Table of Contents Table of Contents

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Table of contents Table of contents................................................................................................................. 1 Summary ............................................................................................................................. 3 Abbreviations ...................................................................................................................... 4 Gene Symbols I - Incidentals .............................................................................................. 5 Gene symbols II - Target Gene Names ............................................................................... 6 1. Introduction........................................................................................................... 12 1.1. The Pathos of the Crab ..................................................................................... 12 1.2. Cancer in the Molecular Age - a genetic and epigenetic disease..................... 13 1.3. Tumoral evolution............................................................................................. 14 1.4. DNA repair systems .......................................................................................... 17 1.4.1. DNA Mismatch Repair.............................................................................. 18 1.4.2. Double-strand Break Repair..................................................................... 19 1.4.3. Direct Repair............................................................................................ 21 1.4.4. Nucleotide Excision Repair.......................................................................21 1.4.5. Base Excision Repair ................................................................................ 21 1.5. The Cell Cycle and Apoptosis........................................................................... 22 1.6. Mutator Phenotypes.......................................................................................... 25 1.7. Colorectal cancer.............................................................................................. 25 1.7.1. Signaling pathways critical to colorectal carcinogenesis ........................ 30 1.7.2. Colorectal cancer with microsatellite instability...................................... 35 1.7.2.1 MMR deficiency and replication slippage ................................................ 35 1.7.2.2. Other non-slippage-induced alterations in MSI tumors .......................... 36 1.7.2.3. Concepts of downstream MSI target genes.............................................. 36 1.7.2.4. Nonsense-mediated decay and immunogenicity in MSI cancers ............. 39 1.8. Objectives.......................................................................................................... 40 2. Materials and Methods ......................................................................................... 41 2.1. Materials........................................................................................................... 41 2.1.1. MSI series..................................................................................................41 2.1.2. AUS series................................................................................................. 41 2.1.3. Cell lines................................................................................................... 41 2.2. Methods............................................................................................................. 42 2.2.1. DNA isolation............................................................................................42 2.2.2. MSI status..................................................................................................42 2.2.3. Literature survey of putative target genes ................................................ 44 2.2.4. Target genes.............................................................................................. 46 2.2.4.1. Target gene selection ............................................................................... 46 2.2.4.2. Mutation analysis..................................................................................... 49 2.2.4.3. Clustering analysis and survival correlation of target genes.................. 53 2.2.4.4. In silico assessment of frameshift consequences ..................................... 54 3. Results....................................................................................................................... 55 3.1. MSI series..........................................................................................................55 3.1.1. MSI status..................................................................................................55 3.1.2 Literature survey....................................................................................... 56 3.1.3. Target gene mutation................................................................................ 61 1 3.2. AUS series......................................................................................................... 68 3.2.1. DNA quantity and quality ......................................................................... 68 3.2.2. MSI status – AUS series............................................................................ 68 4. Discussion................................................................................................................. 69 Perspectives .................................................................................................................. 75 Reference List.................................................................................................................... 76 Appendix 1 - Analysis of MSI status in MSI series and AUS series…………………………… Appendix 2 - Mutation analyses of MSI target genes…………………………………………… Appendix 3 - Primer sequences for Bethesda markers and MSI target genes……………… Appendix 4 - Reference List for Table 2: Literature Survey…………………………………… Appendix 5 - PCR conditions for Bethesda marker MSI-testing……………………………… Appendix 6 - Review of MSI target genes………………………………………………………… 2 Summary Colorectal cancer is one of the most common cancer types, and a leading cause of cancer-related deaths. Cases can be divided into two main molecular phenotypes: those with chromosomal instability (CIN) and those with microsatellite instability (MSI), which occur at a frequency of 85% and 15%, respectively. The focus of this study was on MSI tumors, which have defective mismatch repair systems, and on the multitudinous insertions and deletions in MSI tumor DNA which are the result of this defect. The primary aim of the thesis was to serve as a pilot project for later work on a consecutive, clinically representative tumor series. Firstly, we wished to establish an assemblage of genes which could reasonably be assumed to be targets of mismatch repair deficiency, i.e. that they were more frequently subject to insertions or deletions than comparable sequences. Secondly, we wanted to see whether there were, among the above targets, genes which either singly or in company appeared to affect patient outcome depending on their mutational status. A search of the available scientific literature for genes which had been analyzed for, almost uniquely, frameshift mutations in MSI tumors yielded 162 candidates. Forty- three of these were selected for laboratory analysis. The results provided confirmation of the target gene status for many of these, among them certain well-known genes such as TGFβRII, MSH3, E2F4 and CASP5. The histone acetyl transferase EP300 had never before been examined for this type of mutation in primary tumor DNA, and proved to be a low-frequency, but nevertheless noteworthy, target in MSI colorectal cancers. No significant covariance of genes was found which did not depend on mutation frequency alone. A single gene of intermediate mutation frequency showed a robust association with long- term patient survival. SLC23A2, which encodes a sodium/vitamin C cotransporter, was significantly associated with poor prognosis when mutated, and showed indications of being additionally informative with regard to clinical staging as well. 3 Abbreviations ATP Adenosine triphosphate BER Base excision repair CDK Cyclin-dependent kinase CIMP CpG island methylator phenotype CIN Chromomsomal instability CML Chronic myelogenous leukemia cMNR Coding mononucleotide repeat CpG Cytosine-phosphate-guanine CRC Colorectal cancer CSC Cancer stem cell DNA Deoxyribonucleic acid GEF Guanine nucleotide exchange factor GJIC Gap junction intercellular communication HNPCC Hereditary non-polyposis coli MMR Mismatch repair MSI Microsatellite instability MSI-H High microsatellite instability MSI-L Low microsatellite instability MSS Microsatellite stability NER Nucleotide excision repair NHEJ Non-homologous end joining NMD Nonsense-mediated decay PCR Polymerase chain reaction RNA Ribonucleic acid UTR Untranslated region 4 Gene Symbols I - Incidentals ABL Abelson murine leukemia viral (v-abl) oncogene homolog AKT Protein kinase B APC Adenomatous polyposis coli APE Apurinic/apyrimidinic endonuclease ARF Alternative reading frame = p14 BCL2 B-cell chronic lymphatic leukemia/lymphoma 2 BCR Breakpoint cluster region BECN1 Beclin 1 BIRC5 Baculoviral IAP repeat-containing protein 5 BRAF v-raf murine sarcoma viral oncogene homolog B1 BRCA1 Breast cancer gene 1 CCND1 Cyclin D1 CDH1 E-cadherin CTNNB β-catenin ERCC1 Excision repair cross-complementing rodent repair deficiency, complementation
Recommended publications
  • Table 2. Significant

