sign in sign up
<<
Home , Tryptophan synthase

US007833761 B2

(12) United States Patent (10) Patent No.: US 7,833,761 B2 Terashita et al. (45) Date of Patent: Nov. 16, 2010

(54) PRODUCING 2007/0212764 A1 9/2007 Ptitsyn et al. MCROORGANISMAND AMETHOD FOR 2007/0249017 A1 10/2007 USuda et al. PRODUCING ANAMINOACD (75) Inventors: Masaru Terashita, Kawasaki (JP); FOREIGN PATENT DOCUMENTS Yoshihiro Usuda, Kawasaki (JP); EP 1253, 195 A1 10/2002 Kazuhiko Matsui, Kawasaki (JP) EP 1715 055 A2 10/2006 EP 1715 055 A3 10, 2006 (73) Assignee: Ajinomoto Co., Inc., Tokyo (JP) EP 1715 056 A1 10/2006 JP 2001-136991 A 5, 2001 (*) Notice: Subject to any disclaimer, the term of this WO WOO2, 14522 A1 2, 2002 patent is extended or adjusted under 35 WO WOO2,22829 A2 3, 2002 U.S.C. 154(b) by 0 days. WO WO2006,135075 A1 12/2006 WO WO2007/O13695 A1 2, 2007 (21) Appl. No.: 12/202,476 WO WO2007/039532 A2 4/2007 WO WO2007/039532 A3 4/2007 (22) Filed: Sep. 2, 2008 WO WO2007/100009 A1 9, 2007 (65) Prior Publication Data WO WO2007.136133 A1 11, 2007 WO WO2008.002053 A1 1, 2008 US 2009/OO68712 A1 Mar. 12, 2009 WO WO2008/O 10565 A2 1, 2008 WO WO2008/032757 A1 3, 2008 (30) Foreign Application Priority Data WO WO2008/072761 A2 6, 2008 Sep. 4, 2007 (JP) ...... 2007-228733 WO WO2008/081959 A1 T 2008 WO WO2008, 102861 A1 8, 2008 (51) Int. Cl. WO WO2008/107.277 A1 9, 2008 CI2PI3/04 (2006.01) CI2PI3/06 (2006.01) CI2P 13/08 (2006.01) OTHER PUBLICATIONS CI2P 13/22 (2006.01) Blaschkowski, H. P. et al., “Routes of Flavodoxin and Ferredoxin (52) U.S. Cl...... 435/106; 435/115; 435/108; Reduction in Escherichia coli CoA-Acylating Pyruvate: Flavodoxin 435/116:435/189 and NADPH: Flavodoxin Participating in the Acti (58) Field of Classification Search ...... None vation of Pyruvate Formate-.” Eur, J. Chem. 1982:123:563 See application file for complete search history. 569. Ferredoxin beta subunit Methanococcus (56) References Cited maripaludis S2. online, GenBank, Jan. 18, 2006, accession:NP 988624. U.S. PATENT DOCUMENTS Hypothetical protein, MMP1502 Methanococcus maripaludis S2). 5,661,012 A 8, 1997 Sano et al. online, GenBank, Jan. 18, 2006, accession:NP 988622. 5,827,698 A 10, 1998 Kikuchi et al. Hypothetical protein, pyruvate oxidoreductase-associated 5,830,716 A 11/1998 Kojima et al. Methanococcus maripaludis S2)., online). GenBank, Jan. 18, 2006, 5,932,453 A 8, 1999 Kikuchi et al. accession:NP 988623. 6,040,160 A 3/2000 Kojima et al. Ikeda, T., et al., “Anabolic five subunit-type pyruvate:ferredoxin 6,911,332 B2 6, 2005 USuda et al. oxidoreductase from Hydrogenobacter thermophilus TK-6.” 7,026,149 B2 4/2006 USuda et al. Biochem. Biophys. Res. Commun. 2006:340:76-82. 7,029,893 B2 4/2006 USuda et al. 7,060,475 B2 6, 2006 USuda et al. (Continued) 7,090,998 B2 8/2006 Ishikawa et al. 7,192,748 B2 3/2007 USuda et al. Primary Examiner Rebecca E. Prouty 7,220,570 B2 5, 2007 USuda et al. (74) Attorney, Agent, or Firm—Shelly Guest Cermak; 7,306,933 B2 12/2007 Dien et al. Cermak Nakajima LLP 2002fO155556 A1 10, 2002 Imaizumi et al. 2002/0160461 A1 10, 2002 Nakai et al. (57) ABSTRACT 2004/02293.05 A1 11/2004 USuda et al. 2004/0229321 A1 11/2004 Savrasova et al. 2004/0265956 All 12/2004 Takikawa et al. A microorganism is provided which has an ability to produce 2005, 0181488 A1 8, 2005 Akhverdian et al. an L-amino acid such as L-lysine, L-, L-phenyla 2005/0214911 A1 9, 2005 Marchenko et al. lanine, L-valine, L-leucine, L-isoleucine and L-, and 2005/0233308 A1 10, 2005 Nishio et al. has been modified to increase the activity of pyruvate Syn 2006, OO19355 A1 1/2006 Ueda et al. thase or pyruvate:NADP' oxidoreductase. This microorgan 2006, OO19356 A1 1/2006 USuda et al. ism is cultured in a medium containing ethanol oran aliphatic 2006,003 0010 A1 2/2006 USuda et al. 2006, OO30011 A1 2/2006 USuda et al. acid as the carbon source to produce and accumulate the 2006, OO88919 A1 4/2006 Rybak et al. L-amino acid in the medium or cells, and the L-amino acid is 2006, O141586 A1 6/2006 Rybak et al. collected from the medium or the cells. 2006/0234356 A1 10, 2006 USuda et al. 2006/0234357 A1 10, 2006 USuda et al. 12 Claims, 1 Drawing Sheet US 7,833,761 B2 Page 2

OTHER PUBLICATIONS Pyruvate oxidoreductase () Subunit alpha Methanococcus maripaludis S2)., online). GenBank, Jan. 18, 2006, Indolepyruvate ferredoxin oxidoreductase Methanococcus accession:NP 988625. maripaludis S2)., online). GenBank, Jan. 18, 2006, accession:NP Pyruvate oxidoreductase (synthase) subunit delta Methanococcus 988627. http://www.genome.adjp/dbget-. maripaludis S2)., online). GenBank, Jan. 18, 2006, KEGG (Kyoto Encyclopedia of Genes and Genomes) Entry No. accession:NP 988626. b1378, bin/www bget?eco--1378. Reed, J. L., et al., “An expanded genome-scale model of Escherichia Lin, W., et al., “The importance of porE and porF in the anabolic coli K-I2 (i.JR904 GSM/GPR).” Genome Biology 2003:4:R54. pyruvate oxidoreductase of Methanococcus maripaludis.” Arch. Rotte, C., et al., “PyruvateL NADP+ Oxidoreductase from the Mitochondrion of Euglena gracilis and from the Apicomplexan Microbiol. 2004; 181:68-73. Cryptosporidium parvum: A Biochemical Relic Linking Pyruvate Lin, W. C., et al., “The anabolic pyruvate oxidoreductase from Metabolism in Mitochondriate and Amitochondriate .” Mol. Methanococcus maripaludis.” Arch. Microbiol. 2003; 179:444-456. Bio. Evol. 2001:18(5):710-720. Probable pyruvate-flavodoxin oxidoreductase., online), Jul. 10, International Search Report for PCT Patent App. No. PCT/JP2008/ 2007, accession: P52647, database PIR. 065834 (Oct. 7, 2008). Pyruvate flavodoxin/ferrodoxin oxidoreductase Chlorobium Mahadevan, R., et al., “Characterization of Metabolism in the Fe(III)- tepidum TLS., online. GenBank, Dec. 2, 2005, Reducing Organism Geobacter sulfurreducens by Constraint-Based accession:NP 6625 11. Modeling.” Applied Environmen. Microbiol. 2006:72(2): 1558-1568. U.S. Patent Nov. 16, 2010 US 7,833,761 B2

Fig. 1

22OKD-D 1- PNO 12OKD->

6OKD-> US 7,833,761 B2 1. 2 AMINO ACID PRODUCING serine (U.S. Pat. No. 5,618,716), a bacterium having MCROORGANISMAND AMETHOD FOR L-serine-producing ability and at least phosphoserine phos PRODUCING ANAMINOACD phatase activity, phosphoserine transaminase activity, or both, is enhanced, a bacterium deficient in L-serine decom This application claims priority under 35 U.S.C. S 119 to position ability (U.S. Pat. No. 6,037,154), a bacterium resis Japanese Patent Application No. 2007-228733, filed Sep. 4, tant to azaserine or B-(2-thienyl)-DL-alanine and having 2007, which is incorporated by reference. The Sequence List L-serine-producing ability (U.S. Pat. No. 6,258,573), and so ing in electronic format filed herewith is also hereby incor forth are known. porated by reference in its entirety (FileName: US-372 Se q List Copy 1: File Size: 210 KB: Date Created: Sep. 2, 10 SUMMARY OF THE INVENTION 2008). The present invention provides a bacterial strain which can TECHNICAL FIELD efficiently produce an L-amino acid. A method is also pro vided for efficiently producing an L-amino acid using such a The present invention relates to a microorganism which 15 strain. produces an L-amino acid and a method for producing an Conventional L-amino acid production is mainly based on L-amino acid. L-lysine and L-tryptophan are widely used as maintaining the supply of acetyl-CoA to the TCA cycle by feed additives, etc. L-phenylalanine is used as a raw material pyruvate using Sugar as the carbon Source. in the production of Sweeteners. L-valine, L-leucine, and However, since the reaction catalyzed by pyruvate dehydro L-isoleucine are used for amino acid infusions or Supple genase is accompanied by decarboxylation, one molecule of ments. L-serine is useful as a food additive and a raw material CO, is inevitably released. Therefore, in order to further in the production of cosmetics, etc. increase the productivity, it is