest. Dentener FJ, Dlugokencky EJ, Easterling Lauber K, Wagner G. 2001. Flora Helvetica: Haupt, DR, Kaplan A, Soden BJ, Thorne PW, Bern. Wild M, Zhai PM. 2013. Observations: Levitt J. 1980. Responses of plants to environmental Atmosphere and Surface. In: Climate Change stress: Academic Press, New York. 2013: The Physical Sciences Basis. Llorens L, Peñuelas J. 2005. Experimental evidence Contribution of Working Group I to the Fifth of future drier and warmer conditions Assessment Report of the Intergovernmental affecting flowering of two co-occurring Panel on Climate Change.[Stocker TF, Mediterranean shrubs. International Journal D.Qin, G.-K. Plattner, M. Tignor, S.K. Allen, of Plant Sciences, 166: 235-245. J. Boschung, A. Nauels, Y. Xia, V. Bex and Memmott J, Craze PG, Waser NM, Price MV. P.M. Midgley (eds)]. Cambridge University 2007. Global warming and the disruption of Press, Cambridge, United Kingdom and New plant-pollinator interactions. Ecology Letters, York, NY, USA. 10: 710-717. Hothorn T, Bretz F, Westfall P, Heiberger RM, A. Menzel A, Sparks TH, Estrella N, Koch E, Aasa A, S. 2014. Simultaneous Inference in General Ahas R, Alm-Kubler K, Bissolli P, Parametrics Models. Biometrical Journal, 50: Braslavska O, Briede A, Chmielewski FM, 346-363. Crepinsek Z, Curnel Y, Dahl A, Defila C, Hudson JMG, Henry GHR, Cornwell WK. 2011. Donnelly A, Filella Y, Jatcza K, Mage F, Taller and larger: shifts in Arctic tundra leaf Mestre A, Nordli O, Penuelas J, Pirinen P, traits after 16 years of experimental warming. Remisova V, Scheifinger H, Striz M, Global Change Biology, 17: 1013-1021. Susnik A, Van Vliet AJH, Wielgolaski FE, Inouye DW. 2008. Effects of climate change on Zach S, Zust A. 2006. European phenology, frost damage, and floral phenological response to climate change abundance of montane wildflowers. Ecology, matches the warming pattern. Global Change 89: 353-362. Biology, 12: 1969-1976. Jentsch A, Kreyling J, Boettcher-Treschkow J, MeteoSwiss. 2014. Federal Office of Meteorology Beierkuhnlein C. 2009. Beyond gradual and Climatology. warming: extreme weather events alter Nicotra AB, Atkin OK, Bonser SP, Davidson AM, flower phenology of European grassland and Finnegan EJ, Mathesius U, Poot P, heath species. Global Change Biology, 15: Purugganan MD, Richards CL, Valladares 837-849. F, van Kleunen M. 2010. Plant phenotypic Keller F, Körner C. 2003. The role of plasticity in a changing climate. Trends in photoperiodism in alpine plant development. Plant Science, 15: 684-692. Arctic Antarctic and Alpine Research, 35: Parmesan C, Yohe G. 2003. A globally coherent 361-368. fingerprint of climate change impacts across Körner C. 2003. Alpine plant life: functional plant natural systems. Nature, 421: 37-42. ecology of high mountain ecosystems. Peñuelas J, Filella I, Zhang XY, Llorens L, Ogaya Germany: Springer Verlag. R, Lloret F, Comas P, Estiarte M, Kovats RS, Valentini R, Bouwer LM, Terradas J. 2004. Complex spatiotemporal Georgopoulou E, Jacob D, Martin E, phenological shifts as a response to rainfall Rounsevell M, Soussana J-F. 2014. Europe. changes. New Phytologist, 161: 837-846. In: Climate Change 2014: Impacts, Pigliucci M, Murren CJ, Schlichting CD. 2006. Adaptation, and vulberability. Part B: Phenotypic plasticity and evolution by Regional Aspects. Contribution of Working genetic assimilation. Journal of Experimental Group II to the Fifth Assessment Report of Biology, 209: 2362-2367. the Intergovernmental Panel on Climate Post ES, Pedersen C, Wilmers CC, Forchhammer Change.[Barros VR, C.B. Field, D.J. Dokken, MC. 2008. Phenological sequences reveal M.D. Mastrandrea, K.J. Mach, T.E. Bilir, M. aggregate life history response to climatic Chatterjee, K.L. Ebi, Y.O. Estrada, R.C. warming. Ecology, 89: 363-370. Genova, B. Girma, E.S. Kissel, A.N. Levy, S. Price MV, Waser NM. 1998. Effects of experimental MacCracken, P.R. Mastrandrea, and L.L. warming on plant reproductive phenology in White (eds.)]. Cambridge University Press, a subalpine meadow. Ecology, 79: 1261- Cambridge, United Kingdom and New York, 1271. NY, USA. Price TD, Qvarnstrom A, Irwin DE. 2003. The role Kuznetsova A, Brockhoff PB, Christensen RHB. of phenotypic plasticity in driving genetic 2013. lmerTest: Tests for random and fixed evolution. Proceedings of the Royal Society effects for linear mixed effect models (lmer of London Series B-Biological Sciences, 270: 1433-1440.
40 Chapter 2
Rathcke B, Lacey EP. 1985. Phenological patterns of Valladares F, Sanchez-Gomez D, Zavala MA. 2006. terrestrial plants. Annual Review of Ecology Quantitative estimation of phenotypic and Systematics, 16: 179-214. plasticity: bridging the gap between the Richter S, Kipfer T, Wohlgemuth T, Guerrero CC, evolutionary concept and its ecological Ghazoul J, Moser B. 2012. Phenotypic applications. Journal of Ecology, 94: 1103- plasticity facilitates resistance to climate 1116. change in a highly variable environment. Vasek FC, Sauer RH. 1971. Seasonal progression of Oecologia, 169: 269-279. flowering in Clarkia. Ecology, 52: 1038-&. Scheepens JF, Stöcklin J. 2013. Flowering Verhoeven KJF, Poorter H, Nevo E, Biere A. 2008. phenology and reproductive fitness along a Habitat-specific natural selection at a mountain slope: maladaptive responses to flowering-time QTL is a main driver of local transplantation to a warmer climate in adaptation in two wild barley populations. Campanula thyrsoides. Oecologia, 171: 679- Molecular Ecology, 17: 3416-3424. 691. Visser ME. 2008. Keeping up with a warming world; Shaw RG, Etterson JR. 2012. Rapid climate change assessing the rate of adaptation to climate and the rate of adaptation: insight from change. Proceedings of the Royal Society B- experimental quantitative genetics. New Biological Sciences, 275: 649-659. Phytologist, 195: 752-765. Vitasse Y, Basler D. 2013. What role for photoperiod Sherry RA, Zhou XH, Gu SL, Arnone JA, Schimel in the bud burst phenology of European DS, Verburg PS, Wallace LL, Luo YQ. beech. European Journal of Forest Research, 2007. Divergence of reproductive phenology 132: 1-8. under climate warming. Proceedings of the Vitasse Y, Hoch G, Randin CF, Lenz A, Kollas C, National Academy of Sciences of the United Scheepens JF, Korner C. 2013. Elevational States of America, 104: 198-202. adaptation and plasticity in seedling Sørensen TJ. 1941. Temperature relations and phenology of temperate deciduous tree phenology of the northeast Greebland species. Oecologia, 171: 663-678. flowering plants: Meddr. Grønland, 125(9). Walther GR, Post E, Convey P, Menzel A, Steltzer H, Post E. 2009. Seasons and Life Cycles. Parmesan C, Beebee TJC, Fromentin JM, Science, 324: 886-887. Hoegh-Guldberg O, Bairlein F. 2002. Theurillat JP, Guisan A. 2001. Potential impact of Ecological responses to recent climate climate change on vegetation in the European change. Nature, 416: 389-395. Alps: A review. Climatic Change, 50: 77- 109.
41 Flowering phenology in mid- vs. high-elevation species
Supplementary Data
Table S1: Average day of the year (± SE) of initiations and midpoint of phenological stages, and durations (in number of days) of phenophases reported for the species groups (lowland and highland) and treatment combinations: A (low site/control), B (low site/dry), C (high site/control), D (high site/dry).
Lowland Highland Lowland Highland Treatment Treatment species species species species A 150.6 ± 2.2 145.1 ± 2.3 A 27.1 ± 1.5 27.5 ± 1.3 Duration Onset of B 148.5 ± 2.6 139.0 ± 1.9 B 23.8 ± 1.3 26.2 ± 1.2 of budding C 183.1 ± 1.8 174.7 ± 1.3 budding C 26.6 ± 1.4 20.7 ± 1.0 D 182.9 ± 1.7 173.8 ± 1.0 D 22.8 ± 1.0 22.0 ± 1.0 A 170.0 ± 2.5 165.2 ± 2.6 A 17.8 ± 1.0 16.7 ± 0.9 Duration Onset of B 167.4 ± 2.6 159.5 ± 2.3 B 16.4 ± 0.7 18.5 ± 1.1 of flowering C 200.6 ± 2.3 191.6 ± 1.9 flowering C 19.0 ± 1.1 14.7 ± 0.7 D 199.1 ± 2.0 191.8 ± 1.8 D 17.6 ± 0.9 14.9 ± 0.6 A 176.5 ± 2.5 170.7 ± 2.7 A 42.7 ± 1.4 40.1 ± 1.4
Onset of B 173.4 ± 2.6 166.1 ± 2.4 Duration B 39.5 ± 1.2 40.4 ± 1.3 fruiting C 207.7 ± 2.3 198.1 ± 1.9 of fruiting C 52.5 ± 1.4 48.2 ± 1.3 D 205.2 ± 2.1 198.0 ± 1.7 D 46.1 ± 1.4 46.1 ± 1.3 A 180.1 ± 2.4 174.7 ± 2.5 A 68.4 ± 1.5 65.7 ± 1.4 Midpoint B 175.4 ± 2.4 169.0 ± 2.3 Total B 64.4 ± 1.4 67.6 ± 1.0 of duration flowering C 211.3 ± 2.5 198.4 ± 2.0 C 75.9 ± 1.9 71.2 ± 1.7 D 207.9 ± 2.1 197.9 ± 1.8 D 68.4 ± 1.6 70.1 ± 1.6
42 Chapter 2
Fig. S1: Schematic overview of the experimental design.
43 Flowering phenology in mid- vs. high-elevation species
44 Chapter 3
Chapter 3
Plant responses to simulated warming and drought: a comparative study of functional plasticity between congeneric mid and high elevation species
Elena Hamann*, Halil Kesselring and Jürg Stöcklin *E. Hamann is the corresponding author.
Journal of Plant Ecology (2017) DOI:10.1093/jpe/rtx023, available online at www.jpe.oxfordjournals.org
45 Functional plasticity in mid vs. high elevation species
46 Chapter 3
Responses of key plant traits to experimental warming and drought: a comparative study of functional plasticity between congeneric mid- and high elevation species
Elena Hamann*, Halil Kesselring, Jürg Stöcklin
Botanical Institute, Department of Environmental Sciences, Section Plant Ecology, University of Basel, Schönbeinstrasse 6, CH-4056 Basel, Switzerland
*For correspondence: [email protected]
Abstract
• Effects of climate change, especially changes in temperatures and precipitation patterns, are particularly pronounced in alpine regions. In response, plants may exhibit phenotypic plasticity in key functional traits allowing short-term adjustment to novel conditions. However, little is known about the degree of phenotypic plasticity of high elevation species relative to mid elevation congeners. • We transplanted 14 herbaceous perennial species from high elevation into two common gardens (1050 and 2000 m.a.s.l.) in the Swiss Alps, and we examined plastic responses in key functional traits to changes in temperature and soil water availability. This design was replicated with 14 congeneric species from mid elevation to assess if the degree of phenotypic plasticity differs between mid and high elevation species. Survival was assessed across two growing seasons, while aboveground biomass and specific leaf area (SLA) were measured after the first growing season, and biomass allocation to belowground and reproductive structures after the second. Moreover, a phenotypic plasticity index was calculated for the functional traits to compare the degree of plasticity between mid and high elevation species. • Aboveground biomass was higher in mid elevation species relative to high elevation congeners in all treatments, yet decreased for both with elevation and drought. Similarly, SLA decreased with elevation and drought. Root mass fraction (RMF) was generally higher in high elevation species, and decreased with drought at the lower site. Drought increased the allocation to reproductive structures, especially when plants were grown at their elevation of origin. Interestingly no difference was found in the degree of phenotypic plasticity averaged across mid and high elevation species for any of the studied functional traits. • These results indicate that phenotypic plasticity in the focal traits did not depend on the elevation of origin of the species. Plasticity was not related to environmental heterogeneity, nor constrained by selective pressures at high elevation. However, both species groups showed a remarkable capacity for short-term acclimation to a prospective climate through rapid adjustments in key functional traits.
Keywords: Biomass allocation, Common garden, Climate change, Perennial herbaceous species, Phenotypic plasticity, SLA, Swiss Alps, Transplant experiment
47 Functional plasticity in mid vs. high elevation species
Introduction A number of studies have investigated shifts in plant traits in response to climate In the late nineteenth century, pioneer change. While modifications in flowering experimental botanists began using phenology are probably the best documented transplantation experiments along elevational worldwide (Parmesan et al. 2003), gradients to investigate the degree of adjustments in other key plant functional transformation of plants in novel traits have also been reported in response to environments (Kerner 1869, Bonnier 1890, ; changes in temperature and soil water reviewed in Briggs et al. 1997). Soon after, availability. Leaf traits and particularly the genetic component of ecotypic specific leaf area (SLA) are considered as differentiation of plants from different most informative (Wright et al. 2004, elevations was recognized by Clausen et al. Scheepens et al. 2010), as SLA is an (1941), along with the possibility that plants indicator of relative growth rate, stress might change their phenotype depending on a tolerance and leaf longevity (Lavorel et al. given environment. This particular finding, 2002, Atkin et al. 2006, Poorter et al. 2009). later termed phenotypic plasticity, has SLA has been shown to strongly correlate received growing attention in the past with temperature, irradiance and soil water decades (Bradshaw 1965, Schlichting 1986, availability (Poorter et al. 2009), and Sultan 1987, Thompson 1991), and the generally decreases with increasing elevation current interest results in part from an (Körner 2003, Ma et al. 2010, Scheepens et urgency to predict species responses to al. 2010), and with reduced soil water global change (Valladares et al. 2006). availability (Poorter et al. 2009). SLA is a In Europe, increasing temperatures and highly plastic trait, which adjusts rapidly to changes in precipitation patterns have been changing environmental conditions reported by the IPCC (Hartmann et al. 2013, (Scheepens et al. 2010). Kovats et al. 2014), and it has been Increasing elevation and decreasing soil suggested that the effects of global change water availability are important factors are proportionally more important at high limiting plant productivity. Indeed, elevation (Beniston et al. 1997). Indeed, in aboveground biomass generally decreases alpine regions, the amplitude of temperature with increasing elevation and drought changes during the past decades is greater (Lambers et al. 1998, Körner 2003). More than globally observed changes (Beniston et specifically, the allocation of biomass to al. 1994), and summer droughts are predicted different plant organs differs along to become more frequent (Kovats et al. elevational and soil moisture gradients. Plant 2014), leaving mountain biota particularly growth theory predicts that plants from stress vulnerable to climate change (Theurillat et dominated and cold habitats allocate a high al. 2001, Körner 2003). In this context, portion of dry matter to belowground organs phenotypic plasticity may play a crucial role thereby increasing survival (Bloom et al. in the short-term adjustment to novel 1985, Grime 2001). Indeed, Körner et al. conditions and could promote long-term (1987) showed in an extensive study on 49 adaptive evolution by buffering against rapid perennial herbaceous species, that high change (Price et al. 2003, Nicotra et al. 2010, elevation plants allocate more dry matter to Richter et al. 2012). roots, especially fine roots, than typical lowland plants, and these results were
48 Chapter 3 generally corroborated since (Prock et al. growing at lower elevation. While a 1996, Ma et al. 2010, Poorter et al. 2012a). reciprocal transplant experiment with three Similarly, in the context of drought stress, grassland species revealed no difference in greater proportional root biomass presumably the plasticity of growth, phenology and leaf increases the uptake surface area and thus the traits between low and high elevation water acquisition potential (Heschel et al. populations (Frei et al. 2014a), Vitasse et al. 2004, Pang et al. 2011, Huang et al. 2013). (2013) found lower phenological plasticity in However, increased allocation to high elevation deciduous tree species. Theory belowground structures may come at the predicts that phenotypic plasticity is expense of allocation to reproductive advantageous in spatially and temporally structures and/or photosynthetic organs such heterogeneous environments (Via et al. 1985, as leaves, and a trade-off between these Alpert et al. 2002, van Kleunen et al. 2005). structures has been found in several studies One could hypothesise that high elevation (Körner et al. 1987, Prock et al. 1996, Ma et species, adapted to habitats with great spatial al. 2010). Furthermore, when comparing and temporal heterogeneity (Scherrer et al. high and low elevation species, it was found 2011) might display greater plasticity in that high elevation species allocated three response to environmental variation than times more of their aboveground biomass plants from lower more homogeneous sites. specifically to floral structures (Fabbro et al. On the other hand, high elevation species 2004), indicating a clear prioritisation of have evolved under strong selective reproduction over growth. Similarly, under pressures, imposing directional or stabilizing drought stress, trade-offs at the expense of selection on plant traits, and thereby reproductive structures have also been found constraining their capacity to respond (Huang et al. 2013). However, another study plastically to changes in external conditions showed that two out of 11 alpine species had (Vitasse et al. 2013). In a parallel study, we a higher reproductive biomass when grown found lower plasticity in the flowering under drought (Peterson et al. 1982), phenology of high elevation species, which indicating that investment in sexual are probably constrained by canalized reproduction can be favoured in some species selection for rapid flowering after snowmelt under drought stress or competition in regard of the short growing season at high (Rautiainen et al. 2004). elevation (Gugger et al. 2015). In the traits Although a number of studies have studied here, we expect the opposite because examined the effects of warming and drought high plasticity in SLA and biomass on plant traits (Arft et al. 1999, Heschel et al. allocation might be advantageous in a highly 2004, Atkin et al. 2006, Gilgen et al. 2009), heterogeneous environment such as the only few have studied the effects of these alpine habitat. factors in combination, and simultaneously Here, we examine the combined effects of on multiple herbaceous species (Cleland et warming and drought on specific plant traits, al. 2006, Bloor et al. 2010). Furthermore, to known to be particularly plastic to these this day, we know of only two studies, which environmental factors (i.e. SLA, biomass have used a comparative approach to allocation). We reciprocally transplanted 14 examine if species or populations growing at congeneric pairs of herbaceous perennial high elevation harbour the same potential for species originating from mid and high phenotypic plasticity as their counterparts elevation sites in the Swiss Alps to common
49 Functional plasticity in mid vs. high elevation species gardens differing c. 1000 m in elevation to from elevations between c. 300 and 1000 mimic changes in temperature, and installed m.a.s.l and high elevation species between rain-shelters to control soil water availability. c.1600 and 2400 m.a.s.l (Lauber et al. 2001, Our factorial design allows to quantify the Aeschimann et al. 2004), as to avoid an effects of simultaneous warming and drought overlap in their altitudinal range of on key plant functional traits and to test for distribution (see details in Table 1 in Gugger differences in direction and magnitude of et al. 2015). Seed mixes, originally collected plastic responses between mid and high from wild flower populations from the elevation species. Specifically, we expect: aforementioned distributional ranges and (1) plant productivity to decrease with then proliferated in gardens for two years, elevation and drought (2) specific leaf area to were purchased from Swiss seed producers decrease with increasing elevation and (Samen und Pflanzen AG Schutz, Filisur; drought 3) allocation to belowground and UFA-Samen, fenaco Genossenschaft, reproductive structures to increase with Winterthur; Wildstaudengärtnerei, drought and elevation, and to be Eschenbach). proportionately greater in high elevation species (4) the degree of phenotypic Experimental design plasticity to be higher in high elevation For a detailed experimental design refer to species relative to congeneric mid elevation (Gugger et al. 2015). In short, seeds were species, resulting from adaptation to high germinated in spring 2012 and seedlings environmental heterogeneity at high were later transferred into multitrays (4 cm Ø elevation. *6*9=54 pots) filled with low-nutrient soil (Anzuchterde Ökohum, Herrenhof, Materials and methods Switzerland). In early July, plants were transported to the common gardens and Common gardens and study species transplanted into bigger pots (11.5*11.5*21.5 Common gardens, with four plant beds cm) with identical soil. At each site, 12 each, were established at 1050 and 2000 individuals per species were placed in the m.a.s.l on the same mountain of the Bernese control beds and 12 in the beds receiving Highland in Switzerland. The difference in rain-shelters (i.e. drought treatment), leading elevation between the common gardens to a full factorial design including 12 entails for an annual mean air temperature replicates * 28 species (14 mid and 14 high difference of 5-6°C (Körner 2003), which elevation species) * 2 sites (mid/high) * 2 mimics extreme warming scenarios of the treatments (control/dry) = 1344 individuals IPCC by 2100 (Kovats et al. 2014). Specific in total. Rain-shelters were installed after two site location and abiotic conditions have weeks of acclimation and consisted of previously been described in a related paper triangular aluminium frames with a base area (Gugger et al. 2015). of 2.4 x 3.0 m and a height of 1.2 m, covered 14 species pairs of congeneric perennial by a UV-B transmissible greenhouse film herbs naturally growing in the region and (Luminance AF Window, Folitec, Germany; originating from mid and high elevations Samuel Schmid and Michael Scherer- were selected for this study (Table 1), Lorenzen, personal communication). A covering a broad taxonomic and growth form minimal water input was provided every two range. Mid elevation species were selected weeks during the growth period by
50 Chapter 3 distributing 20 l of rainwater equally over the treatment. plants in both the control and the drought
Table 1 Overview of the congeneric pairs of mid and high elevation species included in our study (or subspecies in the case of Anthyllis, Silene and Trifolium). Mid elevation species ranged from 300 to 1000 m a.s.l., and high elevation species ranged from 1600 – 2400 m a.s.l. (Lauber & Wagner, 2001; Aeschiman et al., 2004). For details on the natural range of distribution of each species refer to Gugger et al. (2015) Family Mid elevation species High elevation species Lamiaceae Acinos arvensis (Lam.) Dandy Acinos alpinus (L.) Moench Poaceae Anthoxanthum odoratum L. Anthoxanthum alpinum Löve Anthyllis vulneraria ssp. vulneraria Anthyllis vulneraria ssp. alpestris Fabaceae L. s.l. Schult Brassicaceae Arabis hirsuta L. Arabis alpina L. s.l. Campanulaceae Campanula rotundifolia L. Campanula scheuchzeri Vill. Asteraceae Centaurea scabiosa L. s.l. Centaurea montana L. Caryophyllaceae Dianthus deltoides L. Dianthus sylvestris Wulfen Rosaceae Geum urbanum L. Geum montanum L. Fabaceae Lotus corniculatus L. Lotus alpinus Ramond Fabaceae Onobrychis viccifolia Scop. Onobrychis montana DC. Poaceae Phleum phleoides (L.) Karsten Phleum alpinum L. Plantaginaceae Plantago lanceolata L. Plantago alpina L. Silene vulgaris ssp. vulgaris Silene vulgaris ssp. glareosa (Jord.) Caryophyllaceae (Moench) Garcke s.l. Marsd.-Jon & Turill Fabaceae Trifolium pratense ssp. pratense L. Trifolium pratense ssp. nivale (Koch)
It follows that the difference in soil water warming effects of rain-shelters. Similarly, availability between the two treatments light intensity loggers (Hobo pendant light equalled the amount of natural precipitation data logger 64K-UA-002-64, Onset (blocked by the rain-shelters in the drought Computer Corporation, Bourne, MA, USA) treatment). Rain-shelters were removed after were installed in each common garden and the first growing season to allow plants to treatment to control for shading effects overwinter under snow-cover. After induced by the rain-shelters. Volumetric soil snowmelt in spring 2013, rain-shelters were moisture content (VSCM m3 m-3) was re-installed (mid-May at the low common measured monthly on a subset of pots in each garden and mid-June at the high common treatment with a HH2 Moisture Meter and a garden). Theta Probe type ML2x (Delta-T Devices, At each site, data loggers (TidBit v.2 Cambridge, England). UTBI-001; Onset Computer Corporation, Bourne, MA, USA) recorded temperatures at Abiotic treatment effect 0.5 m above the ground in both treatments Over the growing season (from May to (control and drought) to assess possible October 2013), the recorded temperature
51 Functional plasticity in mid vs. high elevation species averaged 15.7 °C at the lower site and 11.3 without having limiting effects on plant °C at the higher site (Table 2), and differed growth (see Fig.11.11 in Körner 2003). on average by 4.4 °C between both common Volumetric soil moisture content (VSMC in gardens. Rain-shelters only marginally m3 m-3, Table 2) was significantly reduced increased the temperature of the plant beds (at least six-fold) in the drought treatment by 0.3 °C on average (Table 2). Light relative to the control at both common intensity (measured in klux at 1 PM, Table 2) gardens (W = 900, P = 10-4; W = 844.5, P = was greater at the higher site but at both sites 10-4, respectively). rain-shelters intercepted c. 30% of light
Table 2: Mean temperature, light intensity and volumetric soil moisture content (VSMC) for each treatment averaged over the second growing season (May-October 2013). Temprature Light Intensity VSMC (°C) (klux) (m3 m-3) Low site / Control 15.5 11.53 0.4 Low site / Dry 15.9 8.45 0.06 High site / Control 11.2 13.98 0.48 High site / Dry 11.4 10.12 0.08
Assessment of plant traits and fitness proxies individuals was recorded before re-installing At the end of the first growing season in the rain-shelters. Final harvest was done 2012 (12 weeks after transplantation, from from September 15 to 17 at the lower October 1 to 4), survival of individuals was common garden and from October 15 to 17 recorded. Aboveground biomass was at the higher common garden. The harvested at c. 2 cm above the ground, stored intentional difference between both harvests in individual parchment bags, dried for 72h allowed plants to grow for 18 weeks at both at 80°C and weighed to obtain dry mass. sites. For every individual, aboveground Specific leaf area (SLA) was measured biomass was harvested at ground level, during harvest by taking circular corings separated into vegetative and reproductive from three newly grown, mature leaves per biomass and stored in parchment bags. individual, while avoiding the central leaf Reproductive biomass includes flower heads vein (Scheepens et al. 2010). The diameter of and flower stems. Individual root biomass, the corings differed between species and including all belowground organs, was ranged between 2.5 and 10 mm depending on sampled from pots and additional roots were leaf size. The three leaf corings from one dug up when they had grown out of the pots individual were pooled in individual (rare occurrence). After roughly cleaning parchment bags, and dried for 48h at 60 °C. roots of soil they were stored in parchment Leaf corings of one individual were weighed bags. All samples were kept refrigerated until together to a precision of 0.0001 g. SLA was transporting them back to the laboratory calculated for every individual by dividing (max. three days), where vegetative and the area of corings by their average dry mass reproductive biomass was dried for 72h at 80 (Perez-Harguindeguy et al. 2013). °C and weighed for dry mass. Root samples At the beginning of the second growing were carefully washed to remove all season (2013), over-winter survival of sediment particles above a 2 mm mesh sieve
52 Chapter 3 to minimize loss of fine roots. Clean roots phenotypic plasticity), while the ‘origin’ of were dried for 72h at 80 °C and weighed. species effect indicates differences between Plant mass fractions (Poorter et al. 2012b) mid and high elevation species. The were calculated as the proportion of total interaction between ‘origin’ of species and plant biomass allocated to each structure ‘elevation’ and/or ‘drought’ indicates a (RMF: root mass fraction, FMF: flower mass difference in the responses to environmental fraction). conditions between mid and high elevation species. All proportions were arc sine Degree of phenotypic plasticity transformed prior to analysis (Crawley The degree of phenotypic plasticity in 2007). Initially, the growth form, taxonomic response to warming and drought was and functional group of species were estimated as a Phenotypic Plasticity Index included in the models to check for patterns
(Piv) (Valladares et al. 2006). This index was induced by these factors, but these terms calculated as the difference between the were removed because they were never maximum and the minimum mean value of a significant. All linear mixed-effect models given trait and species over all treatment where performed with the ‘lmerTest’ combinations divided by the maximum package for R software (Kuznetsova et al. mean, which serves to standardize the index 2013) and based on Type 3 errors and ranging from zero (no plasticity) to one Satterthwaite approximation for denominator
(maximum plasticity). The Piv was examined degrees of freedom. We report F-values and for the functional plant traits (i.e. SLA, RMF, p-values for fixed effects and χ2-values and FMF) of every species, in order to compare p-values for random effects using the “rand” the degree of phenotypic plasticity between function in lmerTest. Normality was verified mid and high elevation species for traits for all variables to ensure accuracy of the related to but not directly indicative of plant estimated p-values (Pinheiro et al. 2000). fitness (i.e. biomass). Post-hoc Tukey HSD tests for multiple comparisons were performed using the Statistical analysis ‘multcomp’ package (Hothorn et al. 2014) To test if the transplantation and drought for R software. treatment had an effect on plant functional The number of individuals that survived traits and fitness proxies of mid and high the first growing season and the following elevation species, linear mixed-effect models winter was counted at each site and for each were applied. ‘Elevation’ (mid elevation or treatment and analyzed using Fisher’s Exact high elevation site), ‘drought’ (control or Test for Count Data. drought treatment), ‘origin’ of species (mid Finally, to test for differences in the elevation and high elevation species) were degree of phenotypic plasticity of focal plant included as fixed effects, along with their traits between mid and high elevation respective two-way and three-way species, the calculated Phenotypic Plasticity interactions. To account for variances Index (Piv) was analysed with a paired between species, species nested within genus Wilcoxon signed rank test (accounting for was included as random effect in the models. species genera). The environmental effects of ‘elevation’ All the analyses were performed on R and/or ‘drought’ indicate trait variation due version 3.0.2 software (R Development Core to different environmental conditions (i.e Team, 2013).
53 Functional plasticity in mid vs. high elevation species
Results origin of species (Fisher’s Exact Test for Count Data: P=0.33). Additionally, another Fitness proxies (survival and biomass) 13% of individuals were damaged by 96.7% of individuals survived herbivores or were not reproductive during transplantations to the common gardens and the following growing season. This resulted the first growing season. Not surprisingly, in highly unbalanced data across treatment aboveground biomass differed between combinations for species of 5 genera species nested within genus, because of (Centaurea, Geum, Onobrychis, Silene and inherent differences in productivity (Table 3; Trifolium), leading to the complete exclusion χ2=768, P<10-4). Although certain genera of these genera from analysis of data produced larger plants (i.e. Anthyllis, Silene) collected in 2013 to avoid any statistical or smaller plants (i.e. Campanula, Dianthus), biases. grouping of species in functional and After the second growing season (18 taxonomic groups or growth forms did not weeks), total biomass still differed between yield further insight (factors were species nested within genus (Table 3; 2 -4 subsequently removed from final models). χ =294, P<10 ). Differences between genera However, after the first growing season (c.12 were larger than those between species pairs weeks in 2012) interesting overall patterns within genera, with some being inherently emerged between grouped mid and high larger (i.e. Anthyllis, Lotus, Silene), elevation species in response to elevation and compared to others (i.e. Campanula, manipulated water availability (Fig. 1a). Dianthus). More importantly, total biomass Specifically, aboveground biomass decreased differed across treatment combinations, as significantly with elevation for both mid and revealed by a significant interaction between high elevation species (Fig. 1a; Table S1). elevation and drought (Table 3; F=4.79, On average, mid and high elevation species P=0.02). While drought marginally increased differed in their response to transplantation, total biomass of mid elevation species at the as indicated by a significant interaction lower site, total biomass of mid elevation between elevation and origin of species species significantly decreased with drought (Table 3; F=28.7, P<10-4). High elevation at the high elevation site (Fig. 1b, Table S1). species had a consistently lower biomass High elevation species were only marginally than mid elevation species at both sites, but affected by drought at the lower site, yet total this effect was significant only at the lower biomass of plants was significantly reduced elevation site (Fig. 1a). Furthermore, a when grown under dry conditions at the significant interaction between drought and higher site relative to the control treatment at origin of species was found (Table 3; F=4.29, the lower site (Fig. 1b, Table S1). P=0.03). While drought generally decreased aboveground biomass for both mid and high Specific leaf area elevation species, the negative effect of Across the sites and treatments, specific 2 -1 drought was significant only for mid leaf area ranged from 25.7 ± 0.30 mm mg elevation species at the lower site (Fig. 1a). at the lower elevation site, under control 2 -1 Survival assessment in 2013 revealed that conditions to 15.8 ± 0.13 mm mg at the c. 25% of individuals had died over winter high elevation site under dry conditions (Fig. 2012/13. Mortality was however independent 2a, Table S1). Specific leaf area also differed of site of transplantation, treatment and between species nested within their genus
54 Chapter 3
specific specific
-
4 4 - -
P 0.53 0.58 0.55 0.81 0.26 <10 <10 0.001 ecies (mid vs. (mid ecies
2 and and high elevation values for values random
χ - - 188 0.41 0.33 0.35 0.05 1.26 F / 27.36 10.45 mid
1 1 1 1 1 1 1 1 df Flower Mass Fraction
4 4 4 values and p and values - - - -
2 P χ 0.95 0.01 0.05 0.22 0.51 <10 <10 <10
2 χ 463 9.89 3.58 1.52 0.45 F / 0.002 24.16 38.82
1 1 1 1 1 1 1 1 df Root MassRoot Fraction
4 4 4 4 ) - - - - 1
r fixed effects and - and and high elevation species to highlight species P
- 0.77 0.47 0.96 <10 <10 <10 <10 0.012 mg
2
2 χ values fovalues - 830 0.51 6.21 F / 13.01 36.76 0.002 331.45 265.84
1 1 1 1 1 1 1 1 SLA (mm df
4 -
P V, P V = 23, P = 0.13 V = 37, P = 0.09 V = 24, P = 0.9 0.08 0.24 0.02 0.54 0.85 0.12 values and p and values <10 - 0.0002 F
2 (in (in parentheses) for mid χ
/ iv
294
3.07 1.57 4.79 0.36 0.03 2.31 F 14.33
e report report e 1 1 1 1 1 1 1 1 df Total biomass (g) biomass Total
) for key functional traits (SLA, RMF, FMF) compared between v 0.35) 0.91)
0.58)
4 4 4 4
- - - - – –
–
P 0.06 0.09 0.03 0.11 <10 <10 <10 <10
2 χ
mean (range) of (range) high mean 3.96 2.85 4.29 2.46
F / 20.95 28.69 768.8 v ground biomass (g) ground biomass evation species evation 254.53 - Pi el 0.11 (0.20 0.45± 0.08 (0.10 0.24 ± 0.24 (0.27 0.56 ±
1 1 1 1 1 1 1 1 df Above
0.56) 0.54) 0.89)
values are shown(P bold < 0.05). are in values – – – -
± ± SD Phenotypic Plasticity Indices (Pi
mean (range) of (range) mid mean
Mean v
Linear mixed effect model for the responses of functional traits to the elevation and drought treatment, the origin of sp origin the the treatment, drought and elevation the to for responses oftraits effect the model functional mixed Linear
The significant P significant The Pi species elevation 0.10 (0.24 0.41 ± 0.15 (0.09 0.29 ± 0.19 (0.28 0.56 ±
Elevation Drought Origin drought : Elevation origin : Elevation origin Drought : origin : drought : Elevation genus / Species Table 3: Table W interactions. respective their and species) elevation high effects. Table 4: species with a paired Wilcoxon test. We also report ranges of P responses. SLA RMF FMF ! 55 Functional plasticity in mid vs. high elevation species
of key
ented ented in
6 Tukey Tukey tests can
ng individuals ng individuals Mean Mean ± 1 SE : post hoc Fig. Fig. 2 functional plant Specific Leaf traits Area, (b) Root Mass (a) Fraction, and (c) Flower Mass Fraction in response to treatment combinations low (i.e. or high elevation, control and drought). Mid species elevation are white bars repres and high elevation species in black bars. Results from contrasts. letter the in seen be Tukey tests can be seen in the letter letter the in seen be can tests Tukey
r removal of 5 genera (n = 55 of 5 genera r removal post hoc
ean ± 1 SE of aboveground biomass (a) measured in 2012, in measured (a) 1 SE of biomass ± aboveground ean . Results from. Results M : Fig. 1 Fig. species 2013, for elevation in mid (b) measured biomass total and each bars) in (black species elevation high bars) and (white and control elevation, high low and (i.e. combination treatment drought) contrasts. of 1300 total 2012 on a in was * Aboveground biomass measured 2013 on the in was biomass measured total the while individuals, afte individuals surviving
enera (n = 556). enera
survivi 2013 on the in FMF RMF the measured the and were while of 1300 individuals, total 2012 on a in * SLA was measured of 5 g removal after ! 56 Chapter 3
(Table 3; χ2=830, P<10-4). On average, SLA the significant interaction between elevation decreased with elevation and drought, and and drought (Table 3; F=38.8, P<10-4). For the negative effect of drought was more both mid and high elevation species, drought pronounced at the lower site (Fig. 2a, Table significantly decreased the allocation to roots S1), as indicated by the significant at the lower site relative to the control interaction between elevation and drought treatment, while allocation to roots was only (Table 3; F=36.7, P<10-4). Additionally, the marginally increased at the higher site (Fig. negative effect of drought on SLA was also 2b). more pronounced for high elevation species, The investment in reproductive structures leading to a significant interaction between (Flower Mass Fraction: FMF, Fig. 2c) drought and origin (Table 3; F=6.2, P=0.01). differed between elevation of transplantation Specific leaf area was however very similar and species’ origin, as indicated by the between mid and high elevation species significant interaction between elevation and within each site (Table 3; F=13.01, P=0.7, origin (Table 3; F=10.45, P=0.001). On and Tukey; Fig. 2a). average, species tended to have a higher FMF when growing at their elevation of Biomass allocation (to roots and origin relative to their foreign congeners (not reproductive structures) revealed by individual post-hoc test Fig. 2c). On average, plants allocated 26% of total Moreover, drought had a significant effect on biomass to belowground structures and 13% the FMF (Table 3; F=27.4, P<10-4). to reproductive structures (61% to vegetative Specifically, both mid and high elevation structures). While the proportion of biomass species significantly increased the allocation allocated to roots or reproductive structures to reproductive structures when growing differed between species nested within their under limited water conditions at their genus (Table 3; χ2=463, P<10-4, χ2=188, elevation of origin (Fig. 2c, Table S1). P<10-4, respectively), interesting patterns emerged when averaged across mid and high Phenotypic Plasticity Index (Piv) of mid and elevation species. high elevation species The proportion of total biomass allocated The phenotypic plasticity index did not to belowground structures (Root Mass significantly differ between mid and high Fraction: RMF, Fig. 2b) differed significantly elevation species for the measured plant between mid and high elevation species, as functional traits (Table 4). The Root Mass indicated by a significant origin effect (Table Fraction was the only trait for which a
3; F=9.89, P=0.01). Indeed, RMF of high marginally lower Piv was found for high elevation species was significantly higher elevation species (Table 4; P < 0.10). The compared to mid elevation species when phenotypic plasticity indices were however grown under control conditions at the lower highly species and trait specific (see ranges site, and marginally higher compared to their Table 4). For example, plasticity in SLA mid elevation congeners in all other ranged from 0.24 to 0.56 in mid elevation treatment combinations (Fig. 2b, Table S1). species and from 0.20 to 0.58 in high For both species’ groups, RMF was elevation species. Plasticity in RMF ranged surprisingly highest when grown at the lower from 0.09 to 0.54 in mid elevation species site under control conditions, but drought had and from 0.10 to 0.35 in high elevation opposite effects at both sites, as revealed by species. The highest ranges were found for
57 Functional plasticity in mid vs. high elevation species plasticity in FMF, which ranged from 0.28 to 1a). This result confirms the efficiency of our 0.89 in mid elevation species and from 0.27 drought treatment, which reduced the to 0.91 in high elevation species. Finally, volumetric soil moisture content six-fold, and from the average Piv’s and their ranges, it that water availability is an important also becomes apparent that the FMF was the limiting factor for plant productivity most plastic trait, SLA had an intermediate (Lambers et al. 1998). degree of plasticity and the RMF was the Variation in total biomass in response to least plastic trait (Table 4). the different treatment combinations during the second growing season was less Discussion consistent (Fig. 1b). Although, total biomass was significantly reduced by drought at the In the present study, we investigated the high site, at the lower site drought had no effects of changes in temperature (through effect on the total biomass of high elevation transplantations to different elevations) and species and seemed to marginally increase soil water availability on phenotypic the productivity of mid elevation species. variation in key functional plant traits (i.e. Increased biomass productivity of grasslands SLA, RMF, FMF) of 14 congeneric pairs of subjected to drought stress has also been mid and high elevation species. We further reported by Gilgen et al. (2009) and was examined if trait plasticity varied in direction explained by improved soil oxygenation. and magnitude between species originating Higher soil oxygen concentrations are from mid and high elevation. expected to increase soil mineralisation rates and consequently nutrient availability, which Plant productivity in response to elevation could rapidly lead to higher plant and drought productivity (Gilgen et al. 2009, Brilli et al. After the first growing season, plant 2011). productivity, measured as the aboveground Finally, while inherent differences in biomass, was in accordance with productivity were detected between genera, expectations as it decreased with elevation no significant effects of growth forms or and lower temperatures (Fig. 1a). Positive taxonomic and functional groups were warming effects indicate that plant growth is detected. However, across the species’ origin constrained by low temperatures (Körner we detected that on average high elevation 2003). A moderate warming could thus have species always had lower aboveground and beneficial effects on high elevation plant total biomass than mid elevation species. performance and productivity, as suggested This result highlights the fundamental by a meta-analysis of in situ warming differences in growth strategies between experiments with arctic and alpine tundra species from mid and high elevation, with species (Arft et al. 1999) and by a climate high elevation species displaying smaller or chamber warming experiment on three even dwarfed morphologies (Billings et al. grassland species (Frei et al. 2014b). Drought 1968, Körner et al. 1987, Körner 2003), stress, however, had a negative effect on allowing them to better withstand harsh plant productivity, especially for mid alpine conditions (i.e. temperature extremes, elevation species and significantly reduced snow, wind, irradiance etc.). Clearly, our the production of aboveground biomass (Fig. results confirm that these differences in growth form are genetically determined.
