Epithelial-Mesenchymal Transition Cross-Journal Focus EMT Epithelial-Mesenchymal Transition

Total Page:16

File Type:pdf, Size:1020Kb

Epithelial-Mesenchymal Transition Cross-Journal Focus EMT Epithelial-Mesenchymal Transition EMBO Molecular Medicine cross-journal focus EMT Epithelial-Mesenchymal Transition cross-journal focus EMT Epithelial-Mesenchymal Transition EDITORS David del Alamo Editor [email protected] | T +49 6221 8891 309 David received his PhD. from the Madrid’s Autónoma University where he studied proximal-distal patterning in Drosophila with Fernando Díaz-Benjumea. As a postdoc, he continued working with Drosophila, first in Marek Mlodzik’s lab (Mount Sinai School of Medicine, New York) on the mechanisms of epithelial planar cell polarity generation, and then with François Schweisguth (Institut Pasteur, Paris) where he focused on the modulation of Notch signalling in lateral inhibition. David joined The EMBO Journal in 2011. Nonia Pariente Senior Editor [email protected] | T +49 6221 8891 305 Nonia joined EMBO Reports in August 2007. She studied biochemistry and molecular biology in Madrid’s Autónoma University, where she also gained her PhD on the generation of new antiviral strategies against RNA viruses. She did a four-year post-doc at UCLA focusing on the development of new strategies for gene therapy. Roberto Buccione Editor [email protected] | T +49 6221 8891 310 Roberto Buccione completed his PhD at the University of l’Aquila, Italy studying the process of oogenesis in mammals. After continuing these studies as a post-doctoral researcher at the EMBO Jackson Laboratory, Bar Harbor ME, USA, he joined the Mario Negri Sud research institute in S. Molecular Maria Imbaro, Italy, where he lead a research group focused on the cell biology of tumour cell Medicine invasion. He joined EMBO Molecular Medicine as a Scientific Editor in October 2012. Maria Polychronidou Editor [email protected] | T +49 6221 8891 410 Maria received her PhD from the University of Heidelberg, where she studied the role of nuclear membrane proteins in development and aging. During her post-doctoral work, she focused on the analysis of tissue-specific regulatory functions of Hox transcription factors using a combination of computational and genome-wide methods. emboj.embopress.org | embor.embopress.org | embomolmed.embopress.org | msb.embopress.org full articles The EMBO Journal Genome-wide identification of miR-200 targets reveals a regulatory network controlling cell invasion. Bracken CP, Li X, Wright JA, Lawrence DM, Pillman KA, Salmanidis M, Anderson MA, Dredge BK, Gregory PA, Tsykin A, Neilsen C, Thomson DW, Bert AG, Leerberg JM, Yap AS, Jensen KB, Khew-Goodall Y, Goodall GJ. DOI: 10.15252/embj.201488641 | Published 28.07.2014 MiR-133 promotes cardiac reprogramming by directly repressing Snai1 and silencing fibroblast signatures. Muraoka N, Yamakawa H, Miyamoto K, Sadahiro T, Umei T, Isomi M, Nakashima H, Akiyama M, Wada R, Inagawa K, Nishiyama T, Kaneda R, Fukuda T, Takeda S, Tohyama S, Hashimoto H, Kawamura Y, Goshima N, Aeba R, Yamagishi H, Fukuda K, Ieda M. DOI: 10.15252/embj.201387605 | Published 11.06.2014 EMBO Reports Review Dedifferentiation and reprogramming: origins of cancer stem cells. Friedmann-Morvinski D, Verma IM. DOI: 10.1002/embr.201338254 | Published 14.02.2014 Article E2F1 induces miR-224/452 expression to drive EMT through TXNIP downregulation. Knoll S, Fürst K, Kowtharapu B, Schmitz U, Marquardt S, Wolkenhauer O, Martin H, Pützer BM. DOI: 10.15252/embr.201439392 | Published 23.10.2014 EMBO Molecular Medicine Epithelial-mesenchymal transition spectrum quantification and its efficacy in deciphering survival and drug responses of cancer patients. Tan TZ, Miow QH, Miki Y, Noda T, Mori S, Huang RY, Thiery JP. DOI: 10.15252/emmm.201404208 | Published 11.09.2014 Molecular Systems Biology A computational study of the Warburg effect identifies metabolic targets inhibiting cancer migration. Yizhak K, Le Dévédec SE, Rogkoti VM, Baenke F, de Boer VC, Frezza C, Schulze A, van de Water B, Ruppin E. DOI: 10.15252/msb.20134993 | Published 01.08.2014 For further reading please see inside back cover Article Genome-wide identification of miR-200 targets reveals a regulatory network controlling cell invasion Cameron P Bracken1,2, Xiaochun Li1, Josephine A Wright1, David M Lawrence1, Katherine A Pillman1, Marika Salmanidis1, Matthew A Anderson1, B Kate Dredge3, Philip A Gregory1,2, Anna Tsykin1, Corine Neilsen1, Daniel W Thomson1, Andrew G Bert1, Joanne M Leerberg4, Alpha S Yap4, Kirk B Jensen3, Yeesim Khew-Goodall1,3,*,† & Gregory J Goodall1,2,3,**,† Abstract Introduction The microRNAs of the miR-200 family maintain the central charac- MicroRNAs and their targets are important components in the regu- teristics of epithelia and inhibit tumor cell motility and invasive- latory networks that maintain cell phenotype and control cell differ- ness. Using the Ago-HITS-CLIP technology for transcriptome-wide entiation. Although microRNAs typically act as mild modulators of identification of direct microRNA targets in living cells, along gene expression, exerting only a modest inhibitory effect on individ- with extensive validation to verify the reliability of the approach, ual targets, conceivably they can broadly refine gene expression we have identified hundreds of miR-200a and miR-200b targets, patterns because each microRNA may target several hundred different providing insights into general features of miRNA target site mRNAs. Thus, one microRNA can potentially influence a biological selection. Gene ontology analysis revealed a predominant effect process by having a coordinated effect on multiple components of miR-200 targets in widespread coordinate control of actin of a network or pathway. However, due to the uncertainties in cytoskeleton dynamics. Functional characterization of the miR-200 predicting or experimentally identifying the spectrum of targets of targets indicates that they constitute subnetworks that underlie individual miRNAs, there are few confirmed examples of broad the ability of cancer cells to migrate and invade, including coor- network regulation by a miRNA. dinate effects on Rho-ROCK signaling, invadopodia formation, The miR-200 family of microRNAs acts as enforcers of the epithe- MMP activity, and focal adhesions. Thus, the miR-200 family lial phenotype. They are expressed in most, if not all, epithelial cells maintains the central characteristics of the epithelial phenotype and their expression must be turned off for epithelial to mesenchy- by acting on numerous targets at multiple levels, encompassing mal transition (EMT) to occur (Burk et al, 2008; Gregory et al, both cytoskeletal effectors that control actin filament organiza- 2008a; Korpal et al, 2008; Park et al, 2008). EMT involves a tion and dynamics, and upstream signals that locally regulate morphological change whereby immobile epithelial cells acquire the cytoskeleton to maintain cell morphology and prevent cell pro-invasive mesenchymal characteristics that are key to various migration. developmental processes and are drivers of metastatic progression in cancer (Nieto, 2013). Two major targets of miR-200 in controlling Keywords cytoskeleton; HITS-CLIP; invadopodia; microRNA; miR-200 EMT are the transcription repressors, ZEB1 and ZEB2 (formerly Subject Categories Cancer; Cell Adhesion, Polarity & Cytoskeleton; RNA known as SIP1) (Gregory et al, 2008a; Park et al, 2008). Further- Biology more, the ZEB proteins are strong repressors of transcription of the DOI 10.15252/embj.201488641 | Received 2 April 2014 | Revised 6 June 2014 | miR-200 genes, producing a double negative feedback loop that is Accepted 12 June 2014 | Published online 28 July 2014 central to the control of EMT in in vitro models (Bracken et al, The EMBO Journal (2014) 33: 2040–2056 2008; Burk et al, 2008; Parker et al, 2009; Gregory et al, 2011) and has been implicated in contributing to cancer progression through promotion of EMT in various epithelial-derived cancers. However, like all microRNAs, the miR-200 family members are predicted to 1 Centre for Cancer Biology, SA Pathology and University of South