necessary to decrease this decarboxylation. As a result, ethanol and aliphatic acids can BACKGROUND ART be used as the carbon source which provides acetyl-CoA. 25 Also, the enzymatic activity of pyruvate synthase can be Methods for production of a target Substance, Such as an increased. This catalyzes carbon dioxide fixation, or L-amino acid, by fermentation of a microorganism have been pyruvate:NADP oxidoreductase. Furthermore, L-amino reported. The microorganisms used for this purpose include acid production can be improved by increasing the enzymatic wild-type microorganisms (wild-type strain), auxotrophic activity of ferredoxin-NADP reductase, which reduces strains derived from wild-type strains, metabolic regulation 30 ferredoxin or flavodoxin from the oxidized proteins, and is mutant strains derived from wild-type strains which are resis required for the enzymatic activity of pyruvate synthase. tant to various drugs, strains which act as both auxotrophic Also, the ability to produce ferredoxin or flavodoxin can be and metabolic regulation mutants, and so forth. increased. In recent years, recombinant DNA techniques have been It is an aspect of the present invention to provide a micro used in the production of target Substances by fermentation. 35 organism which has an ability to produce an L-amino acid For example, it is well-known that L-amino acid productivity selected from the group consisting of L-lysine, L-tryptophan, of a microorganism can be improved by enhancing expres L-phenylalanine, L-Valine, L-leucine, L-isoleucine and sion of agene encoding an L-amino acid biosynthetic enzyme L-serine, and has been modified to increase the activity of or by enhancing uptake of a carbon Source to the L-amino acid pyruvate synthase or pyruvate:NADP" oxidoreductase. biosynthesis system. 40 It is a further aspect of the present invention to provide the For example, known methods include, for L-lysine, aforementioned microorganism, which is modified to enhancing expression of genes encoding such as increase the activity of pyruvate synthase. dihydrodipicolinate synthase, aspartokinase, dihydrodipi It is a further aspect of the present invention to provide the colinate reductase, diaminopimelate decarboxylase, and dia aforementioned microorganism, which is modified to rinopimelate dehydrogenase (U.S. Pat. No. 6,040,160), 45 increase the activity of pyruvate:NADP' oxidoreductase. reducing the activities of homoserine dehydrogenase and It is a further aspect of the present invention to provide the lysine decarboxylase (U.S. Pat. No. 5,827.698), reducing the aforementioned microorganism, wherein the activity of pyru activity of the malicenzyme (WO2005/010175), and so forth. vate synthase or pyruvate:NADP oxidoreductase is For L-tryptophan, desensitization to the feedback inhibi increased by a method selected from the group consisting of tion of phosphoglycerate dehydrogenase and anthranilate 50 synthase (U.S. Pat. No. 6,180.373), deletion of tryptophanase A) increasing expression of the gene encoding pyruvate (U.S. Pat. No. 4,371,614), and so forth are known. synthase or pyruvate:NADP' oxidoreductase, For L-phenylalanine, desensitization to the feedback inhi b) increasing translation of the gene, and bition of chorismate mutase-prephenate (U.S. c) combinations thereof. Pat. No. 5,354,672), deletion of chorismate mutase-prephen 55 It is a further aspect of the present invention to provide the ate dehydrogenase and tyrosine repressor (WO03/044191), aforementioned microorganism, wherein the activity of pyru and so forth are known. vate synthase or pyruvate:NADP oxidoreductase is For L-valine, a mutant strain requiring lipoic acid for its increased by increasing the copy number of the gene encod growth and/or which is deficient in H"-ATPase (U.S. Pat. No. ing pyruvate synthase or pyruvate:NADP oxidoreductase, or 5,888,783), and so forth are known. For L-leucine, desensi 60 by modifying an expression control sequence of the gene. tization to the feedback inhibition of isopropyl malate syn It is a further aspect of the present invention to provide the thase (U.S. Pat. No. 6,403,342) and so forth are known, and aforementioned microorganism, wherein pyruvate synthase for L-isoleucine, increasing the expression of genes encoding is selected from the group consisting of threonine deaminase and acetohydroxy acid synthase (U.S. (A) a polypeptide comprising the amino acid sequence Pat. No. 5,998,178), and so forth are known. 65 shown in SEQID NO: 2, For L-serine, a strain containing 3-phosphoglycerate dehy (B) a polypeptide comprising the amino acid sequence drogenase which is desensitized to feedback inhibition by shown in SEQ ID NO: 2, but which includes one or more US 7,833,761 B2 3 4 Substitutions, deletions, insertions, or additions of one or It is a further aspect of the present invention to provide the several amino acid residues, and having pyruvate synthase aforementioned microorganism, which is a coryneform bac activity, terium. (C) a polypeptide comprising the amino acid sequence It is a further aspect of the present invention to provide a shown in SEQID NO: 4, method for producing an L-amino acid comprising culturing (D) a polypeptide comprising the amino acid sequence the aforementioned microorganism in a medium to produce shown in SEQ ID NO: 4, but which includes one or more an L-amino acid selected from the group consisting of Substitutions, deletions, insertions, or additions of one or L-lysine, L-tryptophan, L-phenylalanine, L-valine, L-leu several amino acid residues and having pyruvate synthase cine, L-isoleucine, and L-serine, and collecting the L-amino activity. 10 acid from the medium or the microorganism. It is a further aspect of the present invention to provide the It is a further aspect of the present invention to provide the aforementioned microorganism, wherein the gene encoding aforementioned method, wherein the medium contains etha pyruvate synthase is selected from the group consisting of: nol or an aliphatic acid as the carbon source. (a) a DNA comprising the nucleotide sequence shown in SEQID NO: 1, 15 BRIEF DESCRIPTION OF THE DRAWINGS (b) a DNA which is able to hybridize with a sequence complementary to the nucleotide sequence shown in SEQID FIG. 1 is a photograph showing the result of Western blot NO: 1, or a probe which is prepared from the nucleotide ting showing expression of the pyruvate:NADP" oxidoreduc sequence, under stringent conditions, and encoding a tase (PNO) gene derived from Euglena gracilis. polypeptide having pyruvate synthase activity, Lane 1: Markers (c) a DNA comprising the nucleotide sequence shown in Lane 2: Crude enzyme extract obtained from SEQID NO:3, WC196AcadAAldc/pCABD2/pMW-Pthr (d) a DNA which is able to hybridize with a sequence Lane 3: Crude enzyme extract obtained from complementary to the nucleotide sequence shown in SEQID WC196AcadAAldc/pCABD2/pMW-Pthr-PNO. NO:3, or a probe which can be prepared from the nucleotide 25 sequence, under stringent conditions, and encoding a DESCRIPTION OF THE PREFERRED polypeptide having pyruvate synthase activity. EMBODIMENTS (8) The aforementioned microorganism, wherein NADP" oxidoreductase is selected from the group consisting of: Hereinafter, the present invention will be explained in 30 detail. (A) a polypeptide comprising the amino acid sequence <1> Microorganism shown in SEQID NO: 6, The microorganism has the ability to produced an L-amino (B) a polypeptide comprising the amino acid sequence acid, Such as L-lysine, L-tryptophan, L-phenylalanine, L-va shown in SEQ ID NO: 6, but which includes one or more line, L-leucine, L-isoleucine, and L-serine, and has been Substitutions, deletions, insertions or addition of one or sev 35 modified to increase an activity of pyruvate synthase orpyru eral amino acid residues and having pyruvate:NADP' oxi