DOCSLIB.ORG

Novel Genetic and Epigenetic Alterations in Colorectal Tumors and Their Potential As Biomarkers

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Novel Genetic and Epigenetic Alterations in Colorectal Tumors and Their Potential As Biomarkers Novel genetic and epigenetic alterations in colorectal tumors and their potential as biomarkers Terje Cruickshank Ahlquist Group of Molecular Genetics Department of Cancer Prevention Institute for Cancer Research The Norwegian Radium Hospital Rikshospitalet University Hospital Faculty Division The Norwegian Radium Hospital Faculty of Medicine University of Oslo The Research Council of Norway Norwegian Centre of Excellence University of Oslo A thesis for the PhD degree, Oslo, 2008 © Terje Cruickshank Ahlquist, 2009 Series of dissertations submitted to the Faculty of Medicine, University of Oslo No. 766 ISBN 978-82-8072-325-3 All rights reserved. No part of this publication may be reproduced or transmitted, in any form or by any means, without permission. Cover: Inger Sandved Anfinsen. Printed in Norway: AiT e-dit AS, Oslo, 2009. Produced in co-operation with Unipub AS. The thesis is produced by Unipub AS merely in connection with the thesis defence. Kindly direct all inquiries regarding the thesis to the copyright holder or the unit which grants the doctorate. Unipub AS is owned by The University Foundation for Student Life (SiO) TABLE OF CONTENTS ACKNOWLEDGEMENTS .............................................................................................................5 PREFACE.............................................................................................................................................6 LIST OF PAPERS...............................................................................................................................8 SUMMARY...........................................................................................................................................9 GENERAL INTRODUCTION ....................................................................................................11 Genetic and epigenetic inheritance .............................................................................................11 Cancer as a genetic and epigenetic disease.................................................................................12 DNA mutations in cancer ............................................................................................................13 DNA methylation..........................................................................................................................15 DNA methylation and cancer .................................................................................................20 Colorectal cancer ...........................................................................................................................21 Incidence, treatment and outcome – Nature versus Nurture.............................................21 Genetics and epigenetics of CRC – a timeline......................................................................24 Molecular and morphological developmental pathways in colorectal cancer..................25 Instabilities involved in colorectal cancer..............................................................................28 Chromosomal instability – CIN.........................................................................................28 Microsatellite instability – MSI...........................................................................................28 CpG island methylator phenotype – CIMP......................................................................30 Signaling pathways ....................................................................................................................32 Clinical challenges for CRC.....................................................................................................33 AIMS....................................................................................................................................................37 RESULTS IN BRIEF .......................................................................................................................38 DISCUSSION....................................................................................................................................43 Fresh-frozen versus formalin embedded tissue....................................................................43 Methodological considerations....................................................................................................43 DNA methylation analyses......................................................................................................43 Bisulfite treatment ................................................................................................................43 Methylation specific PCR (MSP)........................................................................................44 Scoring of MSP results ........................................................................................................45 Bisulfite sequencing..............................................................................................................46 Mutation analyses......................................................................................................................47 Denaturing high performance liquid chromatography ...................................................48 Direct sequencing.................................................................................................................50 Fragment analysis .................................................................................................................51 Multiplex-dependent probe amplification ........................................................................52 Clinical impact of molecular biology ..........................................................................................54 Early tumor markers.................................................................................................................54 Prognostic markers ...................................................................................................................56 Predictive markers.....................................................................................................................58 Survival analyses........................................................................................................................60 Driver and passenger (epi)mutations..........................................................................................61 Different origins of colorectal cancer contribute to a non-uniform disease ........................63 CONCLUSIONS...............................................................................................................................64 Introduction FUTURE PERSPECTIVES............................................................................................................65 REFERENCES..................................................................................................................................68 ORIGINAL ARTICLES...................................................................................................................... APPENDIX............................................................................................................................................ Appendix I. Associated paper.......................................................................................................... Appendix II. Abbreviations ............................................................................................................. ACKNOWLEDGEMENTS The present work has been performed at the Department of Cancer Prevention, Institute for Cancer Research at Rikshospitalet University Hospital – Radiumhospitalet and was supported by the Research Council of Norway and Centre for Cancer Biomedicine. I am grateful for working under my supervisor, Professor Ragnhild Lothe, who with her supreme knowledge, enthusiasm and kindness has made it easy to thrive both scientifically and socially. Especially big thanks to post doc Guro Lind for being invaluable, both by helping out in the lab as well as with preparing manuscripts. A big “grazie” to Professor Bruno Dallapiccola for inviting me to his excellent research facilities in Rome to work, and also to Irene Bottillo who with her excellent laboratory skills and including, friendly nature made my stay scientifically as well as socially very rewarding. A big thanks goes to co-authors and collaborators for very good biological material, clinical data and scientific input. I would also like to acknowledge Professor Arild Nesbakken for being my official link to the Faculty of Medicine, as well as contributing with valuable feedback on the clinical aspects of the thesis. Kudos to all my good friends and colleagues in the department who have meant the world to me. Special thanks to Helge and Marianne for making my day as we’ve been my office mates for 5 years. An important factor in completing this thesis is the personnel the Narvesen kiosk who ensured that my blood-sugar was at a constantly elevated level. Jan-Ivar Hansen, my biology teacher at Bjørknes Privatskole was so in love with biology that it was impossible not to be the same. Thanks! This thesis had never even been started if it wasn’t for my wonderful wife, Hege and my parents. Her for making me not want to study medicine in Hungary, and them for teaching me to have high standards and big aims. I love you! Oslo, December 23rd 2008 PREFACE “Is it just me? Or does everyone come across genetics, genes, and DNA almost everywhere?”
Load more

Recommended publications
  • Table 2. Significant
    Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Download The
    PROBING THE INTERACTION OF ASPERGILLUS FUMIGATUS CONIDIA AND HUMAN AIRWAY EPITHELIAL CELLS BY TRANSCRIPTIONAL PROFILING IN BOTH SPECIES by POL GOMEZ B.Sc., The University of British Columbia, 2002 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Experimental Medicine) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) January 2010 © Pol Gomez, 2010 ABSTRACT The cells of the airway epithelium play critical roles in host defense to inhaled irritants, and in asthma pathogenesis. These cells are constantly exposed to environmental factors, including the conidia of the ubiquitous mould Aspergillus fumigatus, which are small enough to reach the alveoli. A. fumigatus is associated with a spectrum of diseases ranging from asthma and allergic bronchopulmonary aspergillosis to aspergilloma and invasive aspergillosis. Airway epithelial cells have been shown to internalize A. fumigatus conidia in vitro, but the implications of this process for pathogenesis remain unclear. We have developed a cell culture model for this interaction using the human bronchial epithelium cell line 16HBE and a transgenic A. fumigatus strain expressing green fluorescent protein (GFP). Immunofluorescent staining and nystatin protection assays indicated that cells internalized upwards of 50% of bound conidia. Using fluorescence-activated cell sorting (FACS), cells directly interacting with conidia and cells not associated with any conidia were sorted into separate samples, with an overall accuracy of 75%. Genome-wide transcriptional profiling using microarrays revealed significant responses of 16HBE cells and conidia to each other. Significant changes in gene expression were identified between cells and conidia incubated alone versus together, as well as between GFP positive and negative sorted cells.
    [Show full text]
  • Bidirectional Cooperation Between Ubtf1 and SL1 Determines RNA Polymerase I Promoter
    bioRxiv preprint doi: https://doi.org/10.1101/2021.06.07.447350; this version posted June 7, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Bidirectional cooperation between Ubtf1 and SL1 determines RNA Polymerase I promoter 2 recognition in cell and is negatively affected in the UBTF-E210K neuroregression syndrome. 3 4 Michel G. Tremblay1, Dany S. Sibai1,2, Melissa Valère1,2, Jean-Clément Mars1,2,+, Frédéric Lessard1, 5 Roderick T. Hori3, Mohammad M. Khan4, Victor Y. Stefanovsky1, Mark S. Ledoux5 and Tom Moss1,2*. 6 7 1Laboratory of Growth and Development, St-Patrick Research Group in Basic Oncology, Cancer 8 Division of the Quebec University Hospital Research Centre, Québec, Canada. 2Department of 9 Molecular Biology, Medical Biochemistry and Pathology, Faculty of Medicine, Laval University, 10 Québec, Canada. 3Departments of Microbiology, Immunology and Biochemistry and 4Departments of 11 Neurology and Anatomy & Neurobiology, University of Tennessee Health Science Center, Memphis, 12 TN, USA. 5Department of Psychology, University of Memphis, Memphis TN and Veracity 13 Neuroscience LLC, Memphis, TN 14 15 +Present address, IRIC, Université de Montréal, Montréal, Québec, Canada 16 17 Correspondence should be addressed to; 18 Tom Moss, PhD, 19 Edifice St Patrick, 9 rue McMahon, Québec, QC, G1R 3S3, Canada. 20 E-mail. [email protected] 21 Tel. 1 418 691 5281 22 FAX 1 418 691 5439 23 24 Short title: Ubtf1-SL1 cooperation and the Ubtf-E210K syndrome.
