DOCSLIB.ORG

Melanoma Metastasis Suppression by Chromosome 6: Evidence for a Pathway Regulated by CRSP3 and TXNIP1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Melanoma Metastasis Suppression by Chromosome 6: Evidence for a Pathway Regulated by CRSP3 and TXNIP1 [CANCER RESEARCH 63, 432–440, January 15, 2003] Melanoma Metastasis Suppression by Chromosome 6: Evidence for a Pathway Regulated by CRSP3 and TXNIP1 Steven F. Goldberg,2 Mary E. Miele, Naohito Hatta, Minoru Takata,3 Carrie Paquette-Straub, Leonard P. Freedman,4 and Danny R. Welch5 Jake Gittlen Cancer Research Institute, Penn State College of Medicine, Hershey, Pennsylvania 17033 [S. F. G., D. R. W.]; Department of Medical Technology, University of Delaware, Newark, Delaware 19716 [M. E. M., C. P-S.]; The Penn State-National Foundation for Cancer Research Center for Metastasis Research, Hershey, Pennsylvania 17033 [D. R. W.]; Department of Dermatology, Kanazawa University School of Medicine, 13-1 Takaramachi, Kanazawa, 920-8640 Japan [N. H., M. T.]; and Cell Biology Program, Memorial Sloan-Kettering Cancer Center, Sloan-Kettering Division, Joan and Sanford I. Weill Graduate School of Medical Sciences of Cornell University, New York, New York 10021 [L. P. F.] ABSTRACT We have shown that the MMCT6 of human chr6 into metastatic human melanoma cell lines C8161 or MelJuSo suppressed metastasis Loss of genetic material on chromosome 6 has been associated with without blocking tumor formation (4, 5). Metastasis-suppressed hy- progression of human melanomas. We showed previously that introducing brids of C8161 (neo6/C8161) were blocked at steps in the metastatic chromosome 6 into metastatic human melanoma cell lines suppresses metastasis without affecting the ability of the hybrids to form progres- cascade affecting the survival and proliferation at secondary sites (6). sively growing tumors. By subtractive hybridization comparing nonmeta- We used subtractive hybridization to identify a metastasis suppressor static chromosome 6-containing (neo6/C8161) versus parental (C8161) gene, KISS1, which mapped to 1q32 (7–10). Tumor cells transfected metastatic cells, the KISS1 metastasis suppressor gene was isolated. How- with KISS1 cDNA were nonmetastatic, but remained tumorigenic. ever, KISS1 mapped to chromosome 1q32. To identify upstream regula- MMCT of chr6 with a deletion (ϳ40 Mb) spanning 6q16.3-q23 tor(s) of (and downstream effectors of) KISS1, microarray hybridization (neo6qdel) did not suppresses metastasis (11). Because KISS1 was comparing C8161 and neo6/C8161 variants was performed. TXNIP/ cloned from C8161 cells, the genetic defect must be at the level of VDUP1, a thioredoxin-binding protein, was expressed more highly in KISS1 regulation, not in KISS1 itself. Also, because neo6qdel hybrids neo6/C8161 and in nonmetastatic melanomas. Increased TXNIP expres- did not express KISS1, the upstream regulator(s) of KISS1 was sion inhibited metastasis and up-regulated KISS1. Surprisingly, TXNIP mapped between 6q16.3-q23 (11). Shirasaki et al. verified this hy- also mapped to chromosome 1q. PCR karyotyping that refined the region on chromosome 6 identified CRSP3/DRIP130, a transcriptional coactiva- pothesis in melanoma clinical samples by showing loss of heterozy- tor, as a metastasis suppressor. CRSP3 transfectant cells had up-regulated gosity of markers in that region correlated with decreased KISS1 KISS1 and TXNIP expression and were suppressed for metastasis. Quan- expression (12). titative real-time reverse-transcription PCR of clinical melanoma samples KISS1 is a precursor for secreted neuropeptide ligands [designated showed that loss of CRSP3 expression correlated with decreased KISS1 Metastin (13) or Kisspeptins (14)] for a G-protein coupled [named expression and increased metastasis. Thus, we implicated a specific gene hOT7T175 (13), AXOR12 (15), or