wate:NADP" oxidoreductase. doreductase activity. The “L-amino acid' means L-lysine, L-tryptophan, L-phe It is a further aspect of the present invention to provide the nylalanine, L-valine, L-leucine, L-isoleucine, and L-serine, aforementioned microorganism, wherein the gene encoding unless specifically mentioned otherwise. pyruvate:NADP oxidoreductase is selected from the group 40 The phrase “ability to produce an L-amino acid (L-amino consisting of: acid-producing ability)' refers to the ability to produce an (a) a DNA comprising the nucleotide sequence shown in L-amino acid and cause accumulation of the L-amino acid in SEQID NO: 5, the cells of the microorganism or into the medium to Such a (b) a DNA which is able to hybridize with a sequence degree that the L-amino acid can be collected from the cells or complementary to the nucleotide sequence shown in SEQID 45 medium when the microorganism is cultured in the medium. NO: 5, or a probe which can be prepared from the nucleotide One or more amino acids may be produced by the microor sequence, under stringent conditions, and encoding a ganism. The microorganism may inherently have the ability polypeptide having pyruvate:NADP' oxidoreductase activ to produce the L-amino acid, or the ability may be imparted ity. by modifying the microorganism using mutagenesis or It is a further aspect of the present invention to provide the 50 recombinant DNA techniques, or by introducing the gene aforementioned microorganism, which has been modified to described herein to the microorganism. increase the activity of ferredoxin-NADP reductase. The expression “activity of pyruvate synthase or pyruvate: It is a further aspect of the present invention to provide the NADP" oxidoreductase is increased' or “to increase the aforementioned microorganism, which has been modified to activity of pyruvate synthase orpyruvate:NADP" oxidoreduc improve the ability of said microorganism to produce ferre 55 tase' means that the activity of pyruvate synthase or pyruvate: doxin or flavodoxin. NADP' oxidoreductase increases in a microorganism which It is a further aspect of the present invention to provide the inherently has pyruvate synthase and/or pyruvate:NADP" aforementioned microorganism, which has been modified to oxidoreductase, or that the activity of pyruvate synthase or decrease activity. pyruvate:NADP oxidoreductase is imparted to a microor It is a further aspect of the present invention to provide the 60 ganism to which pyruvate synthase and pyruvate:NADP" aforementioned microorganism, which has been modified so oxidoreductase are not native. that it can aerobically assimilate ethanol. <1-1> Impairing the Ability to Produce an L-Amino Acid It is a further aspect of the present invention to provide the The microorganism can be obtained by modifying a parent aforementioned microorganism, wherein said microorgan strain which is able to produce an L-amino acid so that the ism is a bacterium belonging to a genus selected from the 65 activity of pyruvate synthase or pyruvate:NADP oxi group consisting of Escherichia, Enterobacter; Pantoea, doreductase, or both, is increased. The microorganism can Klebsiella and Serratia. also be obtained by modifying a parent strain to have US 7,833,761 B2 5 6 increased activity of pyruvate synthase or pyruvate:NADP' examples of the Klebsiella include Klebsiella plan oxidoreductase, and then imparting or enhancing the ability ticola. Specific examples include the following strains: to produce L-amino acids. Erwinia amylovora ATCC 15580 Methods for imparting the L-amino acid-producing ability Erwinia Carotovora ATCC 15713 to a microorganism, and microorganisms imparted with Klebsiella planticola AJ13399 (FERM BP-6600, Euro L-amino acid-producing ability, will be exemplified below, pean Patent Publication No. 955368) but the methods are not limited to these. Klebsiella planticola AJ13410 (FERM BP-6617, Euro Microorganisms belonging to Y-Proteobacteria Such as pean Patent Publication No. 955368). bacteria belonging to the genera Escherichia, Enterobacter; The coryneform bacteria are a group of microorganisms Pantoea, Klebsiella, Serratia, Erwinia, Salmonella, Mor 10 defined in Bergey’s Manual of Determinative Bacteriology, ganella, etc.; coryneform bacteria Such as bacteria belonging 8th Ed., p. 599, 1974, and include aerobic, Gram-positive, and to the genera Brevibacterium, Corynebacterium, and Micro nonacid-fastbacilli which are notable to sporulate, and which bacterium; and microorganisms belonging to the genera Ali were originally classified into the genus Brevibacterium, but cyclobacillus, Bacillus, and Saccharomyces can be used. are now recognized as being in the genus Corynebacterium Y-proteobacteria include those classified according to the 15 (Liebl, W. Ehrmann, M., Ludwig, W., and Schleifer, K. H., NCBI (National Center for Biotechnology Information) tax 1991, Int J. Syst. Bacteriol. 41:255-260). These bacteria also onomy database and can be used. include bacteria belonging to the genus Brevibacterium or Examples of Escherichia bacteria include Escherichia coli Microbacterium which are closely related to the genus and so forth. When Escherichia coli strains are bred by using Corynebacterium. genetic engineering techniques, the E. coli K12 strain and Specific examples of coryneform bacteria which are used derivatives thereof, the Escherichia coli MG 1655 strain to produce amino acids of the L-glutamic acid family include (ATCC 47076), and the W3110 strain (ATCC 27325) can be the following: used. The Escherichia coli K12 strain was isolated at Stanford Corynebacterium acetoacidophilum University in 1922. This strain is a lysogenic bacterium of Corynebacterium acetoglutamicum phage and has the F-factor. This strain is a highly versatile 25 Corynebacterium alkanolyticum strain from which genetic recombinants can be constructed Corynebacterium callunae by conjugation or the like. Furthermore, the genome Corynebacterium glutamnicum sequence of the Escherichia coli K12 strain has been deter Corynebacterium lilium (Corynebacterium glutarnicum) mined, and the genetic information can be used freely. The Corynebacterium melassecola Escherichia coli K12 strain and derivatives thereof are avail 30 Corynebacterium thermoaminogenes (Corynebacterium able from the American Type Culture Collection (ATCC, efficiens) Address: P.O. Box 1549, Manassas, Va. 20108, United States Corynebacterium herculis of America). Brevibacterium divaricatum (Corynebacterium In particular, Pantoea bacteria, Erwinia bacteria, and glutamicum) Enterobacter bacteria are classified as Y-proteobacteria, and 35 Brevibacterium flavum (Corynebacterium glutamicum) they are taxonomically very close to one another (J. Gen. Brevibacterium immariophilum Appl. Microbiol., 1997, 43, 355-361; Int J. Syst. Bacteriol., Brevibacterium lactofermentum (Corynebacterium 1997, 43, 1061-1067). In recent years, some bacteria belong glutamicum) ing to the genus Enterobacter were reclassified as Pantoea Brevibacterium roseum agglomerans, Pantoea dispersa, or the like, on the basis of 40 Brevibacterium saccharolyticum DNA-DNA hybridization experiments etc. (International Brevibacterium thiogenitalis Journal of Systematic Bacteriology, July 1989, 39:337-345). Brevibacterium ammoniagenes (Corynebacterium ammo Furthermore, Some bacteria belonging to the genus Erwinia niagenes) were reclassified as Pantoea ananas or Pantoea Stewartii Brevibacterium album (refer to Int. J. Syst. Bacteriol., 1993, 43:162-173). 