58 Chapter 3
Plastic responses of key functional traits to tolerance to prevailing environmental elevation and drought treatment conditions (Wright et al. 2004, Scheepens et Specific leaf area showed substantial al. 2010). phenotypic plasticity after 12 weeks, as The proportion of total biomass allocated indicated by a significant decrease in SLA to belowground structures, measured as the with increasing elevation and drought (Fig. root mass fraction (RMF), only decreased 2a), in accordance with literature (Prock et under drought stress at the mid elevation site, al. 1996, Scheepens et al. 2010, Pang et al. and was unaffected by site elevation in 2011, Poorter et al. 2012a). At both sites, general. This result is counter to predictions, drought stress reduced SLA and the highest as investment in roots usually increases with SLA values were found for leaves of elevation (Körner 2003) and under limited individuals grown under control conditions at soil water availability (Bell et al. 1999, the mid elevation site and lowest values were Heschel et al. 2004, Larcher et al. 2010). found under dry conditions at the high Similarly to our results, Kreyling et al. elevation site. However, SLA values did not (2008), Gilgen et al. (2009), and Backhaus et vary between the dry treatment at mid al. (2014) found small increases or no elevation and the control treatment at high alterations in plant belowground biomass in elevation, possibly implying that response to limited soil water availability. transplantations to the higher site and the While we cannot exclude that some root drought treatment at low elevation exerted material was lost during sampling or comparable pressures on plants, resulting in cleaning, leading to biases in our data, we similar SLA values. Additionally, SLA rather hypothesize that the similar values in values of mid and high elevation species did RMF are due to the fact that root morphology not differ within treatment combinations, differed between treatment combinations. suggesting similar responses to external Körner et al. (1987) showed that with conditions. The decrease in SLA with increasing elevation, investment in fine roots increasing elevation and drought stress can increases, and a similar result was found in be achieved through increases in leaf density response to low water potential (Fraser et al. and/or leaf thickness (Körner 2003, Poorter 1990). Fine roots, which have a thinner et al. 2009). Though we did not measure diameter and are less lignified and suberised these traits separately, Scheepens et al. than coarse roots (Lavelle et al. 2005), (2010) found in Campanula thyrsoides that probably result in less dry weight than leaf thickness significantly decreased with thicker roots and we argue that this elevation and thus explained the decrease in morphological difference could potentially SLA through substantial increases in leaf explain that changes in RMF between site density, leading to smaller cells and more elevations and soil water availability were cells per unit leaf volume. This might also be relatively small. In accordance with true in our case, especially in the event of literature, our results however showed that drought stress, which restricts cell expansion high elevation species generally invested by decreasing internal turgor pressure of the more biomass in belowground structures cells (Sharp et al. 1989, Tardieu et al. 2000). relative to their mid elevation congeners Overall, high plasticity in SLA is highly (Billings et al. 1968, Körner 2003). advantageous as it allows plants to adjust Additionally, among the studied functional growth rate, leaf longevity and stress traits, RMF was the least plastic trait (Piv c.
59 Functional plasticity in mid vs. high elevation species
0.265) and showed particularly little (2014b), where plasticity was reduced in only variation in high relative to mid elevation a single trait (leaf length) in high elevation species, and lesser variation when mid populations of Trifolium montanum. elevation species were grown at the higher Consequently, the magnitude but also the site, indicating the constraints acting on direction of plasticity in key plant traits in allocation patterns at high elevation. response to transplantations and soil water The proportion of total biomass allocated availability in mid and high elevation species to reproductive structures, measured as the was similar, suggesting rather uniform flower mass fraction (FMF) tended to be responses to climate change between these greater for mid elevation species when two groups of species (Frei et al. 2014b). growing at the lower elevation site and for More generally, and contrary to our high elevation species when growing at the hypothesis, phenotypic plasticity did not high elevation site. As the FMF is closely seem to depend on environmental associated with seed production and plant heterogeneity more commonly observed at fitness, these results seem to indicate a home- high elevation (Scherrer et al. 2011). In site advantage of species to the conditions at contrast to the general consensus that their habitat of origin (Joshi et al. 2001, phenotypic plasticity should be selected for Blanquart et al. 2013). Furthermore, drought in heterogeneous environments (Via et al. also increased the allocation to reproductive 1985), other studies also reported no structures for mid and high elevation species differences in plant trait plasticity compared at their respective elevation of origin. These between populations from habitats with results suggest a prioritisation of constant and more variable environmental reproduction at the expense of growth under conditions (Heschel et al. 2004, Franks drought stress. Interestingly, FMF showed 2011). These previous results, in combination the highest plasticity among the studied plant with our study, indicate that increased traits (Piv of 0.56), probably indicating the environmental variation does not necessarily importance of adjusting this trait to lead to a greater degree of functional environmental conditions to maintain fitness plasticity. Two combined factors are homeostasis. predicted to favour selection for phenotypic plasticity: when the rates of environmental Degree of phenotypic plasticity compared change are similar or slower than the between mid and high elevation species response rate of an organism and when said We found very little evidence for change is highly but not completely differences in the degree of phenotypic predictable (Scheiner 1993). In alpine plasticity in key plant traits between mid and environments, change might be rather high elevation species. Only the plasticity in unpredictable and could thus explain why the RMF was marginally smaller for high advantages of being plastic in response to elevation species (Table 4). This indicates environmental heterogeneity do not that high elevation species were less capable necessarily outweigh the costs (i.e. of adjusting the allocation to belowground maintenance, production and information structures to changing external conditions, acquisition cost; DeWitt et al. 1998). probably reflecting their genetically fixed Although no difference was found in higher allocation to below-ground structures. functional plasticity between mid and high Similar results were found by Frei et al. elevation species, some traits were more
60 Chapter 3 plastic than others. Specific leaf area and the Conclusion allocation to reproductive structures (FMF) were highly plastic in response to treatment To conclude, both mid and high elevation combinations, while the allocation to species displayed great functional plasticity belowground structures (RMF) was in key plant traits related to ecophysiological comparatively less plastic, hence more characteristics in response to changing strongly genetically controlled. This result temperatures and soil water availability. As indicates constrained phenotypic plasticity in the direction and magnitude of functional this specific trait, which could be related to plasticity was similar between mid and high potential stabilizing selection acting on elevation species, our results suggest rather allocation patterns at high elevation. uniform responses of these species groups to Constrained plasticity was also found in the climate change. While plasticity in functional reproductive phenology of high elevation traits was highly species and trait specific, species, which was monitored in a parallel the general capacity of species to respond study during the second year of this plastically to environmental changes may experiment (Gugger et al. 2015). offer a short-term strategy to face climate Particularly, high elevation species were less change. plastic than their lower elevation congeners in the timing of peak flowering, suggesting Acknowledgements that adaptation to short growing seasons in alpine environments limits the potential for We thank Samuel Schmid and Michael plasticity of flowering phenology in high Scherer-Lorenzen from the Agroscope, elevation species in response to Switzerland for the loan of the rain-shelters. environmental change (Gugger et al. 2015), We also thank Georg Armbruster, Ayaka and leads to a higher genetic canalization of Gütlin and Guy Villaume for major technical the timing of peak flowering (Price et al. support. This work was supported by the 2003, Pigliucci et al. 2006, Ghalambor et al. Swiss National Science Foundation [project 2007). This however does not seem to apply no. 3100A-135611] to J. Stöcklin. to all functional traits of high elevation species, as we have shown here that SLA and FMF were highly and equally plastic in mid and high elevation species.
References Robinson CH, Starr G, Stenstrom A, Stenstrom M, Totland O, Turner PL, Walker LJ, Webber PJ, Welker JM, Aeschimann L, Lauber K, Moser DM, Theurillat Wookey PA. 1999. Responses of tundra JP. 2004. Flora alpina: Haupt, Bern. plants to experimental warming: Meta- Alpert P, Simms EL. 2002. The relative advantages analysis of the international tundra of plasticity and fixity in different experiment. Ecological Monographs, 69: environments: when is it good for a plant to 491-511. adjust? Evolutionary Ecology, 16: 285-297. Atkin OK, Loveys BR, Atkinson LJ, Pons TL. Arft AM, Walker MD, Gurevitch J, Alatalo JM, 2006. Phenotypic plasticity and growth Bret-Harte MS, Dale M, Diemer M, temperature: understanding interspecific Gugerli F, Henry GHR, Jones MH, variability. Journal of Experimental Botany, Hollister RD, Jonsdottir IS, Laine K, 57: 267-281. Levesque E, Marion GM, Molau U, Backhaus S, Kreyling J, Grant K, Beierkuhnlein C, Molgaard P, Nordenhall U, Raszhivin V, Walter J, Jentsch A. 2014. Recurrent Mild
61 Functional plasticity in mid vs. high elevation species
Drought Events Increase Resistance Toward Flora - Morphology, Distribution, Functional Extreme Drought Stress. Ecosystems, 17: Ecology of Plants, 199: 70-81. 1068-1081. Franks SJ. 2011. Plasticity and evolution in drought Bell DL, Sultan SE. 1999. Dynamic phenotypic avoidance and escape in the annual plant plasticity for root growth in Polygonum: a Brassica rapa. New Phytologist, 190: 249- comparative study. American Journal of 257. Botany: 807-819. Fraser TE, Kuhn Silk W, Rost TL. 1990. Effects of Beniston M, Diaz HF, Bradley RS. 1997. Climatic low water potential on cortical cell length in change at high elevation sites: An overview. growing regions of maize roots. Plant Climatic Change, 36: 233-251. Physiology, 93: 648-651. Beniston M, Rebetez M, Giorgi F, Marinucci MR. Frei ER, Ghazoul J, Matter P, Heggli M, Pluess 1994. An analysis of regional climate change AR. 2014a. Plant population differentiation in Switzerland. Theoretical and Applied and climate change: responses of grassland Climatology, 49: 135-159. species along an elevational gradient. Global Billings WD, Mooney HA. 1968. Ecology of arctic Change Biology, 20: 441-455. and alpine plants. Biological Reviews of the Frei ER, Ghazoul J, Pluess AR. 2014b. Plastic Cambridge Philosophical Society, 43: 481- Responses to Elevated Temperature in Low 529. and High Elevation Populations of Three Blanquart F, Kaltz O, Nuismer SL, Gandon S. Grassland Species. PLoS ONE, 9. 2013. A practical guide to measuring local Ghalambor CK, McKay JK, Carroll SP, Reznick adaptation. Ecology Letters, 16: 1195-1205. DN. 2007. Adaptive versus non-adaptive Bloom AJ, Chapin FS, Mooney HA. 1985. Resource phenotypic plasticity and the potential for limitation in plants - an economic analogy. contemporary adaptation in new Annual Review of Ecology and Systematics, environments. Functional Ecology, 21: 394- 16: 363-392. 407. Bloor JMG, Pichon P, Falcimagne R, Leadley P, Gilgen AK, Buchmann N. 2009. Response of Soussana J-F. 2010. Effects of Warming, temperate grasslands at different altitudes to Summer Drought, and CO2 Enrichment on simulated summer drought differed but Aboveground Biomass Production, scaled with annual precipitation. Flowering Phenology, and Community Biogeosciences: 2525-2539. Structure in an Upland Grassland Ecosystem. Grime JP. 2001. Plant Strategies, Vegetation Ecosystems, 13: 888-900. Processe, and Ecosystem Properties Bradshaw AD. 1965. Evolutionary significance of Chichester, England: John Wiley & Sons, phenotypic plasticity in plants. Advances in LTD. Genetics, 13: 115-155. Gugger S, Kesselring H, Stoecklin J, Hamann E. Briggs D, Walters SM. 1997. Plant variation and 2015. Lower plasticity exhibited by high- evolution: University Press, Cambridge, versus mid elevation species in their United Kingdom. phenological responses to manipulated Brilli F, Hörtnagl L, Hammerle A, Haslwanter A, temperature and drought. Annals of Botany, Hansel A, Loreto F, Wohlfahrt G. 2011. in press. Leaf and ecosystem response to soil water Hartmann DL, Klein Tank AMG, Rusticucci M, availability in mountain grasslands. Alexander LV, Brönnimann S, Charabi Y, Agricultural and Forest Meteorology: 1731- Dentener FJ, Dlugokencky EJ, Easterling 1740. DR, Kaplan A, Soden BJ, Thorne PW, Clausen J, Keck WM, Hiesey WM. 1941. Regional Wild M, Zhai PM. 2013. Observations: differentiation in plant species. American Atmosphere and Surface. In: Climate Change Naturalist, 75: 231-250. 2013: The Physical Sciences Basis. Cleland EE, Chiariello NR, Loarie SR, Mooney Contribution of Working Group I to the Fifth HA, Field CB. 2006. Diverse responses of Assessment Report of the Intergovernmental phenology to global changes in a grassland Panel on Climate Change.[Stocker TF, ecosystem. Proceedings of the National D.Qin, G.-K. Plattner, M. Tignor, S.K. Allen, Academy of Sciences of the United States of J. Boschung, A. Nauels, Y. Xia, V. Bex and America, 103: 13740-13744. P.M. Midgley (eds)]. Cambridge University Crawley MJ. 2007. Proportion Data. In: The R Book. Press, Cambridge, United Kingdom and New West Sussex, England: John Wiley & Sons. York, NY, USA. DeWitt TJ, Sih A, Wilson DS. 1998. Costs and limits Heschel MS, Sultan SE, Glover S, Sloan D. 2004. of phenotypic plasticity. Trends in Ecology & Population differentiation and plastic Evolution, 13: 77-81. responses to drought stress in the generalist Fabbro T, Körner C. 2004. Altitudinal differences in annual Polygonum persicaria. International flower traits and reproductive allocation. Journal of Plant Sciences, 165: 817-824.
62 Chapter 3
Hothorn T, Bretz F, Westfall P, Heiberger RM, A. Larcher W, Kainmueller C, Wagner J. 2010. S. 2014. Simultaneous Inference in General Survival types of high mountain plants under Parametrics Models. Biometrical Journal, 50: extreme temperatures. Flora, 205: 3-18. 346-363. Lauber K, Wagner G. 2001. Flora Helvetica: Haupt, Huang Y, Zhao X, Zhou D, Wang T, Li G, Li Q. Bern. 2013. Biomass allocation to vegetative and Lavelle P, Spain A. 2005. Soil Ecology. Netherlands: reproductive organs of Chenopodium Springer. acuminatum Willd. under soil nutrient and Lavorel S, Garnier E. 2002. Predicting changes in water stress. Bangladesh Journal of Botany, community composition and ecosystem 42: 113-121. functioning from plant traits: revisiting the Joshi J, Schmid B, Caldeira MC, Dimitrakopoulos Holy Grail. Functional Ecology, 16: 545-556. PG, Good J, Harris R, Hector A, Huss- Ma WL, Shi PL, Li WH, He YT, Zhang XZ, Shen Danell K, Jumpponen A, Minns A, Mulder ZX, Chai SY. 2010. Changes in individual CPH, Pereira JS, Prinz A, Scherer- plant traits and biomass allocation in alpine Lorenzen M, Siamantziouras ASD, Terry meadow with elevation variation on the AC, Troumbis AY, Lawton JH. 2001. Qinghai-Tibetan Plateau. Science China-Life Local adaptation enhances performance of Sciences, 53: 1142-1151. common plant species. Ecology Letters, 4: MeteoSwiss. 2014. Federal Office of Meteorology 536-544. and Climatology MeteoSwiss. MeteoSwiss. Kerner A. 1895. The natural history of plants, their Nicotra AB, Atkin OK, Bonser SP, Davidson AM, forms, growth, reproduction and distribution. Finnegan EJ, Mathesius U, Poot P, London: Blackie: Translated and edited by F. Purugganan MD, Richards CL, Valladares W. Oliver. F, van Kleunen M. 2010. Plant phenotypic Körner C. 2003. Alpine plant life: functional plant plasticity in a changing climate. Trends in ecology of high mountain ecosystems. Plant Science, 15: 684-692. Germany: Springer Verlag. Pang JY, Yang JY, Ward P, Siddique KHM, Körner C, Renhardt U. 1987. Dry-matter Lambers H, Tibbett M, Ryan M. 2011. partitioning and root length leaf-area ratios in Contrasting responses to drought stress in herbaceous perrenial plants with diverse herbaceous perennial legumes. Plant and altitudinal distribution. Oecologia, 74: 411- Soil, 348: 299-314. 418. Parmesan C, Yohe G. 2003. A globally coherent Kovats RS, Valentini R, Bouwer LM, fingerprint of climate change impacts across Georgopoulou E, Jacob D, Martin E, natural systems. Nature, 421: 37-42. Rounsevell M, Soussana J-F. 2014. Europe. Perez-Harguindeguy N, Diaz S, Garnier E, Lavorel In: Climate Change 2014: Impacts, S, Poorter H, Jaureguiberry P, Bret-Harte Adaptation, and vulberability. Part B: MS, Cornwell WK, Craine JM, Gurvich Regional Aspects. Contribution of Working DE, Urcelay C, Veneklaas EJ, Reich PB, Group II to the Fifth Assessment Report of Poorter L, Wright IJ, Ray P, Enrico L, the Intergovernmental Panel on Climate Pausas JG, de Vos AC, Buchmann N, Change.[Barros VR, C.B. Field, D.J. Dokken, Funes G, Quetier F, Hodgson JG, M.D. Mastrandrea, K.J. Mach, T.E. Bilir, M. Thompson K, Morgan HD, ter Steege H, Chatterjee, K.L. Ebi, Y.O. Estrada, R.C. van der Heijden MGA, Sack L, Blonder B, Genova, B. Girma, E.S. Kissel, A.N. Levy, S. Poschlod P, Vaieretti MV, Conti G, Staver MacCracken, P.R. Mastrandrea, and L.L. AC, Aquino S, Cornelissen JHC. 2013. White (eds.)]. Cambridge University Press, New handbook for standardised measurement Cambridge, United Kingdom and New York, of plant functional traits worldwide. NY, USA. Australian Journal of Botany, 61: 167-234. Kreyling J, Wenigmann M, Beierkuhnlein C, Peterson KM, Billings WD. 1982. Growth of alpine Jentsch A. 2008. Effects of extreme weather plants under controlled drought. Arctic and events on plant productivity and tissue die- Alpine Research, 14: 189-194. back are modified by community Pigliucci M, Murren CJ, Schlichting CD. 2006. composition. Ecosystems, 11: 752-763. Phenotypic plasticity and evolution by Kuznetsova A, Brockhoff PB, Christensen RHB. genetic assimilation. Journal of Experimental 2013. lmerTest: Tests for random and fixed Biology, 209: 2362-2367. effects for linear mixed effect models (lmer Poorter H, Niinemets U, Poorter L, Wright IJ, objects of lme4 package) http://cran.r- Villar R. 2009. Causes and consequences of project.org/package=lmerTest. variation in leaf mass per area (LMA): a Lambers H, Chapin FS, Pons TL. 1998. Plant meta-analysis. New Phytologist, 182: 565- physiological ecology. New York, NY, USA: 588. Springer.
63 Functional plasticity in mid vs. high elevation species
Poorter H, Niklas KJ, Reich PB, Oleksyn J, Poot P, Stress. Cambridge, UK: Mommer L. 2012. Biomass allocation to CambridgeUniversity Press. leaves, stems and roots: meta-analyses of Sultan SE. 1987. Evolutionary implications of interspecific variation and environmental phenotypic plasticity in plants. Evolutionary control. New Phytologist, 193: 30-50. Biology, 21: 127-178. Poorter H, Sack L. 2012. Pitfalls and possibilities in Tardieu F, Reymond M, Hamard P, Garnier C, the analysis of biomass allocation patterns in Muller B. 2000. Spatial distributions of plants. Frontiers in Plant Science, 3. expansion rate and cell size in öaize leaves: a Price TD, Qvarnstrom A, Irwin DE. 2003. The role synthesis of the effect of soil water status, of phenotypic plasticity in driving genetic evaporative demand and temperature. evolution. Proceedings of the Royal Society Journal of Experimental Biology, 51: 1505- of London Series B-Biological Sciences, 270: 1514. 1433-1440. Theurillat JP, Guisan A. 2001. Potential impact of Prock S, Körner C. 1996. A Cross-Continental climate change on vegetation in the European Comparison of Phenology, Leaf Dynamics Alps: A review. Climatic Change, 50: 77- and Dry Matter Allocation in Arctic and 109. Temperate Zone Herbaceous Plants from Thompson JD. 1991. Phenotypic plasticity as a Contrasting Altitudes. Ecological Bulletins: component of evolutionary change. Trends in 93-103. Ecology & Evolution, 6: 246-249. Rautiainen P, Koivula K, Hyvärinen M. 2004. The Valladares F, Sanchez-Gomez D, Zavala MA. 2006. effect of within-genet and between-genet Quantitative estimation of phenotypic competition on sexual reproduction and plasticity: bridging the gap between the vegetative spread in Potentilla anserina ssp. evolutionary concept and its ecological egedii. Journal of Ecology, 92: 505-511. applications. Journal of Ecology, 94: 1103- Richter S, Kipfer T, Wohlgemuth T, Guerrero CC, 1116. Ghazoul J, Moser B. 2012. Phenotypic van Kleunen M, Fischer M. 2005. Constraints on the plasticity facilitates resistance to climate evolution of adaptive phenotypic plasticity in change in a highly variable environment. plants. New Phytologist, 166: 49-60. Oecologia, 169: 269-279. Via S, Lande R. 1985. Genotype-environment Scheepens JF, Frei ES, Stöcklin J. 2010. Genotypic interaction and the evolution of phenotypic and environmental variation in specific leaf plasticity. Evolution, 39: 505-522. area in a widespread Alpine plant after Vitasse Y, Hoch G, Randin CF, Lenz A, Kollas C, transplantation to different altitudes. Scheepens JF, Korner C. 2013. Elevational Oecologia, 164: 141-150. adaptation and plasticity in seedling Scheiner SM. 1993. Genetics and evolution of phenology of temperate deciduous tree phenotypic plasticity. Annual Review of species. Oecologia, 171: 663-678. Ecology and Systematics, 24: 35-68. Wright IJ, Reich PB, Westoby M, Ackerly DD, Scherrer D, Körner C. 2011. Topographically Baruch Z, Bongers F, Cavender-Bares J, controlled thermal-habitat differentiation Chapin T, Cornelissen JHC, Diemer M, buffers alpine plant diversity against climate Flexas J, Garnier E, Groom PK, Gulias J, warming. Journal of Biogeography, 38: 406- Hikosaka K, Lamont BB, Lee T, Lee W, 416. Lusk C, Midgley JJ, Navas ML, Niinemets Schlichting CD. 1986. The evolution of phenotypic U, Oleksyn J, Osada N, Poorter H, Poot P, plasticity in plants. In: Johnston, R. F. Prior L, Pyankov VI, Roumet C, Thomas Sharp RE, Davies WJ. 1989. Regulation of growth SC, Tjoelker MG, Veneklaas EJ, Villar R. and development of plants growing with a 2004. The worldwide leaf economics restricted supply of water. edited by Jones spectrum. Nature, 428: 821-827. HG, Flowers TJ, Jones MB. In: Plants Under
64 Chapter 3
Supplementary data
Table S1: Mean ± SE of aboveground biomass, total biomass, SLA, RMF and FMF reported for the species groups (mid elevation and high elevation species) and treatment combinations: A (low site/control), B (low site/dry), C (high site/control), D (high site/dry).
Treatment combinations Species group A B C D Mid elevation 2.99 ± 2.42 ± 1.53 ± 1.32 ± Aboveground biomass species 0.07 0.05 0.03 0.02 (g) High elevation 1.71 ± 1.51 ± 1.07 ± 0.91 ± species 0.04 0.04 0.03 0.02 Mid elevation 11.65 ± 14.15 ± 15.82 ± 10.45 ± species 0.50 0.38 0.45 0.31 Total biomass (g) High elevation 10.26 ± 9.91 ± 11.51 ± 7.75 ± species 0.74 0.38 0.38 0.21 Mid elevation 25.59 ± 0. 20.19 ± 18.73 ± 16.55 ± Specific leaf area species 23 0.13 0.12 0.12 (mm2.mm-1) High elevation 25.74 ± 18.67 ± 19.47 ± 15.86 ± species 0.35 0.17 0.21 0.14 Mid elevation 0.28 ± 0.19 ± 0.24 ± 0.26 ± species 0.007 0.004 0.006 0.005 Root mass fraction High elevation 0.34 ± 0.23 ± 0.26 ± 0.27 ± species 0.009 0.005 0.006 0.006 Mid elevation 0.11 ± 0.17 ± 0.10 ± 0.13 ± species 0.004 0.004 0.004 0.005 Flower mass fraction High elevation 0.09 ± 0.13 ± 0.11 ± 0.16 ± species 0.003 0.003 0.003 0.004
65 Functional plasticity in mid vs. high elevation species
66 Chapter 4
Chapter 4
Past selection explains differentiation in flowering phenology of nearby populations of a common alpine plant
Halil Kesselring*, G.F.J. Armbruster, Elena Hamann, and Jürg Stöcklin *H. Kesselring is the corresponding author.
Alpine Botany (2015) 125:113-124 DOI: 10.1007/s00035-015-0157-z, available online at www.springer.com
67 Divergent selection in flowering phenology in A. vulneraria
68 Chapter 4
Past selection explains differentiation in flowering phenology of nearby populations of a common alpine plant.
Halil Kesselring*, Georg F. J. Armbruster, Elena Hamann, Jürg Stöcklin
Department of Environmental Sciences, Section Plant Ecology, University of Basel, Schönbeinstrasse 6, CH-4056 Basel, Switzerland
* For correspondence: [email protected]
Abstract
• The timing of and relative investment in reproductive events are crucial fitness determinants for alpine plants, which have limited opportunities for reproduction in the cold and short growing seasons at high elevations. We use the alpine Anthyllis vulneraria to study whether flowering phenology and reproductive allocation have been under diversifying selection, and to assess genetic diversity and plastic responses to drought in these traits. • Open-pollinated maternal families from three populations in each of two regions from the Swiss Alps with contrasting precipitation were grown in low and high soil moisture in a common garden. We measured onset, peak, and end of flowering, as well as vegetative and reproductive aboveground biomass. Population differentiation for each character (QST) was compared to differentiation at neutral microsatellite loci (FST) to test for past selection. • We found population differentiation in onset and peak of flowering which results from natural selection according to QST-FST. End of flowering and biomass were not significantly differentiated among populations. Reduced soil moisture had no consistent effect on mean onset of flowering, and advanced peak and end of flowering by less than one week. Reproductive biomass was strongly decreased by lowered soil moisture. No genetic variation within or among populations was found for plasticity in any trait measured. • The results suggest past heterogeneous selection on onset and peak of flowering in alpine Anthyllis vulneraria and potentially indicate local adaptation to differences in snowmelt date over distances < 5 km. Limited variation in plastic responses to reduced soil moisture suggests that soil moisture might not vary between populations.
Keywords: Local adaptation; QST-FST comparison; phenotypic plasticity; drought
69 Divergent selection in flowering phenology in A. vulneraria
Introduction snowmelt (Hülber et al. 2006). Among animal-pollinated plant species, the Evolution by means of divergent natural phenology and allocation of reproductive selection in spatially heterogeneous effort must also be coordinated with environments is considered the major cause pollinator abundances and behaviour (Müller of phenotypic variation (Linhart and Grant 1881; Kudo 1996). Temperature and the date 1996; Schluter 2009). Apart from divergent of snowmelt at high elevations are subject to natural selection, phenotypic variation among strong microhabitat effects, which may populations can also result from genetic drift outweigh elevational effects of a few – random variation in allele frequencies hundred meters (Scherrer and Körner 2010; eventually resulting in the fixation of alleles Wheeler et al. 2014). Therefore the tight in some populations and their extinction in links of temperature and snowmelt with other populations (Wright 1931). phenology and pollinator behaviour Furthermore, population differentiation may (Bergman et al. 1996) is expected to result in result from the expression of different strong population differentiation in flowering phenotypes by the same genotypes in phenology. The sensitivity of flowering different environments, a phenomenon phenology to external conditions can further referred to as phenotypic plasticity facilitate reproductive isolation via (Bradshaw 1965). In alpine plants, both local asynchronous flowering time and therefore adaptation and phenotypic plasticity have promote differentiation and local adaptation been hypothesized particularly important due (Linhart and Grant 1996; Hall and Willis to the steep environmental gradients across 2006; Hülber et al. 2010). short geographical distances. On the other Contrarily, the evolution of phenotypic hand, populations of alpine plants are plasticity is expected when genotypes or frequently small owing to the highly lineages are likely to experience various structured landscape, thereby intensifying external conditions due to high spatial or genetic drift. The relative significance of temporal environmental heterogeneity genetic drift, local adaptation, and plasticity (Sultan and Spencer 2002). Flowering for population differentiation in alpine phenology is an inherently plastic trait that is environments, however, is a question that strongly environmentally controlled through remains insufficiently answered (Leimu and temperature, photoperiod, or both (Keller and Fischer 2008; Frei et al. 2014). Körner 2003). Phenotypic plasticity can slow The timing of reproductive events and the the response to selection when genetic allocation of resources to reproduction are variation in plasticity exists in a population, particularly crucial fitness determinants in i.e. when all genotypes in the population do the highly seasonal alpine environments not respond to environmental change in the (Rathcke and Lacey 1985; Ozenda 1995; same way. Natural selection then cannot Körner 2003). As temperature decreases operate on trait means as efficiently as when along rising elevation with 0.55 °C/100 m, environments and phenotypes are stable, the snow free period and the time window for because the same genotype does not have reproduction narrow down (Schroeter 1923). highest fitness under all conditions (Via and At high elevations, flowering phenology is Lande 1985). The question, whether mean therefore tightly linked to the date of flowering time is subject to divergent selection among populations in the highly
70 Chapter 4 variable alpine landscape remains rarely heterogeneous selection across environments. addressed (Scheepens et al. 2011; Scheepens If QST = FST, we have no reason to infer a and Stöcklin 2013; Frei et al. 2014). role of selection as drift alone can explain the Besides temperature and photoperiod, observed population differentiation. We also reproductive characters such as reproductive assess plastic responses to drought in allocation are likely to respond to soil water reproductive allocation and phenology by availability (Caruso 2006, and references subjecting plants to two soil moisture therein), because flowering incurs substantial treatments in a common garden. We asked (i) water costs to the plant. The transpirational if population differentiation in reproductive water loss of flowers can exceed that of allocation and flowering phenology is likely leaves (Galen et al. 1999; Lambrecht 2013). the result of past selection and therefore Alpine plants often have big flowers relative adaptive evolution, and (ii) if soil moisture to the vegetative body (Körner 2003). availability has an effect on reproductive Disproportionately large flowers therefore allocation and phenology (i.e. presence of might further raise water costs. Under phenotypic plasticity). drought, plants produce smaller flowers and smaller reproductive structures in general Methods (Mal and Lovett-Doust 2005; Caruso 2006), and were also found to advance flowering Study species phenology as a plastic as well as an Anthyllis vulneraria L. sensu lato (s.l.) is a evolutionary response (Dunne et al. 2003; polymorphic fabacean taxon with unclear Franks 2011). Precipitation is very variable infraspecific classification (Nanni et al. 2004; across the European Alps as a result of the Köster et al. 2008), and consists of a self- interplay of climatic patterns with the compatible clade of short-lived herbaceous obstructing effect of mountain ranges. This plant species very common throughout leads to regions of particularly low Europe. It grows preferably on calcareous precipitation in the deep valleys inside the meadows and scree grounds from sea level to highest mountain ranges (Ozenda 1985). the alpine belt up to around 3000 m a.s.l. Here we use comparisons of quantitative (Hegi 1975). Here we examined three alpine trait differentiation and genetic populations of Anthyllis vulneraria in each of differentiation at neutral marker loci (QST-FST two regions in the Swiss Alps. Plants grow to comparisons; Spitze 1993) to test for the role a height of around 15-45 cm. A variable of past selection in shaping patterns of number of shoots sprout from the basal leaf population differentiation in reproductive rosette, each bearing 2-6 inflorescences. Each allocation and phenology in a common alpine inflorescence comprises a number of 7-19 herb. QST-FST comparisons allow to infer mm long white to yellow, sometimes claret natural selection as opposed to random to red flowers arranged in a capitulum (Hegi processes such as genetic drift as a cause of 1975; Navarro 1999). Shoots are usually population differentiation when QST is either unbranched, but may have up to three side- significantly smaller or larger than FST. QST branches originating from the axils of evenly values smaller than FST values indicate pinnate compound leafs. Leafs of the basal stabilizing selection across environments, rosette consist of the enlarged terminal leaflet whereas QST’s larger than FST indicate of a compound leaf. Anthyllis vulneraria is population divergence as a result of representative of a type of fabacean flower
71 Divergent selection in flowering phenology in A. vulneraria characterized by a pump mechanism adapted (1975). Seeds were stored in the refrigerator to insect-mediated pollination (Müller 1881). until they were scarified and sown in early Flower development of Anthyllis vulneraria August 2013 directly into their final high takes approximately 4 weeks. Flowers ripen mineral potting soil mixture (210 l Ökohum from bottom to top along a shoot and from Anzuchterde® with 14 l sand and 8 kg top to bottom within a capitulum. pumice). 5 individuals per seed family, and 6 Asynchronous flower ripening allows for seed families per population were used (180 geitonogamous selfing across capitulae, but individuals in total). Seedlings were kept in suggests multiple paternity per maternal the greenhouse in 10 by 10 cm pots and offspring. Microsatellite analyses found a watered ad libitum. Plants were randomized variable degree of inbreeding in the studied twice per week. Greenhouse heating and populations (FIS 0 - 0.42, unpublished cooling systems were set so that temperatures results), suggesting regular outcrossing. A would not fall below 16 °C and 8 °C at day single flower is open and accessible to and night, respectively, nor exceed 20 °C and pollinators for about 6 to 7 days and 10 °C at day and night, respectively. Early produces a single seed. leaf size was measured on every individual as length*width/2 of the first true leaf as soon Experimental procedures as it was fully developed (2 leaf stage). After In August 2012, seeds from open- 4.5 weeks, on 11-Sep-2013, seedlings were pollinated wild flowers in three populations potted into larger 2 l pots into the same soil from each of two regions (eastern and mixture and watered to carrying capacity. At western Swiss Alps near Davos and Zermatt, the same time, plants were moved to the respectively) were sampled (Table 1; Online outside garden under a UV-B transmissible Resource 1). The offspring of the same rain shelter (folitec Agrarfolien-Vertriebs maternal plant are referred to throughout the GmbH, Westerburg, Germany) and arranged article as seed family. Members of a seed in a regular array, alternating between family presumably are mostly half-sibs, as individuals of all levels of hierarchy from populations are outcrossed, and the seed family to region. Eleven days later, on asynchronous ripening of flowers within a the 22-Sep-2013, treatment began by capitulum makes it unlikely that they are watering plants designated for the wet sired by the same father (Pannell and treatment. Alternating between seed families, Labouche 2013). Populations are situated 3 or 2 of the 5 individuals per seed family between 2000 m a.s.l. and 2650 m a.s.l. were allocated to the dry treatment. Distances between populations within Subsequently, volumetric soil moisture regions range from 2 km to 18 km, and content was monitored with a moisture meter regions are 180 km apart. Regions were calibrated to the soil mixture used in the specifically chosen for their difference in experiment and plants were watered growing season precipitation, with the Davos accordingly (HH2 Moisture Meter with Theta region getting approximately 50% more Probe ML2x, Delta-T Devices Ltd. precipitation in the months of June through Cambridge, England). Wet plants were September than the Zermatt region (Table 1; watered when mean soil moisture fell below Zimmermann and Kienast 1999). We have 18 %, and dry plants when soil moisture fell identified populations as belonging to below 5 %. Ten different plants of each Anthyllis vulneraria ssp. alpestris after Hegi treatment were randomly chosen each time at
72 Chapter 4 irregular intervals for soil moisture Once reproductive shoots became visible, measurements (Online Resource 2). Plants plants were checked daily and the date of the were sitting on a thick sand bed and following critical stages of flowering marginally striked roots into the sand 2cm phenology were noted for each individual: i) deep at maximum. Throughout the duration onset of flowering defined as the date when of the experiment, air temperature was the first flower opened on an individual; ii) logged hourly with a TidbiT® v2 peak of flowering defined as the date at Temperature Logger (Onset Computer which the maximum number of open flowers Corporation, Bourne, Massachusetts, U.S.A.; was observed; iii) end of flowering defined as Online Resource 3). The logger was hung-up the date when the last flower opened and no under a reversed 2 l plastic flowerpot painted more flower buds were visible. Flower in white and with perforation to allow air opening is very easily observed in Anthyllis circulation. All plants were preventively vulneraria when the brightly coloured corolla treated with a ready-to-use fungicide powder appears from the calyx, a process that takes (Maag Pirox®, Syngenta Agro AG, less than 24 hours. Onset of flowering was Dielsdorf, Switzerland) on a few occasions always a representative measure because the during growth phase, because alpine opening of the first flower was never an Anthyllis vulneraria is susceptible to mildew isolated event, but led to the onset of when grown at low elevations. Anthyllis flowering of the whole plant. vulneraria needs vernalisation to induce Once a plant had reached the flower end, flowering (Halil Kesselring, personal aboveground biomass was harvested and observation), so we left plants outside over dried at 75 °C for 72 hours. Aboveground winter. During winter, from 19-Nov-2013 biomass was then separated into the onwards, the rain shelter was temporarily vegetative leaf rosette and into reproductive removed and water treatment was suspended. parts, and weighed to the nearest mg. We Treatment was re-established on the 19-Mar- also estimated reproductive allocation as the 2014 by watering with 100ml and 60ml for ratio of reproductive biomass over total wet and dry plants, respectively, and aboveground biomass. subsequently continued as described above.