Australia, Adelaide, SA, Australia 2 Discipline of Medicine, University of Adelaide, Adelaide, SA, Australia 3 School of Molecular and Biomedical Science, University of Adelaide, Adelaide, SA, Australia 4 Division of Molecular Cell Biology, Institute for Molecular Bioscience, University of Queensland, St Lucia, Brisbane, Qld, Australia *Corresponding author. Tel: +61 8 8222 3410; Fax: +61 8 8232 4092; Email: [email protected] **Corresponding author. Tel: +61 8 8222 3430; Fax +61 8 8232 4092; Email: [email protected] †These authors contributed equally to the work 2040 The EMBO Journal Vol 33 | No 18 | 2014 ª 2014 The Authors Cameron P Bracken et al miR-200 targets a cytoskeletal regulatory network The EMBO Journal The EMBO Journal miR-200 targets a cytoskeletal regulatory network Cameron P Bracken et al A have many other targets. Some of these may also play central roles cancer cell invasion and metastasis. In particular, we show that the Figure 1. Genome-wide identification of miR-200 targets by Ago-HITS- in mediating the epithelial response to miR-200, while others may formation of invadopodia, which relies on rearrangement of the CLIP. provide a more subtle role in the sculpting of phenotype by actin cytoskeleton and provides a site for localized secretion of A Percentages of total reads and read peaks derived from Ago-HITS-CLIP and mapped relative to their genomic locations. miR-200. enzymes to degrade the extracellular matrix, is regulated by miR-200 B, C Histograms displaying read peaks across the CFL2 and MPRIP 30UTRs. The The miR-200 family consists of 5 miRNAs that are closely related at multiple points in the pathway. y-axis shows the number of overlapping unique sequencing reads in sequence, but are predicted to comprise two distinct classes in comprising the peak, and the x-axis indicates the position of the peak terms of their targets, with miR-200a and miR-141 sharing identical within the 30UTR. The locations of potential seed sites (black arrows, seed regions and miR-200b, miR-200c, and miR-429 constituting a Results 8-mers; purple arrows, 7-mers; yellow arrows, 6-mers; asterisk, central- paired) are indicated.
Recommended publications
  • Table 2. Significant
    Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.
    [Show full text]
  • Dynamic Transcriptomic Profiles of Zebrafish Gills in Response to Zinc
    Zheng et al. BMC Genomics 2010, 11:548 http://www.biomedcentral.com/1471-2164/11/548 RESEARCH ARTICLE Open Access Dynamic transcriptomic profiles of zebrafish gills in response to zinc depletion Dongling Zheng1,4, Peter Kille2, Graham P Feeney2, Phil Cunningham1, Richard D Handy3, Christer Hogstrand1* Abstract Background: Zinc deficiency is detrimental to organisms, highlighting its role as an essential micronutrient contributing to numerous biological processes. To investigate the underlying molecular events invoked by zinc depletion we performed a temporal analysis of transcriptome changes observed within the zebrafish gill. This tissue represents a model system for studying ion absorption across polarised epithelial cells as it provides a major pathway for fish to acquire zinc directly from water whilst sharing a conserved zinc transporting system with mammals. Results: Zebrafish were treated with either zinc-depleted (water = 2.61 μgL-1; diet = 26 mg kg-1) or zinc-adequate (water = 16.3 μgL-1; diet = 233 mg kg-1) conditions for two weeks. Gill samples were collected at five time points and transcriptome changes analysed in quintuplicate using a 16K oligonucleotide array. Of the genes represented the expression of a total of 333 transcripts showed differential regulation by zinc depletion (having a fold-change greater than 1.8 and an adjusted P-value less than 0.1, controlling for a 10% False Discovery Rate). Down-regulation was dominant at most time points and distinct sets of genes were regulated at different stages. Annotation enrichment analysis revealed that ‘Developmental Process’ was the most significantly overrepresented Biological Process GO term (P = 0.0006), involving 26% of all regulated genes.