45 Brevibacterium cerinum Examples of the Enterobacter bacteria include, but are not Microbacterium ammoniaphilum limited to, Enterobacter agglomerans, Enterobacter aero Specifically, the following strains can be mentioned: genes, and so forth. Specifically, the strains exemplified in Corynebacterium thermoaminogenes AJ12340 (FERM European Patent Publication No. 952221 can be used. A BP-1539) typical strain of the genus Enterobacter is the Enterobacter 50 Corynebacterium glutamicum ATCC 13032 agglomeranses ATCC 12287 strain. Brevibacterium flavum (Corynebacterium glutamicum) Typical strains of the Pantoea bacteria include, but are not ATCC 13826, ATCC 14067 limited to, Pantoea anamatis, Pantoea stewartii, Pantoea Brevibacterium lactofermentum (Corynebacterium agglomerans, and Pantoea citrea. Specific examples include glutamicum) ATCC 13665, ATCC 13869 the following Strains: 55 Brevibacterium ammoniagenes (Corynebacterium ammo Pantoea ananatis AJ13355 (FERM BP-6614, European niagenes) ATCC 6871 The bacterium may be able to assimilate ethanol. The bac Patent Publication No. 0952221) terium may inherently be able to assimilate ethanol, or the Pantoea ananatis AJ13356 (FERM BP-6615, European ability to assimilate ethanol may be imparted or increased Patent Publication No. 0952221) 60 recombinantly. Escherichia coli is known to have AdhE, Although these strains are described as Enterobacter which has activities of acetaldehyde dehydrogenase and alco agglomerans in European Patent Publication No. 0952221, holdehydrogenase, which are enzymes which can generate they are currently classified as Pantoea ananatis on the basis ethanol under anaerobic conditions, and catalyze the reac of nucleotide sequence analysis of the 16S rRNA etc., as tions described below. described above. 65 Acetyl-CoA+NADH--H=acetaldehyde--NAD+CoA Examples of the Erwinia bacteria include, but are not lim ited to, Erwinia amylovora and Erwinia carotovora, and Acetaldehyde--NADH--H'=ethanol--NAD" US 7,833,761 B2 7 8 Although Escherichia coli cannot assimilate ethanol under metabolic regulation mutation may be combined with the aerobic conditions, the mutation of AdhE results in Escheri methods of enhancing the biosynthesis enzymes. chia coli to be able to aerobically assimilate ethanol (Clark D. An auxotrophic mutant strain, L-amino acid analogue-re P., and Cronan, J. E. Jr., 1980, J. Bacteriol., 144:179-184: sistant strain, or metabolic regulation mutant Strain with the Membrillo-Hernandez, J. et al., 2000, J. Biol. Chem., 275: ability to produce an L-amino acid can be obtained by Sub 33869-33875). The specific mutation is that the glutamic acid jecting a parent strain or wild-type strain to conventional at position 569 in Escherichia coli AdhE is replaced with an mutatagenesis, such as exposure to X-rays or UV irradiation, amino acid other than glutamic acid and aspartic acid, such as or treatment with a mutagen such as N-methyl-N'-nitro-N- lysine (Glu568Lys or E568K). nitrosoguanidine, etc., then selecting those which exhibit The aforementioned AdhE mutant may further include the 10 autotrophy, analogue resistance, or a metabolic regulation following additional mutations: mutation and which also have the ability to produce an A) Replacement of the glutamic acid at position 560 with L-amino acid. another amino acid, Such as lysine, Moreover, L-amino acid-producing ability can also be B) Replacement of the phenylalanine at position 566 with imparted or enhanced by enhancing an enzymatic activity by another amino acid, 15 gene recombination. Examples of the method for enhancing C) Replacement of the glutamic acid at position 22, enzymatic activity include, for example, modifying the bac methionine at position 236, tyrosine at position 461, isoleu terium to increase expression of a gene encoding an enzyme cine at position 554, and alanine at position 786, with glycine, involved in the biosynthesis of an L-amino acid. Gene expres Valine, cysteine, serine, and valine, respectively, or sion can also be increased by introducing an amplification D) a combination of the aforementioned mutations. plasmid prepared by introducing a DNA fragment containing It is known that Corynebacterium glutamicum has two or the gene into an appropriate plasmid, for example, a plasmid more kinds of alcohol , and can aerobically vector containing at least a gene responsible for replication assimilate ethanol (Pelechova J. Smekal F. Koura V. Plachy J and proliferation of the plasmid in the microorganism, and Krumphanzl V, 1980, Folia Microbiol (Praha) 25:341 increasing the copy number of the gene on the chromosome 346). 25 by conjugation, transfer or the like, or introducing a mutation The bacterium may be able to assimilate fat, oil, or an into the promoter region of the gene (refer to International aliphatic acid. The bacterium may inherently be able to Patent Publication WO95/34672). assimilate fat, oil, or aliphatic acids, or the ability can be When a target gene is introduced into the aforementioned imparted or increased recombinantly. Escherichia coli is amplification plasmid or chromosome, any promoter may be known to be able to assimilate long chain aliphatic acids 30 used to express the gene so long as the chosen promoter having a length of 12 or longer (Clark D. P. and Cronan J. E., functions in the L-amino acid-producing bacterium. The pro 1996. In Escherichia coli and Salmonella: Cellular and moter may be inherent to the gene, or may be a modified form. Molecular Biology/Second Edition (Neidhardt, F. C. Ed.) pp. Expression of the gene can also be controlled by suitably 343-357). Furthermore, Escherichia coli strains which were choosing a promoter that potently functions in the L-amino mutated to assimilate short- to medium-chain aliphatic acids 35 acid-producing bacterium, or by approximating the -35 and are known (Nunn, W. D. et al., 1979, J. Biol. Chem., 254: -10 regions of the promoter close to the consensus sequence. 9130-9134; Salanitro, J. P. and Wegener, W. S., 1971, J. The methods for enhancing expression of genes encoding the Bacteriol., 108:885-892). target enzymes are described in WOO4/18935, European A bacterium which is able to produce an L-amino acid Patent Publication No. 1010755, and so forth. means that the bacterium can produce and cause accumula 40 Examples of methods for imparting L-amino acid-produc tion of an L-amino acid in the medium in Such an amount that ing ability to a bacterium and bacteria imparted with an the L-amino acid can be collected from the medium when the L-amino acid-producing ability will be described below. bacterium is cultured in the medium. The target L-amino acid L-Lysine-Producing Bacteria can accumulate in the medium in an amount not less than 0.5 Examples of L-lysine-producing Escherichia bacteria g/L, more preferably not less than 1.0 g/L. The “L-amino 45 include mutants which are resistant to L-lysine analogues. acid encompasses L-lysine, L-tryptophan, L-phenylalanine, L-lysine analogues inhibit growth of the bacteria, but this L-valine, L-leucine, L-isoleucine, and L-serine. L-Lysine and inhibition is fully or partially desensitized when L-lysine is L-tryptophan are especially preferred. present in the medium. Examples of the L-lysine analogues Hereinafter, methods for imparting an L-amino acid-pro include, but are not limited to, oxalysine, lysine hydroxamate, ducing ability to such bacteria as mentioned above, or meth 50 S-(2-aminoethyl)-L-cysteine (AEC), Y-methyllysine, C.