hGPR54 (14)]. Although on chromosome 6 in the etiology of melanoma metastasis and identified hOT7T175-transfected B16/BL6 melanoma-injected mice treated potential up-stream regulators of KISS1 and TXNIP. with Metastin developed fewer lung metastases (13), the mechanism of KISS1 suppression is still unknown. Recent publications suggest INTRODUCTION possible mechanisms for KISS1 metastasis suppression. Metastin induces Ca2ϩ in receptor-transfected CHO cells (13), as well as Metastasis is the culmination of neoplastic progression toward phosphorylation of ERK1/2 and weak phosphorylation of p38/MAPK autonomy from host regulation. Acquiring metastatic potential is but not of SAPK/JNK (14). Metastin inhibits motility, chemotaxis, apparently “driven” by genomic instability with coincident or super- and invasion in vitro (13, 16), possibly by repressing the transcription imposed selection pressures (1). To be metastatic, tumor cells must of MMP-9 [via induction of cytosolic I␬B␣ (17)]. Metastin also complete a sequential, multistep cascade involving complex interac- induces excessive formation of focal adhesions and stress fibers in tions between tumor and host. Cells must navigate a series of obsta- hOT7T175-transfected B16/BL6 and induces the phosphorylation of cles, including immune surveillance, loss of original tissue context, FAK and paxillin (13), possibly through Rho (14). invasion through the basement membrane, lymphatic or hematoge- The primary objective of the current study was to identify the nous circulation, extravasation, and growth at the secondary site. Any upstream regulator(s) of KiSS1 on chr6. Additionally, microarray cell shed from the primary neoplasm that fails to complete all requisite hybridizations using metastatic (C8161) and nonmetastatic (neo6/ steps cannot form metastases (2, 3). C8161) variants of a human melanoma cell line could be useful in identifying some additional downstream regulators of KISS1. Received 8/6/02; accepted 11/14/02. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. MATERIALS AND METHODS 1 Supported by NIH Grants CA66128 (to D. R. W.), CA87728 (to D. R. W.), and CA88876 (to M. E. M.); the National Foundation for Cancer Research (to D. R. W.); a Cell Lines and Culture. C8161 is a human melanoma cell line that metasta- Grant-in-Aid for Scientific Research (C2-12670812) from the Japan Society for the sizes after orthotopic or i.v. injection into athymic mice (18). C8161.9 is a highly Promotion of Science (to N. H. and M. T.); a predoctoral fellowship from the Foreman metastatic subclone of C8161 (7). Nonmetastatic neo6/C8161.1, neo6/C8161.2, Foundation (to S. F. G. and D. R. W.); and the Jake Gittlen Memorial Golf Tournament (to D. R. W.). neo6/C8161.3, and neo6/C8161.6 were derived by MMCT using the 2 Present address: Laboratory of Biosystems and Cancer, National Cancer Institute, MCH262A1.D6 donor cell line (4). Metastatic neo6(del)(q16.3-q23)/C8161 hy- Building 37/Room 5046/MSC 4264, 37 Convent Drive, Bethesda, Maryland 20892. brids (neo6qdel/C8161.9.1, neo6qdel/C8161.9.2, neo6qdel/C8161.9.7, neo6qdel/ 3 Present address: Toyama Prefectural Central Hospital, 2-2-78 Nishinagae, Toyama, 930-8550 Japan. 4 Present address: Department of Bone Biology, Merck Research Laboratories, 6 The abbreviations used are: MMCT, microcell-mediated chromosome transfer; chr, WP26A-1000, West Point, Pennsylvania 19486. chromosome; DME-F12, 1:1 mixture of DMEM and Ham’s F-12 medium; cDME-F12, 5 To whom correspondence should be addressed at: Department of Pathology, Uni- mixture of DME-F12 and 5% fetal bovine serum; CMF-DPBS, Ca2ϩ/Mg2ϩ-free Dulbec- versity of Alabama at Birmingham, 1670 University Boulevard, Volker Hall G-038, co’s PBS; TRX, thioredoxin; VGP, vertical growth phase; MTD, mean tumor diameter; Birmingham, AL 35294-0019. E-mail: [email protected]; Phone: (205) 934-2956; RT-PCR, reverse-transcription PCR; RTQ, quantitative real-time RT-PCR; FAM, 6- Fax: (205) 934-1775. carboxyfluorescein; TAMRA, 6-carboxy-tetramethyl-rhodamine. 