Table 1 Coordinates (Swiss coordinate system LV03), elevation, and mean monthly precipitation during the growing season (June – September) of the six populations of Anthyllis vulneraria studied in the common garden. Precipitation data is interpolated from monthly precipitation data using a digital elevation model (Zimmermann and Kienast 1999). Region Population Coordinates Elevation Summer precipitation (°E/°N) (m a.s.l.) (mm) Davos Schiahorn 780513.385/187874.756 2650 1463 Casanna 782301.543/192247.969 2320 1454 Monstein 779685.630/173389.160 2010 1225 Zermatt Findelwald 626828.986/95475.764 2170 809 Findelgletscher 629173.611/95175.270 2490 939 Stafelalp 619094.320/94427.436 2280 898
73 Divergent selection in flowering phenology in A. vulneraria
Statistical analyses P-values, mean squares, and chi-square We performed separate linear mixed- values that correspond to those from the effects models for each of our flowering model comparisons using the step function in phenology variables and for the biomass lmerTest (i.e. likelihood-ratio tests). All variables in R version 3.0.2 (R Development random terms were specified as simple scalar Core Team 2008). In these models, water terms. Phenological variables were analysed treatment and region as well as their as date objects. Contrasts for fixed effects interaction were included as fixed effects, were tested using differences of least squares and population and seed family and their means as implemented in the step function of interactions with water treatment were lmerTest. included as random terms. Each seed family was given a unique identifier, which leads to Molecular analyses the models implicitly nesting seed family in 20 individuals per population were scored population. Likewise, population was nested for amplified fragments at 9 microsatellite in region. In these models, a significant loci. We used Spreadex® gels and the water treatment effect indicates that soil ORIGINS electrophoresis unit (Elchrom moisture availability has an effect on either Scientific AG, Cham, Switzerland) to flowering phenology or aboveground separate PCR amplicons with size differences biomass allocation, i.e. the focal trait is as small as 2bp. Gels were stained with plastic in response to soil moisture. A ethidium-bromide and scored by hand significant interaction between water comparing against the M3 ladder from treatment and region indicates that ELCHROM. Polymorphic microsatellites populations from both regions differ in their were developed to be suitable in length for plastic responses to soil water availability. analysis on Spreadex® gels (Kesselring et al. Analogously, a significant seed family effect 2013). PCR programs were run in a indicates that related individuals are more Mastercycler Gradient (Eppendorf, Hamburg, similar to each other in the focal trait Germany). 35 cycles with denaturation for 30 expression than randomly grouped s at 95°C, start PCR for 30 s at 95°C, locus- individuals, and an interaction of seed family specific annealing temperature (50 or 52°C) with water treatment indicates genetic for 45 s, followed by 45 s at 72°C were variation in phenotypic plasticity among seed repeated. Termination was set to 72°C for 8 families within populations. In order to min. A detailed description of the control for maternal effects to the maximum microsatellite development and loci possible extent, early leaf size description can be found in Kesselring et al. (length*width/2) was included in all models (2013). The free software FreeNA (Chapuis as covariate. Statistical models were and Estoup 2007) was used to check for null computed with the lmerTest package alleles. Null alleles were suggested for (Kuznetsova 2013). lmerTest applies F-tests several loci, but taking their frequencies into to lmer objects of the lme4 package for fixed account resulted in nearly identical FST effects and likelihood-ratio tests for random estimates for each locus except locus 8. effects using stepwise model reduction and Mean FST was slightly lower with null alleles comparisons. We used type 3 errors and taken into account, therefore inclusion of null
Satterthwaite approximations for alleles would render tests of QST > FST less denominator degrees of freedom. We report conservative. Since a low degree of
74 Chapter 4 inbreeding is suggested by the data and the (Guillaume and Rougemont 2006) was used floral biology of Anthyllis vulneraria, and to calculate Weir and Cockerham’s since blank lanes (homozygote null alleles) coefficients a,b, and c for each of the 8 were only present at locus 8, we are microsatellite loci as a basis to estimate confident that increased homozygosity at all Wright’s FST (Weir and Cockerham 1984). but one locus is not due to null alleles, but Whitlock and Guillaume (2009) provide an R results from bi-parental inbreeding and script for a nonparametric bootstrap of FST selfing. Estimation of null alleles rests on values, which was used to generate 103 untested assumptions (e.g. a single null allele bootstrap replicates of FST, from which a is present) and is not free of bias (Chapuis probability distribution of FST was and Estoup 2007; David et al. 2007). constructed. The script calculates FST’s by Consequently, we preferred to remove the randomly sampling with replacement from outlier locus with clear signals of null alleles the Weir and Cockerham coefficients instead of including null allele frequencies calculated by Nemo a number of times for final analyses. Genotyping error was equivalent to the number of loci used in the estimated at 2.5 % (Kesselring et al. 2013). analyses. The QST replicates were calculated Population pairwise FST-values were by parametric bootstrapping using the calculated in GenAlEx (Peakall and Smouse Lewontin-Krakauer distribution and the 2006) based on allele frequencies. observed within-population variances and
Probabilities of finding the observed FST- observed FST according to Whitlock and values are based on comparison of the Guillaume (2009). For the calculation of observed value against 999 random QST’s, we used Spitze’s (1993) formula, permutations of the samples. estimating within-population variances as 4 times the seed family variance components,
QST-FST comparison and among-population variance as the QST-FST comparisons were performed for population variance components from the all traits to test whether population statistical models. Some degree of inbreeding differentiation in quantitative traits is the is indicated in 5 of the studied populations by result of natural selection. We followed the heterozygote deficiencies. Therefore the method described by Whitlock and assumption of half-sibs may not always hold,
Guillaume (2009), which provides a and render tests of QST>FST too conservative powerful significance test of the hypothesis and those of QST FST, this null-distribution is the expected We only report results assuming half-sibs as distribution of QST-FST under neutral this is the more realistic and more evolution of the trait. The tail probability of conservative assumption. We used the the observed QST-FST under the assumption minimal adequate models resulting from of neutral evolution is then calculated from stepwise model reduction as implemented in the null-distribution. the step function of lmerTest for estimation The software Nemo version 2.2.0 of all variance components used in the QST- 75 Divergent selection in flowering phenology in A. vulneraria FST comparisons. The entire sample across selection as a driver of population evolution. both treatments was used for analyses to Variance components analysis of the random achieve reasonable sample sizes. If the terms revealed that large amounts of minimal model did not include population or variability in vegetative and reproductive seed family those terms were re-included as aboveground biomass were explained by they are necessary for calculations of QST. seed family (31% and 22%, respectively; Table 3), indicating high within-population Results genetic diversity. The two regions were significantly In the experimental garden, global mean differentiated for all stages of reproductive peak flowering was on the 25-April-2014. phenology (Table 3). All populations from Peak flowering in the natural stands of these Zermatt flowered later than any of the populations is roughly in the last week of populations from Davos, and the difference June (Halil Kesselring, personal in peak flowering date between the first observation). Therefore, plants in this population from Davos and the last one from experiment flowered approximately 2 months Zermatt was more than 5 weeks (Fig. 1). earlier than the natural stands, equalling a 1h Significant population differentiation within 45 min shorter photoperiod. All populations regions was indicated by the statistical were significantly differentiated at models for onset and peak of flowering, but microsatellite loci from one another (average not for end of flowering (Fig. 1; Table 3). FST = 0.079, 95% CI: [0.063, 0.098]) except Observed QST’s ranged from 0.020 for end of populations Stafelalp and Findelwald (Table flowering to 0.353 for peak flowering (Fig. 2). Mean pairwise population differentiation 2). The observed QST-FST value for end of within regions (FST=0.04) was lower than flowering fell within the 95%-confidence mean pairwise population differentiation limit of the corresponding null-distribution across regions (FST=0.08, Table 2). (P=0.984), and therefore differentiation in this trait can be explained by drift alone. QST- Effects of origin on allocation of biomass FST values for onset and peak of flowering and phenology were greater than expected under the null- Differentiation at the regional level was hypothesis and appeared in the tail of the only indicated for vegetative biomass and corresponding null-distributions with an reproductive allocation (ratio of reproductive associated probability of finding the observed biomass over total aboveground biomass), value or one that is greater of 0.002 and but not for reproductive biomass by 0.001, respectively. Therefore, divergent statistical analyses (Table 3). Populations selection is indicated for onset and peak of nested within region were not significantly flowering. The observed FST as inferred from differentiated for biomass traits (Table 3), the microsatellite data was 0.079 (95% CI: with observed QST’s of 0.074 and 0.11 for [0.063, 0.098]) averaged over all loci. vegetative and reproductive biomass, Genetic variation within populations was respectively. Accordingly, observed QST-FST indicated for all phenological variables by values fell within the 95%-confidence limit significant seed family terms (Table 3). Seed of the corresponding null-distributions for family explained 10%, 11%, and 37%, of the both vegetative (P=0.666) and reproductive variability in the random terms for onset, biomass (P=0.429), giving no reason to infer peak, and end of flowering, respectively. 76 Chapter 4 P ns ns ns ns ns *** *** *** 2 χ 0 0 0.71 7.79 0.27 0.88 F/ 12.20 23.18 1 1 1 1 df na na na na End of flowering * * P ns ns ns ns ** *** riate riate to control for 2 χ 0 1.29 8.54 4.36 0.03 0.29 F/ 21.37 12.35 values values for random effects. - 2 1 1 1 1 df na na na na χ Peak of flowering Peak P ns ns ns ns ns ** ** ** 2 8 χ 0 0 0.02 8.40 0.09 0.24 8.5 F/ 17.51 1 1 1 1 df na na na na Onset of flowering * * * P ns ns ns *** *** - 0.001 0.001 0.001 0.001 0.450 Stafelalp 2 χ 0 0 0 8.44 F/ 10.33 12.30 31.26 14.54 ased on 999 ased ratios ratios are given for fixed effects and - - 0.001 0.001 0.001 0.014 0.000 1 1 1 1 df na na na na Findelwald Reproductive allocation Reproductive * P ns ns ns ns ** *** *** - not not significant. F 0.001 0.001 0.001 0.020 0.052 ment, ment, and family membership on aboveground biomass and reproductive phenology (linear 2 χ ns 3.34 1.60 0.03 1.14 F/ 23.35 26.17 27.06 24.98 Findelgletscher <0.05, 1 1 1 df na na na na P - Reproductive biomass Reproductive 0.001 0.037 0.096 0.064 0.085 Monstein * * P ns ns ns ** ** *** <0.01, * - P 2 χ 0.001 0.014 0.078 0.038 0.039 0 0 Casanna 5.40 4.74 1.94 F/ values (below diagonal) with tail probabilities b probabilities tail with diagonal) (below values 15.40 15.77 32.91 ST 1 1 1 1 df na na na na Vegetative biomassVegetative - <0.001, ** 0.051 0.084 0.127 0.095 0.098 P Schiahorn *** Population pairwise F pairwise Population The The effects of population origin, soil moisture treat : ! effects analyses). Early leaf size (measured as length*width/2 of the first fully developed true leaf) was included as a cova amily x treatment amily - Schiahorn Casanna Monstein Findelgletscher Findelwald Stafelalp Davos Zermatt factor size leaf early Region Treatment x treatment Region (region) Population (population) family Seed x treatment Population f Seed 2 Table diagonal). (above given GenAlEx in of as implemented samples permutations random Table 3 mixed maternal effects. biomass. aboveground total over biomass of reproductive ratio is the allocation Reproductive 77 Divergent! selection in flowering phenology in A. vulneraria dry wet Schiahorn Jun 01 Casanna Monstein Findelgletscher Findelwald Stafelalp May 15 May 01 Apr 15 Apr 01 Onset Peak End Onset Peak End Fig. 1: Flowering phenology of six alpine populations of Anthyllis vulneraria in the common garden of the Botanical Institute in Basel in the two soil moisture treatments. Open symbols represent populations from Davos (Schiahorn, Casanna, Monstein), and closed symbols represent populations from Zermatt (Findelgletscher, Findelwald, Stafelalp). Error bars denote one standard error of the mean based on individual variation within population. 200 FST (molecular markers) QST Vegetative Biomass QST Reproductive Biomass QST Flower Onset QST Flower Peak 150 < 95 % CI > QST Flower End 100 Density 50 0 0.0 0.1 0.2 0.3 Population Differentiation 3 Fig. 2: Probability density distributions of FST and QST’s for biomass and phenological traits. 10 replicate values of FST were generated by a non-parametric bootstrap. FST is based on microsatellites. Distributions of QST’s for this plot consist of only 36 replicates per trait, which were generated by jackknifing over seed families. Vertical lines indicate the 95 % confidence interval of the estimate of FST. 95% confidence intervals of QST’s of onset and peak of flowering do not overlap with the 95 % confidence interval of the estimate of FST and therefore reveal a signature of past selection. 78 Chapter 4 Effects of treatment on biomass allocation Findelwald, which responded with a strong and reproductive phenology decrease in reproductive biomass to the Regions responded differently in their drought treatment. The third population from aboveground biomass to the soil moisture Zermatt (Stafelalp) reacted very similarly to treatment (significant region x treatment for the Davos populations with a small decrease vegetative and reproductive biomass, and in reproductive biomass (Fig. 3). Overall, the reproductive allocation; Table 3). Contrasts population-level decrease in reproductive of the treatments in each region revealed that biomass in response to drought was vegetative biomass decreased in Zermatt proportional to the mean reproductive under lowered soil moisture (p=0.003), while biomass across both treatments (Pearson’s it was not significantly affected in Davos product moment, t=4.81, df=4, P<0.01). (p=0.93; Fig. 3). Concerning reproductive There was no correlation of reproductive biomass, contrasts of the treatments in each allocation with vegetative biomass across all region revealed that both the Davos and populations at the level of seed family Zermatt regions were significantly affected (Pearson’s product moment, t= 1.75, df=34, by lowered soil moisture (p=0.04; resp. P>0.09), and therefore no indication of a p<0.01), but the Zermatt region more trade-off between reproductive and strongly so. However, Figure 3 suggests the vegetative biomass in the studied region x treatment for reproductive biomass populations. No significant interactions of was largely driven by the two geographically treatment with population or seed family adjacent populations of Findelgletscher and were found. vegetative biomass reproductive biomass reproductive allocation 12.5 70 Schiahorn Casanna Monstein Findelgletscher 10.0 Findelwald 60 Stafelalp 7.5 50 Dry Dry mass (g) 5.0 40 2.5 Percentage reproductive biomass of total biomass (%) of total biomass biomass reproductive Percentage 30 dry wet dry wet dry wet Fig. 3 Reaction norms of vegetative and reproductive aboveground biomass in response to two soil moisture treatments of six alpine populations of Anthyllis vulneraria in the common garden in Basel. Open symbols and dashed lines represent populations from Davos (Schiahorn, Casanna, Monstein), and closed symbols and solid lines represent populations from Zermatt (Findelgletscher, Findelwald, Stafelalp). Error bars denote one standard error of the mean based on individual variation within population. 79 Divergent selection in flowering phenology in A. vulneraria Reduced soil moisture treatment had no neutral expectation in reproductive allocation consistent effect on the onset of flowering, across such short geographic distances as but significantly advanced peak flowering indicated by QST-FST comparison. and end of flowering of all populations by an Both vegetative and reproductive biomass average of 3 and 6 days, respectively. No were plastic in response to soil moisture significant interactions of treatment with availability suggesting that summer population or seed family were found. precipitation plays a role for growth and reproduction of alpine Anthyllis vulneraria. Discussion Drought stress in the alpine life zone is a phenomenon mostly reserved to special microhabitats such as extremely shallow or The current study demonstrates exposed substrates (Neuner et al. 1999), and considerable variation in reproductive tolerance to desiccation is often high (Körner phenology and aboveground biomass among 2003). However, reduced soil moisture - six alpine populations of Anthyllis vulneraria even if it does not cause problems with sampled in two contrasting regions. Q -F ST ST maintaining turgor - frequently leads to comparisons suggest that divergent selection nutrient limitation and therefore reduced likely caused population genetic growth (Körner 2003). Interestingly, reduced differentiation in onset and peak of flowering soil moisture did not have a negative effect but not in biomass. Substantial amounts of on vegetative biomass for populations from variation in all measured traits are explained Davos. Previous results also show no effect by family membership, indicating within- or a slightly positive effect of drought for population genetic variation and sustained alpine grassland sites receiving high annual potential for future evolution. Soil moisture precipitation (Gilgen and Buchmann 2009). treatment had a significant effect on biomass Drought stress therefore seems to be avoided traits, and resulted in a small but statistically in the Davos populations through slow significant forward shift of peak and end of growth resulting in lower total leaf surface flowering. No genetic variation in plastic area and consequently in lower transpiration. responses to soil moisture was found within Whether this pattern is a genetic adaptation populations, neither for flowering phenology driven by regional differences in nor for biomass traits. Moreover, populations precipitation should be further investigated within each region did also not differ in their with a larger number of populations and plastic response to drought, but across measurements of in situ water availability. regions populations responded differently in Statistical models and graphical inspection vegetative biomass. also showed that there is no significant within-population genetic variation in Variation in biomass allocation phenotypic plasticity in response to soil There is good evidence that reproductive moisture, meaning that all seed families allocation increases along elevation (Fabbro within a population responded similarly to and Körner 2004; Zhu et al. 2010). Since our soil moisture change. This is in line with the populations are not spread along elevation absence of divergent selection across very far and since we study only three populations as found in the Q -F populations per region, it is not surprising ST ST comparison, because environmental that we do not find differentiation beyond the heterogeneity in water limitation and 80 Chapter 4 associated divergent selection are predicted Such correlations could strengthen the case to preserve genetic variation in plasticity for past and current adaptive evolution of (Via and Lande 1985). Although stabilizing flowering time and inform about selective selection across populations on trait means agents. An emerging key environmental was not indicated by the QST-FST comparison determinant of plant distributions in alpine for biomass traits, stabilizing selection on habitats is spring frost (Bannister et al. 2005; reaction norms rather than on trait means Ladinig et al. 2013; Lenz et al. 2013; Briceño might still be present and explain the absence et al. 2014; Wheeler et al. 2014). The of genetic variation in plasticity within likelihood of spring frost at any elevation is populations. largely determined by the date of snowmelt, which in turn is a function of winter Variation in reproductive phenology precipitation, and topography. A thick snow Populations of Anthyllis vulneraria are cover in spring buffers temperature differentiated in their reproductive phenology fluctuations and protects critical plant tissues at all spatial scales from more than a hundred from freezing damage due to very low km to a few km. Snowmelt date was temperatures. Reproductive structures of drastically advanced in our common garden flowering plants are highly frost-susceptible compared to the natural sites because the and much less frost-tolerant than vegetative garden is situated at much lower elevation. plant tissues (Neuner et al. 2013). Genetic differences in photoperiodic Consequently, the timing of reproduction is sensitivity between populations, i.e. G x E in expected to evolve so as to avoid periods photoperiodic control, might therefore have with a high likelihood of frost. Sites with become visible in our garden (Pigliucci little snow accumulation during winter and 2003). Likewise G x E in vernalisation relatively early snowmelt experience spring requirement might also contribute to the frost more commonly and should extend the variation that was found in the common pre-flowering duration. Similarly to spring garden (Mendez-Vigo et al. 2013). Yet the frost, the emergence of pollinating insects of strong forward shift in the phenology of all Anthyllis vulneraria can also potentially populations compared to the natural sites select for corresponding peak flowering suggests strong insensitivity to photoperiod times. As the activity of pollinating insects is of all populations. Furthermore, we observed strongly temperature-dependent, differences comparable differences in flowering time in in elevation and exposition among an accompanying experiment with populations could lead to divergent selection transplantations into the original field sites through pollinators (Kudo 1996). Flowering (Halil Kesselring, personal observation). phenology is a trait particularly likely to be Therefore it is more plausible, as the QST-FST differentiated even over short geographical comparison suggests, that heterogeneous distances, because it is also a mechanism to selection on onset and peak of flowering is reduce gene flow via pollen movement the reason for the within-region population between individuals flowering at different differentiation in these traits. Because a total times (Linhart and Grant 1996). There is a of only 6 populations and a regional shortage of studies investigating whether subdivision were used in our study, it is not populations of alpine plants at similar feasible to correlate flowering dates with elevations experience divergent selection on environmental variables at the sites of origin. flowering time by the local environments, 81 Divergent selection in flowering phenology in A. vulneraria and future studies should test the link be present. between snowmelt date, pollinator abundances, and flowering time. Accuracy of QST and FST estimation The observed advances of peak and end of The method of comparing QST to the flowering in response to decreased soil neutral expectation using FST has been moisture availability - although mild as they scrutinized, because both indices are not were - are in keeping with a strategy of quick without problems (e.g. McKay and Latta reproduction under stressful conditions. This 2002; O'Hara and Merila 2005). The is a previously observed reaction of short- accuracy of the estimation of QST depends on lived plants on short as well as evolutionary how well we can separate additive genetic time-scales (Dunne et al. 2003; Franks 2011). variance (VA) within and between Peak flowering date per seed family was not populations from environmental effects, a function of the reproductive biomass maternal effects, and non-additive genetic (ANCOVA, F=1.25, p=0.27). Hence, it is effects such as dominance. Since we have unlikely that the advanced dates of peak and largely reduced environmental variation by end of flowering are merely the result of raising all plants in a common garden and decreased biomass. Likewise, the time controlling for soil moisture availability to between re-establishment of the treatment in our best ability, direct environmental effects the second growing season to onset of should be minimal in our study (Leinonen et flowering was not correlated to plasticity in al. 2008). Indirect environmental variation flowering onset either, meaning that later- can still occur through maternal effects in our flowering populations were not more plastic. design as we used maternal half-sibs to Therefore, the absence of a plastic response estimate VA. However, maternal effects in of flowering onset to soil moisture is unlikely plants have so far almost exclusively been the result of the suspension of the treatment found to affect only early life-history stages during winter. Advanced peak and end of and to diminish over time (Bischoff and flowering therefore potentially reflect an Müller-Schärer 2010 and references therein). adaptive drought escape strategy in Anthyllis As our plants were in the second growing vulneraria. No variation in the response of season when traits were measured, maternal the flowering phenology to soil moisture effects might not have had a considerable availability was indicated by statistical effect on the outcome. Furthermore, we have analyses, neither at the among-population nor included early leaf size as co-variate in the at the within-population level (Tab. 3). As analyses, a method commonly used to control theory predicts that genetic variation in for maternal effects (Scheepens and Stöcklin plasticity should be preserved under 2013). We used the phenotypic resemblance conditions of heterogeneous selection (Via of open-pollinated half-sibs to assess VA, a and Lande 1985), one might conclude from method that confounds additive with non- these results that variability in soil moisture additive genetic effects such as dominance. leading to heterogeneous selection on However, non-additive effects always cause flowering phenology does not exist at the a downward bias in estimating QST (Lynch scale at which populations were sampled in and Walsh 1998), and therefore render tests this experiment (< 20 km within regions). of QST>FST conservative. As we found no Alternatively, evolutionary constraints or QST smaller than FST, this bias is unlikely to stabilizing selection on reaction norms may affect our conclusions. Finally, FST has been 82 Chapter 4 hotly debated as an accurate measure of grown in the common garden. Analyses neutral population differentiation and the suggest that differentiation resulting from molecular markers used to assess it are selection occurs even at spatial scales < 20 criticised (e.g. Hedrick 2005; Jost 2008). In km and we hypothesize it is the result of this study we used microsatellites, which are temperature differences at the population notorious for having a high mutation rate sites resulting in divergent snowmelt and resulting in lower estimates of FST. Indeed, pollinator conditions. We found ample Jost’s estimate of differentiation was more genetic variation within populations for all than twice as big as FST. However, since this traits, supporting the idea that future difference is still mild compared to many adaptations in flowering phenology and previous microsatellite studies, and since far reproductive allocation to novel conditions less than 1 private allele per locus and are possible. However, genetic variation in population was found (results not shown), we phenotypic plasticity in response to soil suspect that our microsatellites do not have moisture availability was absent for all traits an exceedingly high mutation rate and are studied. This indicates either the absence of therefore suitable for comparisons of QST significant heterogeneity in soil moisture with FST (Edelaar and Björklund 2011). across populations, or stabilizing selection on Furthermore, Jost’s estimate of reaction norms across populations, or in the differentiation was still smaller than both case of flowering phenology might be due to QST’s concluded to be significantly larger the low overall plasticity in flowering than FST. Consequently, if our FST falsely phenology in response to soil moisture. underestimates population differentiation at neutral marker sites, then this would mostly Supplementary Data affect our conclusions that none of the traits is under stabilizing selection across Additional supporting information is populations. In summary, we are confident in available in the online version of this article the accuracy of the results with the exception (see “supplementary material”) and contains of underestimating stabilizing selection the following: across the Alps in plant size. Nonetheless, we 1_Map.pdf, 2_SoilMoisture.pdf, caution the reader against taking QST-FST 3_Temperature. Pdf, RawData.xls. comparisons as definitive proof for the presence or absence of selection. Acknowledgements Conclusion The work was supported financially by the Swiss National Science Foundation grant no. Our results suggest that the timing of 3100A-135611 to JS, and the Freiwillige onset and peak of flowering has been under Akademische Gesellschaft Basel and the divergent selection among populations of Basler Stiftung für biologische Forschung to alpine Anthylllis vulneraria. Populations HK. Three anonymous reviewers have were differentiated in onset and peak of helped improve the manuscript. flowering up to 5 weeks across regions and more than 2 weeks within regions when 83 Divergent selection in flowering phenology in A. vulneraria References Franks SJ (2011) Plasticity and evolution in drought avoidance and escape in the annual plant Bannister P et al. (2005) Will loss of snow cover Brassica rapa. New Phytol 190:249-257 during climatic warming expose New Frei ER, Hahn T, Ghazoul J, Pluess AR (2014) Zealand alpine plants to increased frost Divergent selection in low and high elevation damage? Oecologia 144:245-256 populations of a perennial herb in the Swiss Bergman P, Molau U, Holmgren B (1996). Alps. Alpine Botany 124:131-142 Micrometeorological impacts on insect Galen C, Sherry RA, Carroll AB (1999) Are flowers activity and plant reproductive success in an physiological sinks or faucets? Costs and alpine environment, Swedish Lapland. Arctic correlates of water use by flowers of and Alpine Research 28: 196-202. Polemonium viscosum. Oecologia 118:461- Bingham RA, Orthner AR (1998) Efficient 470 pollination of alpine plants. Nature 391:238- Gilgen AK, Buchmann N (2009) Response of 239 temperate grasslands at different altitudes to Bischoff A, Müller-Schärer H (2010) Testing simulated summer drought differed but population differentiation in plant species - scaled with annual precipitation. how important are environmental maternal Biogeosciences 6: 2525-2539 effects. Oikos 119:445-454 Guillaume F, Rougemont J (2006) Nemo: an Bradshaw AD (1965) Evolutionary significance of evolutionary and population genetics phenotypic plasticity in plants. In: Caspari programming framework. Bioinformatics EW, Thoday JM (eds) Advances in Genetics, 22:2556-2557 vol 13. Academic Press, pp 115-155. Hall MC, Willis JH (2006) Divergent selection on Briceño VF, Harris-Pascal D, Nicotra AB, flowering time contributes to local adaptation Williams E, Ball MC (2014) Variation in in Mimulus guttatus populations. Evolution snow cover drives differences in frost 60:2466-2477 resistance in seedlings of the alpine herb Hedrick PW (2005) A standardized genetic Aciphylla glacialis. Environmental and differentiation measure. Evolution 59:1633- Experimental Botany 106:174-181 1638 Caruso CM (2006) Plasticity of inflorescence traits in Hegi G (1975) Illustrierte Flora von Mitteleuropa. vol Lobelia siphilitica (Lobeliaceae) in response 4. Dicotyledones, 3rd edn. Verlag Paul Parey, to soil water availability. American Journal Berlin und Hamburg, Deutschland of Botany 93:531-538 Hülber K, Gottfried M, Pauli H, Reiter K, Winkler Chapuis MP, Estoup A (2007) Microsatellite null M, Grabherr G (2006) Phenological alleles and estimation of population responses of snowbed species to snow differentiation. Mol Biol Evol 24:621-631 removal dates in the central Alps: David P, Pujol B, Viard F, Castella V, Goudet J implications for climate warming. Arctic, (2007) Reliable selfing rate estimates from Antarctic, and Alpine Research 38:99-103 imperfect population genetic data. Mol Ecol Hülber K, Winkler M, Grabherr G (2010) 16:2474-2487 Intraseasonal climate and habitat-specific Dunne JA, Harte J, Taylor KJ (2003) Subalpine variability controls the flowering phenology meadow flowering phenology responses to of high alpine plant species. Functional climate change: integrating experimental and Ecology 24:245-252 gradient methods. Ecological Monographs Inouye DW (2008) Effects of climate change on 73:69-86 phenology, frost damage, and floral abundance of montane wildflowers. Ecology Edelaar P, Björklund M (2011) If FST does not measure neutral genetic differentiation, then 89:353-362 Jost L (2008) G and its relatives do not measure comparing it with QST is misleading. Or is it? ST Mol Ecol 20:1805-1812 differentiation. Mol Ecol 17:4015-4026 Fabbro T, Körner C (2004) Altitudinal differences in Keller F, Körner C (2003) The role of flower traits and reproductive allocation. photoperiodism in alpine plant development. Flora - Morphology, Distribution, Functional Arctic, Antarctic, and Alpine Research Ecology of Plants 199: 70-81 35:361-368 84 Chapter 4 Kesselring H, Hamann E, Stöcklin J, Armbruster Lynch M, Walsh B (1998) Genetics and analysis of GFJ (2013) New microsatellite markers for quantitative traits. Sinauer Associates, Anthyllis vulneraria (Fabaceae), analyzed Sunderland, Massachusetts. with Spreadex gel electrophoresis. Mal TK, Lovett-Doust J (2005) Phenotypic plasticity Applications in Plant Sciences 1:1300054 in vegetative and reproductive traits in an Körner C (2003) Alpine plant life: functional plant invasive weed, Lythrum salicaria ecology of high mountain ecosystems. (Lythraceae), in response to soil moisture. Springer Berlin Heidelberg American Journal of Botany 92:819-825 Köster E, Bitocchi E, Papa R, Pihu S (2008) Genetic McKay JK, Latta RG (2002) Adaptive population structure of the Anthyllis vulneraria L. s. l. divergence: markers, QTL and traits. Trends species complex in Estonia based on AFLPs. in Ecology & Evolution 17:285-291 Central European Journal of Biology 3:442- Méndez-Vigo B, Gomaa NH, Alonso-Blanco C, 450 Picó FX (2013) Among- and within- Kudo G (1996) Effects of snowmelt timing on population variation in flowering time of reproductive phenology and pollination Iberian Arabidopsis thaliana estimated in process of alpine plants. Memoirs of National field and glasshouse conditions. New Phytol Institute of Polar Research, Special Issue, 197:1332-1343 No. 51, Tokyo, Japan Müller H (1881) Alpenblumen, ihre Befruchtung Kuss P, Armbruster GFJ, Ægisdóttir HH, durch Insekten und ihre Anpassungen an Scheepens JF, Stöcklin J (2011) Spatial dieselben. W. Engelmann, Switzerland genetic structure of Campanula thyrsoides Nanni L, Ferradini N, Taffetani F, Papa R (2004) across the European Alps: indications for Molecular phylogeny of Anthyllis spp. Plant glaciation-driven allopatric subspeciation. Biology 6:454-464 Perspectives in Plant Ecology, Evolution and Navarro L (1999) Allocation of reproductive Systematics 13:101-110 resources within inflorescences of Anthyllis Kuznetsova A, Brockhoff PB, Christensen RHB vulneraria subsp. vulgaris (Fabaceae). In: (2013) lmerTest: tests for random and fixed Hemsley AR, Kurmann MH [eds] The effects for linear mixed effect models (lmer Evolution of Plant Architecture 1: 323-330. objects of lme4 package). Royal Botanic Gardens, Kew. Ladinig U, Hacker J, Neuner G, Wagner J (2013) Neuner G, Braun V, Buchner O, Taschler D (1999) How endangered is sexual reproduction of Leaf rosette closure in the alpine rock species high-mountain plants by summer frosts? Saxifraga paniculata Mill.: significance for Frost resistance, frequency of frost events survival of drought and heat under high and risk assessment. Oecologia 171:743-760 irradiation. Plant, Cell & Environment 22: Lambrecht SC (2013) Floral water costs and size 1539-1548 variation in the highly selfing Leptosiphon Neuner G, Erler A, Ladinig U, Hacker J, Wagner J bicolor (Polemoniaceae). International (2013) Frost resistance of reproductive Journal of Plant Sciences 174:74-84 tissues during various stages of development Leimu R, Fischer M (2008) A meta-analysis of local in high mountain plants. Physiologia adaptation in plants. PLoS ONE 3:e4010 plantarum 147:88-100 Leinonen T, O'Hara RB, Cano JM, Merilä J (2008) O'Hara RB, Merilä J (2005) Bias and precision in Comparative studies of quantitative trait and QST estimates: problems and some solutions. neutral marker divergence: a meta-analysis. J Genetics 171:1331-1339 Evol Biol 21:1-17 Ozenda P (1985) La végétation de la chaîne alpine. Lenz A, Hoch G, Vitasse Y, Körner C (2013) Masson European deciduous trees exhibit similar Packer JG (1974) Differentiation and dispersal in safety margins against damage by spring alpine floras. Arctic and Alpine Research freeze events along elevational gradients. 6:117-128 New Phytol 200:1166-1175 Pannell JR, Labouche A-M (2013) The incidence Linhart YB, Grant MC (1996) Evolutionary and selection of multiple mating in plants. significance of local genetic differentiation in Philosophical Transactions of the Royal plants. Annual Review of Ecology and Society B-Biological Sciences 368: Article Systematics 27:237-277 number 20120051. 85 Divergent selection in flowering phenology in A. vulneraria Peakall R, Smouse PE (2006) GENALEX 6: genetic Spitze K (1993) Population structure in Daphnia analysis in Excel. Population genetic obtusa: quantitative genetic and allozymic software for teaching and research. variation. Genetics 135:367-374 Molecular Ecology Notes 6: 288-295 Sultan SE, Spencer HG (2002) Metapopulation Pigliucci M (2003) Selection in a model system: structure favors plasticity over local ecological genetics of flowering time in adaptation. American Naturalist 160:271-283 Arabidopsis thaliana. Ecology 84:1700-1712 Thiel-Egenter C et al. (2011) Break zones in the Price MV, Waser NM (1998) Effects of experimental distributions of alleles and species in alpine warming on plant reproductive phenology in plants. Journal of Biogeography 38:772-782 a subalpine meadow. Ecology 79:1261-1271 Via S, Lande R (1985) Genotype-environment R Development Core Team (2008) R: a language interaction and the evolution of phenotypic and environment for statistical computing. R plasticity. Evolution 39:505-522 foundation for Statistical Computing, Vienna, Weir BS, Cockerham CC (1984) Estimating F- Austria. statistics for the analysis of population Rathcke B, Lacey EP (1985) Phenological patterns of structure. Evolution 38:1358-1370 terrestrial plants. Annual Review of Ecology Wheeler JA, Hoch G, Cortés AJ, Sedlacek J, Wipf and Systematics 16:179-214 S, Rixen C (2014) Increased spring freezing Scheepens JF, Kuss P, Stöcklin J (2011) vulnerability for alpine shrubs under early Differentiation in morphology and flowering snowmelt. Oecologia 175:219-229 phenology between two Campanula Whitlock MC, Guillaume F (2009) Testing for thyrsoides L. subspecies. Alpine Botany spatially divergent selection: comparing QST 121:37-47 to FST. Genetics 183:1055-1063 Scheepens JF, Stocklin J (2013) Flowering Wright S (1931) Evolution in mendelian populations. phenology and reproductive fitness along a Genetics 16:97-159 mountain slope: maladaptive responses to Zhu Y, Siegwolf RTW, Durka W, Koerner C transplantation to a warmer climate in (2010) Phylogenetically balanced evidence Campanula thyrsoides. Oecologia 171:679- for structural and carbon isotope responses in 691 plants along elevational gradients. Oecologia Scherrer D, Körner C (2010) Infra-red thermometry 162: 853-863 of alpine landscapes challenges climatic Zimmermann NE, Kienast F (1999) Predictive warming projections. Global Change Biology mapping of alpine grasslands in Switzerland: 16:2602–2613 Species versus community approach. Journal Schluter D (2009) Evidence for ecological speciation of Vegetation Science 10: 469-482 and its alternative. Science 323:737-741 Schroeter C (1923) Das Pflanzenleben der Alpen. Teile 1-4. A. Raustein, Zurich, Switzerland 86 Chapter 4 Supplementary Data Online Resource 1 Hill shade maps of European Alps showing the 6 sampled populations. The top panel map is derived from the global digital elevation model of the European Environment Agency, and the two bottom panels are copyrighted by swisstopo, 3084 Wabern, Switzerland (Swiss ALTI3D). The scale only applies to the bottom panels. Germany France Austria Switzerland Slovenia Italy 10 km 87 Divergent selection in flowering phenology in A. vulneraria Online Resource 2 Volumetric soil moisture measurements were taken twice per week at random intervals and at different times after watering on 10 haphazardly selected individuals per treatment. Wet and dry plants were watered when the average moisture content undercut 18 % and 5 %, respectively as indicated by the horizontal lines. The vertical line indicates the suspension of the treatment during winter. Wet plants were given between 100 ml and 190 ml of water and on each watering, and dry plants between 60 ml and 100 ml, depending on water status. 88 Chapter 4 Online Resource 3 Weekly average (black solid line) and weekly maximum and minimum (grey shade) air temperatures for the duration of the experiment. 89 Divergent selection in flowering phenology in A. vulneraria 90 Chapter 5 Chapter 5 Evidence of local adaptation to fine- and coarse-grained environmental variability in Poa alpina in the Swiss Alps Elena Hamann*, Halil Kesselring, GFJ Armbruster, JF Scheepens and Jürg Stöcklin *E. Hamann is the corresponding author. Journal of Ecology (2016) 104: 1627-1637 DOI: 10.1111/1365-2745.12628, available at www.wiley.com 91 Local adaptation in Poa alpina 92 Chapter 5 Evidence of local adaptation to fine- and coarse-grained environmental variability in Poa alpina in the Swiss Alps Elena Hamanna, Halil Kesselringa, Georg F.J. Armbrustera, J.F. Scheepensb, Jürg Stöcklina aInstitute of Botany, Department of Environmental Sciences, Section Plant Ecology, University of Basel, Schönbeinstrasse 6, CH-4056 Basel, Switzerland bPlant Evolutionary Ecology, Institute of Evolution & Ecology University of Tübingen, Auf der Morgenstelle 5, D-72076 Tübingen, Germany * For correspondence: [email protected] Abstract • In the alpine landscape, characterized by high spatiotemporal heterogeneity and barriers, divergent selection is likely to lead to local adaptation of plant populations either through adaptive genetic differentiation or phenotypic plasticity. The relative importance of these processes has rarely been investigated in relation to the spatial scale of environmental heterogeneity. In this study we used reciprocal transplantation experiments of populations across nearby and distant field sites to shed light on these complementary processes. • We reciprocally transplanted populations of the widespread alpine grass, Poa alpina, within and across regions in the Swiss Alps. We inferred local adaptation at the meta- population level by comparing fitness of plants transplanted to their site of origin, and to nearby or distant novel sites. Additionally, we measured specific leaf area (SLA) and performed selection analyses to investigate directional selection on mean trait values at the different field sites, and on the degree of plasticity of this trait to assess if plastic responses were adaptive. In parallel, all populations were genotyped with microsatellite markers to assess neutral molecular differentiation. • Molecular differentiation was high among populations within and among regions, indicating restricted gene flow among P. alpina populations. Reproductive biomass was highest in individuals grown in their region of origin, revealing local adaptation to coarse- grained environmental variability. Similarly, inflorescence height, associated with reproductive biomass, reflected adaptation to fine- and coarse-grained environmental variability. Furthermore, we found evidence that plasticity in SLA across coarse-grained habitats was correlated with plant fitness, suggesting that plasticity in this trait is adaptive. • Our results revealed adaptive genetic differentiation between P. alpina populations in the Swiss Alps reflecting local adaptation. Furthermore, high phenotypic plasticity in SLA contributed to the maintenance of fitness homeostasis across habitats. Hence, adaptive genetic differentiation and phenotypic plasticity play a complementary role for adaption of P. alpina to environmental heterogeneity in the Swiss Alps, and may both be critical to mitigate local extinction risk under rapid climate change. Keywords: adaptive potential, genetic differentiation, phenotypic plasticity, plant-climate interactions, reciprocal transplantation experiment, spatial scale, sympatric vs. allopatric contrast. 