DOCSLIB.ORG

Transcriptional Regulation by the Estrogen-Related Receptors

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Transcriptional Regulation by the Estrogen-Related Receptors Transcriptional Regulation by the Estrogen-Related Receptors Annie Tremblay A thesis submitted to the faculty of Graduate studies and Research in partial fulfillment of the requirements for the degree of Doctor of Philosophy © Annie Tremblay, November 2009 Department of Biochemistry McGill University Montréal, Québec, Canada ABSTRACT The Estrogen-Related receptors (ERRα, ERRβ and ERRγ) are ubiquitous, constitutively active, orphan nuclear receptors and little is known concerning post-translational modifications affecting their transcriptional activity. We observed that the conserved phosphorylation-dependent sumoylation motif (PDSM) within the N-terminal domain of the ERRs represses their transcriptional activity on compound promoters via a synergy control mechanism. We also identified protein inhibitor of activated stat y (PIASy), a SUMO E3 ligase, as a new interacting partner of ERRα which promotes the sumoylation of ERRα and represses its transcriptional activity in a PDSM-dependent manner. Furthermore, by showing that an ERRα phosphoS19-specific antibody, but not a polyclonal ERRα antibody with a minimal affinity for phosphorylated S19, allows detection of endogenous sumoylated ERRα in mouse liver extract, we confirmed that the ERRα phospho-sumoyl switch is functional in vivo. ERRα is highly expressed in the kidney, but its role in this organ is unknown. Therefore, we used a combination of physiological studies, gene expression and genome-wide location analysis to explore the role of ERRα in the kidney. A defect in sodium and potassium homeostasis was observed in the ERRα null mice, which correlated with the ERRα renal transcriptional program comprising key sodium and potassium channels. Furthermore, telemetry monitoring revealed that the ERRα null mice display a significantly reduced blood pressure at nighttime and this correlated the renal transcriptional program of ERRα comprising genes involved in blood pressure regulation. In addition, we identified the Renin-Angiotensin pathway genes as direct ERRα target genes in the kidney. These results identify a role for ERRα in renal sodium/potassium handling, intra-renal renin-angiotensin pathway, blood pressure regulation and possibly hypertension. ii RÉSUMÉ Les récepteurs reliés aux récepteurs de l’estrogène (ERRs) sont ubiquitaires et constitutivement actifs et le rôle joué par les modifications post- traductionnelles sur leur activité transcriptonnelle est peu connu. Nous avons démontré qu’un motif consensus de sumoylation phospho-dependente (PDSM) situé dans le domaine N-terminal diminue l’activité transcriptionnelle des ERRs sur des promoteurs à élements de réponses multiples grâce à un mécanisme de contrôle de la synergie. Nous avons aussi établi que les ERRs intéragissent avec la E3-SUMO-ligase PIASy et que cette dernière promouvoit la sumoylation du ERRα de manière phospho-dépendante. De plus, en montrant que la forme sumoylée endogène de ERRα dans de l’extrait de foie de souris n’était détectable qu’avec un anticorps spécifique dirigé contre la sérine 19 phoshorylée nous avons confirmé la validité de l’interrelation phosphorylation-sumoylation dans un contexte physiologique in vivo. Même si le haut niveau d’expression de ERRα dans les reins est reconnu, son rôle dans cet organe est inconnu. Nous avons donc utilisé une approche combinatoire d’analyses physiologiques, d’expression génique et d’identification de sites spécifiques de liaison à l’ADN au niveau génomique afin d’explorer plus avant le rôle physiologique de ERRα dans le rein. Nous avons observé que les souris knock-out pour le gène de ERRα présentent un problème au niveau de l’homéostasie sodique et potassique corrèlant directement avec le programme transcriptionnel rénal qui comprends plusieurs canaux sodiques et potassiques importants. De plus, la mesure des paramètres cardiovasculaires par télémétrie a révélé que les souris knock-out pour le gène du ERRα ont une pression sanguine nocturne plus faible qui corrèle avec le programme transcriptionnel comprenant plusieurs gènes influençant la pression sanguine. Nous avons aussi identifié les promoteurs de certains gènes composant le système rénine-angiotensine comme gènes cibles potentiels de ERRα dans les reins. Nos résultats suggèrent une implication du ERRα dans le contrôle de la pression sanguine basale et possiblement dans l’hypertension. iii ACKNOWLEDGEMENTS I am thankful to my supervisor, Vincent Giguère, for giving me the opportunity to work in his laboratory. I am sincerely grateful not only for the advice, constructive criticism and directions, but especially for the freedom and latitude for research, which adequately prepared me for the future challenges of