    Table 2. Significant

    Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Bidirectional Cooperation Between Ubtf1 and SL1 Determines RNA Polymerase I Promoter

    Bidirectional Cooperation Between Ubtf1 and SL1 Determines RNA Polymerase I Promoter

    bioRxiv preprint doi: https://doi.org/10.1101/2021.06.07.447350; this version posted June 7, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Bidirectional cooperation between Ubtf1 and SL1 determines RNA Polymerase I promoter 2 recognition in cell and is negatively affected in the UBTF-E210K neuroregression syndrome. 3 4 Michel G. Tremblay1, Dany S. Sibai1,2, Melissa Valère1,2, Jean-Clément Mars1,2,+, Frédéric Lessard1, 5 Roderick T. Hori3, Mohammad M. Khan4, Victor Y. Stefanovsky1, Mark S. Ledoux5 and Tom Moss1,2*. 6 7 1Laboratory of Growth and Development, St-Patrick Research Group in Basic Oncology, Cancer 8 Division of the Quebec University Hospital Research Centre, Québec, Canada. 2Department of 9 Molecular Biology, Medical Biochemistry and Pathology, Faculty of Medicine, Laval University, 10 Québec, Canada. 3Departments of Microbiology, Immunology and Biochemistry and 4Departments of 11 Neurology and Anatomy & Neurobiology, University of Tennessee Health Science Center, Memphis, 12 TN, USA. 5Department of Psychology, University of Memphis, Memphis TN and Veracity 13 Neuroscience LLC, Memphis, TN 14 15 +Present address, IRIC, Université de Montréal, Montréal, Québec, Canada 16 17 Correspondence should be addressed to; 18 Tom Moss, PhD, 19 Edifice St Patrick, 9 rue McMahon, Québec, QC, G1R 3S3, Canada. 20 E-mail. [email protected] 21 Tel. 1 418 691 5281 22 FAX 1 418 691 5439 23 24 Short title: Ubtf1-SL1 cooperation and the Ubtf-E210K syndrome.
  • Dynamic Transcriptomic Profiles of Zebrafish Gills in Response to Zinc