    [Show full text]
  • Predicting Clinical Response to Treatment with a Soluble Tnf-Antagonist Or Tnf, Or a Tnf Receptor Agonist
    (19) TZZ _ __T (11) EP 2 192 197 A1 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 02.06.2010 Bulletin 2010/22 C12Q 1/68 (2006.01) (21) Application number: 08170119.5 (22) Date of filing: 27.11.2008 (84) Designated Contracting States: (72) Inventor: The designation of the inventor has not AT BE BG CH CY CZ DE DK EE ES FI FR GB GR yet been filed HR HU IE IS IT LI LT LU LV MC MT NL NO PL PT RO SE SI SK TR (74) Representative: Habets, Winand Designated Extension States: Life Science Patents AL BA MK RS PO Box 5096 6130 PB Sittard (NL) (71) Applicant: Vereniging voor Christelijk Hoger Onderwijs, Wetenschappelijk Onderzoek en Patiëntenzorg 1081 HV Amsterdam (NL) (54) Predicting clinical response to treatment with a soluble tnf-antagonist or tnf, or a tnf receptor agonist (57) The invention relates to methods for predicting a clinical response to a therapy with a soluble TNF antagonist, TNF or a TNF receptor agonist and a kit for use in said methods. EP 2 192 197 A1 Printed by Jouve, 75001 PARIS (FR) EP 2 192 197 A1 Description [0001] The invention relates to methods for predicting a clinical response to a treatment with a soluble TNF antagonist, with TNF or a TNF receptor agonist using expression levels of genes of the Type I INF pathway and a kit for use in said 5 methods. In another aspect, the invention relates to a method for evaluating a pharmacological effect of a treatment with a soluble TNF antagonist, TNF or a TNF receptor agonist.
    [Show full text]
  • Highly Frequent Allelic Loss of Chromosome 6Q16-23 in Osteosarcoma: Involvement of Cyclin C in Osteosarcoma
    1153-1158 5/11/06 16:31 Page 1153 INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE 18: 1153-1158, 2006 Highly frequent allelic loss of chromosome 6q16-23 in osteosarcoma: Involvement of cyclin C in osteosarcoma NORIHIDE OHATA1, SACHIO ITO2, AKI YOSHIDA1, TOSHIYUKI KUNISADA1, KUNIHIKO NUMOTO1, YOSHIMI JITSUMORI2, HIROTAKA KANZAKI2, TOSHIFUMI OZAKI1, KENJI SHIMIZU2 and MAMORU OUCHIDA2 1Science of Functional Recovery and Reconstruction, 2Department of Molecular Genetics, Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama University, Shikata-cho 2-5-1, Okayama 700-8558, Japan Received June 13, 2006; Accepted August 14, 2006 Abstract. The molecular pathogenesis of osteosarcoma is very rearrangements (1,2). It has been reported that both RB1 and complicated and associated with chaotic abnormalities on many TP53 pathways are inactivated, and the regulation of cell cycle chromosomal arms. We analyzed 12 cases of osteosarcomas is impaired in most osteosarcomas (1). For example, deletion/ with comparative genomic hybridization (CGH) to identify mutation of the CDKN2A gene encoding both p16INK4A and chromosomal imbalances, and detected highly frequent p14ARF on 9p21 (3-5), amplification of the CDK4 (6), CCND1, chromosomal alterations in chromosome 6q, 8p, 10p and MDM2 genes (4), and other aberrations related to inactivation 10q. To define the narrow rearranged region on chromosome 6 of these pathways have been found. Tumor suppressor genes with higher resolution, loss of heterozygosity (LOH) analysis (TSGs) are suspected to be involved in tumorigenesis of was performed with 21 microsatellite markers. Out of 31 cases, osteosarcoma. Loss of heterozygosity (LOH) studies have 23 cases (74%) showed allelic loss at least with one marker on detected frequent allelic loss at 3q, 13q, 17p and 18q (7).