432 Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 2003 American Association for Cancer Research. CRSP3/TXNIP/KISS1: METASTASIS SUPPRESSION PATHWAY C8161.9.8) were prepared using a related chr6 microcell donor variant (11). using a hemacytometer. Cell numbers were determined daily for 10 days. Presence and retention of the added chromosome was verified by PCR of single- Morphology was recorded using an inverted microscope (Nikon Diaphot) sequence-length polymorphisms, karyotyping, and/or fluorescence in situ hybrid- equipped with a digital camera (DC Viewer Version 3.2.0.0; Leica Microsys- ization (see corresponding references in 7, 11 and 18). tems, Ltd., Heerbrugg, Germany). C8161-derived cells were cultured in DME-F12 (Invitrogen) supplemented In Vivo Experiments. Female athymic mice 3–4 weeks of age (Harlan with 5% fetal bovine serum (Atlanta Biologicals, Atlanta, GA), 1% nonessen- Sprague Dawley, Madison, WI) were maintained under the NIH and The tial amino acids (Invitrogen), and cDME-F12, but no antibiotics or antimy- Pennsylvania State University College of Medicine guidelines. The Institu- cotics. Neomycin-resistant cells were maintained in cDME-F12 containing 500 tional Animal Care and Use Committee approved all protocols. Food and water ␮g/ml of active G418 (Invitrogen). Cultures were maintained at 37°Cina were provided ad libitum. humidified atmosphere with 5% CO2. None of the cultures were infected with For in vivo experiments, C8161.9/pcDNA3 (P6 and 16), neo6/C8161.2 Mycoplasma spp. according to the PCR-based TaKaRa Mycoplasma detection (P20–21), neo6/C8161.6 (P10), C8161.9/TXNIP (P4–5), and C8161.9/CRSP3 kit (Panvera, Madison, WI). Cells were detached using a solution of 2 mM (P4–7) were detached at 70–90% confluence,
Load more

Recommended publications
  • Table 2. Significant
    Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.
    [Show full text]
  • Dynamic Transcriptomic Profiles of Zebrafish Gills in Response to Zinc
    Zheng et al. BMC Genomics 2010, 11:548 http://www.biomedcentral.com/1471-2164/11/548 RESEARCH ARTICLE Open Access Dynamic transcriptomic profiles of zebrafish gills in response to zinc depletion Dongling Zheng1,4, Peter Kille2, Graham P Feeney2, Phil Cunningham1, Richard D Handy3, Christer Hogstrand1* Abstract Background: Zinc deficiency is detrimental to organisms, highlighting its role as an essential micronutrient contributing to numerous biological processes. To investigate the underlying molecular events invoked by zinc depletion we performed a temporal analysis of transcriptome changes observed within the zebrafish gill. This tissue represents a model system for studying ion absorption across polarised epithelial cells as it provides a major pathway for fish to acquire zinc directly from water whilst sharing a conserved zinc transporting system with mammals. Results: Zebrafish were treated with either zinc-depleted (water = 2.61 μgL-1; diet = 26 mg kg-1) or zinc-adequate (water = 16.3 μgL-1; diet = 233 mg kg-1) conditions for two weeks. Gill samples were collected at five time points and transcriptome changes analysed in quintuplicate using a 16K oligonucleotide array. Of the genes represented the expression of a total of 333 transcripts showed differential regulation by zinc depletion (having a fold-change greater than 1.8 and an adjusted P-value less than 0.1, controlling for a 10% False Discovery Rate). Down-regulation was dominant at most time points and distinct sets of genes were regulated at different stages. Annotation enrichment analysis revealed that ‘Developmental Process’ was the most significantly overrepresented Biological Process GO term (P = 0.0006), involving 26% of all regulated genes.