independent research. I wish to thank all the members of the laboratory, past and present, for the interesting discussions, scientific or not, which rendered more pleasant spending a lot of time in the laboratory, and especially to my bench neighbor Brian for his friendship, all the laughs as well as scientific collaboration. I also want to thank Majid and Geneviève for their suggestions and encouragements, their positive spirit and friendship. I also wish to express gratitude to our skillful technician Cathy for generating the in vivo ChIP-on-chip lists and sharing some of her precious mouse tissue collection. I want to extend my gratitude to Anna, Yoshi and other past members of the lab, for passing on their technical expertise of the molecular biology basics. I am grateful to the members of my advisory committee, Michel Tremblay and Xiang-Jiao Yang, for their valuable advice and suggestions. I also want to thank Serge for the interesting discussions and technical advice in the SUMO project. I am thankful to Carlo for his help and interest into my mice projects, as well as to our collaborators Tim Reudelhuber and Chantale for the telemetry and plasma renin experiments. Last but not least, I wish to express my profound gratitude to my family and friends for their endless and priceless support along this journey and, most of all, for believing in me. I am also thankful to Canderel and CIHR for funding. iv LIST OF PUBLICATIONS Arising From work of the thesis - Tremblay AM, Wilson BJ, Yang XJ and Giguère V. Phosphorylation- Dependent Sumoylation Regulates Estrogen-Related Receptor-α and -γ Transcriptional Activity through a Synergy Control Motif. (2008) Mol Endocrinol 22(3): 570–584. First Published Online December 6, 2007. - Tremblay AM, Dufour CR, Ghahremani M, Reudelhuber TL and Giguère V. Physiological Genomics Identifies Estrogen-Related Receptor α as a Regulator of Renal Sodium and Potassium Homeostasis and the Renin-Angiotensin Pathway. Mol Endocrinol. In Press. Epub November 9th 2009. Other publications - Grégoire S, Tremblay AM, Xiao L, Yang Q, Ma K, Nie J, Mao Z, Wu Z, Giguère V and Yang XJ. Control of MEF2 transcriptional activity by coordinated phosphorylation and sumoylation. (2006) J Biol Chem 281, 4423 –4433. - Tremblay AM and Giguère V. The NR3B subgroup: an ovERRview. (2007) Nuclear Receptor Signaling 5, e009. Review. - Wilson BJ, Tremblay AM, Giguère V. An Acetylation Switch Modulates the Function of Estrogen Related Receptor α. To be submitted shortly. v CONTRIBUTIONS OF AUTHORS Vincent Giguère: Supervised all aspects of the projects and edited the manuscripts. Xiang-Jiao Yang: Provided the wild-type Ubc9 and SUMO and E3 ligases plasmids; Discussed the results and revised the manuscript. Timothy L. Reudelhuber: Generated the telemetry and plasma renin concentration results. Discussed these results and revised the manuscript. Brian J. Wilson: Generated the following serine mutants: ERRα S19D, KR/S19A, KR/S19D, ERRγ S45A, S45D, KR/S45A, KR/S45D; performed the reporter gene assays presented in panels 3G, 3H, 5D and 6D; immortalized my primary ERRα null MEFs by SV40 large T viral infection. Catherine R. Dufour: Performed the ChIP-on-chip on mouse kidneys and target validations comprising those shown in panel 5A; provided the frozen circadian kidneys. Majid Ghahremani: Technical assistance and qRT-PCR validation. vi TABLE OF CONTENTS ABSTRACT .......................................................................................................... ii RÉSUMÉ .............................................................................................................. iii ACKNOWLEDGEMENTS .................................................................................iv LIST OF PUBLICATIONS ..................................................................................v CONTRIBUTIONS OF AUTHORS...................................................................vi TABLE OF CONTENTS ................................................................................... vii LIST OF FIGURES...............................................................................................x LIST OF TABLES.............................................................................................. xii LIST OF ABBREVIATIONS........................................................................... xiii CHAPTER I: Literature Review..........................................................................1 1.1 The Nuclear Receptor Superfamily ...............................................................1 1.1.1 Classical Mode of Action and Hormone Response Elements .......................... 1 1.1.2 Nomenclature....................................................................................................... 5 1.1.3 Nuclear Receptor Anatomy ...............................................................................