    [Show full text]
  • Table of Contents Table of Contents
    Table of contents Table of contents................................................................................................................. 1 Summary ............................................................................................................................. 3 Abbreviations ...................................................................................................................... 4 Gene Symbols I - Incidentals .............................................................................................. 5 Gene symbols II - Target Gene Names ............................................................................... 6 1. Introduction........................................................................................................... 12 1.1. The Pathos of the Crab ..................................................................................... 12 1.2. Cancer in the Molecular Age - a genetic and epigenetic disease..................... 13 1.3. Tumoral evolution............................................................................................. 14 1.4. DNA repair systems .......................................................................................... 17 1.4.1. DNA Mismatch Repair.............................................................................. 18 1.4.2. Double-strand Break Repair..................................................................... 19 1.4.3. Direct Repair...........................................................................................
    [Show full text]
  • Supplementary Tables S1-S3
    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
    [Show full text]
  • Interventions to Increase Apolipoprotein A-I Transcription in Hepg2 Cells
    Interventions to increase apolipoprotein A-I transcription in HepG2 cells Citation for published version (APA): van der Krieken, S. E. (2017). Interventions to increase apolipoprotein A-I transcription in HepG2 cells. Uitgeverij BOXPress. https://doi.org/10.26481/dis.20170330svdk Document status and date: Published: 01/01/2017 DOI: 10.26481/dis.20170330svdk Document Version: Publisher's PDF, also known as Version of record Please check the document version of this publication: • A submitted manuscript is the version of the article upon submission and before peer-review. There can be important differences between the submitted version and the official published version of record. People interested in the research are advised to contact the author for the final version of the publication, or visit the DOI to the publisher's website. • The final author version and the galley proof are versions of the publication after peer review. • The final published version features the final layout of the paper including the volume, issue and page numbers. Link to publication General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain • You may freely distribute the URL identifying the publication in the public portal.
    [Show full text]
  • Thom Ulullallittur
    THOMULULLALLITTUR US009737480B2 (12 ) United States Patent ( 10 ) Patent No. : US 9 ,737 ,480 B2 Lu et al. (45 ) Date of Patent: Aug. 22 , 2017 ( 54 ) ARRDC1-MEDIATED MICROVESICLES 2014 /0273226 AL 9 /2014 Wu 2014 /0364588 A1 12 / 2014 Haugwitz et al. ?? (ARMMS ) AND USES THEREOF 2016 / 0206566 AL 7 / 2016 Lu et al. ( 71 ) Applicants : President and Fellows of Harvard College , Cambridge, MA (US ) ; The FOREIGN PATENT DOCUMENTS Board of Trustees of the Leland WO WO 2011 / 127219 10 /2011 Stanford Junior University , Palo Alto , WO WO 2013 / 119602 8 / 2013 CA (US ) WO WO 2014 /093655 6 / 2014 (72 ) Inventors : Quan Lu , Newton , MA (US ) ; Joseph OTHER PUBLICATIONS F . Nabhan , Cambridge , MA (US ) ; Stanley N . Cohen , Stanford , CA (US ) Properzi et al . , Biomarkers Med . 2013 , 7 ( 5 ) 769 - 778 . * Kosaka et al. J . Biol. Chem 2010 , 285 : 17442 - 17452 . * International Search Report and Written Opinion for PCT/ US2013 / ( 73 ) Assignees : President and Fellows of Harvard 024839 , mailed May 28 , 2013 . College, Cambridge , MA (US ) ; The International Preliminary Report on Patentability for PCT /US2013 / Board of Trustees of the Leland 024839 , mailed Aug . 21 , 2014 . Standford Junior University , Stanford , Genbank Submission ; NIH /NCBI , Accession No. NP _ 689498 . CA (US ) Puca et al ., Mar. 22 , 2014 . Genbank Submission ; NIH /NCBI , Accession No. NP _ 001155957 . ( * ) Notice : Subject to any disclaimer , the term of this Skarnes et al. , Feb . 26 , 2014 . patent is extended or adjusted under 35 Genbank Submission ; NIH /NCBI , Accession No . NP _ 848495 . ? U . S . C . 154 ( b ) by 0 days . Skarnes et al ., Feb . 26 , 2014 .