93 Local adaptation in Poa alpina Introduction environmental differences (i.e. coarse- grained environmental variation) and genetic Intraspecific phenotypic variation among isolation (Kawecki and Ebert, 2004, plant populations can arise from genetic drift, Baythavong, 2011, Volis et al., 2015). In adaptive genetic differentiation, or passive contrast, genetic differentiation to and adaptive phenotypic plasticity (Van environmental variability at a more local Tienderen, 1991, Van Tienderen, 1997). In scale (i.e. fine-grained environmental widespread species, populations are often variation) may be hindered by gene flow distributed across diverse habitats generating (Kawecki and Ebert, 2004), and phenotypic divergent selective pressures resulting in plasticity could instead be advantageous to adaptive genetic variation among populations accommodate environmental heterogeneity that maximizes fitness in local habitats (i.e. (Pigliucci, 2001, Sultan and Spencer, 2002, local adaptation; Lande and Arnold, 1983, Baythavong, 2011). Accordingly, when Briggs and Walters, 1997, Kawecki and attempting to understand how selection Ebert, 2004, Byars et al., 2007). In alpine shapes plant responses to environmental environments, characterized by steep heterogeneity, it is crucial to study patterns environmental gradients, strong spatio- of local adaptation and phenotypic plasticity temporal habitat heterogeneity, and high across different spatial scales characterized natural landscape fragmentation (Körner, by fine- and coarse-grained environmental 2003, Scherrer and Körner, 2010), local variation (Baythavong, 2011). adaptation is likely to occur. Alternatively, Furthermore, intraspecific genetic heterogeneity across small spatial scales in variation and phenotypic plasticity are two these habitats could also favour adaptive critical components of responses to changing phenotypic plasticity (Alpert and Simms, environments (Byars et al., 2007, Nicotra et 2002). A highly plastic genotype producing a al., 2015), and can indicate the potential of locally superior phenotype across habitats plants to adapt to climate change (Kim and would rapidly become dominant, and would Donohue, 2013, Pluess et al., 2016). In the lead to phenotypic differentiation among long term, intraspecific genetic habitats without underlying genetic differentiation can increase population differentiation (Kawecki and Ebert, 2004). persistence under climate change through A central goal in ecological genetics has dispersal of adaptive genes from other been to determine to what extent different populations (Matter et al., 2014). This is phenotypes in contrasting environments particularly plausible in mountain systems result from genotypic differentiation, where populations at lower elevations may phenotypic plasticity or a combination of provide adaptive genes to populations at both (Van Tienderen, 1991, Van Tienderen, higher elevations as climate change advances 1997, Conner and Hartl, 2004, Ghalambor et (Gonzalo-Turpin and Hazard, 2009, Matter et al., 2007, Gienapp et al., 2008). Theoretical al., 2014). Alternatively, phenotypic conjectures relying on the scale of pollen and plasticity can play a central role in the short- seed dispersal relative to the scale of term adaptive potential of species by environmental variability predict that local allowing the rapid accommodation of adaptation via genetic differentiation changes in environmental conditions (Richter increases with geographic distance between et al., 2012), and can promote long-term populations, as a result of increasing adaptive evolution by buffering against 94 Chapter 5 climate change (Price et al., 2003, Pigliucci allopatric” and “sympatric vs. far- et al., 2006, Nicotra et al., 2010). As such, allopatric”). Thus this criterion is ideal when characterizing genetic differentiation and trying to investigate the spatial scale at which phenotypic plasticity in alpine plant local adaptation operates (Banta et al., 2007, populations will help assess their adaptive Richardson et al., 2014, Volis et al., 2015), potential to ongoing climate change (Till- and when attempting to understand the Bottraud and Gaudeul, 2002, Byars et al., mutual role of adaptive genetic 2007, Pluess et al., 2016). differentiation and phenotypic plasticity. Reciprocal transplantation studies have To do so, it is important to not only assess long been used in alpine systems to traits indicative of plant fitness but also key investigate patterns of local adaptation to functional traits known to vary along elevational gradients (Byars et al., 2007, environmental gradients (Liancourt et al., Byars et al., 2009, Gonzalo-Turpin and 2015). Leaf traits, in particular specific leaf Hazard, 2009, Hautier et al., 2009, Kim and area (SLA), are considered most indicative Donohue, 2013, Scheepens and Stöcklin, for plant resource management and stress 2013, Frei et al., 2014), snow cover (Stanton tolerance (Lavorel and Garnier, 2002, and Galen, 1997, Sedlacek et al., 2015) or Garnier et al., 2015), and strongly correlate land use type (Fischer et al., 2008). In most with temperature, irradiance and soil water studies, local adaptation is inferred by availability (Poorter et al., 2009, Scheepens comparing the fitness of “home vs. away” et al., 2010). Phenotypic selection analyses, and/or “local vs. foreign” populations in which fitness is regressed against trait (Kawecki and Ebert, 2004, Bennington et al., plasticity, can evaluate if trait plasticity is 2012). While both these criteria are powerful adaptive (Lande and Arnold, 1983, van tools to assess a “home-site advantage” of Kleunen et al., 2000, Nicotra et al., 2015). populations (Bennington et al., 2012), they Here, we reciprocally transplanted can be confounded by intrinsic habitat or populations of the alpine bunchgrass, Poa deme characteristics (Blanquart et al., 2013). alpina, across original field sites in the Swiss This can be avoided by using a meta- Alps. This species was chosen for its wide population approach, which allows the distribution, its growth form ideal for removal of population and habitat effects transplantation of clonal genets, and because before the assessment of local adaptation, by of its dual reproductive mode, relevant for comparing the average fitness of a set of gene dispersal distances across habitats. This populations grown at their sites of origin (in study is among the first to use a meta- sympatry, sensu Blanquart et al., 2013) and population approach and the “sympatric vs. the average fitness of the same set of near- and far-allopatric” criterion to populations grown in novel sites (in investigate patterns of local adaptation across allopatry, sensu Blanquart et al. 2013). two spatial scales, between and within Along with increasing the statistical regions (i.e. fine- and coarse-grained power to test for local adaptation through the environmental variation) on traits related to meta-population approach (Blanquart et al., fitness (i.e. growth and reproduction). 2013), the “sympatric vs. allopatric” contrast Additionally, we measured SLA at each field can be enriched by partitioning the criterion site and investigated potential selection on according to the distance between trait plasticity to infer on the adaptive value transplantation sites (i.e. “sympatric vs. near- of phenotypic plasticity. In parallel, to assess 95 Local adaptation in Poa alpina the genetic relatedness among the study 2008). Moreover, this species is a polyploid populations, within and among region, complex, with highly variable chromosome genetic differentiation was analyzed using numbers and common aneuploidy (Muntzing, microsatellite markers. We specifically 1980, Pierce et al., 2003). predict: (1) a fitness advantage in sympatric vs. allopatric (near and/or far) transplant Reciprocal transplantations combinations indicative of local adaptation; Location of transplantation sites (2) that spatial scale determines the Population sites were chosen at two mechanism underlying local adaptation (i.e. spatial scales: across a regional scale and natural selection favors phenotypic plasticity across a local scale within regions. The two in fine-grained environmental variability, chosen regions in the Swiss Alps namely while coarse-grained environmental Davos and Zermatt differ in coarse-grained variability selects for genotypic environmental conditions (notably climate). differentiation). The distance between these two regions approximates 180 km. Davos is part of the Material and methods Eastern Swiss Alps and situated in the Canton of Graubünden, while Zermatt is part Study species of the Western Swiss Alps and located in the The alpine meadow-grass, Poa alpina L. Canton of Valais. In Zermatt the annual (Poaceae), is a perennial bunchgrass average maximum, daily mean and minimum commonly distributed in arctic and alpine temperature is slightly higher than in Davos regions of the Northern hemisphere (Lauber (Zermatt: 9.82, 4.23, -0.2, respectively and and Wagner, 2001). In the European Alps, it Davos: 8.7 °C, 3.5 °C, -1°C, respectively; occurs in natural sites up to 4200 m above MeteoSwiss). More importantly, Zermatt is a sea level (a.s.l.) and in agricultural grasslands much drier region than Davos (MeteoSwiss, between 1400 and 2500 m a.s.l. (Conert, 2015), and receives almost half of the annual 1998, Aeschimann et al., 2004). This species precipitation in rainfall and depth of snowfall has a broad ecological niche and grows in of Davos (Zermatt: 639 mm and 263 cm, nutrient-rich meadows and pastures, but also respectively and Davos: 1022 mm, 468 cm, in natural alpine grassland and on pioneer respectively). Within each region, three sites like scree fields and snow beds populations differing in fine-grained (Schröter, 1926, Conert, 1998). Poa alpina environmental conditions (i.e. elevation, exhibits two reproductive modes: plants are exposition; Table 1) were sampled at a either seminiferous seed producers (the maximal distance of 5 km of each other, majority are produced apomictically i.e. implying that gene flow between these Steiner et al., 2012) or pseudoviviparous populations is restricted but not prohibited. bulbil producers (Muntzing, 1940). The occurrence of seed-producing plants Experimental design generally decreases with increasing elevation In September 2012 P. alpina plants were relative to bulbil-producing plants (Maurer, sampled from all 6 populations (Table 1). 2005, Fischer et al., 2011, Steiner et al., From each population, 10 healthy mother 2012). In alpine conditions, simulations plants with at least 4 tillers were randomly found that seed dispersal via wind may sampled in the field at a minimum distance exceed 1000 m (Tackenberg and Stöcklin, of 4 m from each other to avoid resampling 96 Chapter 5 the same genotypes. In the greenhouse in Products, Inc., California, USA) were Basel, Switzerland, tillers were individually installed at each site (buried in the soil at a potted in multitrays (54-pots of 4 cm Ø, 5 cm depth of 5 cm) to record hourly temperature deep) filled with low nutrient soil at soil level. (Anzuchterde, Ökohum GmbH, Herrenhof, Switzerland), watered regularly to water- Measurements holding capacity and fertilized once a month Initial number of tillers was recorded for (Wuxal, Syngenta Agro, Dielsdorf, each individual at time of transplantation. Switzerland). As plants grew and expanded, After two growing seasons, in October 2014, clonal tillers were regularly divided to obtain we assessed whether plants had survived and a total of 12 clonal offspring from each reproduced, counted the total number of genotype and population (12 clones × 10 tillers and the number of inflorescences, and genotypes × 6 populations = 720 plants). In measured the height of the tallest Spring 2013, plants were brought outside to inflorescence. On the same date, acclimate to outdoor conditions before aboveground biomass was harvested and transplantations. separated into vegetative biomass and In July 2013, plants were transplanted into reproductive biomass. SLA was assessed at the field as soon as the snow had melted and each transplant site (except at D_Schiahorn the growing season had started. The where stormy weather conditions made reciprocal transplantations consisted of measurements logistically impracticable) and planting each population to its site of origin for each individual by taking three circular (sympatric), to one novel site within the same corings of 2.5 mm ∅ from different mature region (near-allopatric), and to one novel site leaves, drying them at 60°C for 48h and in the foreign region (far-allopatric). weighing them together. SLA was then Accordingly, each site received its local calculated as the fresh leaf area divided by population, a foreign population from the the mean dry weight of the corings in same region and a foreign population from mm2.mg-1 (Cornelissen et al., 2003). the other region. Combinations of foreign Vegetative and reproductive biomass were populations and sites were randomly chosen, weighed separately after drying at 80°C for but with the restriction that each foreign 72h. population was only used in one site within a region (Table 1). Each site received a total of Data analyses 120 individuals, represented by 40 All growth- and reproduction-related traits individuals per population (10 genotypes × 4 were analyzed with linear mixed-effect clonal replicates × 3 populations), which models (Crawley, 2007), using Type III sums were planted directly into the local soil and of squares with the lmerTest package watered once after planting to facilitate (Kuznetsova et al., 2013) for R (R establishment. Individuals were planted Development Core Team, 2008). To test for following a stratified random pattern (i.e. local adaptation, we tested whether the alternating between individuals from each means of the three different site x population transplant combination) in rows of 10, with a combinations (i.e. sympatric, near-allopatric minimal spacing of 20 cm between each and far-allopatric) were significantly other. Data loggers (Thermochrome iButton different from each other. To this end, we Device Model DS1921G, Maxim Intergrated specified models including the fixed factors 97 Local adaptation in Poa alpina site, population, the contrasts between of plasticity in this trait. We used a linear sympatric, near- and far-allopatric transplant mixed-effect model, including the fixed combinations, and the site × population factors site, population and their interaction interaction. Local adaptation was considered (site × population) to analyze SLA. Variance to be operating if (i) a sympatric vs. components were then calculated by fitting allopatric contrast was significant, and if (ii) site, population and their interaction as sympatric transplant combinations random factors and extracting variances after outperformed allopatric ones (sensu Crawley (2007). Blanquart et al., 2013). To account for the To assess potential phenotypic selection replication of clonal tillers, the genotype of on SLA and on plasticity in SLA a individuals (nested within populations) was phenotypic selection analysis would typically included in all models as a random factor. be performed for each site separately (Lande The number of tillers at the time of and Arnold, 1983, Conner and Hartl, 2004). transplantation was initially included in all However, our low sample size at each site models as a covariate to account for initial prevents us to do so with sufficient statistical size, but was removed except in the models power. Hence, data from all sites was pooled, for the vegetative biomass and the total and a linear regression was performed to number of tillers where the covariate was examine fitness as a function of SLA, site, significant. Vegetative biomass, reproductive and SLA by site interaction (SLA × site). biomass and the height of inflorescences The reproductive biomass of individuals was were analyzed using a normal distribution used as a fitness proxy. A significant SLA by with identity link function, while the total site interaction would indicate that number of tillers and of inflorescences were directional selection for specific SLA values analyzed using a Poisson distribution with varies in strength and/or direction among log link function. An inspection of the sites. Subsequently, we estimated the slopes distribution of residuals revealed no need for of these correlations at each site as well as data transformation. Using lmerTest and its their significance to evaluate if SLA “rand” function, we report F-values and p- correlates positively or negatively with plant values for fixed effects and χ2-values and p- fitness at the different sites. values for random effects after Bonferroni Finally, if directional selection on SLA correction for multiple comparisons (p < values was found at certain sites, we 0.007). Post hoc Tukey HSD tests were proceeded to evaluate if phenotypic plasticity performed to detect significant differences in SLA was adaptive (i.e. correlated with among sympatric, near-allopatric and far- fitness), neutral or maladaptive. Standardized allopatric transplant combinations. linear (i.e. directional) selection gradients The proportion of surviving and were estimated as the partial regression reproductive individuals within each coefficient of relative fitness on the transplant combination (i.e. sympatric, near- standardized mean trait values of genotypes allopatric, far-allopatric) was analyzed with across transplant sites and on a standardized generalized linear models using a binomial measure of plasticity across transplant sites distribution with a logit link function. (Relyea, 2002, Conner and Hartl, 2004). Variation in SLA from populations Relative fitness was calculated by dividing transplanted within and across regions was the reproductive biomass of genotypes by the used to assess the extent and adaptive value mean across transplant combinations (i.e. 98 Chapter 5 sympatric, near-allopatric, far-allopatric). horizontal gel electrophoresis of PCR Standardized mean SLA trait values were amplicons, and ethidium bromide staining of calculated across transplant combinations for Spreadex® gels as applied in the current each genotype. The degree of plasticity in study. Since Poa alpina is polyploid, we SLA was calculated as the standardized used a presence/absence (1/0) coding of the phenotypic plasticity index (Piv = (max. microsatellite banding patterns (see mean – min. mean) / max. mean) across Rudmann-Maurer et al., 2007, Steiner et al., transplant combinations for each genotype 2012). In a pre-analysis, we checked the following Valladares et al. (2006). This repeatability of the PCR banding patterns in procedure was done for each of the two 4 individuals with replicates (i.e., two spatial scales studied here. Across the small additional DNA extractions for each of the spatial scales, we considered individuals four individuals). For the five loci, we scored transplanted within regions to nearby sites a total of 154 bands in the four individuals (i.e. in near-allopatry), and across the large with 5 mismatching signals appearing in the spatial scale, we considered individuals repetition analysis, i.e. 5/154 = 0.03 = 3%. transplanted across regions to the far-away Accordingly, an acceptable replication rate of site (i.e. in far-allopatry). 97% was found. All analyses were performed on R version 3.0.2 software (R Development Core Team, Data analyses 2013). We implemented the 1/0 data matrix into GenAlEx 6.2 (Peakall and Smouse, 2006) to Molecular analyses identify multilocus genotypes (i.e. clones) Sample collection and to perform an analysis of molecular For the molecular genetic diversity variance (AMOVA) to partition genetic analysis, leaf samples were taken from 60 variability among regions, among plants in total, corresponding to 10 genotypes populations within regions, and within from the same 6 populations as used for the populations. GenAlEx was also used to reciprocal transplantation study (Table 4). calculate the genetic differentiation indices, The samples, at least 2 cm long leaf parts, Φ, among regions and among populations were dried with silica gel immediately after within regions and to estimate their collection. significance based on 999 permutations across the full data set. Genetic analyses After milling the leaves in a Retsch Results MM400 mill (Retsch, Haan, Germany), DNA was extracted with the DNeasy plant mini kit Reciprocal transplantations (Qiagen GmbH, Hilden, Germany). We used As population PaD3 did not amplify to illustraTM puReTaq Ready-To-Go PCR microsatellite PCR (see molecular variance Beads (GE Healthcare, Buckinghamshire, below), we cannot exclude that another close UK) for microsatellite fingerprinting. Two of Poa species might have been sampled by our previous Poa alpina studies (Maurer et mistake at this site. Thus, to avoid any bias, al., 2005, Steiner et al., 2012) show details on we removed this population from our PCR conditions of five microsatellite loci statistical analyses. Analyses were (CA1D4, GAC1, GA1C3, CA1F4, CAB12), 99 Local adaptation in Poa alpina consequently performed on 5 populations origin (Fig. 2; PAD1 and PAZ3). However, transplanted between 6 sites. Accordingly a this pattern did not hold true on average for total of 15 transplantations were analyzed, all population by site interactions, resulting with 5 sympatric, 5 near-allopatric and 5 far- in non-significant differences between allopatric transplant combinations (600 sympatric vs. allopatric transplant individuals in total). combinations (Table 2; F = 0.12, p = 0.8; Fig Site and population effects: All measured 1b). traits differed significantly among the six For the total number of tillers and the transplant sites indicated by significant site vegetative biomass the sympatric vs. effects (Table 2, p <10-4 for all traits). allopatric contrast was non-significant for Similarly, population effects for all measured both of these growth-related traits (Table 2; F traits were significant, or marginally so (p < = 2.63, p = 0.07; F = 2.79, p = 0.07, 0.10), indicating genetic differences between respectively). Similarly, no significant site × populations (Table 2). population interaction was detected (Table 2) Local adaptation: The reproductive biomass for these traits. differed significantly between sympatric and allopatric transplant combinations (Table 2; F Phenotypic selection analysis = 5.83, p = 0.003). The reproductive biomass A significant site × population interaction of far-allopatric transplant combinations was was found for SLA (F = 4.31, p = 0.01) significantly lower relative to the suggesting genetic variation in plasticity reproductive biomass measured in sympatric among populations, which is a condition sine and near-allopatric transplant combinations qua non for an evolutionary response to (Fig. 1c). Similarly, individuals transplanted selection on plasticity. The variance back to their home site (sympatric transplants components analysis revealed that site effects combinations) produced taller inflorescences (plastic changes) explained 72.2% of the trait than individuals from near- and far-allopatric variation found in SLA and the site × transplant combinations (Table 2; F = 5.35 p population interaction explained 27.8%, = 0.005; Fig. 1a). Furthermore, the site × while the main population factor did not population interaction was significant explain any trait variation. indicating population differences among sites Furthermore, a significant SLA × site not related to local adaptation. For the interaction was found for the reproductive number of inflorescences, a significant site × biomass (i.e. used as a fitness proxy) population interaction was found (Table 2; F suggesting that directional selection for = 5.48, p = 0.001). This result indicates that specific SLA values varies in strength among populations responded differently to sites (F = 4.32, p = 0.002). While the slope of environmental site conditions for this trait. correlations between fitness and SLA was Indeed, the number of inflorescences non-significant at most sites, a significant produced by individuals differed positive correlation between fitness and SLA significantly between sites for population was found at the Z_Rothorn site (Table 3; β PAD1, PAZ2 and PAZ3. These populations = 0.031, p = 0.002). At this site, genotypes either had a higher number of inflorescences from the population of origin PaZ2, used as when grown at their sites of origin (PADZ2), reference point, had a mean SLA of 10.78 ± or the number of inflorescences decreased 2.57. with increasing distance from the site of 100 Chapter 5 values values - P 4 4 4 - - - pop, indicates - p × <10 <10 <10 0.005 0.001 pe pe was included in 2 oty χ - SE SE NE SW NW NW Exp. 5.35 8.34 F / 14.58 96.8 10.8 ude, ude, longitude), elevation (m - 5 4 2 3 1 “ “ “ “ Df Inflorescence height Inflorescence c. 59 c. population population interaction. c.143 Prec. Prec. × 4 - - p 7.6 6.5 9.3 8.9 0.06 0.83 6.25 11.6 <10 0.001 0.004 Temp. values values report on the fixed effects of site, - p 2 χ and and - October, October, reported for regions from MeteoSwiss; October October measured with data loggers at each site, - - - of inflorescences 2.28 0.18 5.48 8.16 F / F 27.81 - 5 4 2 3 1 Df Number Number types types sampled for the transplantations; Site PaZ1, PaZ2, PaD1 PaZ2, PaZ1, PaD2 PaZ3, PaZ2, PaD3 PaZ1, PaZ3, PaD1, PaD3, PaZ2 PaD2, PaD1, PaZ1 PaD3, PaD2, PaZ3 Site x pop Site 4 4 - - p 0.09 0.07 0.15 0.08 <10 <10 g 10 10 10 10 10 10 2 χ n 40 40 40 40 40 40 2.63 2.98 F / 50.65 30.74 1.96 1.74 The The number of initial tillers at time of transplantation was used as a covariate , number of geno g 1 5 4 2 3 1 Df Number ofNumber tillers 2400 2670 2660 2760 2800 2200 Elevation 4 values. - - - p p 0.4 ’’ ’’ 0.016 0.003 0.002 <10 ount ount of precipitation (mm) during July and - 2 2 χ χ - 9°48'15’’ 9°56’54 9°57’20’’ 7°41’51 7°48’15’’ 7°43’26’’ Easting onses in vegetative biomass, reproductive biomass, number of tillers, number of inflorescences, 3.08 5.83 4.92 populations populations sampled across the Swiss Alps. Pop, population abbreviation; Region, geographic F / 47.21 0.697 allopatric allopatric transplant contrast, and the remaining part of the site - - 5 4 2 3 1 Df Reproductive biomass Reproductive populations populations transplanted within and among regions. 4 4 2 - - or far 46°49'01’’ 46°44’49’’ 46°43’41’’ 45°59’16’’ 46°01’02’’ 45°59’26’’ Northing Poa Poa alpina p - 0.07 0.10 <10 <10 0.00 0.004 2 Poa Poa alpina χ Davos Davos Davos Zermatt Zermatt Zermatt Region 4.11 2.79 2.07 8.41 F / 34.87 37.01 effect models for the resp - 1 5 4 2 3 1 Df Vegetative biomass Vegetative PaZ1 PaZ2 PaZ3 PaD1 PaD2 PaD3 Pop ympatric ympatric vs. near Location Location (site name with regional prefix: D for Davos and Z for Zermatt), geographic coordinates (latit Linear Linear mixed , sample size of individuals used in the transplantations; n Table Table 1: a.s.l.) and site characteristics of 6 region; which population was transplanted to which sites; Temp., mean temperature (°C) during July reflecting the length of the growing season; Prec., am sites. of transplantation the exposition Exp., Location D_Flüelapass D_Schwarzhorn D_Schiahorn Z_Schwarzsee Z_Rothorn Z_Furi Table 2: inflorescence height and in population, the s marked in bold are significant after Bonferroni correction (p < 0.007). To account for the replication of clonal tillers, gen the model as a random factor, for which we report of biomass plants. vegetative the and tillers of of number vegetative for analysis the the Covariate Site Population Symp. vs. Allop. x population Site Genotype ! 101 Local adaptation in Poa alpina Fig. 1: Mean values ± SE for the inflorescence height (a), number of reproductive tillers (b) and reproductive biomass (c) for sympatric (S), near-allopatric (NA) and far-allopatric (FA) site × population transplant combinations. Results from the multiple comparisons between groups (post-hoc Tukey HSD test) are indicated as letters contrasts. Fig. 2: Detailed mean ± SD of the number of inflorescences produced by each Poa alpina populations (PAD1, PAD2, PAD3, PAZ1, PAZ2, PAZ3) at each transplant site. Letters illustrate multiple contrasts (post-hoc Tukey HSD test) between site x population transplant combinations. When genotypes from the near-by population the one of the home population, hereby PaZ3 were transplanted to this site, SLA increasing their fitness. increased to an average of 10.99 ± 1.84, in We further analyzed whether directional comparison to a mean of 8.85 ± 0.73 when selection occurred on the degree of plasticity these same genotypes were grown at their in SLA across transplant combinations (i.e. site of origin (Z_Furi). Plastic adjustments correlation between the phenotypic plasticity towards higher SLA values allowed foreign index and mean fitness of genotypes across population to display a mean SLA close to sites). For comparisons across the small 102 Chapter 5 spatial scale (i.e. across sympatric and near- microsatellite signals of a total of 49 allopatric transplant combinations) individuals of five populations. Among the standardized selection gradients for the 49 plants that were analyzed, we detected 62 degree of plasticity were not significant (Piv: banding positions among the five β = -0.10, p = 0.21). Hence, there was no microsatellite loci, between 1 and 44 per evidence that selection favored phenotypic locus. On average, individuals had 16.2 ± plasticity in SLA across the small spatial 2.17 allelic bands and their number did not scale. However, at the larger spatial scale significantly differ between populations. In (i.e. across sympatric and far-allopatric total, we detected 31 multilocus transplant combinations), a significant and microsatellite genotypes. No identical positive selection gradient was detected (Piv: multilocus genotypes were found in β = 0.18, p = 0.006). Accordingly, genotypes population PaD2 and PaZ2, 8 unique showing a higher degree of phenotypic genotypes out of 10 were found in PaZ3 and plasticity in SLA had an increased relative in PaD1, 5 out of 10 in PaZ1, and only 1 out fitness across regions (Fig. 3). of 10 in PaD3. 11% of molecular variance resided among Molecular variance regions, 25% among populations within DNA extraction succeeded in five of the regions, and 64% within populations (Table six populations, with following sample sizes: 4). The genetic differentiation indices, Φ, PAD1, N=10; PAD2, N=9; PAZ1, N = 10; among regions and among populations within PAZ2, N=10; and PAZ3, N=10 (see Table 4). regions were significant. These results In one population (PAD3), DNA of the leaf indicate high molecular regional and samples might have been degraded as population differentiation, which is probably microsatellite PCR did not work. Hence, the due to low gene flow among population. final 1/0 data matrix consisted of Table 3: Mean ± SD SLA values of populations (code in parentheses; see Table 1) transplanted in sympatry, near- or far-allopatry to different sites (Flüelapass: D_Flüela.; Schwarzhorn; D_Schwh.; Schwarzsee; Z_Schws.; Rothorn: Z_Rotho.; and Furi: Z_Furi), and estimated slopes and p-values for the correlation between fitness (i.e. reproductive biomass) and SLA at each site. P-values are marked in bold when significant. Using the populations grown at their site of origin as reference points, we can assess if plastic adjustments in SLA of foreign populations (in allopatry) increased their fitness relative to when grown at their site of origin (in sympatry). SLA Slope Site Sympatric Near-allopatric Far-allopatric b p D_Flüela. 11.46 ± 1.58 (PaD1) 12.45 ± 4.55 (PaD3) 10.96 ± 2.3 (PaZ3) 0.006 0.12 D_Schwh. NA (PaD2) 15.10 ± 4.60 (PaD1) 12.35 ± 1.80 (PaZ1) -0.007 0.18 Z_Schws. 15.76 ± 3.08 (PaZ1) 13.93 ± 4.92 (PaZ2) 11.16 ± 1.75 (PaD1) 0.006 0.38 Z_Rotho. 10.78 ± 2.57 (PaZ2) 10.99 ± 1.84 (PaZ3) NA* (PaD2) 0.031 0.002 Z_Furi 8.85 ± 0.73 (PaZ3) 8.69 ± 1.04 (PaZ1) 9.61 ± 0.84 (PaD3) 0.007 0.30 *NA: missing values are explained by the removal of population PaD2 from analysis. Additionally, SLA could not be measured at the D_Schiahorn site because of harsh meteorological conditions. 103 Local adaptation in Poa alpina Table 4: AMOVA results showing the molecular variance among regions, among populations within regions, and within populations (i.e. 2 regions, 5 populations) as well as genetic differentiation (Φ) among regions and among populations within regions and their significance based on permutation tests. Source df SS MS Est. Var. % Φ p Among regions 1 62.72 62.72 1.25 11 0.11 0.005 Among pops within regions 3 101.37 33.79 2.73 25 0.28 0.001 Within pops 44 307.90 6.99 6.99 64 - - Fig. 3: Linear regression between relative fitness in terms of reproductive biomass and the SLA plasticity index (Piv) across sympatric and far-allopatric transplant combinations. Discussion height for individuals transplanted back into their site of origin (i.e. sympatric) relative to The reciprocal transplantation of P. alpina individuals transplanted to foreign sites (i.e. populations across original field sites allopatric), indicating local adaptation in P. revealed pronounced effects of alpina populations in the Swiss Alps. transplantation sites and populations of origin for all investigated traits indicating Local adaptation inferred from growth- and differences in site conditions and genetic reproduction-related traits differences amongst populations. For most Poa alpina populations showed a home- traits, populations differed also in their region advantage. Individuals transplanted responses to transplantation sites. These site back to their site of origin (in sympatry), or × population interactions reflected a higher to a near-by site within the same region (in reproductive biomass and inflorescence near-allopatry) had a higher reproductive 104 Chapter 5 biomass. This signature for local adaptation Inflorescence height decreased in both near- in this fitness proxy is likely to be a result of and far-allopatric transplant combinations the combination of increased inflorescence relative to sympatric ones, suggesting that height in individuals from sympatric plants grew better not only in their region of transplant combinations (Fig. 1a) and of origin, but also at their site of origin within decreased inflorescence number in the region (i.e. small spatial scale). This individuals from half of the far-allopatric result highlights that divergent selection can transplant combinations (Fig. 2). As both also lead to adaptive differentiation across these traits directly contribute to the total relatively short distances in the alpine reproductive biomass, we suggest that the landscape (Gonzalo-Turpin and Hazard, similar patterns found in these traits reflect 2009). While micro-geographic adaptation is their association to reproductive biomass. often hindered by gene flow among nearby Ultimately, these results indicate a higher populations (Kawecki and Ebert, 2004, reproductive output in individuals grown in Richardson et al., 2014), we found a high their site and region of origin, and local molecular differentiation among nearby adaptation of P. alpina populations populations within the same region (Table 4). distributed across the Swiss Alps. While previous estimations of dispersal The reproductive biomass significantly distance of Poa seeds showed that seeds decreased in far-allopatric transplant could potentially disperse across large combinations, indicating that local adaptation distances (Tackenberg and Stöcklin, 2008), occurred in response to coarse-grained Poa alpina mainly reproduces via environmental variability and was probably pseudoviviparous bulbils at high elevation related to regional differences in climatic (Steiner et al., 2012). Hence, the restricted conditions and length of the growing season. gene flow, maintained through few apomictic Indeed, Zermatt is a warmer and drier region seed producers, is unlikely to counteract than Davos (Table 1) and also receives less population differentiation and local snow during winter, leading to earlier adaptation even at the small spatial scale snowmelt and a longer growing season. As a studied here. This however emphasizes the result, the higher reproductive output importance of considering appropriate spatial displayed by individuals transplanted within scales relative to the dispersal distance of their region of origin probably reflects genes when studying patterns of local genetic adaptation to the regional length of adaptation in widespread species the growing season (Gugger et al., 2015). (Baythavong, 2011). Furthermore, this result is in line with a The total number of tillers and the number of studies that have found local vegetative biomass differed between adaptation to coarse-grained environmental transplant sites and/or population of origin. variation (Galloway and Fenster, 2000, Banta However, no interaction was found between et al., 2007, Volis et al., 2015) and supports these factors and sympatric transplant the general consensus that local adaptation is combinations did not differ from allopatric more likely to occur over large geographic ones. While these traits are often used to distances as a result of increasing measure plant performance (Kawecki and environmental divergences and genetic Ebert, 2004) we argue that, in the case of P. isolation (Kawecki and Ebert, 2004, alpina, they might not be the most suitable Hereford and Winn, 2008, Volis et al., 2015). traits for detecting patterns of local 105 Local adaptation in Poa alpina adaptation. Vegetative growth in P. alpina is photosynthesis (Poorter et al., 2009). At the mainly self-sustainable through other sites, where no correlation between photosynthesis in leaves and stems, while the fitness and SLA was found, the combination production of reproductive structures is more of abiotic factors might have had costly (Watson, 1984). When flowering, P. confounding effects or might not have been alpina stops investing resources in growth of strong enough to impose selection on this leaves and invests instead in reproductive trait. Furthermore, one should also consider shoots (Jürg Stöcklin, personal observation). that SLA is a highly integrated measure Since the majority of individuals in our study indicative for various ecophysiological reproduced (89%), differences in characteristics (Poorter et al. 2009), and performance are probably limited in therefore selection might also have acted on vegetative structures and mainly visible in correlated traits not studied here (Conner and reproductive traits. Furthermore, instead of Hartl, 2004). measuring plant reproductive output at a Interestingly, the degree of plasticity in certain point in time, studies should SLA (Piv) was positively correlated with preferentially focus on lifetime fitness (Shaw mean relative fitness of genotypes et al., 2008, Shaw and Shaw, 2014). Ideally, transplanted across regions (i.e. far-allopatric germination rates, and seed-to-seedling transplantations). Selection thus favored a transitions, which are critical components of high level of plasticity in SLA across coarse- life histories, should be investigated and grained habitats, a result that contrasts with integrated into local adaptation studies our initial hypothesis. Indeed, phenotypic (Geber and Eckhart, 2005, Shaw and plasticity was expected to be favored across Etterson, 2012, Kim and Donohue, 2013, fine-grained habitats, as demonstrated Shaw and Shaw, 2014, Wilczek et al., 2014). empirically for the first time by Baythavong (2011). While our study may lack the Phenotypic plasticity in SLA statistical power to reveal selection for The variance components analysis plasticity across fine-grained habitats, our revealed that most of the variation in SLA results generally confirm that a high degree was explained by site effects (plasticity) and of phenotypic plasticity in this trait is the site × population interaction (differences adaptive (Nicotra et al., 2015). As such, in plasticity between populations). adaptive phenotypic plasticity represents a Furthermore, directional selection favored means for P. alpina to maximize fitness in high SLA values at the Z_Rothorn site, heterogeneous environments (Alpert and where a significant positive relationship was Simms, 2002, Baythavong, 2011). found between SLA and the reproductive biomass (Table 3). When foreign individuals Inferences about the adaptive potential of were transplanted to this site, plastic Poa alpina adjustments occurred towards higher SLA Our AMOVA revealed high within- values, approaching the mean displayed by population molecular variance (Table 4), and the population of origin. An increase in SLA in reciprocal transplantations we found at the Z_Rothorn site, which had a highly significant genotype effects in most northwestern exposition with lower light quantitative traits (Table 2), and high genetic availability, could allow enhanced light differences among P. alpina populations interception, gas exchange and (Table 2). These results highlight that 106 Chapter 5 considerable genetic variation, which natural critical for P. alpina to cope with novel selection can act upon, is existent in this environments or range boundaries (Alpert species widespread across the Swiss Alps, as and Simms, 2002, Nicotra et al., 2010). previously shown by Rudmann-Maurer et al. Indeed, our study revealed that phenotypic (2007) and Fischer et al. (2008). plasticity in SLA was high across transplant Furthermore, the rigorous meta-population sites and positively correlated with plant approach used here for analyzing reciprocal fitness when individuals were transplanted transplantations revealed a home-site across regions. Therefore, we suggest that advantage indicative of local adaptation. The alongside with intraspecific genetic evidence of adaptive variation among differentiation, phenotypic plasticity in this populations together with highly significant species’ traits is critical to moderate the risk genotype effects suggests that there is a of local extinction when facing climate considerable adaptive potential to changing change. environmental conditions in Poa alpina (i.e. microevolutionary ability; Fischer et al., Conclusion 2011). However, the question remains whether and to what extent adaptive genes of Our study revealed adaptive genetic P. alpina populations can spread across the differentiation between P. alpina populations alpine landscape (Pluess et al., 2016). in the Swiss Alps reflecting local adaptation Considering the high genetic differentiation across fine- and coarse-grained habitats. revealed among populations by neutral While local adaptation of P. alpina molecular markers gene flow seems limited populations across regions was expected due even between nearby populations. to increasing environmental variation and Furthermore, whereas seeds from apomictic genetic isolation with increasing spatial plants at lower elevation may possess scale, our results revealed that the adequate dispersal ability, bulbil-producing pronounced fine-grained environmental plants (i.e. clonal reproduction) at higher variation in the alpine landscape, coupled elevations may have much more restricted with reproductive mode of this species, also dispersal. Based on the previous elements, lead to genetic differentiation across fine- dispersal ability is probably low and gene grained habitats. Furthermore, our results flow restricted, suggesting that the effective confirm that phenotypic plasticity in SLA adaptive potential of Poa alpina to rapid contributes to the maintenance of fitness climate change may be compromised. In this homeostasis across heterogeneous context, adaptive phenotypic plasticity environments. Hence, we conclude that both becomes even more crucial by allowing adaptive genetic differentiation and short-term responses to changes in phenotypic plasticity act as complementary environmental conditions, and buffering mechanisms allowing adaptation of against climate change (Price et al., 2003, widespread species to fine- and coarse- Nicotra et al., 2010). Moreover, when grained habitats, and may contribute to the considering the high neutral molecular short- and long-term adaptive potential of P. differentiation found among P. alpina alpina to climate change. populations and the polyploid complex of this species (Muntzing, 1980), we suggest that adaptive phenotypic plasticity might be 107 Local adaptation in Poa alpina Acknowledgments Gütlin for their help in setting up the experiment and in the field. This work was We thank the municipalities of Davos in supported by the Swiss National Science the canton of Graubünden and of Zermatt in Foundation project no. 3100A-135611 to the canton of Valais, as well as the owners of J.S., and the Freiwilige Akademische private land parcels for allowing us to Gesellschaft Basel and the Basler Stiftung für conduct the reciprocal transplantations on Biologische Forschung to E.H. The authors their land. Acknowledgments also go out to have no conflict of interest to declare. Guy Villaume, Simona Gugger and Ayaka Cornelissen JHC, Lavorel S, Garnier E, Diaz S, References Buchmann N, Gurvich DE, Reich PB, ter Aeschimann L, Lauber K, Moser DM, Theurillat Steege H, Morgan HD, van der Heijden JP. 2004. Flora alpina. Bern, Switzerland: MGA, Pausas JG, Poorter H. 2003. A Haupt Verlag. handbook of protocols for standardised and Alpert P, Simms EL. 2002. The relative advantages easy measurement of plant functional traits of plasticity and fixity in different worldwide. Australian Journal of Botany, 51: environments: when is it good for a plant to 335-380. adjust? Evolutionary Ecology, 16: 285-297. Crawley MJ. 2007. The R Book. West Sussex, Banta JA, Dole J, Cruzan MB, Pigliucci M. 2007. England: John Wiley & Sons. Evidence of local adaptation to coarse- Fischer M, Rudmann-Maurer K, Weyand A, grained environmental variation in Stoecklin J. 2008. Agricultural land use and Arabidopsis thaliana. Evolution, 61: 2419- biodiversity in the Alps - How cultural 2432. tradition and socioeconomically motivated Baythavong BS. 2011. Linking the Spatial Scale of changes are shaping grassland biodiversity in Environmental Variation and the Evolution the Swiss Alps. Mountain Research and of Phenotypic Plasticity: Selection Favors Development, 28: 148-155. Adaptive Plasticity in Fine-Grained Fischer M, Weyand A, Rudmann-Maurer K, Environments. American Naturalist, 178: 75- Stocklin J. 2011. Adaptation of Poa alpina to 87. altitude and land use in the Swiss Alps. Bennington CC, Fetcher N, Vavrek MC, Shaver Alpine Botany, 121: 91-105. GR, Cummings KJ, McGraw JB. 2012. Frei ER, Ghazoul J, Matter P, Heggli M, Pluess Home site advantage in two long-lived arctic AR. 2014. Plant population differentiation plant species: results from two 30-year and climate change: responses of grassland reciprocal transplant studies. Journal of species along an elevational gradient. Global Ecology, 100: 841-851. Change Biology, 20: 441-455. Blanquart F, Kaltz O, Nuismer SL, Gandon S. Galloway LF, Fenster CB. 2000. Population 2013. A practical guide to measuring local differentiation in an annual legume: Local adaptation. Ecology Letters, 16: 1195-1205. adaptation. Evolution, 54: 1173-1181. Briggs D, Walters SM. 1997. Plant variation and Garnier E, Navas ML, Grigulis K. 2015. Plant evolution: University Press, Cambridge, functional diversity: organism traits, United Kingdom. community structure, and ecosystem Byars SG, Papst W, Hoffmann AA. 2007. Local properties. Oxford, United Kingdom: Oxford adaptation and cogradient selection in the University Press. alpine plant, Poa hiemata, along a narrow Geber MA, Eckhart VM. 2005. Experimental studies altitudinal gradient. Evolution, 61: 2925- of adaptation in Clarkia xantiana. II. Fitness 2941. variation across a subspecies border. Byars SG, Parsons Y, Hoffmann AA. 2009. Effect Evolution, 59: 521-531. of altitude on the genetic structure of an Ghalambor CK, McKay JK, Carroll SP, Reznick Alpine grass, Poa hiemata. Annals of Botany, DN. 2007. Adaptive versus non-adaptive 103: 885-899. phenotypic plasticity and the potential for Conert HJ. 1998. Poa alpina. In H. J. Conert, E. J. contemporary adaptation in new Jäger, J. W. Kadereit et al., editor. Gustav environments. Functional Ecology, 21: 394- Hegi Illustrierte Flora von Mitteleuropa, 690- 407. 