    Dynamic Transcriptomic Profiles of Zebrafish Gills in Response to Zinc

    Zheng et al. BMC Genomics 2010, 11:548 http://www.biomedcentral.com/1471-2164/11/548 RESEARCH ARTICLE Open Access Dynamic transcriptomic profiles of zebrafish gills in response to zinc depletion Dongling Zheng1,4, Peter Kille2, Graham P Feeney2, Phil Cunningham1, Richard D Handy3, Christer Hogstrand1* Abstract Background: Zinc deficiency is detrimental to organisms, highlighting its role as an essential micronutrient contributing to numerous biological processes. To investigate the underlying molecular events invoked by zinc depletion we performed a temporal analysis of transcriptome changes observed within the zebrafish gill. This tissue represents a model system for studying ion absorption across polarised epithelial cells as it provides a major pathway for fish to acquire zinc directly from water whilst sharing a conserved zinc transporting system with mammals. Results: Zebrafish were treated with either zinc-depleted (water = 2.61 μgL-1; diet = 26 mg kg-1) or zinc-adequate (water = 16.3 μgL-1; diet = 233 mg kg-1) conditions for two weeks. Gill samples were collected at five time points and transcriptome changes analysed in quintuplicate using a 16K oligonucleotide array. Of the genes represented the expression of a total of 333 transcripts showed differential regulation by zinc depletion (having a fold-change greater than 1.8 and an adjusted P-value less than 0.1, controlling for a 10% False Discovery Rate). Down-regulation was dominant at most time points and distinct sets of genes were regulated at different stages. Annotation enrichment analysis revealed that ‘Developmental Process’ was the most significantly overrepresented Biological Process GO term (P = 0.0006), involving 26% of all regulated genes.
  • Predicting Clinical Response to Treatment with a Soluble Tnf-Antagonist Or Tnf, Or a Tnf Receptor Agonist

    Predicting Clinical Response to Treatment with a Soluble Tnf-Antagonist Or Tnf, Or a Tnf Receptor Agonist

    (19) TZZ _ __T (11) EP 2 192 197 A1 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 02.06.2010 Bulletin 2010/22 C12Q 1/68 (2006.01) (21) Application number: 08170119.5 (22) Date of filing: 27.11.2008 (84) Designated Contracting States: (72) Inventor: The designation of the inventor has not AT BE BG CH CY CZ DE DK EE ES FI FR GB GR yet been filed HR HU IE IS IT LI LT LU LV MC MT NL NO PL PT RO SE SI SK TR (74) Representative: Habets, Winand Designated Extension States: Life Science Patents AL BA MK RS PO Box 5096 6130 PB Sittard (NL) (71) Applicant: Vereniging voor Christelijk Hoger Onderwijs, Wetenschappelijk Onderzoek en Patiëntenzorg 1081 HV Amsterdam (NL) (54) Predicting clinical response to treatment with a soluble tnf-antagonist or tnf, or a tnf receptor agonist (57) The invention relates to methods for predicting a clinical response to a therapy with a soluble TNF antagonist, TNF or a TNF receptor agonist and a kit for use in said methods. EP 2 192 197 A1 Printed by Jouve, 75001 PARIS (FR) EP 2 192 197 A1 Description [0001] The invention relates to methods for predicting a clinical response to a treatment with a soluble TNF antagonist, with TNF or a TNF receptor agonist using expression levels of genes of the Type I INF pathway and a kit for use in said 5 methods. In another aspect, the invention relates to a method for evaluating a pharmacological effect of a treatment with a soluble TNF antagonist, TNF or a TNF receptor agonist.
  • Highly Frequent Allelic Loss of Chromosome 6Q16-23 in Osteosarcoma: Involvement of Cyclin C in Osteosarcoma