Load more

Recommended publications
  • SHARP1 (BHLHE41) Mouse Monoclonal Antibody [Clone ID: OTI3H4] Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TA806354 SHARP1 (BHLHE41) Mouse Monoclonal Antibody [Clone ID: OTI3H4] Product data: Product Type: Primary Antibodies Clone Name: OTI3H4 Applications: IHC, WB Recommended Dilution: WB 1:2000, IHC 1:150 Reactivity: Human Host: Mouse Isotype: IgG1 Clonality: Monoclonal Immunogen: Human recombinant protein fragment corresponding to amino acids 1-297 of human BHLHE41(NP_110389) produced in E.coli. Formulation: PBS (PH 7.3) containing 1% BSA, 50% glycerol and 0.02% sodium azide. Concentration: 1 mg/ml Purification: Purified from mouse ascites fluids or tissue culture supernatant by affinity chromatography (protein A/G) Conjugation: Unconjugated Storage: Store at -20°C as received. Stability: Stable for 12 months from date of receipt. Predicted Protein Size: 50.3 kDa Gene Name: basic helix-loop-helix family member e41 Database Link: NP_110389 Entrez Gene 79365 Human Q9C0J9 Background: This gene encodes a basic helix-loop-helix protein expressed in various tissues. The encoded protein can interact with ARNTL or compete for E-box binding sites in the promoter of PER1 and repress CLOCK/ARNTL's transactivation of PER1. This gene is believed to be involved in the control of circadian rhythm and cell differentiation. Defects in this gene are associated with the short sleep phenotype. [provided by RefSeq, Feb 2014] This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 SHARP1 (BHLHE41) Mouse Monoclonal Antibody [Clone ID: OTI3H4] – TA806354 Synonyms: BHLHB3; DEC2; hDEC2; SHARP1 Protein Families: Transcription Factors Protein Pathways: Circadian rhythm - mammal Product images: HEK293T cells were transfected with the pCMV6- ENTRY control (Left lane) or pCMV6-ENTRY BHLHE41 ([RC206882], Right lane) cDNA for 48 hrs and lysed.
    [Show full text]
  • Core Transcriptional Regulatory Circuitries in Cancer
    Oncogene (2020) 39:6633–6646 https://doi.org/10.1038/s41388-020-01459-w REVIEW ARTICLE Core transcriptional regulatory circuitries in cancer 1 1,2,3 1 2 1,4,5 Ye Chen ● Liang Xu ● Ruby Yu-Tong Lin ● Markus Müschen ● H. Phillip Koeffler Received: 14 June 2020 / Revised: 30 August 2020 / Accepted: 4 September 2020 / Published online: 17 September 2020 © The Author(s) 2020. This article is published with open access Abstract Transcription factors (TFs) coordinate the on-and-off states of gene expression typically in a combinatorial fashion. Studies from embryonic stem cells and other cell types have revealed that a clique of self-regulated core TFs control cell identity and cell state. These core TFs form interconnected feed-forward transcriptional loops to establish and reinforce the cell-type- specific gene-expression program; the ensemble of core TFs and their regulatory loops constitutes core transcriptional regulatory circuitry (CRC). Here, we summarize recent progress in computational reconstitution and biologic exploration of CRCs across various human malignancies, and consolidate the strategy and methodology for CRC discovery. We also discuss the genetic basis and therapeutic vulnerability of CRC, and highlight new frontiers and future efforts for the study of CRC in cancer. Knowledge of CRC in cancer is fundamental to understanding cancer-specific transcriptional addiction, and should provide important insight to both pathobiology and therapeutics. 1234567890();,: 1234567890();,: Introduction genes. Till now, one critical goal in biology remains to understand the composition and hierarchy of transcriptional Transcriptional regulation is one of the fundamental mole- regulatory network in each specified cell type/lineage.