-chlo ods for enhancing an L-amino acid-producing ability of Such rocaprolactam, and so forth Mutants which are resistant to bacteria as described above, are described. these lysine analogues can be obtained by Subjecting the To impart the ability to produce an L-amino acid, methods bacteria to a conventional artificial mutagenesis treatment. conventionally employed in the breeding of coryneform bac Specific examples of bacterial strains useful for producing teria or bacteria of the genus Escherichia (see “Amino Acid 55 L-lysine include Escherichia coli AJ1442 (FERM BP-1543, Fermentation”, Gakkai Shuppan Center (Ltd.), 1st Edition, NRRL B-12185; see U.S. Pat. No. 4.346,170) and Escheri published May 30, 1986, pp. 77-100) can be used. Such chia coli VL611. In these microorganisms, feedback inhibi methods include by acquiring the properties of an aux tion of aspartokinase by L-lysine is desensitized. otrophic mutant, an analogue-resistant strain, or a metabolic The WC196 strain is an L-lysine-producing Escherichia regulation mutant, or by constructing a recombinant strain so 60 coli bacterium. This bacterial strain was bred by conferring that it overexpresses an L-amino acid biosynthesis enzyme. AEC resistance to the W3110 strain, which was derived from Here, in the breeding of an L-amino acid-producing bacteria, Escherichia coli K-12. The resulting strain was designated one or more of the above described properties may be Escherichia coli AJ13069 and was deposited at the National imparted. The expression of L-amino acid biosynthesis Institute of Bioscience and Human-Technology, Agency of enzyme(s) can be enhanced alone or in combinations of two 65 Industrial Science and Technology (currently National Insti or more. Furthermore, the methods of imparting properties tute of Advanced Industrial Science and Technology, Interna Such as an auxotrophic mutation, analogue resistance, or tional Patent Organism Depositary, Tsukuba Central 6, 1-1, US 7,833,761 B2 10 Higashi 1-Chome, Tsukuba-shi, Ibaraki-ken, 305-8566, the genus Escherichia, such as E. coli JP4735/pMU3028 Japan) on Dec. 6, 1994 and received an accession number of (DSM10122) and JP6015/pMU91 (DSM10123), which is FERM P-14690. Then, it was converted to an international deficient in tryptophanyl-tRNA synthetase encoded by a deposit under the provisions of the Budapest Treaty on Sep. mutant trpS gene (U.S. Pat. No. 5,756,345); E. coli SV164 29, 1995, and received an accession number of FERM 5 (p.GH5) having a serA allele encoding phosphoglycerate BP-5252 (U.S. Pat. No. 5,827,698). dehydrogenase not subject to feedback inhibition by serine Examples of L-lysine-producing bacteria and parent and a trpE allele encoding anthranilate synthase not subject to strains which can be used to derive L-lysine-producing bac feedback inhibition by tryptophan (U.S. Pat. No. 6,180.373); teria also include strains in which expression is increased of E. coli AGX17 (pGX44) (NRRL B-12263) and AGX6 one or more genes encoding an L-lysine biosynthetic enzyme. 10 (pGX50) aroP(NRRLB-12264) deficient in the enzymetryp Examples of Such enzymes include, but are not limited to, tophanase (U.S. Pat. No. 4,371,614); E. coli AGX17/pGX50, dihydrodipicolinate synthase (dapA), aspartonase (lysC), pACKG4-pps with enhanced phosphoenolpyruvate-produc dihydrodipicolinate reductase (dapB), diaminopimelate ing ability (WO97/08333, U.S. Pat. No. 6,319,696), and so decarboxylase (lySA), diaminopimelate dehydrogenase (ddh) forth. L-tryptophan-producing Escherichia bacteria with (U.S. Pat. No. 6,040,160), phosphoenolpyrvate carboxylase 15 enhanced activity of the protein encoded by the yedAoryddG (ppc), aspartate semialdehyde dehydrogenease (asd), diami genes may also be used (U.S. Published Patent Applications nopimelate epimerase (dapF), tetrahydrodipicolinate Succi 2003/0148473 A1 and 2003/0157667 A1). nylase (dapD), Succinyl diaminopimelate deacylase (dapE), Examples of L-tryptophan-producing bacteria and parent and asparlase (asp A) (EP 1253.195 A). The abbreviations in strains which can be used to derive L-tryptophan-producing parentheses are the gene names which correspond to the bacteria also include strains with enhanced activity of one or enzymes, and this convention is used throughout this speci more enzymes such as anthranilate synthase (trpE), phospho fication. Dihydrodipicolinate reductase, diaminopimelate glycerate dehydrogenase (serA), 3-deoxy-D-arabinoheptu decarboxylase, diaminopimelate dehydrogenase, phospho losonate-7-phosphate syntaase (aroG), 3-dehydroquinate enolpyrvate carboxylase, aspartate aminotransferase, diami synthase (aroB), shikimate dehydrogenase (aroE), shikimate nopimelate epimerase, aspartate semialdehyde dehydroge 25 kinase (aroL), 5-enolpyruvylshikimate-3-phosphate Syn nase, tetrahydrodipicolinate Succinylase, and Succinyl thase (aroA), (aroC), prephenate dehy diaminopimelate deacylase are especially preferred. In addi dratase, chorismate mutase, and tryptophan synthase (tr tion, the chosen parent strains may overexpress the cyogene, pAB). and chorismate mutase are which is involved in energy efficiency (EP 1170376 A), the encoded by the phe A gene as a bifunctional enzyme (CM gene encoding nicotinamide nucleotide transhydrogenase 30 PD). Phosphoglycerate dehydrogenase, 3-deoxy-D-arabino (pntAB) (U.S. Pat. No. 5,830,716), theyb Egene (WO2005/ heptuloSonate-7-phosphate synthase, 3-dehydroquinate Syn 073390), or combinations thereof. thase, shikimate dehydratase, shikimate kinase, Examples of L-lysine-producing bacteria and parent 5-enolpyruvylshikimate-3-phosphate synthase, chorismate strains which can be used to derive L-lysine-producing bac synthase, prephenate dehydratase, chorismate mutase teria also include strains with decreased or no activity of an 35 prephenate dehydratase are especially preferred. The anthra enzyme that catalyzes a reaction which produces a compound nilate synthase and phosphoglycerate dehydrogenase are other than L-lysine via a biosynthetic pathway which both subject to feedback inhibition by L-tryptophan and branches off from the biosynthetic pathway of L-lysine. L-serine, and therefore a mutation desensitizing the feedback Examples of these enzymes include homoserine dehydroge inhibition may be introduced into these enzymes. Specific nase, lysine decarboxylase (U.S. Pat. No. 5,827.698), and the 40 examples of Strains having Such a mutation include E. coli malic enzyme (WO2005/010175). SV164 which harbors desensitized anthranilate synthase, and Preferred examples of L-lysine-producing bacteria include a transformant strain obtained by introducing pGH5 (WO Escherichia coli WC196Amez/pCABD2 (WO2005/010175), 94/08031) into E. coli SV164, which contains a mutant serA WC196AcadAAldc/pCABD2 (WO2006/078039), and so gene encoding feedback inhibition-desensitized phospho forth. The WC196Amez/pCABD2 strain is obtained by intro 45 glycerate dehydrogenase. ducing the plasmid pCABD2, which is disclosed in U.S. Pat. Examples of L-tryptophan-producing bacteria and parent No. 6,040,160, into the WC196 strain with disrupted SfcA and strains which can be used to derive L-tryptophan-producing b2463 genes, which encode the malic enzyme. The nucle bacteria also include strains transformed with the tryptophan otide sequences of the SfcA and b2463 genes and the amino operon which contains a gene encoding desensitized anthra acid sequences encoded by these genes are shown in SEQID 50 nilate synthase (JP 57-71397 A, JP 62-244382 A, U.S. Pat. NOS 52 to 55. No. 4,371,614). Moreover, L-tryptophan-producing ability The WC196AcadAAldc/pCABD2 strain is obtained by may be imparted by enhancing the expression of the gene introducing the plasmid pCABD2, which is disclosed in U.S. which encodes tryptophan synthase, which is part of the Pat. No. 6,040,160, into a WC196 strain with disrupted cadA tryptophan operon (trpBA). The tryptophan synthase consists and lacC genes, which encode lysine decarboxylase. The 55 of Cand B subunits which are encoded by trp A and trpB. pCABD2 plasmid contains a mutant Escherichia coli dap A respectively. In addition, L-tryptophan-producing ability gene encoding a dihydrodipicolinate synthase (DDPS) which may be improved by enhancing expression of the isocitrate is desensitized to feedback inhibition by L-lysine, a mutant lyase-malate synthase operon (WO2005/103275). Escherichia colily SC gene which encodes aspartokinase III L-Phenylalanine-Producing Bacteria which is desensitized to feedback inhibition by L-lysine, the 60 Examples of L-phenylalanine-producing bacteria and par Escherichia coli dapB gene encoding