    Highly Frequent Allelic Loss of Chromosome 6Q16-23 in Osteosarcoma: Involvement of Cyclin C in Osteosarcoma

    1153-1158 5/11/06 16:31 Page 1153 INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE 18: 1153-1158, 2006 Highly frequent allelic loss of chromosome 6q16-23 in osteosarcoma: Involvement of cyclin C in osteosarcoma NORIHIDE OHATA1, SACHIO ITO2, AKI YOSHIDA1, TOSHIYUKI KUNISADA1, KUNIHIKO NUMOTO1, YOSHIMI JITSUMORI2, HIROTAKA KANZAKI2, TOSHIFUMI OZAKI1, KENJI SHIMIZU2 and MAMORU OUCHIDA2 1Science of Functional Recovery and Reconstruction, 2Department of Molecular Genetics, Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama University, Shikata-cho 2-5-1, Okayama 700-8558, Japan Received June 13, 2006; Accepted August 14, 2006 Abstract. The molecular pathogenesis of osteosarcoma is very rearrangements (1,2). It has been reported that both RB1 and complicated and associated with chaotic abnormalities on many TP53 pathways are inactivated, and the regulation of cell cycle chromosomal arms. We analyzed 12 cases of osteosarcomas is impaired in most osteosarcomas (1). For example, deletion/ with comparative genomic hybridization (CGH) to identify mutation of the CDKN2A gene encoding both p16INK4A and chromosomal imbalances, and detected highly frequent p14ARF on 9p21 (3-5), amplification of the CDK4 (6), CCND1, chromosomal alterations in chromosome 6q, 8p, 10p and MDM2 genes (4), and other aberrations related to inactivation 10q. To define the narrow rearranged region on chromosome 6 of these pathways have been found. Tumor suppressor genes with higher resolution, loss of heterozygosity (LOH) analysis (TSGs) are suspected to be involved in tumorigenesis of was performed with 21 microsatellite markers. Out of 31 cases, osteosarcoma. Loss of heterozygosity (LOH) studies have 23 cases (74%) showed allelic loss at least with one marker on detected frequent allelic loss at 3q, 13q, 17p and 18q (7).
  • Reorganization of the Host Epigenome by a Viral Oncogene

    Reorganization of the Host Epigenome by a Viral Oncogene

    Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Research Reorganization of the host epigenome by a viral oncogene Roberto Ferrari,1,2 Trent Su,1,3 Bing Li,1 Giancarlo Bonora,1,4 Amit Oberai,1 Yvonne Chan,1 Rajkumar Sasidharan,5 Arnold J. Berk,6,7 Matteo Pellegrini,2,5 and Siavash K. Kurdistani1,2,7,8,9 1Department of Biological Chemistry, David Geffen School of Medicine, University of California, Los Angeles, California 90095, USA; 2Eli and Edythe Broad Center of Regenerative Medicine and Stem Cell Research, University of California, Los Angeles, California 90095, USA; 3Division of Oral Biology and Medicine, School of Dentistry, David Geffen School of Medicine, University of California, Los Angeles, California 90095, USA; 4UCLA Bioinformatics Interdepartmental Degree Program, David Geffen School of Medicine, University of California, Los Angeles, California 90095, USA; 5Department of Molecular, Cellular, and Developmental Biology, University of California, Los Angeles, California 90095, USA; 6Department of Microbiology, Immunology and Molecular Genetics, University of California, Los Angeles, California 90095, USA; 7Molecular Biology Institute, University of California, Los Angeles, California 90095, USA; 8Department of Pathology and Laboratory of Medicine, David Geffen School of Medicine, University of California, Los Angeles, California 90095, USA Adenovirus small e1a oncoprotein causes ~70% reduction in cellular levels of histone H3 lysine 18 acetylation (H3K18ac). It is unclear, however, where this dramatic reduction occurs genome-wide. ChIP-sequencing revealed that by 24 h after expression, e1a erases 95% of H3K18ac peaks in normal, contact-inhibited fibroblasts and replaces them with one-third as many at new genomic locations.
  • ORM-Like Protein (ORMDL) – Annäherung an Die Funktion Über Die Interaktion