    [Show full text]
  • TGF-Β1 Signaling Targets Metastasis-Associated Protein 1, a New Effector in Epithelial Cells
    Oncogene (2011) 30, 2230–2241 & 2011 Macmillan Publishers Limited All rights reserved 0950-9232/11 www.nature.com/onc ORIGINAL ARTICLE TGF-b1 signaling targets metastasis-associated protein 1, a new effector in epithelial cells SB Pakala1, K Singh1,3, SDN Reddy1, K Ohshiro1, D-Q Li1, L Mishra2 and R Kumar1 1Department of Biochemistry and Molecular Biology and Institute of Coregulator Biology, The George Washington University Medical Center, Washington, DC, USA and 2Department of Gastroenterology, Hepatology and Nutrition, The University of Texas MD Anderson Cancer Center, Houston, TX, USA In spite of a large number of transforming growth factor b1 gene chromatin in response to upstream signals. The (TGF-b1)-regulated genes, the nature of its targets with TGF-b1-signaling is largely mediated by Smad proteins roles in transformation continues to be poorly understood. (Massague et al., 2005) where Smad2 and Smad3 are Here, we discovered that TGF-b1 stimulates transcription phosphorylated by TGF-b1-receptors and associate with of metastasis-associated protein 1 (MTA1), a dual master the common mediator Smad4, which translocates to the coregulator, in epithelial cells, and that MTA1 status is a nucleus to participate in the expression of TGF-b1-target determinant of TGF-b1-induced epithelial-to-mesenchymal genes (Deckers et al., 2006). Previous studies have shown transition (EMT) phenotypes. In addition, we found that that CUTL1, also known as CDP (CCAAT displacement MTA1/polymerase II/activator protein-1 (AP-1) co-activator protein), a target of TGF-b1, is needed for its short-term complex interacts with the FosB-gene chromatin and stimu- effects of TGF-b1 on cell motility involving Smad4- lates its transcription, and FosB in turn, utilizes FosB/histone dependent pathway (Michl et al.,2005).
    [Show full text]
  • Multifactorial Erβ and NOTCH1 Control of Squamous Differentiation and Cancer
    Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks, … , Karine Lefort, G. Paolo Dotto J Clin Invest. 2014;124(5):2260-2276. https://doi.org/10.1172/JCI72718. Research Article Oncology Downmodulation or loss-of-function mutations of the gene encoding NOTCH1 are associated with dysfunctional squamous cell differentiation and development of squamous cell carcinoma (SCC) in skin and internal organs. While NOTCH1 receptor activation has been well characterized, little is known about how NOTCH1 gene transcription is regulated. Using bioinformatics and functional screening approaches, we identified several regulators of the NOTCH1 gene in keratinocytes, with the transcription factors DLX5 and EGR3 and estrogen receptor β (ERβ) directly controlling its expression in differentiation. DLX5 and ERG3 are required for RNA polymerase II (PolII) recruitment to the NOTCH1 locus, while ERβ controls NOTCH1 transcription through RNA PolII pause release. Expression of several identified NOTCH1 regulators, including ERβ, is frequently compromised in skin, head and neck, and lung SCCs and SCC-derived cell lines. Furthermore, a keratinocyte ERβ–dependent program of gene expression is subverted in SCCs from various body sites, and there are consistent differences in mutation and gene-expression signatures of head and neck and lung SCCs in female versus male patients. Experimentally increased ERβ expression or treatment with ERβ agonists inhibited proliferation of SCC cells and promoted NOTCH1 expression and squamous differentiation both in vitro and in mouse xenotransplants. Our data identify a link between transcriptional control of NOTCH1 expression and the estrogen response in keratinocytes, with implications for differentiation therapy of squamous cancer. Find the latest version: https://jci.me/72718/pdf Research article Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks,1,2 Paola Ostano,3 Seung-Hee Jo,1,2 Jun Dai,1,2 Spiro Getsios,4 Piotr Dziunycz,5 Günther F.L.