    [Show full text]
  • Dynamic Transcriptomic Profiles of Zebrafish Gills in Response to Zinc
    Zheng et al. BMC Genomics 2010, 11:548 http://www.biomedcentral.com/1471-2164/11/548 RESEARCH ARTICLE Open Access Dynamic transcriptomic profiles of zebrafish gills in response to zinc depletion Dongling Zheng1,4, Peter Kille2, Graham P Feeney2, Phil Cunningham1, Richard D Handy3, Christer Hogstrand1* Abstract Background: Zinc deficiency is detrimental to organisms, highlighting its role as an essential micronutrient contributing to numerous biological processes. To investigate the underlying molecular events invoked by zinc depletion we performed a temporal analysis of transcriptome changes observed within the zebrafish gill. This tissue represents a model system for studying ion absorption across polarised epithelial cells as it provides a major pathway for fish to acquire zinc directly from water whilst sharing a conserved zinc transporting system with mammals. Results: Zebrafish were treated with either zinc-depleted (water = 2.61 μgL-1; diet = 26 mg kg-1) or zinc-adequate (water = 16.3 μgL-1; diet = 233 mg kg-1) conditions for two weeks. Gill samples were collected at five time points and transcriptome changes analysed in quintuplicate using a 16K oligonucleotide array. Of the genes represented the expression of a total of 333 transcripts showed differential regulation by zinc depletion (having a fold-change greater than 1.8 and an adjusted P-value less than 0.1, controlling for a 10% False Discovery Rate). Down-regulation was dominant at most time points and distinct sets of genes were regulated at different stages. Annotation enrichment analysis revealed that ‘Developmental Process’ was the most significantly overrepresented Biological Process GO term (P = 0.0006), involving 26% of all regulated genes.
    [Show full text]
  • Predicting Clinical Response to Treatment with a Soluble Tnf-Antagonist Or Tnf, Or a Tnf Receptor Agonist
    (19) TZZ _ __T (11) EP 2 192 197 A1 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 02.06.2010 Bulletin 2010/22 C12Q 1/68 (2006.01) (21) Application number: 08170119.5 (22) Date of filing: 27.11.2008 (84) Designated Contracting States: (72) Inventor: The designation of the inventor has not AT BE BG CH CY CZ DE DK EE ES FI FR GB GR yet been filed HR HU IE IS IT LI LT LU LV MC MT NL NO PL PT RO SE SI SK TR (74) Representative: Habets, Winand Designated Extension States: Life Science Patents AL BA MK RS PO Box 5096 6130 PB Sittard (NL) (71) Applicant: Vereniging voor Christelijk Hoger Onderwijs, Wetenschappelijk Onderzoek en Patiëntenzorg 1081 HV Amsterdam (NL) (54) Predicting clinical response to treatment with a soluble tnf-antagonist or tnf, or a tnf receptor agonist (57) The invention relates to methods for predicting a clinical response to a therapy with a soluble TNF antagonist, TNF or a TNF receptor agonist and a kit for use in said methods. EP 2 192 197 A1 Printed by Jouve, 75001 PARIS (FR) EP 2 192 197 A1 Description [0001] The invention relates to methods for predicting a clinical response to a treatment with a soluble TNF antagonist, with TNF or a TNF receptor agonist using expression levels of genes of the Type I INF pathway and a kit for use in said 5 methods. In another aspect, the invention relates to a method for evaluating a pharmacological effect of a treatment with a soluble TNF antagonist, TNF or a TNF receptor agonist.