dihydrodipicolinate ent Strains which can be used to derive L-phenylalanine reductase, and the Brevibacterium lactoformentum dah gene producing bacteria include, but are not limited to, strains encoding diaminopimelate dehydrogenase. belonging to the genus Escherichia, such as E. coli AJ12739 L-Tryptophan-Producing Bacteria (tyrA:Tn 10, tyrR) (VKPMB-8197) (WO03/044191), E. coli Examples of L-tryptophan-producing bacteria and parent 65 HW1089 (ATCC 55371) harboring the phea34 gene encod strains which can be used to derive L-tryptophan-producing ing chorismate mutase-prephenate dehydratase desensitized bacteria include, but are not limited to, Strains belonging to to the feedback inhibition (U.S. Pat. No. 5,354,672), E. coli US 7,833,761 B2 11 12 MWEC101-b (KR8903681), E. coli NRRL B-12141, NRRL hydroxamate (JP 5-1308.82 A). In addition, recombinant B-12145, NRRL B-12146, and NRRL B-12147 (U.S. Pat. strains transformed with genes encoding proteins involved in No. 4,407,952). Also, as a parent strain, E. coli K-12 W3110 L-isoleucine biosynthesis, Such as threonine deaminase and (tyrA)/pPHAB (FERM BP-3566) having a gene encoding acetohydroxy acid synthase, can also be used as parent strains chorismate mutase-prephenate dehydratase desensitized to (JP 2-458A, FR 0356739, and U.S. Pat. No. 5,998,178). feedback inhibition, E. coli K-12 W3110 (tyrA)/pPHAD L-Serine-Producing Bacteria (FERM BP-12659), E. coli K-12 W3110 (tyrA)/pPHATerm Examples of L-serine-producing bacteria and parent (FERM BP-12662) and E. coli K-12 W3110 (tyrA)/pBR strains which can be used to derive L-serine-producing bac aroG4, p.ACMAB), also called AJ12604 (FERM BP-3579) teria include Escherichia coli which are desensitized to feed may be used (EP 488-424 B1). Furthermore, L-phenylala 10 back inhibition of 3-phosphoglycerate dehydrogenase by nine-producing Escherichia bacteria with enhanced activity serine (Japanese Patent No. 2584409, U.S. Pat. No. 5,618, of the protein encoded by the yedA or yddG genes may also 716). Moreover, coryneform bacteria which are able to pro be used (U.S. Published Patent Applications 2003/0148473 duce L-serine and have increased activity of at least one of A1 and 2003/0157667 A1, WO03/044192). phosphoserine phosphatase and phosphoserine transaminase, L-Valine-Producing Bacteria 15 coryneform bacteria which cannot decompose L-serine (JP Examples of L-valine-producing bacteria and parent 11-253.187 A, U.S. Pat. No. 6,037,154), and coryneform bac strains which can be used to derive L-valine-producing bac teria which is resistant to azaserine or B-(2-thienyl)-DL-ala teria include, but are not limited to, strains which have been nine and is able to produce L-serine (JP 11-266881 A, U.S. modified to overexpress the ilvGMEDA operon (U.S. Pat. Pat. No. 6.258,573) can also be used. No. 5,998,178). The region in the ilvGMEDA operon which When the aforementioned L-amino acid-producing bacte is required for attenuation can be removed so that expression ria are bred by gene recombination, the chosen genes are not of the operon is not attenuated by the L-valine that is pro limited to genes having the genetic information described duced. Furthermore, the ilvA gene in the operon can be dis above or genes having known sequences, but genes having rupted so that threonine deaminase activity is decreased. conservative mutations such as homologues or artificially Examples of L-valine-producing bacteria and parent 25 modified genes can also be used, so long as the functions of strains which can be used to derive L-valine-producing bac the encoded proteins are not degraded. That is, the chosen teria also include strains with amino-acyl t-RNA synthetase genes may encode a known amino acid sequence including mutants (U.S. Pat. No. 5,658,766). For example, E. coli substitution, deletion, insertion, addition or the like of one or VL 1970, which has a mutation in the ileS gene, which several amino acid residues at one or several positions. As for encodes isoleucine tRNA synthetase, can be used. E. coli 30 the “conservative mutation', the descriptions concerning VL 1970 was deposited at the Russian National Collection of pyruvate synthase etc. described below are also applied to the Industrial Microorganisms (VKPM) (1 Dorozhny proezd., 1 aforementioned genes. Moscow 117545, Russia) on Jun. 24, 1988 under accession <1-2> Enhancement of Pyruvate Synthase or pyruvate: number VKPMB-4411. NADP" Oxidoreductase Activity Furthermore, mutants requiring lipoic acid for growth and/ 35 The microorganism having an L-amino acid-producing or lacking H-ATPase can also be used as parent strains ability is modified so that an activity of pyruvate synthase or (WO96/06926, U.S. Pat. No. 5,888,783). pyruvate:NADP oxidoreductase is increased. The activity of L-Leucine-Producing Bacteria the pyruvate synthase orpyruvate:NADP oxidoreductase Examples of L-leucine-producing bacteria and parent activity is increased so that it is higher as compared to that of strains which can be used to derive L-leucine-producing bac 40 the parent strain, for example, a wild-type strain or a non teria include, but are not limited to, strains belonging to the modified strain. In addition, this is true when the pyruvate genus Escherichia. Such as E. coli strains resistant to leucine synthase activity is not native to the microorganism, for (for example, the strain 57 (VKPM B-7386, U.S. Pat. No. example, the pyruvate synthase or pyruvate:NADP' oxi 6,124,121)) or leucine analogues including B-2-thienylala doreductase activity of the microorganism, which has been nine, 3-hydroxyleucine, 4-azaleucine and 5.5.5-trifluoroleu 45 modified to have that enzymatic activity, is increased as com cine (JP 62-34397 B and JP 8-70879 A); E. coli strains pared with a non-modified strain. obtained by the genetic engineering method described in The bacterium may be modified first to increase the enzy WO96/06926; and E. coli H-9068 (JP 8-70879 A). matic activity of pyruvate synthase orpyruvate:NADP oxi The bacterium may be improved by enhancing the expres doreductase, and then imparted with an L-amino acid-pro sion of one or more genes which encode proteins involved in 50 ducing ability. In addition, the activity of pyruvate synthase L-leucine biosynthesis. Examples of Such genes include orpyruvate:NADP" oxidoreductase can be increased by genes of the leu ABCD operon, Such as a mutant leuA gene increasing the expression of a gene as described above. That encoding isopropylmalate synthase which is not subject to is, enzyme activity may be increased by increasing expres feedback inhibition by L-leucine (U.S. Pat. No. 6,403,342). sion of the endogenous pyruvate synthase or pyruvate: In addition, the bacterium may be improved by enhancing the 55 NADP' oxidoreductase genes by modifying the expression expression of one or more genes encoding proteins which control regions such as the promoter or the like, or by enhanc promote secretion of L-amino acids from the bacterial cell. ing expression of an exogenous pyruvate synthase gene or Examples of such genes include b2682 and b2683 (ygaZH pyruvate:NADP oxidoreductase gene by introducing a plas genes) (EP 1239041 A2). mid containing the pyruvate synthase or pyruvate:NADP" L-Isoleucine-Producing Bacteria 60 oxidoreductase gene into the bacterium, introducing these Examples of L-isoleucine-producing bacteria and parent genes into the chromosome of the bacterium, or the like. strains which can be used to derive L-isoleucine-producing Pyruvate synthase catalyzes the following reaction, which bacteria include, but are not limited to, mutants having resis generates pyruvic acid from acetyl-CoA and CO in the pres tance to 6-dimethylaminopurine (JP 5-304969 A), mutants ence of an electron donor Such as ferredoxin and flavodoxin having resistance to an isoleucine analogue Such as thiaiso 65 (EC 1.2.7.1). Pyruvate synthase