    [Show full text]
  • Predicting Clinical Response to Treatment with a Soluble Tnf-Antagonist Or Tnf, Or a Tnf Receptor Agonist
    (19) TZZ _ __T (11) EP 2 192 197 A1 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 02.06.2010 Bulletin 2010/22 C12Q 1/68 (2006.01) (21) Application number: 08170119.5 (22) Date of filing: 27.11.2008 (84) Designated Contracting States: (72) Inventor: The designation of the inventor has not AT BE BG CH CY CZ DE DK EE ES FI FR GB GR yet been filed HR HU IE IS IT LI LT LU LV MC MT NL NO PL PT RO SE SI SK TR (74) Representative: Habets, Winand Designated Extension States: Life Science Patents AL BA MK RS PO Box 5096 6130 PB Sittard (NL) (71) Applicant: Vereniging voor Christelijk Hoger Onderwijs, Wetenschappelijk Onderzoek en Patiëntenzorg 1081 HV Amsterdam (NL) (54) Predicting clinical response to treatment with a soluble tnf-antagonist or tnf, or a tnf receptor agonist (57) The invention relates to methods for predicting a clinical response to a therapy with a soluble TNF antagonist, TNF or a TNF receptor agonist and a kit for use in said methods. EP 2 192 197 A1 Printed by Jouve, 75001 PARIS (FR) EP 2 192 197 A1 Description [0001] The invention relates to methods for predicting a clinical response to a treatment with a soluble TNF antagonist, with TNF or a TNF receptor agonist using expression levels of genes of the Type I INF pathway and a kit for use in said 5 methods. In another aspect, the invention relates to a method for evaluating a pharmacological effect of a treatment with a soluble TNF antagonist, TNF or a TNF receptor agonist.
    [Show full text]
  • Highly Frequent Allelic Loss of Chromosome 6Q16-23 in Osteosarcoma: Involvement of Cyclin C in Osteosarcoma
    1153-1158 5/11/06 16:31 Page 1153 INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE 18: 1153-1158, 2006 Highly frequent allelic loss of chromosome 6q16-23 in osteosarcoma: Involvement of cyclin C in osteosarcoma NORIHIDE OHATA1, SACHIO ITO2, AKI YOSHIDA1, TOSHIYUKI KUNISADA1, KUNIHIKO NUMOTO1, YOSHIMI JITSUMORI2, HIROTAKA KANZAKI2, TOSHIFUMI OZAKI1, KENJI SHIMIZU2 and MAMORU OUCHIDA2 1Science of Functional Recovery and Reconstruction, 2Department of Molecular Genetics, Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama University, Shikata-cho 2-5-1, Okayama 700-8558, Japan Received June 13, 2006; Accepted August 14, 2006 Abstract. The molecular pathogenesis of osteosarcoma is very rearrangements (1,2). It has been reported that both RB1 and complicated and associated with chaotic abnormalities on many TP53 pathways are inactivated, and the regulation of cell cycle chromosomal arms. We analyzed 12 cases of osteosarcomas is impaired in most osteosarcomas (1). For example, deletion/ with comparative genomic hybridization (CGH) to identify mutation of the CDKN2A gene encoding both p16INK4A and chromosomal imbalances, and detected highly frequent p14ARF on 9p21 (3-5), amplification of the CDK4 (6), CCND1, chromosomal alterations in chromosome 6q, 8p, 10p and MDM2 genes (4), and other aberrations related to inactivation 10q. To define the narrow rearranged region on chromosome 6 of these pathways have been found. Tumor suppressor genes with higher resolution, loss of heterozygosity (LOH) analysis (TSGs) are suspected to be involved in tumorigenesis of was performed with 21 microsatellite markers. Out of 31 cases, osteosarcoma. Loss of heterozygosity (LOH) studies have 23 cases (74%) showed allelic loss at least with one marker on detected frequent allelic loss at 3q, 13q, 17p and 18q (7).