    [Show full text]
  • Effet De La Cryptorchidie Sur Le Transcriptome Testiculaire Humain
    MARIE EVE BERGERON EFFET DE LA CRYPTORCHIDIE SUR LE TRANSCRIPTOME TESTICULAIRE HUMAIN Mémoire présenté à la Faculté des études supérieures et postdoctorales de l’Université Laval dans le cadre du programme de maîtrise en Physiologie-Endocrinologie pour l’obtention du grade de Maître ès sciences (M.Sc.) DÉPARTEMENT D’OBSTÉTRIQUE ET DE GYNÉCOLOGIE FACULTÉ DE MÉDECINE UNIVERSITÉ LAVAL QUÉBEC 2012 © Marie Eve Bergeron, 2012 Résumé Les niveaux d’expression de nombreux gènes peuvent être affectés par l’environnement et mener au développement de la cryptorchidie. Cette malformation congénitale est la plus commune dont une des conséquences majeures est l’infertilité masculine due au testicule non-descendu, auquel un risque plus élevé de cancer testiculaire est associé. L’expression des ARN totaux isolés à partir de biopsies testiculaires ont été analysés par micropuces, puis par une analyse bio-informatique et une validation par RT-qPCR de plusieurs gènes sélectionnés. Ces analyses m’ont permis d’identifier plus de deux milles candidats montrant une expression différente entre des sujets cryptorchides et normaux. Certains de ces gènes sélectionnés peuvent être associés à la descente testiculaire, d’autres au cancer testiculaire ou encore aux divers types cellulaires retrouvés dans cet organe. Les différences dans le transcriptome dues à la cryptorchidie vont nous aider à comprendre la cause génétique de cette maladie. ii Abstract Expression level of numerous genes may be affected by environmental condition and lead to development of cryptorchidism. The most common congenital malformation in male is cryptorchidism. One major consequence of this anomaly is infertility due to undescended testis, to which an increased risk of testicular cancer is associated.
    [Show full text]
  • A Dissertation Entitled the Androgen Receptor
    A Dissertation entitled The Androgen Receptor as a Transcriptional Co-activator: Implications in the Growth and Progression of Prostate Cancer By Mesfin Gonit Submitted to the Graduate Faculty as partial fulfillment of the requirements for the PhD Degree in Biomedical science Dr. Manohar Ratnam, Committee Chair Dr. Lirim Shemshedini, Committee Member Dr. Robert Trumbly, Committee Member Dr. Edwin Sanchez, Committee Member Dr. Beata Lecka -Czernik, Committee Member Dr. Patricia R. Komuniecki, Dean College of Graduate Studies The University of Toledo August 2011 Copyright 2011, Mesfin Gonit This document is copyrighted material. Under copyright law, no parts of this document may be reproduced without the expressed permission of the author. An Abstract of The Androgen Receptor as a Transcriptional Co-activator: Implications in the Growth and Progression of Prostate Cancer By Mesfin Gonit As partial fulfillment of the requirements for the PhD Degree in Biomedical science The University of Toledo August 2011 Prostate cancer depends on the androgen receptor (AR) for growth and survival even in the absence of androgen. In the classical models of gene activation by AR, ligand activated AR signals through binding to the androgen response elements (AREs) in the target gene promoter/enhancer. In the present study the role of AREs in the androgen- independent transcriptional signaling was investigated using LP50 cells, derived from parental LNCaP cells through extended passage in vitro. LP50 cells reflected the signature gene overexpression profile of advanced clinical prostate tumors. The growth of LP50 cells was profoundly dependent on nuclear localized AR but was independent of androgen. Nevertheless, in these cells AR was unable to bind to AREs in the absence of androgen.