693. Parey Buchverlag: Berlin, Germany. Gienapp P, Teplitsky C, Alho JS, Mills JA, Merila Conner JK, Hartl DL. 2004. A primer of ecological J. 2008. Climate change and evolution: genetics. MA, USA: Sinauer Associates. 108 Chapter 5 disentangling environmental and genetic the Swiss Alps. Ph.D. dissertation, University responses. Molecular Ecology, 17: 167-178. of Basel, Basel, Switzerland. Gonzalo-Turpin H, Hazard L. 2009. Local Maurer K, Gautschi B, Weyand A, Stöcklin J, adaptation occurs along altitudinal gradient Fischer M. 2005. Isolation and despite the existence of gene flow in the characterization of microsatellite DNA alpine plant species Festuca eskia. Journal of markers in the grass Poa alpina L. Molecular Ecology, 97: 742-751. Ecology Notes, 5: 719-720. Gugger S, Kesselring H, Stöcklin J, Hamann E. MeteoSwiss. 2015. Federal Office of Meteorology 2015. Lower plasticity exhibited by high- and Climatology. versus mid-elevation species in their http://www.meteoswiss.admin.ch phenological responses to manipulated (12.11.2015). temperature and drought. Annals of Botany, Muntzing A. 1940. Further studies on apomixis and 116: 953-962. sexuality in Poa. Hereditas, 26: 115-188. Hautier Y, Randin CF, Stocklin J, Guisan A. 2009. Muntzing A. 1980. Mode of propagation and Changes in reproductive investment with chromosomal pecularities in scoth material of altitude in an alpine plant. Journal of Plant Poa alpina. Hereditas, 92: 291-296. Ecology, 2: 125-134. Nicotra AB, Atkin OK, Bonser SP, Davidson AM, Hereford J, Winn AA. 2008. Limits to local Finnegan EJ, Mathesius U, Poot P, adaptation in six populations of the annual Purugganan MD, Richards CL, plant Diodia teres. New Phytologist, 178: Valladares F, van Kleunen M. 2010. Plant 888-896. phenotypic plasticity in a changing climate. Kawecki TJ, Ebert D. 2004. Conceptual issues in Trends in Plant Science, 15: 684-692. local adaptation. Ecology Letters, 7: 1225- Nicotra AB, Segal DL, Hoyle GL, Schrey AW, 1241. Verhoeven KJF, Richards CL. 2015. Kim E, Donohue K. 2013. Local adaptation and Adaptive plasticity and epigenetic variation plasticity of Erysimum capitatum to altitude: in response to warming in an Alpine plant. its implications for responses to climate Ecology and Evolution, 5: 634-647. change. Journal of Ecology, 101: 796-805. Peakall R, Smouse PE. 2006. GENALEX 6: genetic Körner C. 2003. Alpine plant life: functional plant analysis in Excel. Population genetic ecology of high mountain ecosystems. software for teaching and research. Germany: Springer Verlag. Molecular Ecology Notes, 6: 288-295. Kuznetsova A, Brockhoff PB, Christensen RHB. Pierce S, Stirling CM, Baxter R. 2003. 2013. lmerTest: Tests for random and fixed Pseudoviviparous reproduction of Poa alpina effects for linear mixed effect models (lmer var. vivipara L. (Poaceae) during long-term objects of lme4 package) http://cran.r- exposure to elevated atmospheric CO2. project.org/package=lmerTest. Annals of Botany, 91: 613-622. Lande R, Arnold SJ. 1983. The Measurement of Pigliucci M. 2001. Phenotypic Plasticity: Beyond Selection on Correlated Characters. Nature and Nurture. Baltimore, Maryland, Evolution, 37: 1210-1226. USA: John Hopkins University Press. Lauber K, Wagner G. 2001. Flora Helvetica. Bern, Pigliucci M, Murren CJ, Schlichting CD. 2006. Switzerland: Haupt Verlag. Phenotypic plasticity and evolution by Lavorel S, Garnier E. 2002. Predicting changes in genetic assimilation. Journal of Experimental community composition and ecosystem Biology, 209: 2362-2367. functioning from plant traits: revisiting the Pluess AR, Frank A, Heiri C, Lalagüe H, Holy Grail. Functional Ecology, 16: 545- Vendramin GG, Oddou-Muratorio S. 556. 2016. Genome–environment association Liancourt P, Boldgiv B, Song D, Spence LA, study suggests local adaptation to climate at Helliker BR, Petraitis PS, Casper BB. the regional scale in Fagus sylvatica. New 2015. Leaf-trait plasticity and species Phytologist, 210: 589-601. vulnerability to climage change in a Poorter H, Niinemets U, Poorter L, Wright IJ, Mongolian steppe. Global Change Biology, Villar R. 2009. Causes and consequences of 21: 3489-3498. variation in leaf mass per area (LMA): a Matter P, Kettle CJ, Frei ER, Ghazoul J, Pluess meta-analysis. New Phytologist, 182: 565- AR. 2014. Geographic distance is more 588. relevant than elevation to patterns of Price TD, Qvarnstrom A, Irwin DE. 2003. The role outbreeding in Ranunculus bulbosus. Journal of phenotypic plasticity in driving genetic of Ecology, 102: 518-530. evolution. Proceedings of the Royal Society Maurer K. 2005. Natural and anthropogenic of London Series B-Biological Sciences, 270: determinants of biodiversity of grasslands in 1433-1440. 109 Local adaptation in Poa alpina R Development Core Team. 2008. R: A language Shaw RG, Shaw FH. 2014. Quantitative genetic and environment for statistical computing. R study of the adaptive process. Heredity, 112: foundation for Statistical Computing, Vienna, 13-20. Austria. Stanton ML, Galen C. 1997. Life on the edge: Relyea RA. 2002. Costs of Phenotypic plasticity. The Adaptation versus environmentally mediated American Naturalist, 159: 272-282. gene flow in the snow buttercup, Ranunculus Richardson JL, Urban MC, Bolnick DI, Skelly DK. adoneus. American Naturalist, 150: 143-178. 2014. Microgeographic adaptation and the Steiner BL, Armbruster GFJ, Scheepens JF, spatial scale of evolution. Trends in Ecology Stocklin J. 2012. Distribution of bulbil- and & Evolution, 29: 165-176. seed-producing plants of Poa alpina Richter S, Kipfer T, Wohlgemuth T, Guerrero CC, (Poaceae) and their growth and reproduction Ghazoul J, Moser B. 2012. Phenotypic in common gardens suggest adaptation to plasticity facilitates resistance to climate different elevations. American Journal of change in a highly variable environment. Botany, 99: 2035-44. Oecologia, 169: 269-279. Sultan SE, Spencer HG. 2002. Metapopulation Rudmann-Maurer K, Weyand A, Fischer M, structure favors plasticity over local Stocklin J. 2007. Microsatellite Diversity of adaptation. American Naturalist, 160: 271- the Agriculturally Important Alpine Grass 283. Poa alpina in Relation to Land Use and Tackenberg O, Stöcklin J. 2008. Wind dispersal of Natural Environment. Annals of Botany, 100: alpine plant species: A comparison with 1249-1258. lowland species. Journal of Vegetation Scheepens JF, Frei ES, Stöcklin J. 2010. Genotypic Science, 19: 109-118. and environmental variation in specific leaf Till-Bottraud I, Gaudeul M. 2002. Intraspecific area in a widespread Alpine plant after genetic diversity in alpine plants. In: transplantation to different altitudes. Mountain Biodiversity: A Global Assessment. Oecologia, 164: 141-150. New York, NY: Parthenon Publishing. Scheepens JF, Stöcklin J. 2013. Flowering Valladares F, Sanchez-Gomez D, Zavala MA. 2006. phenology and reproductive fitness along a Quantitative estimation of phenotypic mountain slope: maladaptive responses to plasticity: bridging the gap between the transplantation to a warmer climate in evolutionary concept and its ecological Campanula thyrsoides. Oecologia, 171: 679- applications. Journal of Ecology, 94: 1103- 691. 1116. Scherrer D, Körner C. 2010. Infra-red thermometry van Kleunen M, Fischer M, Schmid B. 2000. Costs of alpine landscapes challenges climatic of plasticity in foraging characteristics of the warming projections. Global Change clonal plant Ranunculus reptans. Evolution, Biology, 16: 2602-2613. 54: 1947-1955. Schröter C. 1926. Das Pflanzenleben der Alpen. Van Tienderen PH. 1991. Evolution of generalists Zürich, Switzerland: Verlag Alpert Raustein. and specialists in spatially heterogeneous Sedlacek J, Wheeler JA, Cortés AJ, Bossdorf O, environments. Evolution, 45: 1317-1331. Hoch G, Lexer C, Wipf S, Karrenberg S, Van Tienderen PH. 1997. Generalists, specialists, van Kleunen M, Rixen C. 2015. The and the evolution in sympatric populations of Response of the Alpine Dwarf Shrub disctinct species. Evolution, 51: 1372-1380. 110 Chapter 6 Chapter 6 High intraspecific phenotypic variation, but little evidence for local adaptation in Geum reptans populations in the Central Swiss Alps Elena Hamann*, Halil Kesselring, GFJ Armbruster, JF Scheepens and Jürg Stöcklin *E. Hamann is the corresponding author. Alpine Botany (2017) 127: 121-132 DOI: 10.1007/s00035-017-0185-y, available at www.springer.com 111 Local adaptation in Geum reptans 112 Chapter 6 High intraspecific phenotypic variation, but little evidence for local adaptation in Geum reptans populations in the Central Swiss Alps Elena Hamann*a, Halil Kesselringa, Georg F.J. Armbrustera, J.F. Scheepensb, Jürg Stöcklina aInstitute of Botany, Department of Environmental Sciences, Section Plant Ecology, University of Basel, Schönbeinstrasse 6, CH-4056 Basel, Switzerland bPlant Evolutionary Ecology, Institute of Evolution & Ecology University of Tübingen, Auf der Morgenstelle 5, DE-72076 Tübingen, Germany For correspondence: [email protected] Abstract • The Alpine landscape is characterized by high spatiotemporal heterogeneity in environmental variables, such as climate and soil characteristics. This may lead to divergent selection pressures across plant populations and to local adaptation. Geum reptans, a widespread high-alpine clonal herb, has been the subject of several studies investigating phenotypic variation in populations across the Swiss Alps, yet so far, there is only little knowledge about local adaptation in this species from reciprocal transplantations across original field sites. • Here, we reciprocally transplanted three populations of Geum reptans in the Central Swiss Alps, growing at close or far geographical distance from each other, and compared growth- and reproduction-related traits to investigate patterns of local adaptation. We further measured leaf morphological traits to assess potential selection at field sites, and quantified the relative importance of genetic vs. environmental variation (i.e. phenotypic plasticity) for all traits. Additionally, among and within population genetic differentiation was analyzed using microsatellite markers. • Molecular diversity was high within populations, and molecular differentiation increased with geographic distance among populations, suggesting that gene flow is maintained at close range, but decreased with distance. Although extensive phenotypic variation was found across site × population transplant combinations, our study revealed little evidence for local adaptation in G. reptans populations. Plant traits also showed strong plasticity, as revealed by pronounced site effects, yet no direct linear selection was detected on leaf trait values within field sites. • We suggest that the glacier forelands studied here, which are representative of the habitat of large G. reptans populations, are too similar in environmental conditions to lead to among population intraspecific differentiation in line with local adaptation. As G. reptans showed a great capacity to respond plastically to environmental conditions, we cautiously advocate that the evolution of phenotypic plasticity might have prevailed over genetic differentiation for the adaptation to the relatively narrow niche of this species. Keywords: genetic differentiation, high-alpine clonal herb, molecular variation, phenotypic plasticity, reciprocal transplantation experiment. 113 Local adaptation in Geum reptans Introduction differentiation and plasticity), as well as the conditions for their evolution under divergent Alpine ecosystems are characterized by selection, are theoretically well-understood, steep environmental gradients over short empirical evidence is rather scarce geographic distances (Körner, 2003) and a (Baythavong, 2011, Hamann et al., 2016). patchy microhabitat distribution (Scherrer The spatial grain size of environmental and Körner, 2011), which offers numerous variation, defined by the degree of niches to alpine plant species (Aeschimann et environmental variation as perceived by an al., 2004). These characteristics of the alpine individual plant across its dispersal distance, landscape are often also associated with is likely to determine which of these spatial isolation among populations and mechanisms prevails (Alpert and Simms, restricted gene flow (Stöcklin et al., 2009), 2002, Pigliucci et al., 2003, Kawecki and which may allow for intraspecific population Ebert, 2004). Generally, adaptive genetic differentiation and local adaptation. differentiation is expected when spatial grain Furthermore, at high elevation, plant life is size is coarse, whereas the evolution of challenged by low temperatures, late snow- phenotypic plasticity is expected when melting, short vegetation periods and spatial grain size is fine (Baythavong, 2011, extreme weather events (Billings and Richardson et al., 2014). As such, local Mooney, 1968, Körner, 2003). In this adaptation via genetic differentiation is more heterogeneous habitat, plants can adapt likely to occur when gene flow is limited genetically to locally prevailing conditions between populations, as is the case in (Byars et al., 2007, Gonzalo-Turpin and naturally fragmented landscapes or in Hazard, 2009), and/or respond to populations separated by great geographic spatiotemporal variability in environmental distances (Kawecki and Ebert, 2004, Leimu conditions via adaptive phenotypic plasticity and Fischer, 2008). Alternatively, adaptive (Sultan, 1995). genetic differentiation is unlikely to evolve Intraspecific phenotypic variation when gene flow among populations is resulting from genetic drift or natural extensive, and depending on the spatial grain selection (Volis et al., 2015) is common in size, the evolution of phenotypic plasticity widely distributed species (Bradshaw, 1984, may prevail (Kawecki and Ebert, 2004). Joshi et al., 2001, Banta et al., 2007) and has However, certain exceptions have been frequently been observed in alpine plant documented, such as adaptive genetic species (Pluess and Stöcklin, 2004, Giménez- differentiation despite extensive gene flow, Benavides et al., 2007, Byars et al., 2009, under strong micro-geographic divergent Gonzalo-Turpin and Hazard, 2009, Stöcklin selection (Gonzalo-Turpin and Hazard, 2009, et al., 2009, Frei et al., 2012). Moreover, Richardson et al., 2014). strong phenotypic plasticity is likewise Local adaptation is also contingent on common in alpine species, and has been other factors such as plant mating system, shown to provide a potential advantage for longevity and clonality due to their effects on the persistence and survival of alpine species genetic diversity and the degree of genetic in a heterogeneous environment (Stöcklin et differentiation of populations (Galloway and al., 2009, Frei et al., 2014). While the relative Fenster, 2000, Kawecki and Ebert, 2004). role of these two non-mutually exclusive Selfing, as opposed to outcrossing, reduces strategies (i.e. adaptive genetic genetic diversity within populations, thereby 114 Chapter 6 compromising future adaptive potential Stöcklin, 2004) and natural habitat isolation (Linhart and Grant, 1996). Similarly, (Stöcklin et al., 2009). Direct measures of clonality can limit the potential for local gene flow via seeds and pollen indicated the adaptation in case of limited sexual maintenance of considerable gene flow over reproduction restricting genetic diversity short distances and low molecular within and among populations, but allows for differentiation among close populations plastic foraging among ramets (van Kleunen (Pluess and Stöcklin, 2004). Furthermore, a and Fischer, 2001). Additionally, clonal glasshouse experiment revealed the great plants may be less locally adapted currently capacity of G. reptans to respond plastically if long-lived genets reflect adaptation to past to changes in environmental conditions, conditions (Leimu and Fischer, 2008, de especially in its reproductive behavior Witte and Stöcklin, 2010). Nevertheless, at (Pluess and Stöcklin, 2005). Finally, a high elevation, clonal reproduction is common garden experiment with 20 G. common amongst alpine species, and is reptans populations spanning all associated with benefits such as the ability to biogeographic regions of the European Alps forage for resources, support the revealed that phenotypic differentiation establishment of offspring, and buffer against reflected the glacial history of this species environmental variation (Billings and shaped by founder effects and past selection, Mooney, 1968). but also suggested adaptation to current Geum reptans L. (Rosaceae) is a long- climate conditions (Frei et al., 2012). lived clonal species occurring in high-alpine However, to rigorously prove that adaptation environments that reproduces sexually via to local conditions has occurred, reciprocal strictly outcrossing flowers and vegetatively transplantation experiments across original via clonal ramets on stolons. This species is field sites are necessary (Kawecki and Ebert, an ideal system to study phenotypic variation 2004), which have so far never been and local adaptation, as it has been the performed with this species. subject of numerous prior investigations Consequently, this study aimed at describing molecular and phenotypic complementing previous ones, by variation, as well as gene flow among investigating local adaptation via reciprocal populations in the European Alps, and the transplantations of G. reptans populations relative importance of clonal vs. sexual growing at close or far geographical reproduction (Pluess and Stöcklin, 2004, distances from each other in the Central Pluess and Stöcklin, 2005, Weppler et al., Swiss Alps, and generally contributes to the 2006, Stöcklin et al., 2009, Frei et al., 2012). body of empirical studies testing for local Findings from Weppler et al. (2006) adaptation among alpine species. We suggested that the role of sexual reproduction investigated patterns of local adaptation in was not restricted to the maintenance of growth and reproductive traits by comparing genetic variation or long-distance dispersal, the performance of sympatric and near- or but played an equally important role for far-allopatric site × population transplant population growth as reproduction via clonal combinations. We further measured leaf offspring (Weppler et al., 2006). Moreover, morphology traits known to be particularly prior studies showed that genetic diversity plastic, yet not directly related to plant fitness within populations is high despite clonality (Frei et al., 2012), and investigated plastic (Ellstrand and Elam, 1993, Pluess and responses to environmental site effects. For 115 Local adaptation in Geum reptans all traits, we quantified the importance of forming new rosettes (ramets) at the end of genetic vs. environmental variation (i.e. long stolons, but can also reproduce sexually phenotypic plasticity), and leaf traits were via seeds borne on a single-flowered stem. further used to investigate potential selection Both reproductive strategies are not mutually for mean trait values at each site. In addition, exclusive and seem to contribute equally to we analyzed among and within population population growth (Weppler et al., 2006). genetic diversity and molecular The yellow flowers are proterogynous, differentiation using microsatellite markers. pollinated by insects and c. 100 seeds are We specifically investigate: (1) whether produced per flower (Pluess and Stöcklin, patterns of local adaptation are present 2004). Seed dispersal spectra obtained from amongst the studied populations of G. simulations showed that most seeds are reptans (i.e. sympatric site × population dispersed across less than 10m, while long- transplant combinations outperform distance seed dispersal over 100m and allopatric ones), (2) whether phenotypic 1000m can occur for 0.015% and 0.005% of plasticity is revealed in reproductive and leaf seeds, respectively (Pluess and Stöcklin, traits across sites, (3) if site-specific selection 2004, Tackenberg and Stöcklin, 2008). acts on leaf traits, and (4) whether genetic diversity within populations is maintained Reciprocal transplantations despite clonality and low molecular Three large G. reptans populations were differentiation among close populations (i.e. chosen for this reciprocal transplantation because of gene flow over short distance). experiment growing at close or far distance from each other in the Central Swiss Alps Material and methods (Table 1). For clarity, we will refer to the populations using italic font and to the sites using capital letters. Two populations, Study species abbreviated as Flu growing at Flüelapass Geum reptans L. is a long-lived high- (FLU) and Dur growing at Dürrboden alpine species belonging to the Rosaceae (DUR), were located at relatively close family. It is widespread in the European Alps proximity from each other (c. 5 km) near and extends eastward to the Carpathian Davos (canton of Graubünden, Switzerland). mountains (Conert et al., 1995). The species A third population, abbreviated as Mut occurs above 2100 m above sea level (a.s.l.) growing at Muttgletscher (MUT), was up to 3800 m a.s.l., and grows typically on located at a larger geographic distance (c. moraines in glacier forelands, and on moist 110 km from Davos) near the Furkapass (on scree fields and mountain ridges the border between the canton of Uri and the (Aeschimann et al., 2004). Geum reptans is canton of Valais, Switzerland). All three sites an early-successional species colonizing are glacier forelands but differed in elevation virgin soils after glacier retreat and usually and exposition (Table 1). Soil temperature persists until interspecific competition was recorded (as a proxy of smoothed air becomes too strong (Weppler et al., 2006). temperature; Körner and Paulsen, 2004) The species grows in rosettes with dissected during the second growing season (July – compound leaves. The number of leaflet October 2015) using one data logger buried pairs on a leaf usually ranges from c. 5 – 15. in the soil at a depth of 5 cm at each site Geum reptans can reproduce vegetatively by (Thermochrome iButton Device Model 116 Chapter 6 DS1921G, Maxim Intergrated Products, Inc., meteorological stations (MeteoSwiss, 2015), California, USA). Mean temperature differed also differed between sites when summed among sites when averaged over the time of over the second growing season (July – measurement (Table 1). Precipitation October 2015; Table 1). records, obtained for each site from nearby Table 1: Location, geographic coordinates (latitude, longitude), elevation (m a.s.l.) and site characteristics of 3 Geum reptans populations sampled in the Central Swiss Alps. Pop, population abbreviation (in italic font); n, sample size of individuals used in the transplantations; Temp., mean temperature (°C) averaged from July-October 2015, indicative of the length of the growing season, measured with data loggers at each site; Prec., summed amount of precipitation (mm) from July-October 2015, as obtained from the nearest weather stations to our sites (Weissfluhjoch for FLU, Davos for DUR, Gütsch ob Anderatt for MUT, respectively; MeteoSwiss 2015); Exp., exposition of the slopes of the transplantation sites. Location Pop Latitude Longitude Elevation n Temp. Prec. Exp. Flüelapass (FLU) Flu 46°44’54’’ 9°56’54’’ 2400 40 8.85 570 NE Dürrboden (DUR) Dur 46°42’29’’ 9°56’12’’ 2290 40 10.22 525 NE Muttgletscher (MUT) Mut 46°33’27’’ 8°24’39’’ 2480 40 7.39 465 NW In September 2013 G. reptans populations sites, plants were placed outdoors (Botanical were sampled from all three sites. For each Garden, Basel, Switzerland) for acclimation. population, 40 healthy mother plants were In July 2014, plants were reciprocally randomly chosen and three viable stolons transplanted into field sites as soon as the with rosettes (ramets) were collected from snow had melted and the growing season had each of these individual. A minimum started. For each population, one ramet per sampling distance of 5 m between mother genet was transplanted to each of the three plants was respected to minimize the risk of sites. Each site thus received a total of 120 resampling genotypes (Pluess and Stöcklin, individuals, represented by 40 individuals per 2004). Rosettes were kept in plastic bags and population (40 genets × 3 populations). Due stored at 4 °C in the dark for a maximum of to the MUT site being far away from the two two days until they were planted in the relatively nearby sites near Davos, greenhouse (Botanical Institute, Basel, transplantation resulted in 3 sympatric (i.e. Switzerland) in separate pots 7 x 7 x 8 cm populations transplanted back to their site of filled with potting soil (Containererde, origin), 2 near-allopatric (i.e. populations Ökohum GmbH, Herrenhof, Switzerland). transplanted to a site at close proximity) and Rosettes were grown for nine months in the 4 far-allopatric (i.e. populations transplanted greenhouse, watered regularly to soil to a site at far distance) site × population capacity, fertilized once a month (Wuxal, transplant combinations. Individuals were Syngenta Agro, Dielsdorf, Switzerland), and transplanted into the local soil, in a patch ® treated once with an insecticide (Spruzit , within the natural populations, and Neudorff GmbH, Germany) to control experienced local intra- and inter-specific infestations of Aphidoidae and Aleyrodidae. competition, reflecting natural conditions. Four weeks before transplantation to field Tagged individuals were planted in rows of 10, alternating between populations, with a 117 Local adaptation in Geum reptans minimal spacing of 20 cm between each sympatric vs. allopatric contrast, we tested other, and were watered once after planting whether the means of the three (sympatric, to facilitate establishment. near-allopatric and far-allopatric) Initial number of leaves was counted distributions significantly differed from each immediately after transplantation. After two other. To this end, we specified models growing seasons, in October 2015 we including the factors site, population, and the assessed whether plants had survived and contrast between sympatric, near- and far- reproduced. Number of leaves was counted allopatric transplant combinations (Blanquart on surviving individuals, and the number of et al., 2013). Local adaptation was flowers and/or stolons was counted for considered to be operating if (i) the sympatric reproductive individuals. The total number of vs. allopatric contrast was significant, and if reproductive meristems was calculated for (ii) sympatric transplant combinations each individual by adding individual number outperformed allopatric ones (Blanquart et of flowers and stolons. To assess the relative al., 2013). The replication of genets within importance of clonal vs. sexual reproduction, populations was accounted for by including we calculated the clonality of each individual this factor in the models as a random factor. as the proportion of stolons on all The initial number of leaves recorded at the reproductive meristems. For each individual, time of transplantation was included in the we identified the longest leaf, measured its model as a covariate to account for effects of length and width, and counted the number of initial plant size. This factor was, however, leaflets. As an indicator of its leaf shape, (i.e. non-significant and therefore removed from also called leaf aspect ratio) we calculated the model for all traits except the final the ratio between leaf length and leaf width. number of leaves. Degree of leaf dissection was estimated by For traits related to leaf morphology (i.e. dividing the number of leaflets by the leaf leaf shape, leaf dissection and SLA), we length. SLA was assessed for each individual analyzed if plastic responses were displayed by taking four circular corings of 5 mm ∅ in response to environmental conditions at from different mature leaves (avoiding field sites and if these responses differed veins), drying them at 60°C for 48h and between populations. To this end, we weighing them together. SLA was then specified models testing for differences calculated as the fresh leaf area divided by between sites and populations, the interaction the mean dry weight of the corings between site and population, and included (Cornelissen et al., 2003). Aboveground dry genets as a random factor in the model. mass was harvested and dried at 80°C for The proportion of surviving, reproductive 72h before weighing. (clonal and/or sexual), and flowering individuals within each transplant Data analyses combination (i.e. sympatric, near-allopatric, All traits were analyzed with generalized far-allopatric) was analyzed using a binomial linear mixed-effect models (Crawley, 2007), distribution with a logit link function. The using Type III sum of squares with the lme4 number of leaves, flowers, stolons and total (Bates et al., 2015) and lmerTest packages number of reproductive meristems were (Kuznetsova et al., 2013) for R. To test for analyzed using a Poisson distribution with local adaptation in survival, growth- and log link function (zero-inflated for the reproduction-related traits using the number of flowers, stolons and total 118 Chapter 6 reproductive meristems). The remaining Bonferroni correction (i.e. p-values traits were assessed using a normal multiplied for three response variables). distribution with identity link function All the analyses were performed on R (Crawley, 2007). To normalize data and version 3.0.2 software (R Core Team, 2013). homogenize variance aboveground dry mass was log-transformed, count data (log+1)- Molecular analyses transformed, and ratios (clonality, leaf shape, Leaf samples were taken randomly from leaf dissection and SLA) arcsine-transformed 20 out of the 40 sampled mother plants of (Crawley, 2007). We report p-values after each population Flu, Dur and Mut and Bonferroni correction (i.e. p-values immediately dried for DNA extraction using multiplied for nine response variables) and silica gel. Microsatellite marker development F-values (for fixed effects) or χ2-values (for was performed by Ecogenics GmbH (Zurich- random effects), the latter extracted with the Schlieren, Switzerland), whose screening “rand” function in lmerTest. Post-hoc Tukey technique has previously been described in HSD multiple comparison tests were applied Kesselring et al. (2013). The 60 individuals in the multcomp package (Hothorn et al., were genotyped for nine microsatellite loci. 2014) to detect significant differences among A detailed description of microsatellite site × populations transplant combinations. multiplex PCR in G. reptans can be found in Variance components were calculated for Hamann et al. (2014). In brief, three all traits by fitting site, population, their multiplex PCRs were run. Multiplex I interaction and genets as random factors. We comprised primers for loci 015967, 011721, extracted variances using the “VarCorr” and 013998; multiplex II for loci 002235, function from the lme4 package (Crawley, 003651 and 011534, and multiplex III for 2007). loci 015615, 013198 and 007389. A fraction Furthermore, as strong plastic effects were of the forward primers was fluorescent found in leaf traits, a follow-up selection labeled with ATTO-dyes or FAM. Each analysis was performed to determine if multiplex PCR started with a denaturation environmental conditions at each field site step at 95°C for 15min, followed by 35 selected for particular mean trait values. To cycles of 94°C for 30sec, 56°C for 90sec, and do so, selection gradients were calculated by 72°C for 60sec, with a final extension step at means of multiple linear regressions (Lande 72°C for 30min. Amplicons were loaded on and Arnold, 1983). Leaf shape, leaf an ABI3730 sequencer using an Eco500 size dissection and SLA site-specific trait values standard. Allele calling and crosschecking of were standardized to a mean of zero and a genotypes was done with GeneMarker variance of 1 prior to analysis. Relative version 1.80 (SoftGenetics, State College, fitness was calculated by dividing the Pennsylvania, USA). Multiplex fingerprints number of reproductive meristems of each in G. reptans have proven to be highly genet by the site-specific mean. Standardized reproducible with an error rate of 1.4%. linear (i.e. directional) selection gradients Nonetheless, binning of a few alleles was were estimated as the partial regression performed (see Table 1 in Hamann et al., coefficient from the multiple regression of 2014). The final table of genotypes was relative fitness on all standardized traits exported to GenAlEx 6.5 (Peakall and (Haggerty and Galloway, 2011). We report Smouse, 2006). GenAlex was used to check selection gradients β and p-values after for identical multilocus genotypes among 119 Local adaptation in Geum reptans sampled individuals, and to estimate the No significant differences were detected genetic diversity within populations, across the sympatric vs. allopatric contrast calculated as the unbiased expected for any of the studied growth and heterozygosity (He; Nei, 1973). Additionally, reproductive traits (Table 2), suggesting that the same software was used to perform an these fitness-related traits did not differ analysis of molecular variance (AMOVA) between populations across transplant sites. with 999 permutations to analyze partitioning However, highly significant site effects were of molecular variance among and within detected for all fitness-related traits, except populations, and to calculate population for the number of flowers and clonality pairwise FST values based on allele (Table 2). Similarly, population effects were frequencies. strong for aboveground dry mass and the number of stolons (F = 9.98, p < 10-4, F = Results 8.64, p = 0.0018, respectively; Table 2). Site and population effects were pronounced for Proportion of surviving and reproducing aboveground dry mass as population Dur plants grew best at the MUT site, even relative to On average, 85.8% of individuals the sympatric population Mut (Fig. 1a). survived from transplantation into field sites Similarly, site effects were visible for the until harvest two growing seasons later. number of leaves, which was higher in Survival was, however, independent of population Flu and Dur when grown at the sympatric vs. near- and far-allopatric MUT site, relative to when grown at the FLU transplant combinations (F = 0.34, p = 0.92). site (Fig. 1b). The number of flowers differed Of the surviving individuals, on average between genets (F = 7.67, p = 0.05; Table 2), 40.6% of individuals reproduced during the and while the number of flowers produced by second growing season via sexual and/or population Flu and Dur tended to be lower vegetative meristems, yet this proportion was when grown at the far-away MUT site (Fig. also independent of sympatric vs. near- and 2a), this site effect was not significant after far-allopatric transplant combinations (F = Bonferroni correction (Table 2). The number 0.11, p = 0.69). The frequency of individuals of stolons produced by individuals was producing flowers was low with an average particularly high in population Flu when of only 17.5%. Nevertheless, the proportion grown at its site of origin (FLU), and relative of individuals that flowered when to the population Mut when grown together transplanted to a distant site (i.e. far- at the FLU site (Fig. 2b). Similarly, site allopatric) was lower compared to effects on the total number of reproductive individuals transplanted back home or to a meristems were pronounced for population nearby site (F = 2.27, p = 0.03). Indeed, only Flu (Table 2), which produced a higher 14% of individuals flowered when grown in number of reproductive meristems when far-allopatric transplant combinations against grown at its site of origin (FLU) relative to at 20% and 29% in sympatric and near- the DUR site (Fig. 2c). Moreover, a genet allopatric ones, respectively. effect was revealed for the total number of reproductive meristems (F = 8.11, p = 0.036; Fitness-related growth and reproductive Table 2). traits 120 in Chapter 6 are are 36 - p 1 1 1 . The 0. across related related - lues 2 values in values values - χ - va - p - p / populations populations p , 0.58 3.21 0.92 0.62 ), F ) Clonality and and are are reported - 2 2 1 - Df 2 119 χ . To account for the 4 - ich ich 36 09 - values p 1 - Geum reptans 0. p for for correction <10 0.0 for correction . ductive 2 and and χ populations populations transplanted - / - 2 repro 4.24 0.05 8.11 F 12.15 χ meristems as fixed factors lied lied by 9 - 2 2 1 1 Df Total , and removed from models for the other multiplied by 9 4 multip - 18 s s - p 1 1 Geum reptans calculated dry mass, number of leaves) and fitness <10 0.00 population population interaction calculated as fixed factors. value ) in - value × - 2 p actor, actor, for which p χ - / , leaf dissection and SLA in 8.64 0.46 0.82 F 10.32 number number of leaves - = 0.05; 2 2 1 1 aboveground aboveground Number ofNumber stolons Df ( α = 0.05; - α and and clonality , 5 at 18 - p 1 1 0. 0.0 4 - 2 81 p 1 1 χ - / <10 0.0 values were truncated at 1 if correction >1 after at truncated were values 1 if correction. >1 after at truncated were values 3.99 1.26 1.78 7.67 - - F nses in the leaf shape p p 2 χ / SLA - 2 2 1 1 Df 4.71 1.86 1.62 Number ofNumber flowers F 11.64 ) was significant only for 4 4 - - 2 2 4 1 36 Df p 1 1 significant significant significant 0. - - <10 <10 4 4 - - 2 p 1 χ after after Bonferroni correction ( / <10 <10 0.0018 0.29 0.90 4.22 F 39.80 , and non , and non , and 189.04 2 χ / Number ofNumber leaves 1 2 2 1 1 Df 0.49 14.4 effect models for the respo F effect models for the responses in growth 10.90 13.01 - - re re significant after Bonferroni correction (at Leaf dissection Leaf values values report the effects of site, population, and the site 4 4 2 2 4 1 - re re significant - - Df p - p 1 1 effects of site, population, the sympatric vs. allopatric contrast mixed we <10 <10 4 - 09 and and p 1 1 - inear inear mixed ry mass (g) inear inear F l <10 0.00 2 χ - 2 / χ 9.98 0.93 1.56 49 F 16.95 / d sites. 8.91 1. 0.97 l F 12.71 Leaf shape Leaf values values report the indicated indicated in bold - 2 2 4 1 - 2 2 2 1 Df p Df Aboveground d genets genets within populations, this factor was included in the model as a random f values values indicated in bold we - number number of initial leaves at time of transplantation and and p values values - - F p Results Results of generalized The Results Results of generalized l . : : were significant before Bonferroni correction significant were The The . s ariate ariate (i.e. d sites. ! el Table Table 2 traits (number of flowers, number of stolons, total number of reproductive structures fi variation among cov traits italic Covariate Site Population Symp vs. Allop Genets ! Table 3 transplanted between fie To account for the replication of genets within populations, this factor was included in the model as a reported random factor, for wh before Bonferroni correction significant were italics Site Population x population Site Genets 121 Local adaptation in Geum reptans Fig. 1: Mean ± SE of growth-related traits: aboveground dry mass (a) and number of leaves (b) in Geum reptans populations (Flu, Dur, Mut) transplanted across three sites (Flüelapass: FLU, Dürrboden: DUR, Muttgletscher: MUT). Letters reflect multiple contrast results (post- hoc Tukey HSD test) between site × population transplant combinations. Fig. 2: Mean ± SE of reproduction-related traits: number of flowers (a), number of stolons (b), the total number of reproductive meristems (c), and the clonality (d) in Geum reptans populations (Flu, Dur, Mut) transplanted across three sites (Flüelapass: FLU, Dürrboden: DUR, Muttgletscher: MUT). Letters illustrate multiple contrasts (post-hoc Tukey HSD test) between site × population transplant combinations. 122 Chapter 6 Leaf morphology grown at the DUR or MUT site (Fig. 3a), and No significant interactions between site in contrast to the two other populations at the and population were detected for any of the FLU site (Fig 3a). Similarly, site and traits related to leaf morphology (Table 3), population effects for leaf dissection were indicating that populations did not differ in pronounced for population Flu, which had a leaf morphology across transplant sites. higher leaf dissection ratio when grown at its However, highly significant site and/or site of origin (FLU) relative to when grown population effects were detected for the leaf at the DUR site, and relative to population shape, leaf dissection and SLA, and leaf Mut when grown together at the FLU site dissection also differed across genets (Table (Fig. 3b). For SLA, the site effect was clearly 3). visible when looking at population Dur, Site and population effects in the leaf which displayed a significantly lower SLA shape were particularly pronounced for when grown at its site of origin (DUR), population Mut grown at the FLU site, which relative to when grown at the FLU site (Fig. had a higher leaf shape (i.e. smaller leaf 3c). width for a constant leaf length) than when Fig. 3: Mean ± SE of leaf morphology traits: leaf shape (a), leaf dissection (b) and specific leaf area (c) in Geum reptans populations (Flu, Dur, Mut) transplanted across three sites (Flüelapass: FLU, Dürrboden: DUR, Muttgletscher: MUT). Letters illustrate multiple contrasts (post-hoc Tukey HSD test) between site × population transplant combinations. Partitioning of genetic and environmental main part of trait variation, but effects environmental site effects also explained For the growth-related traits, such as the roughly a quarter of the variability in the aboveground dry mass and the number of number of stolons and total reproductive leaves, environmental site effects explained meristems (Table 4). For the number of about half of the trait variability (44.0% and flowers and clonality, none of the variation 43.5%, respectively; Table 4). However, resulted solely from environmental effects, genetic effects at the level of the population but was mainly explained by genet effects or of the genets the remaining portion of the (Table 4). variance in these traits (Table 4). Finally, for two of the three studied traits For the reproduction-related traits, genetic indicative of leaf morphology, environmental population or genet effects explained the effects and genetic effects determined trait 123 Local adaptation in Geum reptans variations at a similar proportion. experimental field sites. Most selection Environmental site effects explained 50.1% gradients calculated for SLA, leaf dissection of variation in leaf shape, and 37.3% in SLA. and leaf shape at each site were found to be However, the variation in leaf dissection was non-significant, suggesting no correlation mostly determined by genetic effects (27.6% between leaf morphology and individual population, 49.9% genet; Table 4). fitness measured as total number of reproductive meristems (Table 5). Only the Site-specific selection on trait values leaf shape was under direct linear selection at Traits indicative of leaf morphology were the MUT site where plants with a smaller found to be highly variable among transplant ratio (i.e. wider leaves for constant leaf sites (Tables 3, 4). Thus, a selection analysis length) had a marginally higher fitness (non- was performed to identify if selection for significant after Bonferroni correction: β = - specific trait values occurred within 0.45, p = 0.12; Table 5). Table 4: Variance components (%) of genetic effects (Population and Genets), environmentaleffects (Site) and interactive genotype × environment effects (Site × Pop) extracted for all fitness-related traits (growth and reproduction) and leaf morphology traits from three Geum reptans populations transplanted across three sites in the Central Swiss Alps. Site Population Site x pop Genets Growth-related traits Aboveground dry mass 43.99 22.98 3.18 29.84 Number of leaves 43.54 34.60 0.085 21.75 Reproduction-related traits Number of flowers 0 0 9.1 90.9 Number of stolons 26.63 36.13 9.27 27.97 Total reproductive meristems 23.68 9.46 1.50 65.36 Clonality 0 31.62 0 68.38 Leaf morphology Leaf shape 50.11 32.76 0 17.13 Leaf dissection 22.45 27.63 0 49.92 SLA 37.31 11.92 10.15 40.62 Table 5: Standardized linear selection gradients (β) and their level of significance (p-value) estimated as the multiple regression coefficients of relative fitness (i.e. total number of reproductive meristems) on standardized mean trait values at each field site. The p-value in italics was significant before Bonferroni correction (at α = 0.05; p-values multiplied by 3 for correction), and non-significant p-values were truncated at 1 if >1 after correction. Flüelapass (FLU) Dürrboden (DUR) Muttgletscher (MUT) β p β p β p Leaf shape -0.151 1 -0.173 0.39 -0.45 0.12 Leaf dissection -0.148 1 -0.031 1 -0.083 1 SLA 0.359 1 0.011 1 -0.048 1 124 Chapter 6 Molecular differentiation revealed that 11% of molecular variance was No identical multilocus genotypes (clonal found among populations (p = 0.001; Table offspring) were found across the 60 analyzed 6), and 89% within populations (Table 6). plants. We detected a mean number of alleles Population pairwise FST values suggest that per population and locus of 7.18 ± 0.49, with little molecular differentiation resided a range of 3-11 alleles per locus. The mean between the two close populations near genetic diversity (estimated as the unbiased Davos (Flu and Dur; FST = 0.016). However, expected heterozygosity) across all studied higher FST values were found when populations and loci was He = 0.72 ± 0.02. comparing populations Flu and Dur to Mut, The genetic diversity within populations the more distant population at Muttgletscher ranged from 0.69-0.74 and did not (FST = 0.068 and FST = 0.073, respectively), significantly differ among populations. Low suggesting higher molecular differentiation inbreeding was revealed by FIS = 0.16 ± 0.08 among distant populations. across all populations and loci. AMOVA Table 6: AMOVA results showing the molecular variance among and within populations. Source df SS MS Est. Var. % p Among populations 2 56.70 28.35 1.01 11 0.001 Within populations 57 460.10 8.07 8.07 89 - Total 59 516.80 - 9.08 100 - Discussion species are often as genetically diverse as populations of non-clonal plants (Ellstrand Molecular differentiation and gene flow and Elam, 1993, Widen et al., 1994). While among populations sexual reproduction probably plays an High genetic diversity was found within important role for recruitment during the three populations (He = 0.72). Our founding stages of a population after glacier sampling method was designed in order to retreat (Cannone et al., 2008) and for the avoid picking the same genetic individual preservation of genetic diversity (Weppler et twice, by implementing at least 5 m distance al., 2006), the long lifespan of clonal ramets between sampled individuals. This method and potential immortality of genets was apparently successful since no identical undoubtedly contributes to the maintenance multilocus genotypes were found, which also of genotypic diversity in G. reptans (de Witte suggests that clonal ramets of G. reptans et al., 2011). establish predominantly at close proximity to Molecular differentiation was substantial their mother plants (Pluess and Stöcklin, among populations (11%; Table 6). 