    ORM-Like Protein (ORMDL) – Annäherung an Die Funktion Über Die Interaktion

    ORM-like protein (ORMDL) - Annäherung an die Funktion über die Interaktion Julian Klingbeil München 2019 Aus der Kinderklinik und Kinderpoliklinik im Dr. von Haunerschen Kinderspital der Ludwig–Maximilians–Universität München Direktor: Prof. Dr. med. Dr. sci. nat. C. Klein ORM-like protein (ORMDL) – Annäherung an die Funktion über die Interaktion Dissertation zum Erwerb des Doktorgrades der Medizin an der Medizinischen Fakultät der Ludwig–Maximilians–Universität zu München vorgelegt von Julian Malte Klingbeil aus Berlin 2019 Mit Genehmigung der Medizinischen Fakultät der Universität München Berichterstatterin: Prof. Dr. Ania Muntau Mitberichterstatter: Prof. Dr. Katja Radon PD Dr. Anne Hilgendorff Prof. Dr. Jürgen Behr Prof. Dr. Ortrud Steinlein Mitbetreuung durch den promovierten Mitarbeiter: Prof. Dr. Søren Gersting Dekan: Prof. Dr. med. dent. Reinhard Hickel Tag der mündlichen Prüfung: 10.10.2019 Inhaltsverzeichnis Zusammenfassung xiii 1 Einleitung 1 1.1 Asthma bronchiale . .1 1.1.1 Epidemiologie, Pathogenese und Klassifikation . .2 1.1.2 Therapie . .4 1.1.3 Gen-Umwelt-Interaktionen und Genomweite Assoziationsstudien5 1.2 Das neue Asthma-Risikogen ORMDL . .8 1.3 Der β2-Adrenorezeptor . 11 1.4 Protein-Protein-Interaktionen . 13 1.4.1 Biolumineszenz-Resonanz-Energie-Transfer . 15 1.5 Zielsetzung der Arbeit . 18 2 Material und Methoden 19 2.1 Material . 19 2.1.1 Laborgeräte . 19 2.1.2 Allgemeine Verbrauchsmaterialien, Chemikalien und Reagenzien . 21 2.1.3 Lösungen, Reagenzien-Kits und Puffer . 26 2.1.4 Medium . 28 2.1.5 Zelllinien und Bakterienstämme . 28 2.1.6 Antikörper . 29 2.1.7 β-Sympathomimetika . 29 2.1.8 Restriktionsenzyme . 30 2.1.9 Vektoren und DNA .
  • Supplementary Tables S1-S3

    Supplementary Tables S1-S3

    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
  • Interventions to Increase Apolipoprotein A-I Transcription in Hepg2 Cells

    Interventions to Increase Apolipoprotein A-I Transcription in Hepg2 Cells

    Interventions to increase apolipoprotein A-I transcription in HepG2 cells Citation for published version (APA): van der Krieken, S. E. (2017). Interventions to increase apolipoprotein A-I transcription in HepG2 cells. Uitgeverij BOXPress. https://doi.org/10.26481/dis.20170330svdk Document status and date: Published: 01/01/2017 DOI: 10.26481/dis.20170330svdk Document Version: Publisher's PDF, also known as Version of record Please check the document version of this publication: • A submitted manuscript is the version of the article upon submission and before peer-review. There can be important differences between the submitted version and the official published version of record. People interested in the research are advised to contact the author for the final version of the publication, or visit the DOI to the publisher's website. • The final author version and the galley proof are versions of the publication after peer review. • The final published version features the final layout of the paper including the volume, issue and page numbers. Link to publication General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain • You may freely distribute the URL identifying the publication in the public portal.
  • Exposure to Childhood Abuse Is Associated with Human Sperm DNA Methylation Andrea L