    [Show full text]
  • Supplementary Materials
    Supplementary Materials: Supplemental Table 1 Abbreviations FMDV Foot and Mouth Disease Virus FMD Foot and Mouth Disease NC Non-treated Control DEGs Differentially Expressed Genes RNA-seq High-throughput Sequencing of Mrna RT-qPCR Quantitative Real-time Reverse Transcriptase PCR TCID50 50% Tissue Culture Infective Doses CPE Cytopathic Effect MOI Multiplicity of Infection DMEM Dulbecco's Modified Eagle Medium FBS Fetal Bovine Serum PBS Phosphate Buffer Saline QC Quality Control FPKM Fragments per Kilo bases per Million fragments method GO Gene Ontology KEGG Kyoto Encyclopedia of Genes and Genomes R Pearson Correlation Coefficient NFKBIA NF-kappa-B Inhibitor alpha IL6 Interleukin 6 CCL4 C-C motif Chemokine 4 CXCL2 C-X-C motif Chemokine 2 TNF Tumor Necrosis Factor VEGFA Vascular Endothelial Growth Gactor A CCL20 C-C motif Chemokine 20 CSF2 Macrophage Colony-Stimulating Factor 2 GADD45B Growth Arrest and DNA Damage Inducible 45 beta MYC Myc proto-oncogene protein FOS Proto-oncogene c-Fos MCL1 Induced myeloid leukemia cell differentiation protein Mcl-1 MAP3K14 Mitogen-activated protein kinase kinase kinase 14 IRF1 Interferon regulatory factor 1 CCL5 C-C motif chemokine 5 ZBTB3 Zinc finger and BTB domain containing 3 OTX1 Orthodenticle homeobox 1 TXNIP Thioredoxin-interacting protein ZNF180 Znc Finger Protein 180 ZNF36 Znc Finger Protein 36 ZNF182 Zinc finger protein 182 GINS3 GINS complex subunit 3 KLF15 Kruppel-like factor 15 Supplemental Table 2 Primers for Verification of RNA-seq-detected DEGs with RT-qPCR TNF F: CGACTCAGTGCCGAGATCAA R:
    [Show full text]
  • Table 2. Significant
    Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.
    [Show full text]
  • Early B-Cell Factors Are Required for Specifying Multiple Retinal Cell Types and Subtypes from Postmitotic Precursors
    11902 • The Journal of Neuroscience, September 8, 2010 • 30(36):11902–11916 Development/Plasticity/Repair Early B-Cell Factors Are Required for Specifying Multiple Retinal Cell Types and Subtypes from Postmitotic Precursors Kangxin Jin,1,2 Haisong Jiang,1,2 Zeqian Mo,3 and Mengqing Xiang1,2 1Center for Advanced Biotechnology and Medicine and Department of Pediatrics, 2Graduate Program in Molecular Genetics, Microbiology and Immunology, and 3Department of Cell Biology and Neuroscience, University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, Piscataway, New Jersey 08854 The establishment of functional retinal circuits in the mammalian retina depends critically on the proper generation and assembly of six classes of neurons, five of which consist of two or more subtypes that differ in morphologies, physiological properties, and/or sublaminar positions. How these diverse neuronal types and subtypes arise during retinogenesis still remains largely to be defined at the molecular level. Here we show that all four family members of the early B-cell factor (Ebf) helix-loop-helix transcription factors are similarly expressedduringmouseretinogenesisinseveralneuronaltypesandsubtypesincludingganglion,amacrine,bipolar,andhorizontalcells, and that their expression in ganglion cells depends on the ganglion cell specification factor Brn3b. Misexpressed Ebfs bias retinal precursors toward the fates of non-AII glycinergic amacrine, type 2 OFF-cone bipolar and horizontal cells, whereas a dominant-negative Ebf suppresses the differentiation of these cells as well as ganglion cells. Reducing Ebf1 expression by RNA interference (RNAi) leads to an inhibitory effect similar to that of the dominant-negative Ebf, effectively neutralizes the promotive effect of wild-type Ebf1, but has no impact on the promotive effect of an RNAi-resistant Ebf1.