    [Show full text]
  • Characterising Response and Resistance Mechanisms to Faslodex in Breast Cancer
    Characterising response and resistance mechanisms to Faslodex in breast cancer Hayley Elizabeth Francies A thesis presented for the degree of Doctor of Philosophy at Cardiff University September 2013 Breast Cancer Molecular and Pharmacology Group School of Pharmacy and Pharmaceutical Sciences Redwood Building Cardiff University King Edward VII Avenue Cardiff, CF103NB i Abstract In ER+ breast cancer initial responses to antihormones are variable, complete responses are rare and resistance is eventually acquired by many patients. It is important to model these events to discover predictive markers of antihormone outcome and so targeted strategies can be developed to maximise antihormone effectiveness. To date, most studies have employed the MCF-7 cell line which fails to represent the variability of ER+ disease. Focusing on Faslodex, the thesis objective was to use 4 cell lines in vitro encompassing ER+/HER2- (MCF-7/T47D) and ER+/HER2+ (BT474/MDA-MB-361) disease to (i) characterise the magnitude of initial antihormone response, (ii) monitor the onset of resistance by prolonged treatment and (iii) detail gene expression changes during Faslodex treatment. All models were initially growth-inhibited by Faslodex, with superior responses in HER2- lines. Microarray analysis revealed gene cohorts affected by Faslodex treatment differed between HER2+ and HER2- models. While MCF-7, BT474 and MDA-MB-361 cells acquired Faslodex resistance, this failed to develop in the T47D line, providing a model of complete-response. A filtering process identified genes involved in the varying Faslodex responses and clinical relevance was determined using the NEWEST Faslodex clinical trial dataset. Of interest was the Faslodex-induction of CXCR4, as a potential mediator of acquired resistance, while suppression of the RET signalling pathway related to improved initial response in the ER+/HER2- setting.
    [Show full text]
  • Identification of Thioredoxin-Interacting Protein (TXNIP) As a Downstream Target for IGF1 Action
    Identification of thioredoxin-interacting protein (TXNIP) as a downstream target for IGF1 action Karthik Nagaraja, Lena Lapkina-Gendlera, Rive Sarfsteina, David Gurwitza, Metsada Pasmanik-Chorb, Zvi Laronc, Shoshana Yakard, and Haim Wernera,e,1 aDepartment of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel Aviv University, 69978 Tel Aviv, Israel; bBioinformatics Unit, George Wise Faculty of Life Sciences, Tel Aviv University, 69978 Tel Aviv, Israel; cEndocrine and Diabetes Research Unit, Schneider Children’s Medical Center, 49292 Petah Tikva, Israel; dDavid B. Kriser Dental Center, Department of Basic Science and Craniofacial Biology, New York University College of Dentistry, New York, NY; and eYoran Institute for Human Genome Research, Tel Aviv University, 69978 Tel Aviv, Israel Edited by Dennis A. Carson, University of California, San Diego, La Jolla, CA, and approved December 20, 2017 (received for review September 12, 2017) Laron syndrome (LS), or primary growth hormone (GH) insensitiv- Of interest, about 15% of the genes are involved in metabolic path- ity, is the best-characterized entity among the congenital insulin- ways. Given the key role of IGF1 in regulation of cancer cell me- like growth factor 1 (IGF1) deficiencies. Life-long exposure to tabolism, it is reasonable to assume that alteration in the expression of minute endogenous IGF1 levels is linked to low stature as well as a IGF1-dependent metabolic genes may constitute an important mech- number of endocrine and metabolic abnormalities. While elevated anism that contributes to establishment of a malignant phenotype. IGF1 is correlated with increased cancer incidence, epidemiological Thioredoxin-interacting protein (TXNIP) was initially discov- studies revealed that patients with LS do not develop tumors.