2004, Hamann et al., 2014). Furthermore, However, pairwise population FST this result suggests that the clonality of G. comparisons revealed that molecular reptans did not cause a loss of genotypic differentiation was low between the two diversity within populations, and is in line populations growing at close proximity near with previous findings reported in Pluess and Davos (Flu and Dur), yet both these Stöcklin (2004), and ultimately corroborates populations differed strongly from the the consensus that populations of clonal population Mut growing at a larger geographical distance at the MUT site. This 125 Local adaptation in Geum reptans suggests that gene flow is maintained over two nearby populations are c. 5 km apart, distances of c. 5 km, despite the fact that making genetic swamping very unlikely. these two populations are located in While it is possible that local adaptation neighbouring valleys, which is nonetheless in may take more time than allowed in our accordance with a prior studies on pollen and experiment to express depending on plant seed dispersal distances (Pluess and Stöcklin, longevity (Bennington et al., 2012, Hirst et 2004, Tackenberg and Stöcklin, 2008). al., 2016), the most likely explanation for the lack of local adaptation in our study is related Little evidence for local adaptation to the narrow habitat niche of G. reptans. No differences were found in growth or This species grows at high elevation, reproductive traits between populations typically in glacier forelands, close to the transplanted back to their home site or to glacier snout, and in moist scree fields foreign sites (i.e. sympatric vs. allopatric (Aeschimann et al., 2004). Consequently, it contrast). The frequency of individual is likely that environmental conditions are survival and reproduction also did not differ very similar in these habitats, regardless of across the sympatric vs. allopatric contrast, geographic distance, which may explain the and only the frequency of flowering was lack of intraspecific differentiation (Cannone lower in far-allopatric transplant et al., 2008, Cheplick, 2015). Indeed, combinations. Hence, our results suggest differences in elevation, temperature, only little evidence for local adaptation in the precipitation and exposition recorded in our studied G. reptans populations from the study (Table 1) might not be substantial Central Swiss Alps, even when separated by enough to lead to divergent selection. relatively large geographic distances, where Supporting this interpretation, the selection gene flow is probably restricted. analysis for mean leaf traits at different sites Evidence for local adaptation has been showed only little direct linear selection on found in a number of alpine plant populations these traits (Table 5), corroborating the fact (Gonzalo-Turpin and Hazard, 2009, Fischer that there was no divergent selection across et al., 2011, Giménez-Benavides et al., 2011, the studied sites. Since only three populations Hamann et al., 2016), however, an extensive from the Central Swiss Alps were studied meta-analysis and another recent study here, it is important to note that adaptive suggest that local adaptation may be less genetic differentiation may in fact be found common than frequently assumed (Leimu across larger geographic ranges, and such and Fischer, 2008, Hirst et al., 2016). genetic differentiation may well be in line Extensive gene flow among populations has with this species’ glacial history and been recognized as a main hindrance for postglacial recolonization (Frei et al., 2012). local adaptation (Kawecki and Ebert, 2004). An alternative, not mutually exclusive, Given the low level of molecular explanation for the lack of local adaptation in differentiation found in our study among our study could be that highly plastic populations at close proximity, this could phenotypic responses to local environmental potentially explain the lack of phenotypic conditions may overcome the need for differentiation between the two populations genetic differentiation among populations, growing at the sites near Davos (FLU and especially in perennial herbs (Antonovics and DUR), but fails to do so for the more distant Primack, 1982, Bazzaz, 1996, Cheplick, population at the MUT site. Nevertheless, the 2015, Hirst et al., 2016). Indeed, our study 126 Chapter 6 revealed that G. reptans had a great capacity growth of pioneer and early-successional to respond plastically to environmental species, such as G. reptans, relative to sites at conditions (Tables 2 and 3), which can a later-successional stage where interspecific represent a means to maximize plant competition increases (Cannone et al., 2008). performance in heterogeneous environments Similarly, the number of stolons and of total (Alpert and Simms, 2002, Stöcklin et al., reproductive meristems produced by 2009, Nicotra et al., 2010). This may be individuals was lower at the DUR site (Fig. especially true when considering the 3), where higher competition might have relatively narrow range of environmental hindered optimal reproduction. conditions in the glacier forelands studied Leaf morphology also varied greatly in here, which may be within the limits that response to environmental conditions at plants can adjust to by means of plastic transplant sites. Variation in SLA equally responses (Alpert and Simms, 2002). reflected environmental and genetic However, future studies should investigate differences among genets, and variation in the adaptive value of trait plasticity in the leaf shape predominantly resulted from contrast to genetic differentiation in more plastic responses to environmental site detail and across the entire geographical and conditions (Table 4). All these traits can help ecological range of G. reptans. optimize light capture and gas exchange (Wright et al., 2004, Poorter et al., 2009), and Phenotypic differentiation: environmental vs. may have positive repercussions on plant genetic effects fitness if rapidly adjustable across diverse While populations transplanted back to environments. their home sites did not outperform While genetic population and genet populations transplanted to foreign sites, our effects explained a large part of phenotypic experiment revealed certain differences in variation in reproductive traits (Table 4), the site characteristics (Tables 2 and 3). reproductive output of individuals also varied Especially plants grown at the MUT site had between transplantation sites (i.e. plasticity). a higher aboveground dry mass and produced The low frequency of flowering individuals, a greater number of leaves compared to when and the high relative proportion of grown at the other sites (Fig. 1). Variations in reproduction via clonal ramets (Fig. 2d) were these traits were generally strongly driven by probably related to the young age and small environmental conditions (Table 4). While size of our experimental plants as found in we mentioned earlier that environmental prior studies (Pluess and Stöcklin, 2005, conditions in glacier forelands are relatively Weppler et al., 2006). Pluess and Stöcklin similar, they can differ in the time lapse since (2005) also revealed a great size-dependent glacier retreat and hence in their successional plasticity in the reproductive strategy of G. stage (Cannone et al., 2008). Indeed, the reptans, which ensures population MUT site, where glacier retreat started in the persistence and reproduction across a range mid 1990’s, is at an earlier successional stage of habitat conditions, and corroborates our than the two sites near Davos, where glacier hypothesis that phenotypic plasticity might retreat started in the late 19th century prevail over genetic differentiation in G. (Schweizerisches-Gletschermessnetz, 2015). reptans growing in glacier forelands in the Hence, this site is still at an early- Swiss Alps. successional stage, and might allow for better 127 Local adaptation in Geum reptans Conclusion Research Station Furka ALPFOR at the Furkapass for allowing us to conduct the Our study revealed only little evidence for reciprocal transplantations. local adaptation of G. reptans populations Acknowledgments also go out to Guy growing on the studied glacier forelands in Villaume, Ayaka Gütlin, Diego Delgadillo, the Central Swiss Alps, even though Sara Badel, Michael O’Connor and Rémi extensive molecular differentiation was Nguyen for their help in setting up the found between the far-away populations. We experiment and in the field. This work was suggest that the niche of this species is supported by the Swiss National Science relatively narrow, and restricted to similar Foundation (project no. 3100A-135611 to environmental conditions in glacier forelands J.S) and by the Freiwilige Akademische and moist screes. Moreover, both growth- Gesellschaft and the Basler Stiftung für and reproduction-related traits, as well as leaf Biologische Forschung to E.H. traits exhibited strong phenotypic plasticity, which may overcome the need to adapt by Declaration of authorship and means of genetic differentiation. Since only a conflicts of interest limited number of populations were studied here, we cautiously advocate that selection Data and findings presented in this could have led to the evolution of phenotypic manuscript have not been published and are plasticity rather than genetic differentiation, not under consideration for publication and encourage future studies to investigate elsewhere. All the authors have approved this the adaptive value of phenotypic plasticity submission and all persons entitled to across the natural range of this species. authorship have been named. The authors have no conflict of interest to declare. Acknowledgments We thank the local authorities in the municipality of Davos, and the Alpine References Bates D, Meachler M, Bolker B, Walker S. 2015. Fitting linear mixed-effects models using lme4. Journal of Statistical Software, 67: 1- Aeschimann L, Lauber K, Moser DM, Theurillat 48. JP. 2004. Flora alpina. Bern, Switzerland: Baythavong BS. 2011. Linking the Spatial Scale of Haupt Verlag. Environmental Variation and the Evolution Alpert P, Simms EL. 2002. The relative advantages of Phenotypic Plasticity: Selection Favors of plasticity and fixity in different Adaptive Plasticity in Fine-Grained environments: when is it good for a plant to Environments. American Naturalist, 178: 75- adjust? Evolutionary Ecology, 16: 285-297. 87. Antonovics J, Primack RB. 1982. Experimental Bazzaz FA. 1996. Plants in Changing Environments. ecological genetics in Plantago: VI. The New York, USA: Cambridge University demography of seedling transplants of P. Press. lanceolata. Journal of Ecology, 70: 55-75. Bennington CC, Fetcher N, Vavrek MC, Shaver Banta JA, Dole J, Cruzan MB, Pigliucci M. 2007. GR, Cummings KJ, McGraw JB. 2012. Evidence of local adaptation to coarse- Home site advantage in two long-lived arctic grained environmental variation in plant species: results from two 30-year Arabidopsis thaliana. Evolution, 61: 2419- reciprocal transplant studies. Journal of 2432. Ecology, 100: 841-851. 128 Chapter 6 Billings WD, Mooney HA. 1968. Ecology of arctic high elevation populations of three grassland and alpine plants. Biological Reviews of the species. PLoS ONE, 9. Cambridge Philosophical Society, 43: 481- Frei ES, Scheepens JF, Armbruster GFJ, Stöcklin 529. J. 2012. Phenotypic differentiation in a Blanquart F, Kaltz O, Nuismer SL, Gandon S. common garden reflects the phylogeography 2013. A practical guide to measuring local of a widespread Alpine plant. Journal of adaptation. Ecology Letters, 16: 1195-1205. Ecology, 100: 297-308. Bradshaw AD. 1984. Ecological significance of Galloway LF, Fenster CB. 2000. Population genetic variation between populations. In: differentiation in an annual legume: local Perspecitves on Plant Population Ecology. adaptation. Evolution, 54: 1173-1181. Sunderland, MA, USA: Sinauer. Giménez-Benavides L, Escudero A, Iriondo JM. Byars SG, Papst W, Hoffmann AA. 2007. Local 2007. Local Adaptation Enhances Seedling adaptation and cogradient selection in the Recruitment Along an Altitudinal Gradient in alpine plant, Poa hiemata, along a narrow a High Mountain Mediterranean Plant. altitudinal gradient. Evolution, 61: 2925- Annals of Botany, 99: 723-734. 2941. Giménez-Benavides L, García-Camacho R, Iriondo Byars SG, Parsons Y, Hoffmann AA. 2009. Effect JM, Escudero A. 2011. Selection on of altitude on the genetic structure of an flowering time in Mediterranean high- Alpine grass, Poa hiemata. Annals of Botany, mountain plants under global warming. 103: 885-899. Evolutionary Ecology, 25: 777-794. Cannone N, Diolaiuti G, Guglielmin M, Smiraglia Gonzalo-Turpin H, Hazard L. 2009. Local C. 2008. Accelerating climate change adaptation occurs along altitudinal gradient impacts on alpine glacier forefield despite the existence of gene flow in the ecosystems in the European Alps. Ecological alpine plant species Festuca eskia. Journal of Applications, 18: 637-648. Ecology, 97: 742-751. Cheplick GP. 2015. Approaches to plant evolutionary Haggerty BP, Galloway LF. 2011. Response of ecology. New York, NY, USA: Oxford individual components of reproductive University Press. phenology to growing season length in a Conert HJ, Jäger EJ, Kadereit JW, Schultze-Motel monocarpic herb. Journal of Ecology, 99: W, Wagenitz G, Weber HE. 1995. 242-253. Illustrierte Flora von Mitteleuropa. Berlin, Hamann E, Kesselring H, Scheepens JF, Germany: Blackwell Scientific Publications. Armbruster GFJ, Stoecklin J. 2016. Cornelissen JHC, Lavorel S, Garnier E, Diaz S, Evidence of local adaptation to fine- and Buchmann N, Gurvich DE, Reich PB, ter coarse-grained environemntal variability in Steege H, Morgan HD, van der Heijden Poa alpina in the Swiss Alps. Journal of MGA, Pausas JG, Poorter H. 2003. A Ecology, 104: 1627-1637. handbook of protocols for standardised and Hamann E, Kesselring H, Stocklin J, Armbruster easy measurement of plant functional traits GFJ. 2014. Novel microsatellite markers for worldwide. Australian Journal of Botany, 51: the high-alpine Geum reptans (Rosaceae). 335-380. Applications in Plant Sciences, 2: 1400021. Crawley MJ. 2007. The R Book. West Sussex, Hirst MJ, Sexton JP, Hoffmann AA. 2016. England: John Wiley & Sons. Extensive variation, but not local adaptation de Witte LC, Scherrer D, Stöcklin J. 2011. Genet in an Australian alpine daisy. Ecolgy and longevity and population age structure of the Evolution, 6: 5459-5472. clonal pioneer species Geum reptans based Hothorn T, Bretz F, Westfall P, Heiberger RM, A. on demographic field data and projection S. 2014. Simultaneous inference in general matrix modelling. Preslia, 83: 371-386. parametrics models. Biometrical Journal, 50: de Witte LC, Stöcklin J. 2010. Longevity of clonal 346-363. plants: why it matters and how to measure it. Joshi J, Schmid B, Caldeira MC, Dimitrakopoulos Annals of Botany, 106: 859-870. PG, Good J, Harris R, Hector A, Huss- Ellstrand N, Elam D. 1993. Patterns of genotypic Danell K, Jumpponen A, Minns A, Mulder diversity in clonal plant species. American CPH, Pereira JS, Prinz A, Scherer- Journal of Botany, 74: 123-131. Lorenzen M, Siamantziouras ASD, Terry Fischer M, Weyand A, Rudmann-Maurer K, AC, Troumbis AY, Lawton JH. 2001. Stocklin J. 2011. Adaptation of Poa alpina to Local adaptation enhances performance of altitude and land use in the Swiss Alps. common plant species. Ecology Letters, 4: Alpine Botany, 121: 91-105. 536-544. Frei ER, Ghazoul J, Pluess AR. 2014. Plastic Kawecki TJ, Ebert D. 2004. Conceptual issues in responses to elevated temperature in low and local adaptation. Ecology Letters, 7: 1225- 1241. 129 Local adaptation in Geum reptans Kesselring H, Hamann E, Stocklin J, Armbruster Poorter H, Niinemets U, Poorter L, Wright IJ, GFJ. 2013. New microsatellite markers for Villar R. 2009. Causes and consequences of Anthyllis vulneraria (Fabaceae), analyzed variation in leaf mass per area (LMA): a with Spreadex gel electrophoresis. meta-analysis. New Phytologist, 182: 565- Applications in Plant Sciences, 1: 1300054. 588. Körner C. 2003. Alpine plant life: functional plant Richardson JL, Urban MC, Bolnick DI, Skelly DK. ecology of high mountain ecosystems. 2014. Microgeographic adaptation and the Germany: Springer Verlag. spatial scale of evolution. Trends in Ecology Körner C, Paulsen J. 2004. A world-wide study of & Evolution: 165-176. high altitude treeline temperatures. Journal of Scherrer D, Körner C. 2011. Topographically Biogeography, 31: 713-732. controlled thermal-habitat differentiation Kuznetsova A, Brockhoff PB, Christensen RHB. buffers alpine plant diversity against climate 2013. lmerTest: Tests for random and fixed warming. Journal of Biogeography, 38: 406- effects for linear mixed effect models (lmer 416. objects of lme4 package) http://cran.r- Schweizerisches-Gletschermessnetz. 2015. project.org/package=lmerTest. Gletscherberichte (1881-2014). "Die Lande R, Arnold SJ. 1983. The Measurement of Gletscher der Schweizer Alpen", Jahrbücher Selection on Correlated Characters. der Expertenkommision für Evolution, 37: 1210-1226. Kryosphärenmessnetze der Akademie der Leimu R, Fischer M. 2008. A Meta-Analysis of naturwissenschaften Schweiz (SCNAT). ETH Local Adaptation in Plants. PLoS ONE, 3 Zürich: Versuchsanstalt für Wasserbau, (12) e4010. doi: Hydrologie und Glaziologie (VAW). 10.1371/journal.pone.0004010. Stöcklin J, Kuss P, Pluess AR. 2009. Genetic Linhart YB, Grant MC. 1996. Evolutionary diversity, phenotypic variation and local significance of local genetic differentiation in adaptation in the alpine landscape: case plants. Annual Review of Ecology and studies with alpine plant species. Botanica Systematics, 27: 237-277. Helvetica, 119: 125-133. MeteoSwiss. 2015. Federal Office of Meteorology Sultan SE. 1995. Phenotypic plasticity and plant and Climatology. adaptation. Acta Botanica Neerlandica, 44: http://www.meteoswiss.admin.ch 363-383. (12.11.2015). Tackenberg O, Stöcklin J. 2008. Wind dispersal of Nei M. 1973. Analysis of Gene Diversity in alpine plant species: A comparison with Subdivided Populations. Proceedings of the lowland species. Journal of Vegetation National Academy of Sciences, 70: 3321- Science, 19: 109-118. 3323. Team RDC. 2013. R: A language and environment Nicotra AB, Atkin OK, Bonser SP, Davidson AM, for statistical computing. R Core Team. Finnegan EJ, Mathesius U, Poot P, Vienna, Austria: R Foundation for statistical Purugganan MD, Richards CL, Valladares computing. F, van Kleunen M. 2010. Plant phenotypic van Kleunen M, Fischer M. 2001. Adaptive plasticity in a changing climate. Trends in evolution of plastic foraging responses in a Plant Science, 15: 684-692. clonal plants. Ecology, 82: 3309-3319. Peakall R, Smouse PE. 2006. GENALEX 6: genetic Volis S, Ormanbekova D, Yermekbayev K, Song analysis in Excel. Population genetic M, Shulgina I. 2015. Multi-approaches software for teaching and research. analysis reveals local adaptation in the Molecular Ecology Notes, 6: 288-295. Emmer Wheat (Triticum dicoccoides) at Pigliucci M, Pollard H, Cruzan MB. 2003. macro- but not micro-geographical scale. Comparative studies of evolutionary PLoS ONE, 10: e0121153. responses to light environments in Weppler T, Stoll P, Stocklin J. 2006. The relative Arabidopsis. American Naturalist, 161: 68- importance of sexual and clonal reproduction 82. for population growth in the long-lived alpine Pluess AR, Stöcklin J. 2004. Population genetic plant Geum reptans. Journal of Ecology, 94: diversity of the clonal plant Geum reptans 869-879. (Rosaceae) in the Swiss Alps. American Widen B, Cronberg N, Widen M. 1994. Genotypic Journal of Botany, 91: 2013-2021. diversity, molecular markers, and spatial Pluess AR, Stöcklin J. 2005. The importance of distribution of genets in clonal plants, a population origin and environment on clonal literature survey. Folia Geobotanica et and sexual reproduction in the alpine plant Phytotaxonomica, 29: 245-263. Geum reptans. Functional Ecology, 19: 228- Wright IJ, Reich PB, Westoby M, Ackerly DD, 237. Baruch Z, Bongers F, Cavender-Bares J, Chapin T, Cornelissen JHC, Diemer M, 130 Chapter 6 Flexas J, Garnier E, Groom PK, Gulias J, SC, Tjoelker MG, Veneklaas EJ, Villar R. Hikosaka K, Lamont BB, Lee T, Lee W, 2004. The worldwide leaf economics Lusk C, Midgley JJ, Navas ML, Niinemets spectrum. Nature, 428: 821-827. U, Oleksyn J, Osada N, Poorter H, Poot P, Prior L, Pyankov VI, Roumet C, Thomas 131 Local adaptation in Geum reptans 132 Chapter 7 Chapter 7 Spatial patterns of local adaptation in two common herbs from the central European Alps Halil Kesselring*, J.F. Scheepens, Elena Hamann, G.F.J. Armbruster, Jürg Stöcklin * Halil Kesselring is the corresponding author In preparation for Plant Ecology 133 Local adaptation in A. vulneraria and A. alpina 134 Chapter 7 Spatial patterns of local adaptation in two common herbs from the Central European Alps Halil Kesselring*, J.F. Scheepens, Elena Hamann, G.F.J. Armbruster, Jürg Stöcklin Institute of Botany, Department of Environmental Sciences, Section Plant Ecology, University of Basel, Scho¨ nbeinstrasse 6, CH-4056 Basel, Switzerland * For correspondence. E-mail [email protected] Abstract • Spatially variable selection is considered to result in local adaptation. Yet the generality of local adaptation of populations remains debated, and we know little about the spatial patterns of local adaptation. • We conducted reciprocal transplantations among six populations each of two common and well-studied herbaceous plants, Anthyllis vulneraria and Arabis alpina. We measured aboveground biomass, reproductive allocation and flowering propensity to test for local adaptation at two spatial scales: within and between the Eastern and Western Swiss Alps. Additionally, populations were genotyped using microsatellite markers to assess neutral differentiation and historic inbreeding. • Microsatellite analyses indicated neutral population differentiation according to spatial scale in both species, as well as mixed mating in Anthyllis vulneraria and strong inbreeding in Arabis alpina. The spatial scale was also mirrored in fitness variation of transplanted Anthyllis vulneraria: fitness decreased with geographic distance between population origin and transplant site. In Arabis alpina, reproductive biomass was lowered only in near away transplantations, but not in far away transplantations. • The findings suggest that habitat heterogeneity across the alpine landscape can drive local adaptation although results on Arabis alpina remain inconclusive. Selection-driven differentiation appears to increase with geographic distance in the outcrossed Anthyllis vulneraria. Keywords: reciprocal transplantation; spatial scale, alpine plants; Anthyllis vulneraria; Arabis alpina, microsatellites, inbreeding, outcrossing. 135 Local adaptation in A. vulneraria and A. alpina Introduction factors, a novel criterion has recently been introduced, called the sympatric vs. Despite the long history of research on allopatric criterion sensu Blanquart et al. local adaptation of plant populations (2013). It compares the average fitness in (Clausen et al., 1941), there is still debate naturally occurring population by site over its ubiquity (Leimu and Fischer, 2008, combinations (sympatric) to the average Hereford, 2009) and best definition (Kawecki fitness in experimentally created population and Ebert, 2004, Blanquart et al., 2013). by site combinations (allopatric) across a Ideally, proof of local adaptation should preferably large number of populations. demonstrate an increase in individual fitness Before the criterion is assessed, effects of through evolution from the ancestral state population and site quality are statistically towards the descendant state (Lande and removed, and therefore, effects unrelated to Arnold, 1983, Travisano et al., 1995). The local adaptation do not confound the ancestral state, however, is usually not sympatric vs. allopatric criterion. conserved through time (but see Franks et al., It is of particular interest to test local 2007, Franks and Weis, 2008), making this adaptation across multiple ecological scales comparison impossible. The reciprocal- (e.g. habitat types or geographical scales) to transplant design has therefore become the resolve some of the disagreement over the standard experimental design for testing local ubiquity and conditions under which local adaptation of populations (Kawecki and adaptation evolves (Peterson et al., 2016). Ebert, 2004, Blanquart et al., 2013). The sympatric vs. allopatric criterion is ideal Two criteria have traditionally been to incorporate multiple ecological scales applied to test for local adaptation in because it can be divided into multiple levels reciprocal transplant studies: the local vs. with little loss of statistical power (Blanquart foreign criterion and the home vs. away et al., 2013), for example according to the criterion (Kawecki and Ebert, 2004). The geographic distance between a local vs. foreign criterion compares the transplantation site and the site of origin of a fitness of the local population to foreign population (e.g. sympatric, near allopatric, populations at each transplantation site, while far allopatric). the home vs. away criterion compares the The evolution of local adaptation among fitness of each population at their home sites plant populations is expected when to their fitness at away sites. Both criteria are populations of a species experience not free of confounding effects: the former is consistent divergent selection, are confounded by the intrinsic vigour of the sufficiently genetically isolated, and have populations and the latter by the fertility of high genetic variation. Accordingly, the the sites. One frequently finds differences signature of local adaptation should be strong among populations in their intrinsic vigour when comparing plant populations at great that need not be related to local adaptation geographic or environmental distance, and (Leimu and Fischer, 2008, Hirst et al., 2016), weak at small distances. Few studies have set and likewise, the quality of sites can vary out to explicitly test such hypotheses at greatly across the landscape. Therefore, these multiple ecological scales simultaneously. confounding effects are serious problems in Evidence is correspondingly rare, but mostly the analysis of reciprocal transplant supportive (Sambatti and Rice, 2006, experiments. To cope with these confounding Hereford and Winn, 2008, Anderson et al., 136 Chapter 7 2015, Peterson et al., 2016). Galloway and vulneraria L. and Arabis alpina L. These Fenster (2000) have found evidence for local species were chosen because they are widely adaptation of an annual legume at distances distributed and well-studied herbaceous greater than 1’000 km, but not at closer plants of the European Alps. Each of six distances. Likewise, (Torang et al., 2015) populations per species was transplanted to have found strong local adaptation in the its site of origin, to another site in the same arctic-alpine Arabis alpina at distances of region, and to a site in the other region. We 3’000 km, but not at distances smaller than measured mortality, aboveground biomass, 600 km. The only study to date that has made and flowering propensity as fitness proxies, use of the sympatric vs. allopatric criterion and tested for local adaptation using the for testing local adaptation at multiple spatial sympatric vs. allopatric criterion. We also scales is by Hamann et al. (2016), who have investigated genetic population structure, found that a common alpine fodder grass genetic diversity, and inbreeding levels using shows local adaptation at the regional scale microsatellite markers. The following (>200 km), along with some evidence for questions were addressed: (1) Is there adaptive differentiation at the within-region evidence for local adaptation in alpine scale (>20 km). Anthyllis vulneraria and Arabis alpina? (2) Mountain plants are particularly Does the geographic distance between interesting for the study of local adaptation transplant sites explain fitness variation, i.e. because they frequently face diverse habitats is the occurrence and strength of local across their range even at similar elevation adaptation related to the spatial scale? (3) Do (Körner, 2003). While studies in mountain the experimental populations show neutral systems usually find considerable phenotypic genetic differentiation, and is this differentiation among plant populations differentiation in line with their geographic (Pluess and Stöcklin, 2004, Byars et al., distribution? 2007, Giménez-Benavides et al., 2007, Gonzalo-Turpin and Hazard, 2009, Stöcklin Materials and Methods et al., 2009, Frei et al., 2014), there is mixed evidence for the prevalence of local Study species adaptation at high elevations (Galen and Anthyllis vulneraria L. sensu lato (s.l.; Stanton, 1991, Angert and Schemske, 2005, Fabaceae) is a clade of self-compatible short- Geber and Eckhart, 2005, Byars et al., 2007, lived perennial rosette plants common Gonzalo-Turpin and Hazard, 2009, Sedlacek throughout Europe. It grows preferably on et al., 2015, Hirst et al., 2016). Furthermore, calcareous grassland and scree up to around we lack studies that focus on local adaptation 3’000 m above sea level (m a.s.l) (Conert et of mountain plants unrelated to elevational al., 1995). Plants grow to a height of ca. 15- gradients, i.e. local adaptation of plant 45 cm. Each plant comprises a variable populations at similar elevation (Hirst et al., number of shoots, of which each bears 2-6 2016). inflorescences. Each inflorescence comprises In the current study, we performed a number of 7-19mm long white to yellow, reciprocal transplantations across two spatial sometimes claret to red flowers arranged in a scales within the Swiss Alps (within and capitulum (Conert et al., 1995, Navarro, between the Eastern and Western Swiss 1999a). Selfed and geitonogamous offspring Alps) using two alpine species, Anthyllis may be produced due to the spatial co- 137 Local adaptation in A. vulneraria and A. alpina location of self-pollen and stigma and the and 15 individuals per study population of asynchronous flower ripening across Arabis alpina at 10 loci. Six study capitulae and shoots. Populations of Anthyllis populations per species were used (detailed vulneraria may be exclusively selfing below). Leaf samples for DNA extraction (Couderc, 1971) or may be protandrous to a were taken from experimental plants. Each degree where selfing is effectively prevented sample was taken from one randomly chosen (Navarro, 1999b). Anthyllis vulneraria s. l. is offspring of a different maternal plant each, a particularly polymorphic taxon with and stored in paper bags in silica gel. We unclear infraspecific classification (Nanni et used Spreadex® gels and the ORIGINS al 2004; Köster et al 2008). We have electrophoresis unit (Elchrom Scientific AG, assigned the alpine populations studied here Cham, Switzerland) to separate PCR to Anthyllis vulneraria ssp. alpestris (Schult.) amplicons with size differences as small as and to Anthyllis vulneraria ssp. valesiaca 2bp. Gels were stained with ethidium- (Beck) (Lauber and Wagner, 2001). bromide and scored by hand comparing Arabis alpina L. (Brassicaceae) is a against ELCHROM’s M3 ladder. A detailed perennial rosette plant (Conert et al., 1995, description of the microsatellite analysis and Karl and Koch, 2013). Arabis alpina has a Anthyllis vulneraria loci can be found wide distribution range from the high elsewhere (Kesselring et al., 2013). New mountains of northern Africa over the primers were designed for Arabis alpina Pyrenees and the European Alps to the Near based on published GenBank sequences of East, and across the whole arctic region. 10 loci described by Buehler et al. (2011) to Arabis alpina is a pioneer plant and grows achieve an amplicon length of 90-150 bp, near glacier snouts and on screes up to which is suitable for Spreadex around 3’200 m a.s.l., but can also be found electrophoresis (Kesselring et al., 2013). at lower elevations down to 400 m a.s.l. It PCR details and primer sequences are occurs commonly on disturbed and mildly reported in the supplementary materials of moist sites with calcareous and alkaline the primer note cited above. Error rate in bedrock (Conert et al., 1995, Koch et al., electrophoretic genotyping of Arabis alpina 2006). Arabis alpina grows 6-40 cm tall. was estimated with a repetition analysis, Vegetative shoots are short and horizontally starting from DNA extraction of 11 of the crawling with leaf rosettes at the tip of the 105 individuals (9.5% of the entire sample shoots, while reproductive shoots are upright. size). 216 signals of amplified DNA were Flowers produce nectar and are arranged as found in the first run for these 11 individuals raceme. Arabis alpina populations from the across all 10 loci. In the repetition analysis, central and western Alps are highly inbred 212 of the 216 alleles were identically re- due to a non-functional self-incompatibility scored, equalling an error rate of 1.8%. Error system (Buehler et al., 2012) resulting in of Anthyllis vulneraria was estimated at 2.5% frequent selfing along with bi-parental (Kesselring et al., 2013). Null alleles were inbreeding. suggested for all loci in most populations of Anthyllis vulneraria by the software FreeNA Molecular genotyping (Chapuis and Estoup, 2007). However, FST 20 individuals per study population of values adjusted for null alleles were nearly Anthyllis vulneraria were scored for identical for all but one locus and only this amplified fragments at 9 microsatellite loci, locus showed homozygote null alleles (blank 138 Chapter 7 lanes on the gel). Visual inspection of allopatric and far allopatric transplantations electrophoresis gels and the biology of the were randomly matched. We preferred an species furthermore suggest that the observed unbalanced reciprocal design instead of heterozygote deficiencies at the other loci are transplanting all populations to all sites, as a not due to artefacts. Therefore, we removed fully factorial design has been shown to not only the questionable locus from analyses make optimal use of resources in terms of and assumed the rest of the data to be free of statistical power (Blanquart et al., 2013). artefacts. Arabis alpina showed only two blank lanes out of 900 making it highly For Anthyllis vulneraria, open-pollinated unlikely that null-alleles exist in the studied seeds were collected from 45 different samples, especially given the fact that Arabis maternal plants in the second week of August alpina is highly inbred. 2012 and stored in separate paper bags to subsequently trace family membership. One Reciprocal transplantations week later, between 15-Aug-2012 and 17- For both species, three populations from Aug-2012, seeds were scarified and placed each of two regions, namely Davos and on wet filter paper in Petri dishes for Zermatt were used for transplantations (Table germination in the glasshouse. On 21-Aug- 1). The distance between regions roughly 2012, three seedlings per maternal family equals 180 km, and distances between were potted into 54-pot trays filled with low populations within regions range from 2 to nutrient soil (Anzuchterde, Ökohum GmbH, 18 km. Juvenile offspring of each population Herrenhof, Switzerland). Final were transplanted to their home site, to an transplantation to field sites was performed away site in the same region, and to a far on 17 and 18-Sep-2012 in Davos and on 25 away site in the other region. It follows that and 26-Sep-2012 in Zermatt. Of the three each site received offsprings from its local individuals per maternal family, one was population, from a foreign population of the transplanted to its home site, one to the away same region (near foreign), and from a site, and one to the far away site. However, foreign population of the other region (far family membership was ultimately ignored, foreign). Thus, a total of 18 transplantations because uneven mortality led to an unequal were performed per species. Sensu Blanquart genetic make-up of transplanted populations. et al (2013), the combination of a site with its Plants were transplanted into the local soil at local population is referred to as sympatric, the field sites of the native population and one of a site with a foreign population as each plant was watered with 200 ml of water allopatric (again, note that the terms to facilitate establishment. Plants were sympatric and allopatric do not have the transplanted in rows of 10 individuals, same meaning as in classical population alternating between local, near foreign, and biology). In this study, we further specify the far foreign individuals, and spacing combination of a site with a population from individuals at 20 cm distance from each the same region as near allopatric, and a other. Each site received 135 individuals that combination of a site with a foreign were arranged in 14 rows. A total of 810 population from the other region as far individuals were reciprocally transplanted for allopatric. Populations and sites for near Anthyllis vulneraria. 139 Local adaptation in A. vulneraria and A. alpina Table 1: Elevations (m.a.s.l) and coordinates (Swiss grid CH1903) of the 12 populations from two regions of Anthyllis vulneraria and Arabis alpina used for reciprocal transplantations. Anthyllis vulneraria Arabis alpina Population Coordinates Elevation Population Coordinates Elevation 780513.38/ 780513.385/ Schiahorn 2650 Schiahorn 2650 Davos 187874.76 187874.756 (Eastern 782301.54/ 782301.543/ Casanna 2320 Casanna 2320 Swiss 192247.99 192247.969 Alps) 779685.63/ 780324.165/ Monstein 2010 Weissfluhjoch 2700 173389.10 189706.004 626828.96/ 627165.547/ Findelwald 2170 Blauherd 2580 Zermatt 95475.764 96339.072 (Western 629173.61/ 629173.611/ Findelgletscher 2490 Findelgletscher 2490 Swiss 95175.270 95175.270 Alps) 619094.30/ 621622.757/ Stafelalp 2280 Trockener Steg 2880 94427.436 90793.274 Towards the end of the first growing during September and October 2012. Seeds season in the field (September 2013), we were kept at room temperature for one week assessed survival at all transplantation sites. and then stored at 4 °C. Three seeds per Earlier, in the first week of July 2013, we had maternal line were sown on 27-Mar-2013 assessed survival at one site in Davos onto small trays filled with low nutrient soil (Monstein) and one site in Zermatt and topped with a thin layer of soil (Findelgletscher). Thus by comparing (Anzuchterde, Ökohum GmbH, Herrenhof, September survival against July survival, we Switzerland). Seeds were subsequently cold- could assess mortality of established stratified at 4 °C for 4 days to improve individuals during the first summer at these germination rate. Between 18-Apr-2013 and two sites (n = 165). To assess mortality 29-May-2013 seedlings were transferred to during the second winter, we compared data 54-pot multitrays containing the same soil. from September 2013 against survival at the Plants were transplanted to field sites time of harvest in 2014. between 03-Jul-2013 and 26-Jul-2013. After two full growing seasons in the field Transplantations were performed in the same (August 2014), we monitored whether fashion as with Anthyllis vulneraria. A total individuals had flowered or not and of 810 individuals were transplanted. harvested aboveground biomass. Biomass Since Arabis alpina individuals grew in was divided into reproductive and vegetative the field for only one growing season, we did biomass and dried in the oven at 80 °C for 48 not assess mortality because we would not be h. For final analysis of biomass in Anthyllis able to separate site effects from vulneraria 304 plants remained. transplantation effects. However, at the end of the growing season we assessed For Arabis alpina, open-pollinated seeds propensity of flowering and harvested were collected from 45 maternal plants aboveground biomass between 31-Jul-2014 140 Chapter 7 and 05-Aug-2014. Reproductive and report P-values, mean squares, and χ2 values vegetative biomass was separated and dried that correspond to those from the model in the oven at 80 °C for 48 h. comparison (i.e. likelihood-ratio tests) using the step function in lmerTest. Statistical analysis Significant site or population terms We used analysis of molecular variance indicate differences in intrinsic habitat (AMOVA) as implemented in GenAlEx to quality or population quality, respectively. A partition genetic variation at microsatellite significant sympatric vs. allopatric factor loci into components according to the indicates that populations perform on average sources region, population within region, better when transplanted to either one of the individual within population, and within home-, near away- or far away sites. If the individuals. AMOVA also estimates sympatric vs. allopatric factor was Wright’s fixation indices (F) corresponding significant, post-hoc pairwise comparisons to structuring at the same hierarchical levels. were used to check if patterns of fitness We further report genetic diversity at variation conformed to local adaptation. A microsatellite loci in terms of expected significantly positive difference between heterozygosity He and allelic richness. sympatric combinations of sites and populations and near allopatric combinations We used linear mixed effects models for of sites and populations indicates local the analysis of biomass traits based on the adaptation at the scale of populations within sympatric vs. allopatric definition of local regions. A significantly positive difference adaptation (Blanquart et al 2013). To this between sympatric combinations of sites and end, we specified models in the lmerTest populations and far allopatric combinations package (Kuznetsova 2013) for R (R of sites and populations indicates local Development Core Team 2008), which adaptation at the regional scale. We used included a factor for site, population and a differences of least squares means (dlsm) as factor describing whether a combination of output by the step function of lmerTest for site and population was sympatric, near post-hoc comparisons. allopatric, or far allopatric. The factors site, population and sympatric vs. allopatric were Flowering propensity and survival of tested for their effects on total aboveground Anthyllis vulneraria were analysed using biomass and reproductive allocation. generalized linear mixed-effects models of Separate models were specified for each the lme4 package (Bates et al., 2015) for R response variable and species. Site and (R Development Core Team, 2013) with a population, were specified as random effects, binomial distribution and the logit link while sympatric vs. allopatric was a fixed function. Identical model specifications were effect. lmerTest is a package of convenience used as for the mixed effects models above. functions for lmer objects of the lme4 Likelihood ratio tests were performed to package (Bates, 2014) that allow F-tests for assess significance levels of all factors. The fixed effects and likelihood-ratio tests for glht function of the multcomp package random effects using stepwise model (Hothorn et al., 2014) in R was used for post- reduction and comparison. We used Type 3 hoc pairwise comparisons of the levels of the sums of squares and Satterthwaite sympatric vs. allopatric factor. approximations for degrees of freedom. We 141 Local adaptation in A. vulneraria and A. alpina Results Transplant experiments Anthyllis vulneraria Molecular Analyses Mortality after establishment was assessed In Anthyllis vulneraria, average numbers for Anthyllis vulneraria in the first growing of alleles per locus and population ranged season (summer 2013) at one site in each from (mean±SD) 5.80±0.56 to 8.00±1.05 and region and at all sites during the second expected heterozygosities (He) ranged from winter (2013/2014). During summer 2013, 0.68±0.02 to 0.76±0.02 across populations. only a single individual died at the The microsatellite analyses revealed a Findelgletscher site in the Western region, positive mean inbreeding coefficient (FIS) of and seven individuals died at the Monstein 0.254 across populations of Anthyllis site in the Eastern region. Mortality during vulneraria used in this study, ranging from 0 the second winter in the field (2013/2014) to 0.414 across populations. AMOVA was higher: out of 437 plants living at all six showed that small but significant amounts of sites in September 2013, 122 (28%) died molecular variation are explained by region until the final harvest in September 2014. (5%) and population structure within regions However, mortality during the 2013/2014 (4%; Table 2). Pairwise FST’s ranged from winter was not dependent on the sympatric 0.014 to 0.084 within the Davos region, from vs. allopatric factor (results not shown). 