may be abbreviated as “PS', leucine and isoleucine hydroxamate, and mutants addition and may be also be called pyruvate oxidoreductase, pyruvate ally having resistance to DL-ethionine and/or arginine ferredoxin oxidoreductase, pyruvate flavodoxin oxidoreduc US 7,833,761 B2 13 14 tase, or pyruvate oxidoreductase. As the electron donor, ferre The Escherichia coli ydbK gene (b1378), which is shown doxin or flavodoxin can be used. in SEQ ID NO: 3, is located at nucleotide numbers from Reduced ferredoxin--acetyl-CoA--CO-oxidized ferre 1435284 to 1438808 in the genome sequence of the K-12 doxin-pyruvic acid--CoA strain (GenBank Accession No. U00096). This gene is pre Enhancement of the pyruvate synthase activity can be con dicted to encode pyruvate flavodoxin oxidoreductase, that is, firmed by preparing crude enzyme solutions and measuring pyruvate synthase, on the basis of homology of the sequences. the pyruvate synthase activity in both the microorganism The amino acid sequence encoded by this gene is shown in before making the modification to enhance activity, and after SEQ ID NO: 4 (GenBank Accession No. AAC76906). As making the modification. The activity of pyruvate synthase demonstrated in the example section, it was verified that this can be measured by, for example, the method of Yoon et al. 10 gene product has pyruvate synthase activity, and enhancing (Yoon, K. S. Ishii, M., Kodama, T., and Igarashi, Y. 1997. expression of this gene improves the ability to produce an Arch. Microbiol. 167:275-279, 1997). For example, pyruvic L-amino acid. acid is added to a reaction mixture containing oxidized meth Pyruvate:NADP oxidoreductase catalyzes the following ylviologen which acts as an electron acceptor, CoA, and reaction, which generates pyruvic acid from acetyl CoA and crude enzyme solution, and spectroscopically measuring the 15 CO, in the presence of an electron donor such as NADPH or amount of reduced methylviologen, which increases due to NADH (EC 1.2.1.15). Pyruvate:NADP" oxidoreductase may the decarboxylation of pyruvic acid. One unit (U) of the be abbreviated as “PNO, and may also be called pyruvate enzymatic activity is defined as the activity of reducing 1 dehydrogenase. However, pyruvate dehydrogenase activity is umol of methylviologen per 1 minute. When the parent strain the activity of catalyzing the oxidative decarboxylation of has pyruvate synthase activity, the activity desirably pyruvic acid to generate acetyl-CoA, as described later, and increases, for example, preferably 1.5 times or more, more pyruvate dehydrogenase (PDH) which catalyses this reaction preferably 2 times or more, still more preferably 3 times or is different from pyruvate:NADP oxidoreductase. Pyruvate: more, compared with that of the parent strain. When the NADP oxidoreductase can use NADPH or NADH as the parent strain does not have pyruvate synthase activity, electron donor. although it is sufficient that pyruvate synthase is produced by 25 NADPH+acetyl-CoA+CONADP+pyruvic acid+CoA the introduction of the pyruvate synthase gene, the activity is Enhancement of the pyruvate:NADP oxidoreductase preferably enhanced to Such an extent that the enzymatic activity can be confirmed by preparing crude enzyme solu activity can be measured, and the activity is preferably 0.001 tions and measuring the pyruvate:NADP" oxidoreductase U/mg (cell protein) or higher, more preferably 0.005 U/mg or activity in both the microorganism before making the modi higher, still more preferably 0.01 U/mg or higher. Pyruvate 30 fication to enhance activity, and after making the modifica synthase is sensitive to oxygen, and activity expression and tion. The activity of pyruvate:NADP oxidoreductase can be measurement are often generally difficult (Buckel, W. and measured by, for example, the method of Inui et al. (Inui, H., Golding, B. T., 2006, Ann. Rev. of Microbiol. 60:2749). Ono, K., Miyatake, K, Nakano, Y., and Kitaoka, S., 1987, J. Therefore, as described in the examples, the enzymatic activ Biol. Chem., 262:9130-9135). For example, pyruvic acid is ity is measured preferably under reduced oxygen concentra 35 added to a reaction mixture containing oxidized methylviolo tion in the reaction vessel. gen which acts as an electron acceptor, CoA, and crude The gene encoding pyruvate synthase may be derived enzyme solution, and spectroscopically measuring the from, or native to, bacteria with the reductive TCA cycle, and amount of reduced methylviologen, which increases due to includes pyruvate synthase genes from Chlorobium tepidum the decarboxylation of pyruvic acid. One unit (U) of the and Hydrogenobacter thermophilus. 40 enzymatic activity is defined as the activity of reducing 1 Specific examples include the pyruvate synthase gene hav umol of methylviologen per 1 minute. When the parent strain ing the nucleotide sequence located at nucleotide numbers has pyruvate:NADP oxidoreductase activity, the activity from 1534432 to 1537989 of the genome sequence of Chlo increases, for example, preferably 1.5 times or more, more robium tepidum (Genbank Accession No. NC 002932) and preferably 2 times or more, still more preferably 3 times or shown in SEQID NO: 1. The amino acid sequence encoded 45 more, as compared to that of the parent strain. When the by this gene is shown in SEQID NO: 2 (Genbank Accession parent strain does not have pyruvate:NADP" oxidoreductase No. AAC76906). Furthermore, the pyruvate synthase from activity, although it is sufficient that pyruvate:NADP' oxi Hydrogenobacter thermophilus forms a complex of four Sub doreductase is produced by the introduction of the pyruvate: units, the 6-subunit (Genbank Accession No. BAA95604), NADP' oxidoreductase gene, the activity is preferably C.-subunit (Genbank Accession No. BAA95605), B-subunit 50 enhanced to such an extent that the enzymatic activity can be (Genbank Accession No. BAA95606), and Y-subunit (Gen measured, and the activity is preferably 0.001 U/mg (cell bank Accession No. BAA95607) (Ikeda, T. Ochiai, T., protein) or higher, more preferably 0.005 U/mg or higher, still Morita, S., Nishiyama, A., Yamada, E., Arai, H., Ishii, M. and more preferably 0.01 U/mg or higher. Pyruvate:NADP" oxi Igarashi, Y. 2006, Biochem. Biophys. Res. Commun., 340: doreductase is sensitive to oxygen, and activity expression 76-82). The pyruvate synthase gene may also include the four 55 and measurement are often generally difficult (Inui, H., Ono, genes HP108, HP109, HP1110, and HP1111, located at K. Miyatake, K, Nakano, Y., and Kitaoka, S., 1987, J. Biol. nucleotide numbers from 1170138 to 1173296 in the genome Chem., 262:9130-9135; Rotte, C., Stejskal, F. Zhu, G., Kei sequence of Helicobacter pylori (GenBank Accession No. thly, J. S., and Martin, W., 2001, Mol. Biol. Evol., 18:710 NC000915), and the pyruvate synthase gene encoded by the 720). When the activity cannot be measured due to inactiva four genes SSO1208, SSO7412, SSO1207, and SSO1206, 60 tion or the like, it is still possible to confirm expression of the identified by nucleotide numbers from 1047593 to 1044711 protein by Western blotting or the like, as described in the in the genome sequence of Sulfolobus solfataricus (GenBank examples section. Accession No. NC 002754). Furthermore, the pyruvate syn The gene encoding pyruvate:NADP oxidoreductase may thase gene may be cloned from Chlorobium, Desulfobacter, be derived from, or native to, Euglena gracilis, which is a Aquifex, Hydrogenobacter. Thermoproteus, Pyrobaculum 65 photosynthetic eukaryotic microorganism and is also classi bacteria, or the like on the basis of homology to the genes fied into protozoans (Nakazawa, M., Inui, H. Yamaji R. exemplified above. Yamamoto, T., Takenaka, S., Ueda, M., Nakano, Y., US 7,833,761 B2 15 16 Miyatake, K, 2000, FEBS Let, 479:155-156), and the Haggard-Ljungquist, E. 1993, 175:1590-1595). Moreover, it Cryptosporidium