    Exposure to Childhood Abuse Is Associated with Human Sperm DNA Methylation Andrea L

    Roberts et al. Translational Psychiatry (2018) 8:194 DOI 10.1038/s41398-018-0252-1 Translational Psychiatry ARTICLE Open Access Exposure to childhood abuse is associated with human sperm DNA methylation Andrea L. Roberts 1, Nicole Gladish2,EvanGatev2,3, Meaghan J. Jones 2,YingChen4, Julia L. MacIsaac2, Shelley S. Tworoger4,5,S.BrynAustin6, Cigdem Tanrikut7, Jorge E. Chavarro4,5,8,AndreaA.Baccarelli9 and Michael S. Kobor 2,10 Abstract Offspring of persons exposed to childhood abuse are at higher risk of neurodevelopmental and physical health disparities across the life course. Animal experiments have indicated that paternal environmental stressors can affect sperm DNA methylation and gene expression in an offspring. Childhood abuse has been associated with epigenetic marks in human blood, saliva, and brain tissue, with statistically significant methylation differences ranging widely. However, no studies have examined the association of childhood abuse with DNA methylation in gametes. We examined the association of childhood abuse with DNA methylation in human sperm. Combined physical, emotional, and sexual abuse in childhood was characterized as none, medium, or high. DNA methylation was assayed in 46 sperm samples from 34 men in a longitudinal non-clinical cohort using HumanMethylation450 BeadChips. We performed principal component analysis and examined the correlation of principal components with abuse exposure. Childhood abuse was associated with a component that captured 6.2% of total variance in DNA methylation (p < 0.05). Next, we investigated the regions differentially methylated by abuse exposure. We identified 12 DNA regions differentially methylated by childhood abuse, containing 64 probes and including sites on genes associated with 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; neuronal function (MAPT, CLU), fat cell regulation (PRDM16), and immune function (SDK1).
  • Platform Abstracts

    Platform Abstracts

    American Society of Human Genetics 65th Annual Meeting October 6–10, 2015 Baltimore, MD PLATFORM ABSTRACTS Wednesday, October 7, 9:50-10:30am Abstract #’s Friday, October 9, 2:15-4:15 pm: Concurrent Platform Session D: 4. Featured Plenary Abstract Session I Hall F #1-#2 46. Hen’s Teeth? Rare Variants and Common Disease Ballroom I #195-#202 Wednesday, October 7, 2:30-4:30pm Concurrent Platform Session A: 47. The Zen of Gene and Variant 15. Update on Breast and Prostate Assessment Ballroom III #203-#210 Cancer Genetics Ballroom I #3-#10 48. New Genes and Mechanisms in 16. Switching on to Regulatory Variation Ballroom III #11-#18 Developmental Disorders and 17. Shedding Light into the Dark: From Intellectual Disabilities Room 307 #211-#218 Lung Disease to Autoimmune Disease Room 307 #19-#26 49. Statistical Genetics: Networks, 18. Addressing the Difficult Regions of Pathways, and Expression Room 309 #219-#226 the Genome Room 309 #27-#34 50. Going Platinum: Building a Better 19. Statistical Genetics: Complex Genome Room 316 #227-#234 Phenotypes, Complex Solutions Room 316 #35-#42 51. Cancer Genetic Mechanisms Room 318/321 #235-#242 20. Think Globally, Act Locally: Copy 52. Target Practice: Therapy for Genetic Hilton Hotel Number Variation Room 318/321 #43-#50 Diseases Ballroom 1 #243-#250 21. Recent Advances in the Genetic Basis 53. The Real World: Translating Hilton Hotel of Neuromuscular and Other Hilton Hotel Sequencing into the Clinic Ballroom 4 #251-#258 Neurodegenerative Phenotypes Ballroom 1 #51-#58 22. Neuropsychiatric Diseases of Hilton Hotel Friday, October 9, 4:30-6:30pm Concurrent Platform Session E: Childhood Ballroom 4 #59-#66 54.