    [Show full text]
  • Table of Contents Table of Contents
    Table of contents Table of contents................................................................................................................. 1 Summary ............................................................................................................................. 3 Abbreviations ...................................................................................................................... 4 Gene Symbols I - Incidentals .............................................................................................. 5 Gene symbols II - Target Gene Names ............................................................................... 6 1. Introduction........................................................................................................... 12 1.1. The Pathos of the Crab ..................................................................................... 12 1.2. Cancer in the Molecular Age - a genetic and epigenetic disease..................... 13 1.3. Tumoral evolution............................................................................................. 14 1.4. DNA repair systems .......................................................................................... 17 1.4.1. DNA Mismatch Repair.............................................................................. 18 1.4.2. Double-strand Break Repair..................................................................... 19 1.4.3. Direct Repair...........................................................................................
    [Show full text]
  • Supplementary Tables S1-S3
    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
    [Show full text]
  • Interventions to Increase Apolipoprotein A-I Transcription in Hepg2 Cells
    Interventions to increase apolipoprotein A-I transcription in HepG2 cells Citation for published version (APA): van der Krieken, S. E. (2017). Interventions to increase apolipoprotein A-I transcription in HepG2 cells. Uitgeverij BOXPress. https://doi.org/10.26481/dis.20170330svdk Document status and date: Published: 01/01/2017 DOI: 10.26481/dis.20170330svdk Document Version: Publisher's PDF, also known as Version of record Please check the document version of this publication: • A submitted manuscript is the version of the article upon submission and before peer-review. There can be important differences between the submitted version and the official published version of record. People interested in the research are advised to contact the author for the final version of the publication, or visit the DOI to the publisher's website. • The final author version and the galley proof are versions of the publication after peer review. • The final published version features the final layout of the paper including the volume, issue and page numbers. Link to publication General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain • You may freely distribute the URL identifying the publication in the public portal.
    [Show full text]
  • Thom Ulullallittur
    THOMULULLALLITTUR US009737480B2 (12 ) United States Patent ( 10 ) Patent No. : US 9 ,737 ,480 B2 Lu et al. (45 ) Date of Patent: Aug. 22 , 2017 ( 54 ) ARRDC1-MEDIATED MICROVESICLES 2014 /0273226 AL 9 /2014 Wu 2014 /0364588 A1 12 / 2014 Haugwitz et al. ?? (ARMMS ) AND USES THEREOF 2016 / 0206566 AL 7 / 2016 Lu et al. ( 71 ) Applicants : President and Fellows of Harvard College , Cambridge, MA (US ) ; The FOREIGN PATENT DOCUMENTS Board of Trustees of the Leland WO WO 2011 / 127219 10 /2011 Stanford Junior University , Palo Alto , WO WO 2013 / 119602 8 / 2013 CA (US ) WO WO 2014 /093655 6 / 2014 (72 ) Inventors : Quan Lu , Newton , MA (US ) ; Joseph OTHER PUBLICATIONS F . Nabhan , Cambridge , MA (US ) ; Stanley N . Cohen , Stanford , CA (US ) Properzi et al . , Biomarkers Med . 2013 , 7 ( 5 ) 769 - 778 . * Kosaka et al. J . Biol. Chem 2010 , 285 : 17442 - 17452 . * International Search Report and Written Opinion for PCT/ US2013 / ( 73 ) Assignees : President and Fellows of Harvard 024839 , mailed May 28 , 2013 . College, Cambridge , MA (US ) ; The International Preliminary Report on Patentability for PCT /US2013 / Board of Trustees of the Leland 024839 , mailed Aug . 21 , 2014 . Standford Junior University , Stanford , Genbank Submission ; NIH /NCBI , Accession No. NP _ 689498 . CA (US ) Puca et al ., Mar. 22 , 2014 . Genbank Submission ; NIH /NCBI , Accession No. NP _ 001155957 . ( * ) Notice : Subject to any disclaimer , the term of this Skarnes et al. , Feb . 26 , 2014 . patent is extended or adjusted under 35 Genbank Submission ; NIH /NCBI , Accession No . NP _ 848495 . ? U . S . C . 154 ( b ) by 0 days . Skarnes et al ., Feb . 26 , 2014 .