    [Show full text]
  • Highly Frequent Allelic Loss of Chromosome 6Q16-23 in Osteosarcoma: Involvement of Cyclin C in Osteosarcoma
    1153-1158 5/11/06 16:31 Page 1153 INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE 18: 1153-1158, 2006 Highly frequent allelic loss of chromosome 6q16-23 in osteosarcoma: Involvement of cyclin C in osteosarcoma NORIHIDE OHATA1, SACHIO ITO2, AKI YOSHIDA1, TOSHIYUKI KUNISADA1, KUNIHIKO NUMOTO1, YOSHIMI JITSUMORI2, HIROTAKA KANZAKI2, TOSHIFUMI OZAKI1, KENJI SHIMIZU2 and MAMORU OUCHIDA2 1Science of Functional Recovery and Reconstruction, 2Department of Molecular Genetics, Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama University, Shikata-cho 2-5-1, Okayama 700-8558, Japan Received June 13, 2006; Accepted August 14, 2006 Abstract. The molecular pathogenesis of osteosarcoma is very rearrangements (1,2). It has been reported that both RB1 and complicated and associated with chaotic abnormalities on many TP53 pathways are inactivated, and the regulation of cell cycle chromosomal arms. We analyzed 12 cases of osteosarcomas is impaired in most osteosarcomas (1). For example, deletion/ with comparative genomic hybridization (CGH) to identify mutation of the CDKN2A gene encoding both p16INK4A and chromosomal imbalances, and detected highly frequent p14ARF on 9p21 (3-5), amplification of the CDK4 (6), CCND1, chromosomal alterations in chromosome 6q, 8p, 10p and MDM2 genes (4), and other aberrations related to inactivation 10q. To define the narrow rearranged region on chromosome 6 of these pathways have been found. Tumor suppressor genes with higher resolution, loss of heterozygosity (LOH) analysis (TSGs) are suspected to be involved in tumorigenesis of was performed with 21 microsatellite markers. Out of 31 cases, osteosarcoma. Loss of heterozygosity (LOH) studies have 23 cases (74%) showed allelic loss at least with one marker on detected frequent allelic loss at 3q, 13q, 17p and 18q (7).
    [Show full text]
  • Table of Contents Table of Contents
    Table of contents Table of contents................................................................................................................. 1 Summary ............................................................................................................................. 3 Abbreviations ...................................................................................................................... 4 Gene Symbols I - Incidentals .............................................................................................. 5 Gene symbols II - Target Gene Names ............................................................................... 6 1. Introduction........................................................................................................... 12 1.1. The Pathos of the Crab ..................................................................................... 12 1.2. Cancer in the Molecular Age - a genetic and epigenetic disease..................... 13 1.3. Tumoral evolution............................................................................................. 14 1.4. DNA repair systems .......................................................................................... 17 1.4.1. DNA Mismatch Repair.............................................................................. 18 1.4.2. Double-strand Break Repair..................................................................... 19 1.4.3. Direct Repair...........................................................................................
    [Show full text]
  • Reorganization of the Host Epigenome by a Viral Oncogene
    Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Research Reorganization of the host epigenome by a viral oncogene Roberto Ferrari,1,2 Trent Su,1,3 Bing Li,1 Giancarlo Bonora,1,4 Amit Oberai,1 Yvonne Chan,1 Rajkumar Sasidharan,5 Arnold J. Berk,6,7 Matteo Pellegrini,2,5 and Siavash K. Kurdistani1,2,7,8,9 1Department of Biological Chemistry, David Geffen School of Medicine, University of California, Los Angeles, California 90095, USA; 2Eli and Edythe Broad Center of Regenerative Medicine and Stem Cell Research, University of California, Los Angeles, California 90095, USA; 3Division of Oral Biology and Medicine, School of Dentistry, David Geffen School of Medicine, University of California, Los Angeles, California 90095, USA; 4UCLA Bioinformatics Interdepartmental Degree Program, David Geffen School of Medicine, University of California, Los Angeles, California 90095, USA; 5Department of Molecular, Cellular, and Developmental Biology, University of California, Los Angeles, California 90095, USA; 6Department of Microbiology, Immunology and Molecular Genetics, University of California, Los Angeles, California 90095, USA; 7Molecular Biology Institute, University of California, Los Angeles, California 90095, USA; 8Department of Pathology and Laboratory of Medicine, David Geffen School of Medicine, University of California, Los Angeles, California 90095, USA Adenovirus small e1a oncoprotein causes ~70% reduction in cellular levels of histone H3 lysine 18 acetylation (H3K18ac). It is unclear, however, where this dramatic reduction occurs genome-wide. ChIP-sequencing revealed that by 24 h after expression, e1a erases 95% of H3K18ac peaks in normal, contact-inhibited fibroblasts and replaces them with one-third as many at new genomic locations.
    [Show full text]
  • Supplementary Tables S1-S3
    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
    [Show full text]