    [Show full text]
  • Kisspeptin/KISS1R System in Breast Cancer Donna Cvetković 1, Andy V
    Journal of Cancer 2013, Vol. 4 653 Ivyspring International Publisher Journal of Cancer 2013; 4(8): 653-661. doi: 10.7150/jca.7626 Review Kisspeptin/KISS1R System in Breast Cancer Donna Cvetković 1, Andy V. Babwah 1,2,3,4 and Moshmi Bhattacharya 1, 3, 5 1. Department of Physiology and Pharmacology, Schulich School of Medicine and Dentistry, University of Western Ontario, London, Ontario, Canada, N6A 5C1; 2. The Children’s Health Research Institute, London, Ontario, Canada; 3. Lawson Health Research Institute, London, Ontario, Canada; 4. Department of Obstetrics and Gynaecology, University of Western Ontario London, Ontario, Canada N6C 2V5; 5. Department of Oncology, University of Western Ontario, London, Ontario, Canada. Corresponding author: Dr. Moshmi Bhattacharya, Department of Physiology and Pharmacology, Medical Sciences Building, MSB 216, Schulich School of Medicine and Dentistry, University of Western Ontario, London, Ontario, Canada, N6A 5C1. Tel: 519-661-2111, ext. 82970; Fax: 519-661-3827 E-mail: [email protected]. © Ivyspring International Publisher. This is an open-access article distributed under the terms of the Creative Commons License (http://creativecommons.org/ licenses/by-nc-nd/3.0/). Reproduction is permitted for personal, noncommercial use, provided that the article is in whole, unmodified, and properly cited. Received: 2013.09.10; Accepted: 2013.09.22; Published: 2013.09.26 Abstract Kisspeptins (KP), peptide products of the kisspeptin-1 (KISS1) gene are the endogenous ligands for a G protein-coupled receptor (GPCR) – KP receptor (KISS1R). KISS1R couples to the Gαq/11 signaling pathway. KISS1 is a metastasis suppressor gene and the KP/KISS1R signaling has an- ti-metastatic and tumor-suppressant effects in numerous human cancers.
    [Show full text]
  • Novel Genetic and Epigenetic Alterations in Colorectal Tumors and Their Potential As Biomarkers
    Novel genetic and epigenetic alterations in colorectal tumors and their potential as biomarkers Terje Cruickshank Ahlquist Group of Molecular Genetics Department of Cancer Prevention Institute for Cancer Research The Norwegian Radium Hospital Rikshospitalet University Hospital Faculty Division The Norwegian Radium Hospital Faculty of Medicine University of Oslo The Research Council of Norway Norwegian Centre of Excellence University of Oslo A thesis for the PhD degree, Oslo, 2008 © Terje Cruickshank Ahlquist, 2009 Series of dissertations submitted to the Faculty of Medicine, University of Oslo No. 766 ISBN 978-82-8072-325-3 All rights reserved. No part of this publication may be reproduced or transmitted, in any form or by any means, without permission. Cover: Inger Sandved Anfinsen. Printed in Norway: AiT e-dit AS, Oslo, 2009. Produced in co-operation with Unipub AS. The thesis is produced by Unipub AS merely in connection with the thesis defence. Kindly direct all inquiries regarding the thesis to the copyright holder or the unit which grants the doctorate. Unipub AS is owned by The University Foundation for Student Life (SiO) TABLE OF CONTENTS ACKNOWLEDGEMENTS .............................................................................................................5 PREFACE.............................................................................................................................................6 LIST OF PAPERS...............................................................................................................................8
    [Show full text]