    [Show full text]
  • Epithelial-Mesenchymal Transition Cross-Journal Focus EMT Epithelial-Mesenchymal Transition
    EMBO Molecular Medicine cross-journal focus EMT Epithelial-Mesenchymal Transition cross-journal focus EMT Epithelial-Mesenchymal Transition EDITORS David del Alamo Editor [email protected] | T +49 6221 8891 309 David received his PhD. from the Madrid’s Autónoma University where he studied proximal-distal patterning in Drosophila with Fernando Díaz-Benjumea. As a postdoc, he continued working with Drosophila, first in Marek Mlodzik’s lab (Mount Sinai School of Medicine, New York) on the mechanisms of epithelial planar cell polarity generation, and then with François Schweisguth (Institut Pasteur, Paris) where he focused on the modulation of Notch signalling in lateral inhibition. David joined The EMBO Journal in 2011. Nonia Pariente Senior Editor [email protected] | T +49 6221 8891 305 Nonia joined EMBO Reports in August 2007. She studied biochemistry and molecular biology in Madrid’s Autónoma University, where she also gained her PhD on the generation of new antiviral strategies against RNA viruses. She did a four-year post-doc at UCLA focusing on the development of new strategies for gene therapy. Roberto Buccione Editor [email protected] | T +49 6221 8891 310 Roberto Buccione completed his PhD at the University of l’Aquila, Italy studying the process of oogenesis in mammals. After continuing these studies as a post-doctoral researcher at the EMBO Jackson Laboratory, Bar Harbor ME, USA, he joined the Mario Negri Sud research institute in S. Molecular Maria Imbaro, Italy, where he lead a research group focused on the cell biology of tumour cell Medicine invasion. He joined EMBO Molecular Medicine as a Scientific Editor in October 2012.
    [Show full text]
  • Characterising Response and Resistance Mechanisms to Faslodex in Breast Cancer
    Characterising response and resistance mechanisms to Faslodex in breast cancer Hayley Elizabeth Francies A thesis presented for the degree of Doctor of Philosophy at Cardiff University September 2013 Breast Cancer Molecular and Pharmacology Group School of Pharmacy and Pharmaceutical Sciences Redwood Building Cardiff University King Edward VII Avenue Cardiff, CF103NB i Abstract In ER+ breast cancer initial responses to antihormones are variable, complete responses are rare and resistance is eventually acquired by many patients. It is important to model these events to discover predictive markers of antihormone outcome and so targeted strategies can be developed to maximise antihormone effectiveness. To date, most studies have employed the MCF-7 cell line which fails to represent the variability of ER+ disease. Focusing on Faslodex, the thesis objective was to use 4 cell lines in vitro encompassing ER+/HER2- (MCF-7/T47D) and ER+/HER2+ (BT474/MDA-MB-361) disease to (i) characterise the magnitude of initial antihormone response, (ii) monitor the onset of resistance by prolonged treatment and (iii) detail gene expression changes during Faslodex treatment. All models were initially growth-inhibited by Faslodex, with superior responses in HER2- lines. Microarray analysis revealed gene cohorts affected by Faslodex treatment differed between HER2+ and HER2- models. While MCF-7, BT474 and MDA-MB-361 cells acquired Faslodex resistance, this failed to develop in the T47D line, providing a model of complete-response. A filtering process identified genes involved in the varying Faslodex responses and clinical relevance was determined using the NEWEST Faslodex clinical trial dataset. Of interest was the Faslodex-induction of CXCR4, as a potential mediator of acquired resistance, while suppression of the RET signalling pathway related to improved initial response in the ER+/HER2- setting.