0.000 to 0.052 within the Zermatt region, and In contrast, while the flowering propensity from 0.038 to 0.127 across regions. Only the assessed at the end of the two growing populations Findelgletscher and Stafelalp seasons did not differ between populations or were not significantly differentiated from sites (results not shown) it differed each other (Table S1). significantly along the sympatric vs. In Arabis alpina, average numbers of allopatric contrast (Fig. 2; sympatric vs. 2 alleles per locus and population ranged from allopatric factor: df = 2, χ = 6.96, P =0.031). 2.60±0.34 to 3.80±0.44. Expected Sympatric combinations had 76 % flowering heterozygosities (He) ranged from 0.34±0.07 propensity, allopatric combinations 66 %, to 0.54±0.04 across populations. Our and far allopatric only 62%. Generally, the analyses confirmed the highly inbred nature population of origin at each site had the of Arabis alpina with an average FIS of 0.758 highest flowering propensity, the only for the populations studied here (ranging exception being the Stafelalp site. In all from 0.459 – 0.975). Accordingly, AMOVA populations transplanted to the Stafelalp site, revealed that most of the molecular less than 50% of plants flowered due to the variability is between (55%) and not within low overall growth of transplanted plants individuals (17%; Table 2). Furthermore, (see also biomass results). regions and populations within regions Total aboveground biomass of Anthyllis explained relatively large amounts of vulneraria differed between populations and variation with 11 % and 17 %, respectively. sites, and also along the sympatric vs. Pairwise FST’s ranged from 0.048 to 0.127 allopatric factor (Table 3). The average total within the Davos region, from 0.101 to 0.257 aboveground biomass across the experiment within the Zermatt region, and from 0.155 to was lower in far allopatric plants compared 0.282 across regions (Table S2). to sympatric and near allopatric transplant combinations (Fig. 1; dlsm: sym-far.allo=0.5, p<0.001; near.allo-far.allo=0.5, p<0.001). 142 Chapter 7 used 2650 2320 2700 2580 2490 2880 elevation . Degrees . Degrees Arabis alpina Arabis alpina and and Arabis alpina and and coordinates Arabis alpina =0.001 level (**). =0.001 level P 627165.547 / 96339.072 627165.547 / 95175.270 629173.611 / 90793.274 621622.757 / 782301.543/ 192247.969 782301.543/ 780513.385 / 187874.756 780513.385 / 189706.004 780324.165 / ch on Anthyllis vulneraria Anthyllis 0.105 ** 0.195 ** 0.279 ** 0.758 ** 0.826 ** Fixation index Fixation Anthyllis vulneraria Anthyllis Casanna Blauherd of Schiahorn populati % 11 17 55 17 100 Weissfluhjo Trockener Steg Trockener Findelgletscher 3.38 Arabis alpina 0.355 0.589 1.847 0.589 Est. var Est. 2650 2320 2010 2170 2490 2280 elevation 53 SS 53.9 87.8 359.7 554.4 27.436 1 4 df 90 84 179 est. var.), percentage variance explained by each factor (%), and the magnitude of the magnitude the (%), and factor by each explained variance percentage var.), est. coordinates 0.045 ** 0.037 ** 0.081 ** 0.254 ** 0.315 ** 626828.986 / 95475.764 626828.986 / 95175.270 629173.611 / 944 619094.320 / 782301.543/ 192247.969 782301.543/ 780513.385 / 187874.756 780513.385 / 173389.160 779685.630 / Fixation index Fixation Anthyllis vulneraria Anthyllis 5 4 % 23 69 100 Casanna Stafelalp 2.2 Monstein Schiahorn 3.21 population Findelwald 0.145 0.114 0.751 Est. var. Est. Findelgletscher Anthyllis vulneraria Anthyllis SS 422 264 25.7 33.8 744.7 1 4 df 114 120 239 Elevations and coordinates (Swiss from of CH1903)two regions grid of 12 populations coordinates and the Elevations from of two regions 12 populations variance) ofAMOVA (analysis molecular table : total 2 region individual population Davos (Eastern SwissDavos (Eastern Alps) Zermatt (Western Swiss (Western Alps) Zermatt within individual within Table 1: Table transplantations for reciprocal Table ( of (df), freedom variance sums of squares (SS), estimated the at significant were indices fixation All given. are index) (fixation level hierarchical each at index fixation ! 143 Local adaptation in A. vulneraria and A. alpina Arabis and and s p 1.000 0.350 0.015 2,a χ 0.00 0.87 4.44 F/ b Anthyllis vulneraria Anthyllis NA NA 0.14 0.03 MS Reproductive biomas Reproductive for p Arabis alpina <0.001 <0.001 <0.001 2,a χ F/ 10.95 15.52 106.36 otal biomass otal T b NA NA 7.96 0.51 MS and reproductive biomass reproductive and p 0.088 <0.001 <0.001 2,a χ 2.92 8.81 F/ 25.37 tests for random effects as implemented in the lmerTest package for R. lmerTest for R. lmerTest package lmerTest the in for effectstests random as implemented b NA NA 0.43 0.05 MS Reproductive biomass Reproductive values. - 2 χ p and and - <0.001 <0.001 <0.001 Anthyllis vulneraria Anthyllis 2,a χ F/ 10.95 15.52 106.36 otal biomass otal T b NA NA 7.96 0.51 MS 4 5 2 df 299 site tests were used for fixed effects and likelihood ratio used for were tests fixed effects likelihood and ANOVA table of mixed model analyses of total aboveground biomass aboveground of analyses total ANOVA model of mixed table - residual : population 3 . F sympatric vs. allopatric sympatric 144 Table alpina NA’s in of forallows 0, resulting variances F ! Chapter 7 Fig. 1 Total aboveground biomass and allocation to reproductive biomass for Anthyllis vulneraria and Arabis alpina for sympatric, near allopatric and far allopatric transplant combinations. Error bars depict 1 standard error of the mean. Different small letters inside bars of each panel denote significantly different groups. Near allopatric combinations of populations near.allo=0.1, p=0.038; sym-far.allo=0.3, and habitat within the same region had equal p<0.0001, near.allo-far.allo=0.2, p=0.007). total aboveground biomass production to sympatric transplants (Fig. 1; dlsm: sym- Arabis alpina near.allo=0.0, p=0.9). Early timing of transplantations and late Allocation to reproductive biomass also spring frost caused severe mortality at differed among sites and among populations transplantation and transplants from two sites (Table 3; population p=0.002; site p=<0.001) were completely lost. In total, only 200 Moreover, a highly significant sympatric vs. individuals survived and were available for allopatric effect was found for this trait final analyses. Out of the 200 surviving (p=<0.001). Reproductive biomass of Arabis alpina plants at four sites, all but 28 Anthyllis vulneraria tended to decrease with flowered at the time of harvest. Of these 28 increasing distance between transplantation non-flowering plants, 11 were in sympatric site and population origin (Fig. 1). Sympatric transplant combinations with their habitat, 5 transplantations yielded the highest were in near allopatric, and 12 were in far reproductive biomass, near allopatric allopatric ones. None of the factors site, intermediate, and far allopatric population or sympatric vs. allopatric transplantations lowest biomass (dlsm: sym- explained significant variation (results not shown). 145 Local adaptation in A. vulneraria and A. alpina Total aboveground biomass of Arabis therefore favor regional differentiation over alpina was not differentiated among local differentiation. Populations of Anthyllis populations or sites. The sympatric vs. vulneraria appear to be largely outcrossing. allopatric factor was also not significant for Indeed, high levels of genetic diversity seem total biomass (Table 3; Fig. 1). to be maintained within populations and Similarly, there were no significant among individuals of Anthyllis vulneraria, differences among sites or among which are in line with values reviewed by populations in reproductive biomass (Table Nybom (2004). In Arabis alpina, we found 3). However, the sympatric vs. allopatric high FIS values indicative of low rates of factor was significant for reproductive outcrossing (Buehler et al., 2012) and biomass in the Arabis alpina experiment, generally lower genetic diversity than in with near allopatric combinations having Anthyllis vulneraria. Of 13 alpine plant lower biomass than sympatric and far species studied by Manel et al. (2012) across allopatric population by habitat the entire European Alps, Arabis alpina was combinations (Table 3; dlsm: sym-near.allo= in fact the least genetically diverse. Genetic 0.1, p=0.02; near.allo-far.allo=<0.1, p=0.03; diversity is a key determinant of the potential Fig. 1). Cross-regional transplant for local adaptation (Geber and Eckhart, combinations (far allopatric) were not 2005, Blanquart et al., 2013, Cheplick, 2015) significantly different from sympatric and a possible explanation for the absence of combinations (Fig. 1; dlsm: sym- evidence for local adaptation in this species far.allo=0.00, p=0.78). is the high level of inbreeding. Discussion When individuals of Antyllis vulneraria were transplanted away from their home site, Determining the structure of fitness their fitness decreased on average, and more variation and the scale of adaptive strongly so at larger geographic distance differentiation in widespread plant species is from the home site. Although one would important for understanding the ecology of intuitively assume greater divergence in these species and their evolutionary potential. environmental conditions with increasing In the current study, we transplanted six geographic separation between sites, this is populations of each of two widespread alpine not necessarily given. Indeed, species across two spatial scales and tested transplantations across range limits can cause for local adaptation. We found a signature of much stronger fitness reduction than those local adapation in Anthyllis vulneraria, for across habitat types within the native range, which the reproductive biomass and even if the geographical distance of the latter flowering propensity decreased with is much greater than that of across-range increasing distance of sites of origin. transplantations (Geber and Eckhart, 2005). However, in Arabis alpina, no conclusive This suggests that geographic distance alone evidence for local adaptation was found. is not necessarily a surrogate for ecological divergence. Our results, however, suggest Differentiation at microsatellite loci of that within the native range of Anthylllis both species showed stronger differentiation vulneraria, geographic distance can across than within regions. The additional substitute for ecological distance and that genetic isolation between regions should regional and local environmental variation 146 Chapter 7 sum up. It would be interesting to use a vegetative biomass in near allopatric multispecies approach to test the hypothesis population by habitat combinations (dlsm: whether this is always true within a species’ sym-near.allo = 0.2, p=0.032), we can also native range. As we have not specifically set rule out reduced growth as the sole cause for out to test the effect of certain environmental lower flowering propensity or the inability to variables, it is difficult to pinpoint selective reach reproductive maturity of allopatric agents responsible for local adaptation in transplantations (Angert and Schemske Anthyllis vulneraria. However, when 2005). comparing the two regions used in this study, Zermatt has substantially warmer and dryer Even though we must be cautious when summers than Davos and less snowfall interpreting the current results for Arabis during winters (MeteoSwiss). If we presume alpina due to the low final sample size and that within-region small-scale variation, such short observation period, our reciprocal as variation in exposition, elevation and transplant experiment represents an inclination are similar in both regions, then important direct test for local adaptation in the additional regional variation should cause this emerging alpine model organism of the additional differentiation between European Alps. Evidence for local adaptation populations from different regions. Therefore in Arabis alpina of the central European Alps it is conceivable that climatic divergence until now was based on the detection of between the two regions in part explains the outlier loci (Buehler et al., 2012) or fitness variation observed for cross-regional association studies of marker loci with transplants of Anthyllis vulneraria. environmental variables (Manel et al., 2012), The patterns of local adaptation in which sometimes rest on statistical Anthyllis vulneraria were most visible in assumptions or environmental and molecular reproductive biomass and flowering data of coarse resolution. In the current propensity. Reproduction and flowering in experiment, we found only little evidence for alpine plants are commonly associated with the hypothesis that populations of Arabis vernalisation (Wang et al 2009) and alpina within the Swiss Alps are locally photoperiod (Keller and Körner 2003). adapted. Along with the high level of However, it is unlikely that the pattern of inbreeding, a possible explanation for the local adaptation in flowering propensity and lack of local adaptation in this species is that reproductive biomass found here is caused by the ecologically relevant factors for Arabis adaptive differentiation in vernalisation alpina are different than those for Anthyllis requirements or photoperiodic control. All vulneraria, and that the spatial distribution of populations used here need only little variation in these factors is not structured vernalisation: in several independent along geographic distance. Torang et al. experiments, the same populations were able (2015) have conducted a reciprocal transplant to flower in the botanical gardens of our experiment with Arabis alpina across wide institute at 300 m a.s.l., where winters are latitudinal gradients (between Spain and much warmer and shorter compared to any of Sweden; 3’000 km) and found local the transplantations sites. Moreover, all adaptation in flowering phenology and other populations are situated at roughly equal traits related to temperature, water latitude, and so differentiation according to availability, and growing season length. photoperiod is unlikely. Due to the higher However, they did not find significant fitness 147 Local adaptation in A. vulneraria and A. alpina differences between populations of the same adaptation was found across regions, and region (within 690km circumference). In the only little evidence for local adaptation present study we use a maximum within regions. Whether inbreeding transplantation distance of 180 km, and eliminates the potential for local adaptation therefore both transplantation studies carried in Arabis alpina at spatial scales smaller than out to date with Arabis alpina come to the a few hundred kilometres requires further conclusion that local adaptation does not tests. occur at distances smaller than a few hundred kilometers. Acknowledgements Conclusions We thank the Schatzalp-Bahn Davos, especially Pius App, for logistic support. We performed reciprocal transplantation Michelle Gisler has provided substantial help experiments to test for local adaptation at two with sampling and germinating Anthyllis spatial scales using two unrelated but vulneraria. This work was funded by the common alpine species. In Anthyllis Swiss National Science Foundation grant no. vulneraria, flowering propensity and 3100A-135611 to J.S., and the Freiwillige reproductive biomass decreased with Akademische Gesellschaft Basel and the increasing geographical distance to sites of Basler Stiftung für biologische Forschung to origin, indicating local adaptation in this H.K. species. The results provide evidence for the role of natural selection in shaping Conflict of Interest phenotypes in populations of the European Alps and suggest that environmental The authors declare that they have no differences between sites increase on average conflict of interest. with geographic distance. In the highly selfing Arabis alpina, no evidence for local Buehler D, Graf R, Holderegger R, Gugerli F. 2011. Using the 454 pyrosequencing-based References technique in the development of nuclear microsatellite loci in the alpine plant Arabis Anderson JT, Perera N, Chowdhury B, Mitchell- alpina (Brassicaceae). Am J Bot, 98: e103-5. Olds T. 2015. Microgeographic Patterns of Buehler D, Graf R, Holderegger R, Gugerli F. Genetic Divergence and Adaptation across 2012. Contemporary gene flow and mating Environmental Gradients in Boechera stricta system of Arabis alpina in a Central (Brassicaceae). Am Nat, 186 Suppl 1: S60- European alpine landscape. Ann Bot, 109: 73. 1359-67. Angert AL, Schemske DW. 2005. The evolution of Byars SG, Papst W, Hoffmann AA. 2007. Local species' distributions: reciprocal transplants adaptation and cogradient selection in the across the elevation ranges of Mimulus alpine plant, Poa hiemata, along a narrow cardinalis and M. lewisii. Evolution, 59: altitudinal gradient. Evolution, 61: 2925- 1671-84. 2941. Bates D, Meachler M, Bolker B, Walker S. 2015. Chapuis M-P, Estoup A. 2007. Microsatellite Null Fitting linear mixed-effects models using Alleles and Estimation of Population lme4. Journal of Statistical Software, 67: 1- Differentiation. Molecular Biology and 48. Evolution, 24: 621-631. Blanquart F, Kaltz O, Nuismer SL, Gandon S. Cheplick GP. 2015. Approaches to plant evolutionary 2013. A practical guide to measuring local ecology. New York, NY, USA: Oxford adaptation. Ecology Letters, 16: 1195-1205. University Press. 148 Chapter 7 Clausen J, Keck WM, Hiesey WM. 1941. Regional plant Diodia teres. New Phytologist, 178: differentiation in plant species. American 888-896. Naturalist, 75: 231-250. Hirst MJ, Sexton JP, Hoffmann AA. 2016. Conert HJ, Jäger EJ, Kadereit JW, Schultze-Motel Extensive variation, but not local adaptation W, Wagenitz G, Weber HE. 1995. in an Australian alpine daisy. Ecolgy and Illustrierte Flora von Mitteleuropa. Berlin, Evolution, 6: 5459-5472. Germany: Blackwell Scientific Publications. Hothorn T, Bretz F, Westfall P, Heiberger RM, A. Couderc H. 1971. Etude expérimental de la S. 2014. Simultaneous inference in general reproduction de l'Anthyllis vulneraria L. parametrics models. Biometrical Journal, 50: Bulletin de la Societé botanique de France, 346-363. 118: 359-374. Karl R, Koch MA. 2013. A world-wide perspective Franks SJ, Sim S, Weis AE. 2007. Rapid evolution on crucifer speciation and evolution: of flowering time by an annual plant in phylogenetics, biogeography and trait response to a climate fluctuation. evolution in tribe Arabideae. Ann Bot, 112: Proceedings of the National Academy of 983-1001. Sciences of the United States of America, Kawecki TJ, Ebert D. 2004. Conceptual issues in 104: 1278-1282. local adaptation. Ecology Letters, 7: 1225- Franks SJ, Weis AE. 2008. A change in climate 1241. causes rapid evolution of multiple life-history Kesselring H, Hamann E, Stocklin J, Armbruster traits and their interactions in an annual plant. GFJ. 2013. New microsatellite markers for Journal of Evolutionary Biology, 21: 1321- Anthyllis vulneraria (Fabaceae), analyzed 1334. with Spreadex gel electrophoresis. Frei ER, Ghazoul J, Pluess AR. 2014. Plastic Applications in Plant Sciences, 1: 1300054. responses to elevated temperature in low and Koch MA, Kiefer C, Ehrich D, Vogel J, high elevation populations of three grassland Brochmann C, Mummenhoff K. 2006. species. PLoS ONE, 9. Three times out of Asia Minor: the Galen C, Stanton ML. 1991. Consequences of phylogeography of Arabis alpina L. emergence phenology for reproductive (Brassicaceae). Mol Ecol, 15: 825-39. success in anunculus adoneus Körner C. 2003. Alpine plant life: functional plant (Ranunculaceae). American Journal of ecology of high mountain ecosystems. Botany, 78: 978-988. Germany: Springer Verlag. Galloway LF, Fenster CB. 2000. Population Lande R, Arnold SJ. 1983. The Measurement of differentiation in an annual legume: local Selection on Correlated Characters. adaptation. Evolution, 54: 1173-1181. Evolution, 37: 1210-1226. Geber MA, Eckhart VM. 2005. Experimental studies Lauber K, Wagner G. 2001. Flora Helvetica. Bern, of adaptation in Clarkia xantiana. II. Fitness Switzerland: Haupt Verlag. variation across a subspecies border. Leimu R, Fischer M. 2008. A Meta-Analysis of Evolution, 59: 521-531. Local Adaptation in Plants. PLoS ONE, 3 Giménez-Benavides L, Escudero A, Iriondo JM. (12) e4010. doi: 2007. Local Adaptation Enhances Seedling 10.1371/journal.pone.0004010. Recruitment Along an Altitudinal Gradient in Manel S, Gugerli F, Thuiller W, Alvarez N, a High Mountain Mediterranean Plant. Legendre P, Holderegger R, Gielly L, Annals of Botany, 99: 723-734. Taberlet P. 2012. Broad-scale adaptive Gonzalo-Turpin H, Hazard L. 2009. Local genetic variation in alpine plants is driven by adaptation occurs along altitudinal gradient temperature and precipitation. Mol Ecol, 21: despite the existence of gene flow in the 3729-38. alpine plant species Festuca eskia. Journal of Navarro L. 1999a. Allocation of reproductive Ecology, 97: 742-751. resources within inflorescences of Anthyllis Hamann E, Kesselring H, Scheepens JF, vulneraria subsp. vulgaris (Fabaceae). . In: Armbruster GFJ, Stoecklin J. 2016. The evolution of plant architecture.Kurmann Evidence of local adaptation to fine- and MH, Hemsley ARH. Kew, UK: Royal Botanic coarse-grained environemntal variability in Gardens. Poa alpina in the Swiss Alps. Journal of Navarro L. 1999b. Reproductive biology of Anthyllis Ecology, 104: 1627-1637. vulneraria subsp. vulgaris (Fabaceae) in Hereford J. 2009. A Quantitative Survey of Local northwestern Iberian Peninsula. Nordic Adaptation and Fitness Trade-Offs. American Journal of Botany, 19: 281-287. Naturalist, 173: 579-588. Peterson ML, Kay KM, Angert AL. 2016. The scale Hereford J, Winn AA. 2008. Limits to local of local adaptation in Mimulus guttatus: adaptation in six populations of the annual comparing life history races, ecotypes, and populations. New Phytol, 211: 345-56. 149 Local adaptation in A. vulneraria and A. alpina Pluess AR, Stöcklin J. 2004. Population genetic adaptation in the alpine landscape: case diversity of the clonal plant Geum reptans studies with alpine plant species. Botanica (Rosaceae) in the Swiss Alps. American Helvetica, 119: 125-133. Journal of Botany, 91: 2013-2021. Team RDC. 2013. R: A language and environment Sambatti JB, Rice KJ. 2006. Local adaptation, for statistical computing. Vienna, Austria: R patterns of selection, and gene flow in the Foundation for statistical computing. Californian serpentine sunflower (Helianthus Torang P, Wunder J, Obeso JR, Herzog M, exilis). Evolution, 60: 696-710. Coupland G, Agren J. 2015. Large-scale Sedlacek J, Wheeler JA, Cortés AJ, Bossdorf O, adaptive differentiation in the alpine Hoch G, Lexer C, Wipf S, Karrenberg S, perennial herb Arabis alpina. New Phytol, van Kleunen M, Rixen C. 2015. The 206: 459-70. Response of the Alpine Dwarf Shrub Salix Travisano M, Mongold J, Bennett A, Lenski R. herbacea to Altered Snowmelt Timing: 1995. Experimental tests of the roles of Lessons from a Multi-Site Transplant adaptation, chance, and history in evolution. Experiment. PLoS ONE, 10: e0122395. Science, 267: 87-90. Stöcklin J, Kuss P, Pluess AR. 2009. Genetic diversity, phenotypic variation and local 150 Chapter 7 Supplementary Data 0.001 0.001 0.001 0.001 0.450 0.000 Stafelalp 0.001 0.001 0.001 0.001 0.001 0.000 Steg Trockener 0.001 0.001 0.001 0.014 0.000 0.000 0.001 0.001 0.001 0.003 0.000 0.257 Findelwald Fst values are shown below the diagonal and probability, P(rand >= probability, and diagonal shown the are below Fst values . 0.001 0.001 0.001 0.000 0.020 0.052 Fst values are shown below the diagonal and probability, P(rand >= data) P(rand >= data) probability, and diagonal shown the are below Fst values Findelgletscher . 0.001 0.001 0.001 0.000 0.101 0.177 Findelgletscher Blauherd Anthyllis vulneraria Anthyllis Arabis alpina 0.001 0.037 0.000 0.078 0.038 0.039 0.048 0.001 0.000 0.155 0.266 0.155 Casanna Weissfluhjoch 0.001 0.000 0.014 0.096 0.064 0.085 Monstein 0.001 0.000 0.127 0.163 0.210 0.171 Casanna 0.000 0.084 0.051 0.127 0.095 0.098 0.000 0.125 0.048 0.165 0.282 0.181 Schiahorn Schiahorn of for Fst values matrix population Pairwise of for Fst values matrix population Pairwise Casanna Stafelalp Monstein Schiahorn Findelwald Findelgletscher Schiahorn Casanna Weissfluhjoch Blauherd Findelgletscher Steg Trockener S1: Table is showndiagonal. above on 999 permutations based data) ! ! ! S2: Table is showndiagonal. above on 999 permutations based 151 Local adaptation in A. vulneraria and A. alpina 152 Chapter 8 Chapter 8 Novel microsatellite markers for the high-alpine Geum reptans L. (Rosaceae) Elena Hamann, Halil Kesselring, Jürg Stöcklin and G.F.J Armbruster* *G.F.J. Armbruster is the corresponding author. Applications in Plant Sciences 2(6): 2014 DOI: 10.3732/apps.1400021, available online at www.bioone.org 153 Primer note Geum reptans 154 Chapter 8 Novel microsatellite markers for the high-alpine Geum reptans L. (Rosaceae) Elena Hamann, Halil Kesselring, Jürg Stöcklin, Georg F.J. Armbruster* Department of Environmental Sciences, Population Biology of Plants, University of Basel, Schönbeinstrasse 6, CH-4056 Basel, Switzerland * For correspondence: [email protected] Abstract • Premise of the study: Geum reptans L. reproduces by outcrossing or the formation of stolons. Sexual and clonal reproduction are not exclusive strategies and occur mostly simultaneously. We developed novel microsatellite primers for this species. The microsatellites will be used in a study about local adaptation, phenotypic plasticity and random molecular divergence of alpine plants. • Methods and Results: Initially, the forward primers had an M13 tail, and the allelic signals of each locus were amplified using a single fluorescent labeled M13 forward sequence. In the running phase, a multiplex PCR assay was developed using different fluorophore-labeled forward primers. Two to eleven alleles were found per locus, depending on the studied population. • Conclusions: Identical multi-locus genotypes (i.e. clonal offspring) were not found as spacing between individuals in our sampling was at minimum four meters. Fst-Qst analysis will be applied to detect selection processes in populations of Geum reptans across the Alps. Keywords: Alpine scree; clonal reproduction; ECO500 size marker; multiplex PCR 155 Primer note Geum reptans Introduction microsatellite primers developed for the lowland rosid Geum urbanum has been It is generally assumed that alpine plants reported in seeds of Geum reptans (Arens et are locally adapted due to strong selection in al. 2004). However, trans-species habitats characterized by severe climatic amplification was not successful in our lab conditions and high environmental although we used the PCR protocol given by heterogeneity (Körner, 2003). However, this Arens et al. (2004). Hence, we decided to assumption has rarely been tested. find new polymorphic microsatellite loci in Our research uses reciprocal Geum reptans in order to analyze neutral transplantation experiments (RTE) and genetic differentiation of our study sibling analyses to estimate the degree of populations. phenotypic plasticity versus the degree of local adaptation in populations of several Methods and results alpine plant species (Kawecki & Ebert, 2004; Via, 1984). As each transplantation site of Geum reptans is a diploid, perennial an RTE is also a common garden, phenotypic rosette plant usually found in high alpine differentiation of plant functional traits can scree fields and in glacier forelands. The be compared to neutral genetic differentiation plant uses sexual reproduction to produce based on microsatellite data (i.e. Fst-Qst viable seeds, and also expands through analysis). This allows to infer strength and vegetative aboveground stolons (Fig. 1 and direction of past selection on the measured Weppler et al. 2006). Selfing provides no traits and therefore to test for local adaptation viable seeds in G. reptans, probably due to (Scheepens et al. 2013; Spitze, 1993). gametophytic self-incompatibility as in other One of our focal alpine plants is Geum species of the Rosaceae (see Rusterholz et al. reptans L. (Rosidae). Cross-amplification of 1993). Fig. 1: Reproducing individual of Geum reptans in a glacier forefield. The stolons (red arrows) root at the end, eventually forming a new clonal plant next to its ‘mother’. This reproductive mode with sexual flowers and vegetative, above-ground stolons is comparable to strawberries (e.g., Fragaria vesca). We sampled three geographically distinct 45°59'16.69"N, 7°40'40.73"E). Tissue populations of the Swiss Alps (Davos: samples from young leaves of 20 randomly 46°44'47.46"N, 9°56'47.70"E; Furka: selected individuals were collected from each 46°33'24.28"N, 8°24'45.40"E; Zermatt: population in summer 2012. Sampled 156 Chapter 8 individuals were separated by at least four QIAGEN (Hilden, Germany) with 15 mM meters to minimize the risk of re-sampling MgCl2 and 200 µM dNTP’s, 0.3 µL primer identical clones (Pluess & Stöcklin 2004, p. master mix of each of the three loci, 0.5 U 2014). Leaf material was stored in Silica in Hotstar Taq polymerase (QIAGEN, Hilden, the collection of the University of Basel, Germany), and 2-10 ng DNA. Cycling section of Population Biology of Plants. conditions were: denaturation at 95 °C for 15 The microsatellite project was outsourced min, start PCR at 94 °C 30 sec, 56 °C 90 sec, to a professional company for marker and 72 °C 60 sec in 35 cycles. Final development. ECOGENICS GmbH elongation was set to 72 °C for 30 min. After (Schlieren, Zurich, Switzerland) received the PCR, samples were mixed with ECO500 size Silica dried leaf material of G. reptans. The standard (provided by ECOGENICS), and genome screening technique of loaded on an ABI3730 sequencer (Applied ECOGENICS has been described previously Biosystems, Carlsbad, California, USA). (Kesselring et al. 2013). The total 26,603 This size marker is suitable for accurate reads had an average length of 178 bp, and sizing in the range of 50 – 500 bp. ECO500 2,222 of these reads contained a was labeled with ‚orange’ Dyomics630 dye, microsatellite insert with a tetra- or a and comprised the following basepair trinucleotide of at least 6 repeat units or a fragments: 75, 102, 124, 148, 171, 207, 229, dinucleotide of at least 10 repeat units. 260, 274, 311, 321, 349, 374, 395, 419, 455, Suitable primer design was possible in 309 473, and 497 bp. Allelic assignment of the reads. In order to find allelic polymorphisms electropherograms was done with a test sample of N = 15 individuals was used. GeneMarker version 1.80 (SoftGenetics For the screening of loci for polymorphy and LLC, State College, USA). Data were PCR functionality, a PCR strategy (see crosschecked for repeatability. Eight of the details in Kesselring et al. 2013) that 60 individuals were re-tested, starting again involved M13-tailing at the 5’-end of each with DNA extraction of the silica-dried forward primer was used (Schuelke 2000). leaves and microsatellite fingerprinting. Finally, nine out of twelve loci provided Hence, 72 fingerprints (i.e., 8 samples ⋅ 9 sufficient allelic polymorphisms and robust loci) of the first run were opposed to 72 PCR characteristics (Table 1). In order to fingerprints of the repetition run. Just one facilitate subsequent genotyping, the PCR of pair-wise comparison differed, which is an the identified loci were combined in three error rate of 1.4 %. The error occurred due to multiplex assays using fluorophore-labeling inconsistent allelic assignment of an (Table 1). For each locus, a fraction of the individual at locus 015615. Instead of being forward primer was labeled with a heterozygous, the individual was interpreted fluorophore and complemented with non- in the repetition run as homozygous. Two labeled forward primer and reverse primer to loci showed ‘back-ground noise’ (Locus a concentration of 10 µM primer master mix 015967 and 013998; Table 1), i.e. we (see footnote in Table 1). Subsequently, 20 interpreted the constant occurrence of an individuals from each of the three additional peak as mismatch. Moreover, at populations (Davos, Furka, Zermatt) were locus 013998 an allele of 151 bp was found tested (a total of N = 60 individuals, Table to occur in a frequency of 5 %. This allele 2). PCR was done in a final volume of 10 µL, was binned with the common allele of 150 bp and contained 1 µL PCR stock buffer of because of potential stuttering (see Table 1). 157 Primer note Geum reptans The same was done with the ‘144’ allele common and was estimated to range between (frequency of 8 %; binning with ‘143’) at 53 % and 74 % (Weppler et al., 2006). locus 002235 (Table 1). The polished data set was written in Genepop format (Rousset Conclusion 2008). Three software packages were used: Genepop on the Web for general index The new microsatellite markers described calculations and tests on linkage herein proved to be valuable tools to perform disequilibrium population and landscape genetics studies in (http://genepop.curtin.edu.au/), Micro- the clonal plant Geum reptans, for parental Checker (van Oosterhout et al. 2004) for tests analysis or further investigations of its on potential null-alleles with a prior value of breeding system. Observed and expected maximum allele length of 250 bp and a 95% heterozygosity were in good agreement, confidence limit, and GenAlex 6.2 (Smouth indicating random mating of alleles and et al. 2008; Beck et al. 2008) for finding sexual outcrossing. Null-alleles might identical multi-locus clones. however occur at some loci. Given the Two to eleven alleles were found per absence of identical multi-locus genotypes, locus, depending on the studied population we assume that our sampling design was (Table 2). Observed (Ho) and expected successful in avoiding clonal individuals and heterozygosity (He) mostly were in good indicate that clonal offspring of G. reptans agreement, indicating sexual outcrossing and establish only right next to their ‘mother’ random mating of alleles. However, three plants. In the near future, we will examine loci showed obvious deviation in Ho vs. He microsatellite data of G. reptans to identify (Table 2). The presence of null alleles was neutral genetic differentiation across the suggested by Micro-Checker for locus Alps. Contrasting molecular differentiation 002235, 007389 and 011721 in some with differentiation in fitness-related populations (Table 2). The independent phenotypic traits of reciprocally transplanted evolution of the microsatellite loci was tested populations (Fst-Qst analysis) should allow with linkage analysis. There was no linkage detection of selection and local adaptation. disequilibrium among pairs of loci across all populations (all p’s > 0.09). In a further step, Acknowledgments we searched for identical multi-locus genotypes because of clonal reproduction by The authors thank ECOGENICS GmbH stolons. Six of the 60 individuals had to be (Schlieren, Zurich, Switzerland) for technical excluded from the analysis since they had support. This project was funded by a Swiss missing values at some loci (000-allele code National Science Foundation grant to JS (no. in Genepop). We did not find identical multi- 31003A_135611/1). locus genotypes in the 54 remaining individuals, although the establishment of clonal offspring by stolons of G. reptans is 158 Chapter 8 O, in a 2 eles with eles For example, 3 bp. 3 be amplified only in a primers at loci 003651, and - primer at locus 011721; ATTO565 for - primer, 5 µl reverse primer and 40 µl ddH - th 80 bp. 5; ATTO550 for F notype, mismatch signal between 124 bp and 125bp. The 151 bp 151The 125bp. and bp 124 between signal mismatch notype, primer was between 0.11 and 0.52 (see text). - L were pipetted into the PCR tube together with two other µ 0.3 . Comment Depending on genotype, mismatch signal between 122 bp and 126 bp. 126 and bp 122 between signal mismatch genotype, on Depending Depending on ge on Depending allele wascommon binned 150the withofbp. allele allele The 144 bp allele was binned with the common allele of 14 of allele common the with binned was allele bp 144 The Only eight of the 15 test individuals gave readable amplicons; three all three amplicons; readable gave individuals test 15 the of eight Only 180 bp, 183 bp and 186 bp were found. were bp 186 and bp 183 bp, 180 monomorph; 1 allele with 94 bp. 94 with allele 1 monomorph; monomorph; 1 allele wi allele 1 monomorph; primer, 4.5 µl unlabeled F 145 150 171 221 160 182 186 - 189 - - - - - - - 121 Geum reptans - - primer and unlabeled F Amplicon length (bp) 125 92 125 143 125 95 137 131 180 94 80 - 7 7 12 14 11 11 12 13 11 12 11 labeled F - Repeat motif (TG) (TC) (AC) (CT) (GA) (AG) (CA) (AG) (TGA) (TC) (CCG) primer. Of this master mix labeled F - - primers at loci 015967, 002235, and 01561 - 3’) - primer and 10 µM total R - GAGAGTGAGGTTTTCCGGC CGTCGCTCTCTCTATCTACCC Primer sequence (5’ sequence Primer F: ACGGGTCTCTCTTCACTTGG F: R: TGACCATACTCATTCGCCCC R: F: AAAACCCTAGCCTTCGTCGC F: R: ATGTTAAGTGCAGCGGTTCG R: F: GAGCCACACTGAAAGCCATC F: R: GCCACTCTCAGTATCTTCCTCC R: F: TCCGGTCCACCAAAGGATAG F: R: CTTGCCTTTTCCATGGGCTC R: F: CCACCTACAGTACGGACGAC F: R: ACCCCAATTCATTCGACACG R: F: CGCCCAAAATCAATCCATCAC F: R: GTACACCTTTGCTCCCCCTC R: F: F: TTTTGGATTGGACTACATAGACAG R: CAGTACCTGGAATCTGGGGG R: F: TGTGATCGATTAACTGCTGACG F: R: CACTCCCTCCAGCTCAGTTC R: F: ACAAAAATGGCGAGAGCATC F: R: CTTTGGTACGGCCCATTTCG R: F: TGTGTGTGTTTTGCCCTAGC F: R: AAAGTACCCCATCCCAGCTC R: F: F: R: individuals. - Genbank Genbank accession KJ439055 KJ439056 KJ439057 KJ439058 KJ439059 KJ439060 KJ439061 KJ439062 KJ439064 KJ439065 KJ439066 Characteristics of the newly developed microsatellite markers for : 2 of the 15 test 2 2 1 primers at loci 013998, 011534, and 007389; FAM for F Three of the tested loci were excluded. These loci were either monomorphic in the test sample of N = 15 individuals or could Three multiplex PCR assays (a, b, c) were performed. The following fluorescent dyes were used: ATTO532 for F - Locus Locus 015967 a) 011721 a) 013998 a) 002235 b) 003651 b) 011534 b) 015615 c) 013198 c) 07238 14769 26238 Table 1 1 1 F 013198. In the multiplex PCR assays, the ratio of fluorophore the primer master mix of locus 011721 contained 0.5 µl ATTO532 final concentration of 10 µM total F primer master mix solutions (see text). 2 subset 159 Primer note Geum reptans = = o * e 0.53 0.82 0.67 0.83 0.65 0.19 0.14 0.73 0.73 0.39 H Zermatt o 0.60 0.90 0.60 0.85 0.65 0.10 0.05 0.45 0.3 H (each with N = 20 individuals). A = number of alleles, H alleles, of number = A individuals). 20 = N with (each 4 10 6 9 4 3 2 7 2 A * * e Geum reptans Geum 0.77 0.77 0.85 0.86 0.86 0.83 0.59 0.59 0.63 0.79 0.65 H Furka o 0.15 0.85 0.90 0.80 0.90 0.35 0.75 0.70 0.75 H 5 9 10 8 11 3 3 8 4 A * * * e 0.86 0.86 0.81 0.81 0.76 0.77 0.71 0.71 0.56 0.56 0.66 0.66 0.57 H Davos = expected heterozygosity. expected = e o 0.25 0.75 0.65 0.70 0.70 0.50 0.60 0.45 0.6 H 9 9 9 8 11 5 6 6 4 A Details of three populations from Davos, Furka and Zermatt of of Zermatt and Furka Davos, from populations three of Details cus * indicates potential null alleles (see text). (see alleles null potential indicates * 007389 013198 015615 011534 003651 002235 013998 011721 015967 Lo observed heterozygosity, H heterozygosity, observed Table 2: Table 160 Chapter 8 References reptans L. Verhandlungen der Gesellschaft für Ökologie 22: 337–346. Scheepens JF, Frei ES, Stöcklin J. 2013. Glacial Arens P, Durka W, Wernke-Lenting JH, Smulders history affected phenotypic differentiation MJM. 2004. Isolation and characterization in the alpine plant, Campanula thyrsoides. of microsatellite loci in Geum urbanum PLoS ONE 8: e73854. (Rosaceae) and their transferability within Schuelke M. 2000. An economic method for the the genus Geum. Molecular Ecology Notes fluorescent labeling of PCR fragments. A 4: 209-212. poor man’s approach to genotyping for Beck N, Peakall R, Heinsohn R. 2008. Social research and high-throughput diagnostics. constraint and an absence of sexbiased Nature Biotechnology 18: 233-234. dispersal drive fine-scale genetic structure Smouse PE, Peakall R, Gonzales E. 2008. A in white-winged choughs. Molecular heterogeneity test for fine-scale genetic Ecology 17: 4346-4358. structure. Molecular Ecology 17: 3389- Kawecki TJ, Ebert D. 2004. Conceptual issues in 3400. local adaptation. Ecology Letters 7: 1225- Spitze K. 1993. Population-structure in Daphnia 1241 obtusa: quantitative genetic and allozyme Kesselring H, Hamann E, Stöcklin J, Armbruster variation. Genetics 135: 367-374. GFJ. 2013. New microsatellite markers for Van Oosterhout C, Hutchinson WF, Wills DPM, Anthyllis vulneraria (Fabaceae), analyzed Shipley P. 2004. MICRO-CHECKER: with Spreadex gel electrophoresis. software for identifying and correcting Applications in Plant Sciences 1: 1300054. genotyping errors in microsatellite data. Körner C. 2003. Alpine plant life: functional plant Molecular Ecology Notes 4: 535–538. ecology of high mountain ecosystems. 