    [Show full text]
  • Analysis and Characterisation of the Mouse Hic2 Gene
    Aus dem Institut für Entwicklungsgenetik des GSF-Forschungszentrums für Umwelt und Gesundheit, GmbH Direktor: Prof. Dr. Wolfgang Wurst Anfertigung unter der Leitung von Prof. Dr. Jochen Graw Vorgelegt über den Lehrstuhl für Molekulare Tierzucht und Biotechnologie Der Tierärztlichen Fakultät der Ludwig-Maximilians-Universität München Vorstand: Prof. Dr. Eckhard Wolf Untersuchung und Charakterisierung des Hic2-Gens der Maus Inaugural-Dissertation Zur Erlangung der tiermedizinischen Doktorwürde der Tierärztlichen Fakultät der Ludwig-Maximilians-Universität München von Aleksandra Terzic aus Sarajevo/Bosnia und Herzegowina München 2004 II Aus dem Institut für Entwicklungsgenetik des GSF-Forschungszentrums für Umwelt und Gesundheit, GmbH Direktor: Prof. Dr. Wolfgang Wurst Anfertigung unter der Leitung von Prof. Dr. Jochen Graw Vorgelegt über den Lehrstuhl für Molekulare Tierzucht und Biotechnologie Der Tierärztlichen Fakultät der Ludwig-Maximilians-Universität München Vorstand: Prof. Dr. Eckhard Wolf Analysis and characterisation of the mouse Hic2 gene Inaugural-Dissertation Zur Erlangung der tiermedizinischen Doktorwürde der Tierärztlichen Fakultät der Ludwig-Maximilians-Universität München von Aleksandra Terzic aus Sarajevo/Bosnia und Herzegowina München 2004 III Gedruckt mit Genehmigung der Tierärztlichen Fakultät der Ludwig-Maximilians-Universität München Dekan: Univ.-Prof. Dr. A.Stolle Referent: Univ.-Prof. Dr. E. Wolf Korreferent: Univ.-Prof. Dr. K. Heinritzi Tag der Promotion: 13. Februar 2004 IV List of contents 1 INTRODUCTION.............................................................................................................1
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • To Study Mutant P53 Gain of Function, Various Tumor-Derived P53 Mutants
    Differential effects of mutant TAp63γ on transactivation of p53 and/or p63 responsive genes and their effects on global gene expression. A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science By Shama K Khokhar M.Sc., Bilaspur University, 2004 B.Sc., Bhopal University, 2002 2007 1 COPYRIGHT SHAMA K KHOKHAR 2007 2 WRIGHT STATE UNIVERSITY SCHOOL OF GRADUATE STUDIES Date of Defense: 12-03-07 I HEREBY RECOMMEND THAT THE THESIS PREPARED UNDER MY SUPERVISION BY SHAMA KHAN KHOKHAR ENTITLED Differential effects of mutant TAp63γ on transactivation of p53 and/or p63 responsive genes and their effects on global gene expression BE ACCEPTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF Master of Science Madhavi P. Kadakia, Ph.D. Thesis Director Daniel Organisciak , Ph.D. Department Chair Committee on Final Examination Madhavi P. Kadakia, Ph.D. Steven J. Berberich, Ph.D. Michael Leffak, Ph.D. Joseph F. Thomas, Jr., Ph.D. Dean, School of Graduate Studies 3 Abstract Khokhar, Shama K. M.S., Department of Biochemistry and Molecular Biology, Wright State University, 2007 Differential effect of TAp63γ mutants on transactivation of p53 and/or p63 responsive genes and their effects on global gene expression. p63, a member of the p53 gene family, known to play a role in development, has more recently also been implicated in cancer progression. Mice lacking p63 exhibit severe developmental defects such as limb truncations, abnormal skin, and absence of hair follicles, teeth, and mammary glands. Germline missense mutations of p63 have been shown to be responsible for several human developmental syndromes including SHFM, EEC and ADULT syndromes and are associated with anomalies in the development of organs of epithelial origin.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • Integrated Analysis of Differentially Expressed Genes in Breast Cancer Pathogenesis
    2560 ONCOLOGY LETTERS 9: 2560-2566, 2015 Integrated analysis of differentially expressed genes in breast cancer pathogenesis DAOBAO CHEN and HONGJIAN YANG Department of Breast Surgery, Zhejiang Cancer Hospital, Hangzhou, Zhejiang 310022, P.R. China Received October 20, 2014; Accepted March 10, 2015 DOI: 10.3892/ol.2015.3147 Abstract. The present study aimed to detect the differences ducts or from the lobules that supply the ducts (1). Breast between breast cancer cells and normal breast cells, and inves- cancer affects ~1.2 million women worldwide and accounts tigate the potential pathogenetic mechanisms of breast cancer. for ~50,000 mortalities every year (2). Despite major advances The sample GSE9574 series was downloaded, and the micro- in surgical and nonsurgical management of the disease, breast array data was analyzed to identify differentially expressed cancer metastasis remains a significant clinical challenge genes (DEGs). Gene Ontology (GO) cluster analysis using affecting numerous of patients (3). The prognosis and survival the GO Enrichment Analysis Software Toolkit platform and rates for breast cancer are highly variable, and depend on Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway the cancer type, treatment strategy, stage of the disease and analysis for DEGs was conducted using the Gene Set Analysis geographical location of the patient (4). Toolkit V2. In addition, a protein-protein interaction (PPI) Microarray technology, which may be used to simultane- network was constructed, and target sites of potential transcrip- ously interrogate 10,000-40,000 genes, has provided new tion factors and potential microRNA (miRNA) molecules were insight into the molecular classification of different cancer screened.
    [Show full text]