    [Show full text]
  • Identification of Thioredoxin-Interacting Protein (TXNIP) As a Downstream Target for IGF1 Action
    Identification of thioredoxin-interacting protein (TXNIP) as a downstream target for IGF1 action Karthik Nagaraja, Lena Lapkina-Gendlera, Rive Sarfsteina, David Gurwitza, Metsada Pasmanik-Chorb, Zvi Laronc, Shoshana Yakard, and Haim Wernera,e,1 aDepartment of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel Aviv University, 69978 Tel Aviv, Israel; bBioinformatics Unit, George Wise Faculty of Life Sciences, Tel Aviv University, 69978 Tel Aviv, Israel; cEndocrine and Diabetes Research Unit, Schneider Children’s Medical Center, 49292 Petah Tikva, Israel; dDavid B. Kriser Dental Center, Department of Basic Science and Craniofacial Biology, New York University College of Dentistry, New York, NY; and eYoran Institute for Human Genome Research, Tel Aviv University, 69978 Tel Aviv, Israel Edited by Dennis A. Carson, University of California, San Diego, La Jolla, CA, and approved December 20, 2017 (received for review September 12, 2017) Laron syndrome (LS), or primary growth hormone (GH) insensitiv- Of interest, about 15% of the genes are involved in metabolic path- ity, is the best-characterized entity among the congenital insulin- ways. Given the key role of IGF1 in regulation of cancer cell me- like growth factor 1 (IGF1) deficiencies. Life-long exposure to tabolism, it is reasonable to assume that alteration in the expression of minute endogenous IGF1 levels is linked to low stature as well as a IGF1-dependent metabolic genes may constitute an important mech- number of endocrine and metabolic abnormalities. While elevated anism that contributes to establishment of a malignant phenotype. IGF1 is correlated with increased cancer incidence, epidemiological Thioredoxin-interacting protein (TXNIP) was initially discov- studies revealed that patients with LS do not develop tumors.
    [Show full text]
  • Kisspeptin/KISS1R System in Breast Cancer Donna Cvetković 1, Andy V
    Journal of Cancer 2013, Vol. 4 653 Ivyspring International Publisher Journal of Cancer 2013; 4(8): 653-661. doi: 10.7150/jca.7626 Review Kisspeptin/KISS1R System in Breast Cancer Donna Cvetković 1, Andy V. Babwah 1,2,3,4 and Moshmi Bhattacharya 1, 3, 5 1. Department of Physiology and Pharmacology, Schulich School of Medicine and Dentistry, University of Western Ontario, London, Ontario, Canada, N6A 5C1; 2. The Children’s Health Research Institute, London, Ontario, Canada; 3. Lawson Health Research Institute, London, Ontario, Canada; 4. Department of Obstetrics and Gynaecology, University of Western Ontario London, Ontario, Canada N6C 2V5; 5. Department of Oncology, University of Western Ontario, London, Ontario, Canada. Corresponding author: Dr. Moshmi Bhattacharya, Department of Physiology and Pharmacology, Medical Sciences Building, MSB 216, Schulich School of Medicine and Dentistry, University of Western Ontario, London, Ontario, Canada, N6A 5C1. Tel: 519-661-2111, ext. 82970; Fax: 519-661-3827 E-mail: [email protected]. © Ivyspring International Publisher. This is an open-access article distributed under the terms of the Creative Commons License (http://creativecommons.org/ licenses/by-nc-nd/3.0/). Reproduction is permitted for personal, noncommercial use, provided that the article is in whole, unmodified, and properly cited. Received: 2013.09.10; Accepted: 2013.09.22; Published: 2013.09.26 Abstract Kisspeptins (KP), peptide products of the kisspeptin-1 (KISS1) gene are the endogenous ligands for a G protein-coupled receptor (GPCR) – KP receptor (KISS1R). KISS1R couples to the Gαq/11 signaling pathway. KISS1 is a metastasis suppressor gene and the KP/KISS1R signaling has an- ti-metastatic and tumor-suppressant effects in numerous human cancers.
    [Show full text]