2nd Via S. 1984. The quantitative genetics of polyphagy in Edition, Springer, Heidelberg, 344 pp. an insect herbivore. II. Genetic correlations Pluess A, Stöcklin J. 2004. Population genetic in larval performance within and among diversity of the clonal plant Geum reptans host plants. Evolution 38: 896-905. (Rosaceae) in the Swiss Albs. American Weppler T, Stoll P, Stöcklin J. 2006. The relative Journal of Botany 91: 2013–2021. importance of sexual and clonal Rousset F. 2008. GENEPOP’007: A complete reproduction for population growth in the reimplementation of the GENEPOP long-lived alpine plant Geum reptans. software for Windows and Linux. Journal of Ecology 94: 869-879. Molecular Ecology Resources 8: 103–106. Rusterholz HP, Stöcklin J, Schmid B. 1993. Populationsbiologische Studien an Geum 161 Primer note Geum reptans 162 Chapter 9 Chapter 9 New microsatellite markers for Anthyllis vulneraria L. (Fabaceae), analyzed with Spreadex® gel electrophoresis Halil Kesselring, Elena Hamann, Jürg Stöcklin, G.F.J. Armbruster* * G.F.J. Armbruster is the corresponding author Applications in Plant Sciences, 1(12), 2013 DOI: 10.3732/apps.1300054, available online at www.bioone.org 163 Primer Note Anthyllis vulneraria 164 Chapter 9 New microsatellite markers for Anthyllis vulneraria (Fabaceae), analyzed with Spreadex® gel electrophoresis H. Kesselring, E. Hamann, J. Stöcklin, G.F.J. Armbruster* Department of Environmental Sciences, Population Biology of Plants, University of Basel, Schönbeinstrasse 6, CH-4056 Basel, Switzerland * For correspondence: [email protected] Abstract • Premise of the study: New microsatellite primers were developed for the diploid herb Anthyllis vulneraria L. Primers will be used in a study focusing on random genetic variation, local adaptation, and phenotypic plasticity in alpine plants. • Methods and Results: The new primers were adjusted to separate PCR amplicons (70 bp to 170 bp) on precast Spreadex® gels using horizontal gel electrophoresis. No capillary sequencer was needed. • Conclusions: Our preliminary results showed that the three studied alpine populations are predominantly outcrossing, but including variable levels of self-fertilization. Keywords: Alpine plants, Ethidium bromide, Horizontal electrophoresis, Microsatellites 165 Primer note Anthyllis vulneraria Introduction microsatellite loci AV2, AV3, AV7, AV12, and AV23 and the respective primers Alpine environments are considered to be described by van Glabeke et al. (2007). particularly heterogeneous. Two fundamental These loci promised to be suitable for survival strategies for heterogeneous Spreadex® electrophoresis because the environments can be contrasted: local amplicons are between 60 bp and 170 bp. adaptation or specialization vs. phenotypic Despite the infraspecific taxonomic plasticity, a generalist strategy. A major uncertainties of A. vulneraria (Nanni et al., hypothesis suggests that phenotypic plasticity 2004) the above microsatellites finally is favored over local adaptation when the proved to be useful for our populations from spatial scale of dispersal spans several the Swiss Alps (data not shown). However, environmental states (Sultan and Spencer, to study spatial genetic variation with greater 2002). Reciprocal transplantation power we needed additional polymorphic experiments (RTE) are suitable to study both, microsatellite sequences from the genome of local adaptation, and the reaction norm of A. vulneraria. The development of 10 plant phenotypes at different transplantation additional microsatellite primer pairs was sites (Kawecky and Ebert 2004). In the near outsourced to ECOGENICS GmbH future, we will apply RTE using populations (Schlieren, Zurich; see Matter et al. 2012). from two spatial scales (representing fine vs. coarse grained environmental variation) of ECOGENICS started with leaf material of four alpine species including Anthyllis A. vulneraria from the alpine region of vulneraria L. The degree of neutral genetic Davos, Switzerland. Size selected fragments differentiation will be estimated using from genomic DNA were enriched for simple microsatellites and will be compared to sequence repeats (SSR) by using magnetic phenotypic differentiation (e.g., Fst – Qst streptavidin beads and biotin-labelled CT and analysis). GT repeat oligonucleotides. The SSR enriched library was analyzed on a Roche Methods and results 454 platform using the GS FLX titanium reagents (MICROSYNTH AG, Balgach, In our lab, we used Spreadex® gels and Switzerland). The total 23,720 reads had an the ORIGINS electrophoresis unit average length of 188 bp. Of these, 574 (ELCHROM SCIENTIFIC AG, Cham, contained a microsatellite insert with a tetra- Switzerland) for microsatellite analysis. or a trinucleotide of at least 6 repeat units or Spreadex® gels resolve PCR amplicons with a dinucleotide of at least 10 repeat units. One size differences of 2 bp in an electrophoresis prerequisite was that the newly developed time of 1 to 2 h. Amplicons should not be amplicons should be in the size range from longer than ca. 170 bp. In nearly all cases, 70 to 170 bp (see above). Suitable primer heterozygous character states show a ‘third’ design was possible in 120 reads. top band in the gel (i.e. a heteroduplex) Subsequently, ten loci (Table 1) provided because the gels consist of a non-denaturing allelic polymorphisms in 15 individuals matrix (see Figure 1, and Armbruster et al., (using an 48 capillary ABI3730 sequencer; 2005). Homozygous individuals show a data not shown). ECOGENICS used M13- single prominent PCR band. For Anthyllis tailing at the 5’-end of each forward primer vulneraria, we checked the five for PCR. Hence, PCR conditions of 166 Chapter 9 ECOGENICS were different from our with a fluorescent dye for multiplexing), 0.5 protocol in the running phase (below). The U Hotstar Taq polymerase (QIAGEN, 10 µL PCR mix of ECOGENICS consisted Hilden, Germany), and 10 ng DNA. Cycling of 1 µL PCR stock buffer of QIAGEN conditions were: denaturation at 95 °C for 15 (Hilden, Germany) with 15 mM MgCl2, 200 min, start PCR at 95 °C 30 sec, 56 °C 45 sec, µM dNTP’s, 0.04 µM forward primer (with and 72 °C 45 sec in 30 cycles, continued with M13-tail), 0.16 µM reverse primer, 0.16 µM 95 °C 30 sec, 53 °C 45 sec, and 72° 45 sec in M13 primer (5’- eight cycles. Termination was set to 72 °C TGTAAAACGACGGCCAGT-3’, labeled for 30 min. Figure 1. Spreadex® EL 400 gel with electrophoretic resolution of 8 µl to 9 µl of microsatellite amplicons at locus AV-005692. Fingerprints of 23 diploid individuals of Anthyllis vulneraria are shown. M = 7 µl of M3 marker from Elchrom Scientific (see bp at right margin). Genotypes are labeled in capitals. Alleles (A,B,C,D) are coded by size (A = 79 bp, B = 83 bp, C = 89 bp, D = 93 bp). Note that heterozygous individuals show a prominent heteroduplex signal (yellow dots). In the running phase, we checked the ten PCR was run in a MASTERCYCLER loci with Spreadex® electrophoresis. Three GRADIENT (Eppendorf, Hamburg, distinct populations of A. vulneraria that Germany), with denaturation at 95 °C for 2 were geographically close to Davos, min, start PCR at 95 °C 30 sec, locus specific Switzerland, were selected (each with N = annealing temperature (Table 1) 45 sec, 72 20): Schiahorn (46°48'59.64" N, 9°48'16.80" °C 45 sec in 35 cycles. Termination was set E), Monstein (46°41'16.92" N, 9°47'15.84" to 72 °C for 8 min. Samples were loaded on E), and Casanna (46°51'26.88" N, EL 400 or EL 600 gels (Table 1, Figure 1). 9°49'37.74" E). Voucher specimens and M3 ladder from ELCHROM was used as size seeds (sampled by H.K.) are stored in the marker. Finally, gels were stained with collection of the University of Basel, section ethidium bromide. Nine loci provided PCR of Population Biology of Plants. DNA was amplicons, and their alleles were identical in extracted with the DNeasy Plant Mini Kit of size (bp) to those reported by ECOGENICS QIAGEN (Hilden, Germany). We used self- (Table 1). We tested the observed allelic dissolving illustra puReTaq Ready-To-Go signals for repeatability. Repetition PCR Beads (GE Healthcare, comprised DNA extraction of nine Buckinghamshire, UK). 25 pmol forward and individuals (= 15 % of the 60 individuals; reverse primer, ddH20 and 5 ng of DNA were Table 2), PCR and electrophoresis. In the 81 added to the beads (e.g., Steiner et al. 2012). microsatellite lanes on the gels (9 samples ⋅ 9 167 Primer note Anthyllis vulneraria loci), two lanes gave unclear genotype re- reproduction for French populations of assignment (i.e. an error rate of ca. 2.5 %). Anthyllis vulneraria (see Couderc, 1971), whereas Navarro (2000) found that strong Three to twelve alleles were found per protandry constrained self-fertilization in an locus depending on the population studied Iberian population. The molecular analysis of (Table 2). Observed and expected van Glabeke et al. (2007) of two Belgian heterozygosity (Table 2), linkage equilibrium populations indicated that they were and Weir&Cockerham Fis-values were predominantly outcrossing. As all flowers of calculated with ‘Genepop an individual plant do not develop (http://genepop.curtin.edu.au/). P-values for synchronously, it is very likely that insects each locus pair across all populations yielded transfer pollen from late flowers to stigmata no significant linkage (all p’s > 0.07). The of early flowers of the same plant (i.e. mean Fis-values over all loci were positive geitonogamy). Based on our results, we (Schiahorn = 0.12; Monstein = 0.33, and suppose that there is variation in the degree Casanna = 0.34). Micro-Checker (van of outcrossing and inbreeding among our Oosterhout et al. 2004) tested for null alleles, populations from the Swiss Alps. with maximum expected allele size set to 200 bp, and a confidence interval of 95 %. No Conclusions unusual observations were found. Micro- Checker suggested null alleles for AV- The newly developed microsatellite 021012, AV-021049, AV-021224, and some markers are suitable for horizontal others (Table 2). However, in the 60 Spreadex® gel electrophoresis with simple individuals tested just four blank lanes ethidium bromide staining and a considerable appeared, interestingly all at AV-021049. We short electrophoresis time. No sequencer is believe that ‘real’ null alleles are therefore needed to resolve the allelic patterns. only likely for that particular locus. Hence, Multiplex of two loci can also be tested, e.g. we suppose that the excess of homozygosity if the locus-specific amplicons differ in their is mostly due to self-fertilization (e.g. three respective length (e.g, 80 bp to 100 bp vs. of the 60 specimens were homozygous in all 110 bp to 130 bp). Central alpine populations nine loci). Inbreeding is also indicated by the seem to be predominantly outcrossing with positive Fis-values. Autogamy has been variable levels of self-fertilization. reported as the predominant mode of 168 Chapter 9 4 primers primers with ------type EL 400 EL 400 EL 600 EL 400 EL 400 EL 600 EL 400 EL 400 EL 600 EL Spreadex® gel gel Spreadex® (°C) --- 52 52 50 52 50 52 50 52 52 electrophoresis electrophoresis chamber). Our a T TM 3 5 147 93 155 98 170 123 101 117 120 104 – – – – – L per slot). EL 400 and EL 600 differ in the – – – – – µ 77 82 89 77 89 88 Amplicon Amplicon 114 136 133 74 length (bp) 2 12 . 8 7 13 17 12 18 12 13 11 (AG) 12 (TC) (TG) (CA) (AC) (AC) (GA) (AG) (GTT) (AGT) electrophoresis electrophoresis chamber. Note that ECOGENICS used F (TG) Repeat motif motif Repeat TM mples mples per gel (loading volume ca. 9 Anthyllis vulneraria Anthyllis ee text) but could not be established in the running phase in our lab. Amplicon size is otnote 5). otnote 3’) - (5’ 1 021803 (see fo (see 021803 - Primer sequence sequence Primer 2x25 with a loading capacity of 25 sa - CAGCCTGAAAGTATTGGTGGG CACTCTTGCGATACGAGAGC CAGCATAGCTGCTTCTGTGAG AACAATCTGGAAACCCTCGC TGCGCATACACGAAGAAACC TGGGCCATTTGCTTCTATATATGTG TGGAATCGGAGATTGATTCTGG GGTCCTCTATGGCAATCCTCC CAGTCGATTCTCCACCCCTC GCAGAGAAGTTATAGTAGCTGTGTG GCATCTAGCCTCGTTTGTTTTATG GTCTGTTTATATGCAATGCGTGC TGAAATCAACCCACTAGACAACG GACTATGGTGGGTGGGTGG ATGAAGGAGGTGGGGCATAG ACCAGCACCCAAGACCATAG GGAGCTGCTTTTAGCGAGAG TGCATTGTTAAATTGAAGCTAGGTG TCTTACTTTCTCACAAGAATGCTATC Mini Mini S F: F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: TTTGCTAGTGTTGGACCTGC R: Genbank Genbank accession nd, and fluorescent labeled M13 primers in their developmental phase (see text). (see phase developmental their in M13primers labeled fluorescent and nd, KF379737 KF379738 KF379739 KF379740 KF379741 KF379742 KF379743 KF379744 KF379745 KF379746 e - 5 Characteristics of the newly developed microsatellite markers in in markers microsatellite developed of newly the Characteristics = annealing temperature in the running phase of our project (see text). (see project our of phase running the in temperature annealing = a 000290 002128 004868 005692 015354 020270 021012 021049 021224 021803 ------Locus - We We recommend an time electrophoresis of 1.5 to 2.0 h, a temperature of 55 °C, and 10 V/cm (i.e., 120 V in the ORIGINS Elchrom This This locus worked according to the protocol of ECOGENICS (with M13 tailing; s AV AV AV AV AV AV AV AV AV Protocol of ECOGENICS, based on genomic DNA sequences analyzed on a Roche 454 GS FLX platform. FLXGS 454 Roche a on analyzed DNAsequences genomic on ECOGENICS,based of Protocol Inthe 60 individuals of Davos (see Table 2), except locus AV Primers Primers used for PCR and subsequent Spreadex® gel electrophoresis with the ORIGINS Elchrom AV Table 1. Table T Note 1 5’ the at M13an tail 2 3 4 preferred precast Spreadex® gels are the EL400. amplicons shorter for EL600, used we amplicons longer For matrix. gel the of density 5 ECOGENICS.by checked individuals 15 on based 169 Primer note Anthyllis vulneraria = expected = expected e heterozygosity, H heterozygosity, e H ). 0.750 0.802 0.917 0.601 0.715 0.764 0.678 0.803 0.769 = observed = observed o o H 0.650 0.500 0.700 0.700 0.600* 0.600* 0.150* 0.200* 0.400* Casanna (n = 20) Casanna 8 8 6 8 7 3 A 12 10 12 CHECKER analysis (see text (see CHECKER analysis - e H 0.715 0.820 0.729 0.602 0.673 0.689 0.670 0.720 0.635 . A = number of alleles found, ofH . A = number alleles o H 0.600 0.650 0.500 0.550 0.550 0.500* 0.300* 0.250* 0.300* Monstein (n = 20) Monstein 6 8 8 4 6 5 4 8 6 A Anthyllis vulneraria Anthyllis e H 0.601 0.695 0.827 0.675 0.770 0.764 0.714 0.610 0.667 o H 0.600 0.750 0.850 0.750 0.800 0.700 0.500* 0.300* 0.350* Schiahorn (n = 20) Schiahorn 5 7 8 4 7 6 4 4 6 A . Details on the three populations of populations three on the . Details 000290 002128 004868 005692 015354 020270 021012 021049 021224 ------Locus AV AV AV AV AV AV AV AV AV 2 Table heterozygosity. on MICRO based alleles null potential / of excess homozygotes * indicates ! ! 170 Chapter 9 References northwestern Iberian Peninsula. Nordic Journal of Botany 19: 281-287. Steiner BL, Armbruster GFJ, Scheepens JF, Armbruster GFJ, Koller B, Baur B. 2005. Foot Stöcklin J. 2012. Distribution of bulbil- mucus and periostracum fraction as non- and seed-producing plants of Poa alpina destructive source of DNA in the land snail (Poaceae) and their growth and Arianta arbustorum, and the development reproduction in common gardens suggest of new microsatellite loci. Conservation adaptation to different elevations. Genetics 6: 313–316. American Journal of Botany 99: 2035– Couderc H. 1971. Étude expérimentale de la 2044. reproduction de l’Anthyllis vulneraria L. Sultan SE, Spencer HG. 2002. Metapopulation Bulletin de la Société botanique de France structure favors plasticity over local 118: 359-374. adaptation. American Naturalist 160: 271- Kawecki TJ, Ebert D. 2004. Conceptual issues in 283. local adaptation. Ecology Letters 7: 1225- Van Glabeke E, Honnay O, Roldan-Ruiz I. 2007. 1241. Isolation and characterization of Matter P, Pluess AR, Ghazoul J. Kettle CJ. 2012. polymorphic microsatellite markers in Eight microsatellite markers for the Anthyllis vulneraria. Molecular Ecology bulbous buttercup Ranunculus bulbosus Notes 7: 477-479. (Ranunculaceae). American Journal of Van Oosterhout C, Hutchinson WF, Wills DPM, Botany: e399-e401. Shipley P. 2004. MICRO-CHECKER: Nanni L, Ferradini N, Taffetani F, Papa R. 2004. software for identifying and correcting Molecular phylogeny of Anthyllis spp. genotyping errors in microsatellite data. Plant Biology 6: 454-464. Molecular Ecology Notes 4: 535–538. Navarro L. 1999. Reproductive biology of Anthyllis vulneraria subsp. vulgaris (Fabaceae) in 171 Primer note Anthyllis vulneraria 172 Chapter 10 Chapter 10 General Discussion 173 General discussion 174 Chapter 10 Flowering phenology was advanced at the General Discussion lower, warmer site, in accordance with several studies relating earlier flowering Summary phenology in response to warmer temperatures and advanced springtime The aim of this thesis was to understand (Menzel et al., 2006, Cleland et al., 2007). (1) how phenotypic plasticity allows alpine Drought emphasized these responses by plants to buffer against specific aspects of further advancing phenological onsets and climate change, (2) if alpine plants harbor the shortening the duration of phenophases, same potential for phenotypic plasticity as indicative of an escape strategy limiting the lowland species, (3) if patterns of local negative effects of reduced soil water adaptation are present in alpine plant availability (Franks, 2011). The major novel populations in the Swiss Alps, and (4) to finding of this study was the detection of a investigate the mutual role of genetic lower potential for phenotypic plasticity in differentiation and phenotypic plasticity in the flowering phenology of high elevation local adaptation in order to infer on a broader species in comparison to lower elevation scale on the adaptive potential of alpine congeners (Chapter 2). While a prior study plants facing climate change. Based on these had already related similar findings in aims, several questions were formulated in deciduous tree seedlings (Vitasse et al., the General Introduction (Chapter 1) and 2013), this study is the first to demonstrate were addressed in a number of experiments limited plasticity in flowering phenology related in the subsequent chapters (Chapter across a large number of perennial alpine 2-9). I will now attempt to summarize what forbs and grasses. We conclude that this we have learned from the studies conducted result is related to the specific adaptations of in respect to these questions and emphasize high elevation species to a short growing the most novel aspects of our findings. season at high elevation, where selective pressures controlling timing of reproduction The first two questions were addressed in become increasingly stronger (Chapter 2). a common garden experiment were a large In contrast, while the other examined key number of congeneric mid- and high- functional traits (i.e. specific leaf area: SLA, elevation species were grown at two biomass allocation to roots and reproductive elevations and under different soil water structures; Chapter 3) were also very plastic availability (Chapter 2, and 3). We in response to experimental warming and specifically examined plastic responses in drought, no difference in the magnitude of flowering phenology (Chapter 2) and other these plastic responses were detected key functional traits (Chapter 3) of alpine between mid- and high-elevation species for species to experimental warming and these particular traits. Aboveground biomass drought, and asked whether these plastic and SLA decreased with elevation and responses differed in the direction and/or drought for both mid- and high-elevation magnitude between congeneric mid- and species. Biomass allocation to roots (RMF) high-elevation species. Extensive phenotypic was generally higher in high elevation plasticity was found for all traits in mid- and- species relative to lower elevation congeners high elevation species and plastic responses and drought increased the allocation to seemed to track ongoing climate changes. reproductive structures (FMF). However, we 175 General discussion found very little evidence for differences in phenology and allocation to reproductive the degree of phenotypic plasticity in key biomass with genetic differentiation at plant traits between mid- and high-elevation neutral marker loci (Chapter 4). In line with species (Chapter 3), a result in line with previous findings, reduced soil water prior studies (Frei et al., 2014b). In contrast availability advanced phenophases to the degree of plasticity of high elevation suggesting an escape strategy. This response species in flowering phenology, other key was uniform as genetic variation for plant traits such as SLA, RMF and FMF were phenotypic plasticity in response to soil not constrained. These functional traits moisture availability was absent across probably benefit from being very plastic, populations. In accordance with prior studies which allows the adjustment of resource (Frei et al., 2014a), the main finding of this acquisition and allocation and the study was the demonstration that the timing maintenance of fitness homeostasis across of onset and peak flowering has been under diverse environments. Our results suggest past divergent selection (QST > FST) among that mid- and high-elevation species respond populations of A. vulneraria in the Swiss to warming and drought in a similar way in Aps. These results could potentially also respect to these key plant traits, and the indicate local adaptation to currently general capacity of species to respond heterogeneous environmental conditions plastically to environmental changes between population habitats, however, this provides a clear advantage for the persistence can only be rigorously demonstrated by and survival of alpine plants (Chapter 3). To reciprocally transplanting populations across conclude, these two studies revealed that the their original field sites. As such, Chapter 4 degree of functional plasticity in response to provides a relevant and fitting transition to changes in environmental conditions is our next experiments. highly trait specific. While, alpine species had a constrained degree of plasticity in The third question, concerning patterns of flowering phenology relative to lower local adaptation to present environmental elevation congeners reflecting their specific conditions, was investigated in four alpine adaptation to the alpine environment, this species differing in life strategies by was not a general pattern. In contrast, they combining reciprocal field transplantations of benefited from maintaining high plasticity in populations growing at close or far distance other traits crucial for fitness homeostasis form each other (Chapter 5, 6, and 7) with across diverse habitats, and in the long run, analysis of molecular variation among adaptation by means of phenotypic plasticity populations (Chapter 5, 6, 7, 8, and 9). For may allow plants to adapt to the two out of the four studied species (i.e. environmental changes via genetic Chapter 5; Poa alpina and Chapter 7; assimilation (Price et al., 2003). Anthyllis vulneraria), strong evidence was found supporting the hypothesis that A second common garden study, where divergent selection could lead to local source populations of Anthyllis vulneraria adaptation in the spatiotemporally from two regions in the Swiss Alps were heterogeneous and fragmented alpine grown together under control or limited soil landscape (Kawecki and Ebert, 2004). For A. water availability, was used to compare vulneraria the flowering propensity was quantitative trait differentiation in flowering highest in sympatric transplant combinations, 176 Chapter 10 and decreased with increasing distance Methodological limits and between origin and transplant site. In P. perspectives alpina, results suggested adaption to coarse- grained environmental variability in the Common garden and reciprocal reproductive biomass, in line with high transplantation experiments are powerful regional molecular differentiation. In tools to study genetically based phenotypic contrast, the inflorescence height seemed differentiation or adaptive phenotypic adapted at a finer grain size, suggesting that plasticity. However, like any other scientific microhabitat selection was strong. Hence, the method, they are always limited by resources spatial scale and the grain size of (i.e. time and finances), and by the environmental variability at which laboriousness of the task at hand, so that transplants were performed were key in inevitable comprises are struck between the identifying patterns of local adaptation, and available resources and the optimal these patterns were trait-dependent (Chapter experimental design. Furthermore, while one 5). experiment might answer initial questions, For Arabis alpina, the evidence for local they naturally lead to follow-up questions. In adaptation is less conclusive as sympatric this section, I will shortly discuss a few and far allopatric transplant combinations issues concerning experimental limits, and had equal reproductive biomass, which was suggest possible guidelines to answer newly however higher relative to near allopatric raised questions. transplant combinations. Here again, we conclude that environmental divergence does While we were determined to include a not necessarily increase with geographic large number of species in the common distance and may cause complex fitness garden experiments (Chapter 2 and 3), a patterns (Chapter 7). Finally, despite high compromise was made in ordering seeds intraspecific phenotypic variation, little from seed producers rather than collecting evidence was found for local adaptation in maternal seed families ourselves in situ as Geum reptans, a high-alpine clonal plant this would have set us back by an entire (Chapter 6). We hypothesize that glacier growing season. However, this led us to forelands, the typical habitat of this species, consider phenotypic plasticity at the species are very similar in environmental conditions, level rather than at the narrow-sense and consequently, selective pressures are not genotype level. divergent or strong enough to cause Moreover, the drought treatment could pronounced adaptive population have been optimized. Instead of imposing an differentiation. Nevertheless, this last study arbitrary level of drought stress on the plants, also revealed high genetic diversity within precise quantities and frequencies of natural populations, and low molecular precipitation events could have been differentiation between populations growing followed, to precisely estimate the at close proximity, suggesting that the repercussions of decreasing summer relative high clonality of G. reptans does not precipitation in the Swiss Alps. This would impede genetic diversity and that gene flow have involved measuring the quantity and is maintained, at least over short distances. frequency of summer precipitation events and equally re-distributing water amounts 177 General discussion after each precipitation event, to mimic the following question: which specific natural periods of drought. Indeed, new environmental factors are traits adapted to? experimental designs have been proposed to While some hypotheses were formulated improve climate change experiments by concerning factors varying over coarse or accounting for the frequency and magnitude fine environmental grain size (i.e. climate, of extreme events (Jentsch et al., 2007). In competition, respectively), our experiments order to increase the accuracy of our do not allow saying with accuracy. This issue predictions regarding the responses of alpine could however be addressed by measuring species to summer drought events, follow-up biotic and abiotic factors at each experiments should be conducted using such transplantation site (competition, climate designs. data, soil type etc.), and correlating trait values with environmental data. We initially Concerning the reciprocal transplantation attempted to do so by installing data loggers experiments (Chapter 5, 6, and 7), we have at transplant sites, but some were come to the conclusion that the experimental unfortunately lost, and climate data was design can be optimized. For practical consequently often obtained from weather reasons, an inevitable compromise has to be stations more or less far from the sites. Thus, made between sampling many individuals our data is not precise and reliable enough to from a small number of populations or a test for correlations, and follow-up small number of individuals from a large experiments are needed to investigate number of populations. We chose the first precisely which environmental factors option as we expected high rates of mortality impose divergent selection on plant traits. after transplantations. While we were Such experiments would of course be successful in detecting local adaptation in P. incredibly challenging, and could be the alpina, A. vulneraria and A. alpina despite focus of another doctoral thesis, given the this strategy, in retrospect, a higher number infinite factors that could be considered and of populations should have been included in the complex nature of ecological interactions. these experiments at the expense of number of individuals. This would have increased Conclusions statistical power since the population and not the individual is the relevant unit of Using widespread plant species from the replication when testing for local adaptation Swiss Alps, I explored three main questions (Blanquart et al., 2013). In the case of G. in this thesis: (1) does phenotypic plasticity reptans, unfortunate early snowfall limited allow to buffer against specific aspects of the number of populations that we could climate change (i.e. warming and drought)? sample. However, we believe that the reason (2) Do alpine species harbor the same for the lack of evidence for local adaptation potential for phenotypic plasticity in key is not the small number of populations but functional traits as lower elevation rather the low divergence in environmental congeners? (3) Are populations of alpine conditions in glacier forelands where this species locally adapted, and what is the species grows. relative role of genetic differentiation and Although most of our reciprocal adaptive phenotypic plasticity in this process transplantations were successful in detecting in respect to spatial scale of environmental local adaptation in alpine species, they raised 178 Chapter 10 variability? When combining the answers to are strong and that natural selection is acting these three questions, this thesis allows on plant populations. Furthermore, we found inferring on the adaptive potential of alpine that within population genetic diversity and species in the context of current climate gene flow were not necessarily restricted by change. spatial isolation, small population size or clonality at high elevation (Stöcklin et al., As such, I hope the studies conducted in 2009). Hence, the presence of phenotypic this work frame constitute a humble plasticity, alongside to within population contribution to understanding the genetic diversity and the maintenance of repercussions of climate change on alpine genetic breadth among populations, suggests plants and their adaptive potential when that the potential for adaptive is intact in facing it. While anthropogenic climate alpine species. However, the question change poses an uncontestable threat to remains whether natural selection can keep mountain biota, our work provides evidence pace with the speed of ongoing changes suggesting that the adaptive potential is high (Visser, 2008, Shaw and Etterson, 2012). in alpine species. All our experiments demonstrated that alpine plants possess a At this point, I would like to conclude this remarkable capacity to respond to changes in work on a more personal and optimistic note environmental conditions by means of by saying that, given our results and recent phenotypic plasticity, which confers a studies that have demonstrated incredibly definitive advantage for survival and rapid adaptive evolution in plant populations persistence in heterogeneous environments (Franks et al., 2007, Nevo et al., 2012, (Alpert and Simms, 2002). Moreover, the Bustos-Segura et al., 2014), a beacon of hope evidence found for genetic population remains to suggest that plant adaptation and differentiation and local adaptation in some persistence may prevail over local extinction alpine species, indicates that selective forces in the face of climate change. Franks SJ, Sim S, Weis AE. 2007. Rapid evolution References of flowering time by an annual plant in response to a climate fluctuation. Alpert P, Simms EL. 2002. The relative advantages Proceedings of the National Academy of of plasticity and fixity in different Sciences of the United States of America, environments: when is it good for a plant to 104: 1278-1282. adjust? Evolutionary Ecology, 16: 285-297. Frei E, Hahn T, Ghazoul J, Pluess A. 2014a. Blanquart F, Kaltz O, Nuismer SL, Gandon S. Divergent selection in low and high elevation 2013. A practical guide to measuring local populations of a perennial herb in the Swiss adaptation. Ecology Letters, 16: 1195-1205. Alps. Alpine Botany, 124: 131-142. Bustos-Segura C, Fornoni J, Nunez-Farfan J. 2014. Frei ER, Ghazoul J, Pluess AR. 2014b. Plastic Evolutionary changes in plant tolerance Responses to Elevated Temperature in Low against herbivory through a resurrection and High Elevation Populations of Three experiment. Journal of Evolutionary Biology, Grassland Species. PLoS ONE, 9. 27: 488-496. Jentsch K, Kreyling J, Beierkuhnlein C. 2007. A Cleland EE, Chuine I, Menzel A, Mooney HA, new generation of climate change Schwartz MD. 2007. Shifting plant experiments: Events not trends. Frontiers in phenology in response to global change. Ecology and the Environment, 5: 365-374. Trends in Ecology & Evolution, 22: 357-365. Kawecki TJ, Ebert D. 2004. Conceptual issues in Franks SJ. 2011. Plasticity and evolution in drought local adaptation. Ecology Letters, 7: 1225- avoidance and escape in the annual plant 1241. Brassica rapa. New Phytologist, 190: 249- Menzel A, Sparks TH, Estrella N, Koch E, Aasa A, 257. Ahas R, Alm-Kubler K, Bissolli P, Braslavska O, Briede A, Chmielewski FM, 179 General discussion Crepinsek Z, Curnel Y, Dahl A, Defila C, Shaw RG, Etterson JR. 2012. Rapid climate change Donnelly A, Filella Y, Jatcza K, Mage F, and the rate of adaptation: insight from Mestre A, Nordli O, Penuelas J, Pirinen P, experimental quantitative genetics. New Remisova V, Scheifinger H, Striz M, Phytologist, 195: 752-765. Susnik A, Van Vliet AJH, Wielgolaski FE, Stöcklin J, Kuss P, Pluess AR. 2009. Genetic Zach S, Zust A. 2006. European diversity, phenotypic variation and local phenological response to climate change adaptation in the alpine landscape: case matches the warming pattern. Global Change studies with alpine plant species. Botanica Biology, 12: 1969-1976. Helvetica, 119: 125-133. Nevo E, Fu Y-B, Pavlicek T, Khalifa S, Tavasi M, Visser ME. 2008. Keeping up with a warming world; Beiles A. 2012. Evolution of wild cereals assessing the rate of adaptation to climate during 28 years of global warming in Israel. change. Proceedings of the Royal Society B- Proceedings of the National Academy of Biological Sciences, 275: 649-659. Sciences of the United States of America, Vitasse Y, Hoch G, Randin CF, Lenz A, Kollas C, 109: 3412-3415. Scheepens JF, Korner C. 2013. Elevational Price TD, Qvarnstrom A, Irwin DE. 2003. The role adaptation and plasticity in seedling of phenotypic plasticity in driving genetic phenology of temperate deciduous tree evolution. Proceedings of the Royal Society species. Oecologia, 171: 663-678. of London Series B-Biological Sciences, 270: 1433-1440. 180 Acknowledgments Acknowledgments Thanks to my institutional support system First and foremost, I would like to thank Prof. Dr. Jürg Stöcklin, who not only gave me the opportunity to study fascinating ecological and evolutionary questions in an incredible setting, but has also been a wonderful supervisor, who created a very open, interactive and enjoyable work atmosphere. Jürg, I have learned a lot from you, whether it concerns formulating research questions, designing experiments, data analysis, or the communication of results in written or spoken words, and I mostly appreciate the relaxed manner with which you address issues. Although clear research aims were stated from the beginning, you never failed to encourage my own side projects and granted me great freedom and independence in my research, while always being available for questions and discussions, and for that I am incredibly grateful. I now turn to Georg, who was responsible for the molecular laboratory work and molecularly oriented manuscripts. Thanks are also due for his help with fieldwork. Georg, while you complain on a weekly basis about your weak back, you never once did in the field and have been a great trooper. Beyond the practical aspects, I would like to thank Georg for his joyful personality, for his great sense of humor, for the wonderfully tender horsemeat steaks he always contributes to the institute summer barbecues and for sharing his insider tips about the best beer taverns in Basel when I had just arrived. Georg, it has been great sharing an office with you and I will miss your cheerfulness. Thanks are also due to Halil, my Ph. D. colleague. Halil, we shared the best and the worst that fieldwork has to offer and bonded over frozen fingers and lifesaving Kaffee Lutz. Although we both got too busy to help each other in the field after the first year, our conversations kept going, and while we often disagreed on certain scientific issues it has been a pleasure working with you and I wish you all the best. I would also like to acknowledge Niek, the former Ph. D. student of Jürg, who was a Postdoc in our little research group when I started out. Niek’s Ph. D. work opened research questions that I subsequently worked on, and he helped design most of the experiments before moving on for other Postdoc studies. While continuing his own research career, he managed to stay involved in our work, and was always available for prolonged discussions on specific issues and has been very helpful in giving constructive feedback on manuscripts. I hope our paths will cross again for future collaborations. I would now like to thank the team of the Botanical Garden of the University of Basel, and especially Guy, who has been a great help and an incredible source of knowledge for the practical aspects of plant growth in the greenhouse, and who helped on many occasions in the field. My green thumb has become much “greener” thanks to you. Simona, “my” first master student, joined our research group in May 2013 and worked under my direct supervision on her master thesis. Her dedicated work, monitoring the reproductive phenology of almost 1400 plants, led to interesting results, which we have published together. A second master student, Sophie, who worked under the supervision of Halil, was of great help in this process and deserves the same acknowledgments. Beyond her master thesis, Simona became a good friend and continued to work with me as an enthusiastic field assistant, which I have greatly enjoyed. 181 Acknowledgments Many more field and laboratory assistants deserve a great thank you. Ayaka and Andreas have been lifesavers when I faced the tedious task of washing the roots of 1400 plants and Ayaka has also helped on many other occasions in the field. Michelle, Madlen, Rémi, Diego, Sara and Michael were of great help when installing the common gardens or harvesting the experiments. I would also like to thank the Botanical Garden of the Schynige Platte, who welcomed us in a beautiful setting for our common garden experiment and Hans Boss who lent his land in Zweilütschinen for the same purpose. Even though I worked in a small research group, the rest of the institute also deserves acknowledgments. Christian, thank you for running the institute and for your ability to strike up interesting discussions, whether during the Monday morning seminars or during coffee breaks. Thanks are also due to Franziska and Maura for running the administration of the institute and for always being there to help out. Many other co-workers helped in one-way or another, even if simply by providing entertaining conversation during coffee breaks. In this area, special thanks go to Sarah who was always there for a short break to bring back the blood, oxygen, or as the case may be, nicotine, flowing to the brain. Coming to the material aspects that supported this thesis, I am eternally grateful to my loyal USB stick, which carried my thesis-in-progress over these past three years. Many Mobility cars, the old institute Volkswagen van and mainly Jürg’s twelve year old car have provided outstanding services, and while they might have given us scares, they have actually never failed us when driving on sinuous, lonely mountain roads. Last but not least, I sincerely thank my financial support without which this work would not have been possible: (1) the Swiss National Science Foundation, project no. 3100A-135611 to Jürg Stöcklin, the primary funding for my Ph. D. project (2) the Freiwillige Akademische Gesellschaft and (3) the Basler Stiftung für Biologische Forschung to me, who financially supported the completion of my Ph. D. Thesis. Thanks to my personal support system I am very grateful for the support system that my friends have been throughout this period. Claire, Margaux, Manu, Leslie, Sara, and the Lyon HC crew, thanks for always being there in the difficult moments, and for distracting me from my work for a few hours with a good concert or a nice bottle of Côte du Rhône. My parents deserve my deepest gratitude, for they have always encouraged and supported me in my endeavors, which gave me the drive to tackle challenges head on. They also awakened my curiosity and love for nature by taking me on hikes in the Swiss Alps since my earliest age and bringing me to the beautiful country of Sweden every summer, where I was allowed to roam free on a little island and have daily adventures. Some of the last chapters of this thesis have, by the way, been written on that same island. My sister, Andrea, who usually led the way in our Swedish expeditions, has always been a great source of inspiration and an incomparable friend throughout my life, and I am looking forward to many more adventures to come with her. Finally, and most importantly, I would like to thank my partner Diego, who has been by my side these past twelve years. His support, encouragement and quiet patience were unwavering during this trying time, even when it meant moving to another country for my Ph. D. and going long-distance. I now look forward to the new chapters of our life. 182 Curriculum Vitae Academic C.V. of Dr. Elena Hamann Date and place of birth: 7 November 1987, Geneva, Switzerland Nationality: German Contact details: Fordham University, Department of Biological Sciences Larkin Hall, 441 East Fordham Road, Bronx, NY 10458 Email: [email protected]; [email protected] Education 2016-2018 Postdoc at Fordham University, NYC, USA. Supervisor Prof. Steven Franks. “Rapid evolution and changes in genome-wide gene expression in Brassica rapa in response to drought”. 2015-2016 Postdoc at the University of Basel, Switzerland. 2012-2015 Ph. D. in Botany and Evolutionary Ecology, University of Basel, Switzerland. Supervisor Prof. Dr. Jürg Stöcklin. Thesis title: “The role of phenotypic plasticity and local adaptation in Alpine plants facing climate change". 2009-2011 M. Sc. in Ecology & Evolutionary Biology, University of Lyon 1, France. Supervisor Sara Puijalon (Chargé de Recherche CNRS). Thesis title: “Morpho-anatomical and biomechanical responses of aquatic wetland plants to drought”. 2006-2009 B. Sc. in Biology, University of Lyon 1, France 2005-2006 B. Sc. (first year) in Coastal Marine Biology, University of Hull, England 2004-2005 International French Baccalauréat (OIB) and German Abitur, Lycée International de Ferney-Voltaire, France. Academic Appointments 2016-2018 Postdoctoral Research Fellow, Fordham University, NYC, USA 2015-2016 Postdoctoral Research Associate, University of Basel, Switzerland. 2012-2015 Research Associate, Institute of Botany, University of Basel, Switzerland. Teaching experience 183 Curriculum Vitae 2016 Co-lecturer, Contemporary Evolution, Fordham University, USA 2012-2015 Co-lecturer, Ecosystem and population processes, University of Basel, Switzerland 2012-2015 Trilingual guided tours of the Botanical Gardens, University of Basel, Switzerland Undergraduate/Graduate Mentoring and Thesis supervision Ph.D students Acer VanWallendael, Stephen Johnson, Hansol Lee, Fordham University M.Sc. Thesis Simona Gugger, Sophie Schmid, graduated 2015, University of Basel B.Sc. Thesis Ayaka Güttlin, graduated 2014, University of Basel Peer-reviewed Publications Hamann E, Kesselring H, Armbruster GFJ, Scheepens JF, Stöcklin J (2017) High intraspecific phenotypic variation, but little evidence for local adaptation in Geum reptans populations in the Central Swiss Alps. Alpine Botany, DOI: 10.1007/s00035-017-0185-y. Hamann E, Kesselring H, Stöcklin J. (2017) Plant responses to simulated warming and drought: a comparative study of functional plasticity between congeneric mid and high elevation species. Journal of Plant Ecology, DOI: 10.1093/jpe/rtx023. Schmid SF, Stöcklin J, Hamann E, Kesselring H (2017) High-elevation plants have reduced plasticity in flowering time in response to warming compared to low-elevation congeners. Basic and Applied Ecology, DOI: 10.1016/j.baae.2017.05.003. Hamann E, Kesselring H, Armbruster GFJ, Scheepens JF, Stöcklin J (2016) Local adaptation to fine- and coarse-grained environmental variability in Poa alpina in the Swiss Alps. Journal of Ecology, DOI: 10.1111/1365-2745.12628. Gugger S*, Kesselring H, Stöcklin J, Hamann E (2015) Lower plasticity exhibited by high- versus mid-elevation species in their phonological responses to manipulated temperature and drought. Annals of Botany 116(6): 953-962. * undergraduate author Kesselring H, Armbruster GFJ, Hamann E, Stöcklin J (2015) Past selection explains differentiation in flowering phenology of nearby populations of a common alpine plant. Alpine Botany (2015) 125:113-124. Hamann E, Kesselring H, Stöcklin J, Armbruster GFJ (2014) Novel Microsatellite Markers for the high-Alpine Geum reptans (Rosaceae). Applications in Plant Sciences 2: 1400021. 184 Curriculum Vitae Kesselring H, Hamann E, Stöcklin J, Armbruster GFJ (2013) New Microsatellite Markers for Anthyllis Vulneraria (Fabaceae), Analyzed with Spreadex Gel Electrophoresis. Applications in Plant Sciences 1: 1300054. Hamann E, Puijalon S (2013) Biomechanical responses of aquatic plants to aerial conditions. Annals of Botany, 112: 1869-1878. Publications in review, submitted or in preparation Franks S, Hamann E, Weis A. Using the resurrection approach to understand contemporary evolution in changing environments. Invited contribution for Evolutionary applications - Evolutionary aspects of resurrection ecology: Progress, Scope & Applications. In press. VanWallendael A, Hamann E, Franks S. Reciprocal transplantation of Japanese knotweed (Reynoutria japonica) reveals phenotypic differentiation, but not local adaptation across a wide latitudinal range. In preparation. Kesselring H, Scheepens JF, Hamann E, Armbruster GFJ, Stöcklin J. Patterns of local adaptation in two common herbs from the central European Alps. In preparation. Conference contributions 06/2017 Evolution 2017, Portland, USA: “Evolutionary responses to repeated drought episodes in Brassica rapa”. 05/2017 30th PopBio conference, Halle, Germany: “Intraspecific phenotypic variation but no local adaptation in Geum reptans populations in the Swiss Alps” (poster). 06/2016 Evolution 2016, Austin, USA: “Testing for local adaptation in four alpine species using reciprocal transplantation experiments”. 09/14 44th GfÖ conference, Hildesheim, Germany: “Phenotypic plasticity in functional traits of alpine plants in response to warming and drought”. 44th GfÖ conference, Hildesheim, Germany: “Flowering phenology of congeneric lowland and highland species in response to warming and drought” (poster). 05/14 27th PopBio conference, Konstanz, Germany: “Shifts in reproductive phenology in response to warming and to drought: a comparison between lowland and alpine plants”. 05/13 26th PopBio conference, Tartu, Estonia: “Phenotypic plasticity in alpine plants: how do they react to warming and drought and how do they compare with lowland species”. 185 Curriculum Vitae 09/11 Ecophysiology of freshwater organisms Workshop, Lyon, France: “Biomechanical properties of macrophyte responses to drought”. 06/11 54th IAVS Symposium, Lyon, France: “Responses of freshwater plants to drought: Biomechanical properties and morpho-anatomical determinism”. Funding 2016 SNF (Swiss National Science Foundation), Early.Postdoc.Mobility, 75’000 USD 2015 Basler Stiftung für biologische Forschung, 14’000 CHF 2014 Freiwilige Akademische Gesellschaft, 5’000 CHF Memberships Society for the Study of Evolution (SSE) German Society for Ecology (GfÖe) International Association of Vegetation Science (IAVS) Swiss Botanical Society (SBG) Freiwilige Akademische Gesellschaft (FAG) Languages German Mother tongue French Bilingual English Bilingual Spanish Basic understanding Swedish Basic understanding Experimental and analytical techniques and other qualifications Common garden, reciprocal transplantation, and greenhouse experiments Statistical analysis of large datasets with R (linear models, mixed effect models, phenotypic selection analysis, aster models etc.) Genomic tools (RNA extractions, RNA sequencing, DESeq2 etc.) PADI Open Water Diver Drivers License 186 187 188