parvum (Rotte, C., Steiskal, F. Zhu, G., is known that, in Pseudomonasputida, the NADPH-putidare Keithly, J.S., and Martin, W., 2001, Mol. Biol. Evol., 18:710 doxin reductase gene and the putidaredoxin gene are present 720). Furthermore, it is known that a homologous gene also as an operon (Koga, H., Yamaguchi, E., Matsunaga, K, Ara exists in Tharassiosira pseudonana which belongs to Bacil maki, H., and Horiuchi, T. 19089, J. Biochem. (Tokyo), 106: lariophyta (Ctrnacta, V., Ault, J. G., Steiskal, F., and Keithly, 831-836). J. S., 2006, J. Eukaryot Microbiol., 53:225-231). The flavodoxin NADP" reductase gene from Escherichia Specifically, the pyruvate:NADP oxidoreductase gene coli (fpr gene) is located at nucleotide numbers from 4111749 from Euglena gracilis has the nucleotide sequence shown in to 4112495 (complementary strand) in the genome sequence SEQ ID NO: 5 (GenBank Accession No. AB021127). The 10 of the Escherichia coli K-12 strain (Genbank Accession No. amino acid sequence encoded by this gene is shown in SEQ U00096) and is shown in SEQ ID NO: 7. The amino acid ID NO: 6 (GenBank Accession No. BAB12024). sequence of Fpr is shown in SEQID NO: 8 (Genbank Acces The microorganism may be modified so that the pyruvate sion No. AAC76906). Moreover, the ferredoxin NADP" synthase activity is increased by increasing the activity of reductase gene (Genbank Accession No. BAB99777) is recycling the oxidized electron donor to a reduced electron 15 found at the nucleotide numbers from 2526234 to 252721 1 of donor, which is requiled for pyruvate synthase activity, as the genome sequence of Corynebacterium glutamicum (Gen compared to a parent strain, for example, a wild-type strain or bank Accession No. BAO0036). a non-modified strain. An example of the activity for recy The pyruvate synthase activity requires the presence of cling the oxidized electron donor to a reduced electron donor ferredoxin or flavodoxin, which acts as an electron donor. is ferredoxin NADP" reductase activity. Furthermore, the Therefore, the microorganism may be modified so that the microorganism may be modified so that the activity of pyru activity of pyruvate synthase is increased by improving the vate synthase is increased, in addition to enhancing the elec production of ferredoxin or flavodoxin. tron donor recycling activity. The gene encoding the electron Moreover, the microorganism may also be modified to donor recycling activity may be native to the parent strain, or improve the production of ferredoxin or flavodoxin, in addi may be introduced into the parent strain to impart the activity, 25 tion to being modified to enhance pyruvate synthase activity and the ability to produce an L-amino acid is improved. alone, or enhance both the activities of flavodoxin NADP" The ferredoxin NADP reductase is an enzyme that revers reductase and pyruvate synthase. ibly catalyzes the following reaction (EC 1.18.1.2): “Ferredoxin refers to a protein containing nonheme iron Reduced ferredoxin-i-NADP-Oxidized ferredoxin-- atoms (Fe) and sulfur atoms bound with an iron-sulfur cluster NADPH-H 30 called 4Fe-4S, 3Fe-4S or 2Fe-2S, and which functions as a This reaction is reversible, and can generate the reduced one-electron carrier. “Flavodoxin refers to a protein contain ferredoxin in the presence NADPH and the oxidized ferre ing FMN (flavin-mononucleotide) as a prosthetic group and doxin. Ferredoxin can be replaced with flavodoxin, and the which functions as a one- or two-electron carrier. Ferredoxin enzyme is a functional equivalent to flavodoxin NADP' and flavodoxin are described in McLean et al. (McLean K.J., reductase. Ferredoxin NADP" reductase has been confirmed 35 Sabri, M., Marshall, K. R. Lawson, R. J., Lewis, D. G., Clift, to be present in a wide variety of organisms ranging from D., Balding, P. R., Dunford, A.J. Warman, A.J., McVey, J. P. microorganisms to higher organisms (refer to Canillo, N. and Quinn, A.M., Sutcliffe, M.J., Scrutton, N. S., and Munro, A. Ceccarelli, E. A., 2004, Eur. J. Biochem., 270: 1900-1915; W. 2005, Biochem. Soc. Trans., 33:796-801). Ceccarelli, E. A. Arakaki, A. K. Cortez, N., and Canillo, N. Ferredoxin or flavodoxin may be native to the parent strains 2004, Biochim. Biophys. Acta. 1698: 155-165), and it is also 40 which are used to derive the modified microorganism known as ferredoxin NADP" oxidoreductase or NADPH described herein, or a gene encoding ferredoxin or flavodoxin ferredoxin oxidoreductase. may be introduced into the parent Strains to impart the activity Enhancement of the ferredoxin NADP" reductase activity to produce ferredoxin or flavodoxin, and to improve can be confirmed by preparing crude enzyme solutions and L-glutamic producing ability. measuring the ferredoxin NADP" reductase activity in both 45 An improvement in the ability to produce ferredoxin or the microorganism before making the modification to flavodoxin as compared with the parent strain, such as a enhance activity, and after making the modification. The wild-type or non-modified strain, can be confirmed by, for activity of ferredoxin NADP reductase can be measured by, example, comparing the amount of mRNA for ferredoxin or for example, the method of Blaschkowski et al (Blasch flavodoxin with that in a wild-type strain or non-modified kowski, H. P. Neuer, G., Ludwig-Festl, M., and Knappe, J. 50 strain. The expression amount can be confirmed by, for 1989, Eur. J. Biochem., 123:563-569). For example, the activ example, Northern hybridization and RT-PCR (Sambrook J. ity can be measured by using ferredoxin as a Substrate to Fritsch, E. F., and Maniatis, T. 1989, Molecular Cloning A spectroscopically measure the decrease of the amount of Laboratory Manual/Second Edition, Cold Spring Harbor NADPH. One unit (U) of the enzymatic activity is defined as Laboratory Press, New York). The degree of the increase of the activity of oxidizing 1 umol of NADPH per 1 minute. 55 the expression is not particularly limited so long as it is When the parent strain has ferredoxin NADP" reductase increased compared with that of a wild-type strain or non activity, and the activity of the parent strain is sufficiently modified strain. However, it is increased, for example, 1.5 high, it is not necessary to enhance the activity. However, the times or more, preferably 2 times or more, more preferably 3 enzymatic activity is desirably increased preferably 1.5 times times or more, compared with that of a wild-type strain or or more, more preferably 2 times or more, still more prefer 60 non-modified Strain. ably 3 times or more, compared with that of the parent strain. Whether the ability to produce ferredoxin or flavodoxin is Genes encoding ferredoxin NADP" reductase are found in improved as compared with a parent strain, for example, a many biological species, and any that have activity in the wild-type strain or a non-modified Strain, can be detected by chosen L-amino acid producing strain can be used. In SDS-PAGE, two-dimensional electrophoresis, or Western Escherichia coli, the fpr gene has been identified as the gene 65 blotting using antibodies (Sambrook J. Fritsch, E. F., and encoding flavodoxin NADP reductase (Bianchi, V. Rei Maniatis, T. 1989, Molecular Cloning A Laboratory Manual/ chard, P., Eliasson, R, Pontis, E., Krook M., Jomvall, H., and Second Edition, Cold Spring Harbor Laboratory Press, New US 7,833,761 B2 17 18 York). The degree of improvement is not particularly limited ferredoxin I and ferredoxin II are shown in SEQID NOS: 18 So long as it is increased as compared with that of a wild-type and 20 (Genbank Accession Nos. AAM72491 and strain or non-modified strain. However, it is increased, for AAM72490, respectively). Examples further include the example, 1.5 times or more, preferably 2 times or more, more ferredoxin gene of Hydrogenobacter thermophilus (Genbank preferably 3 times or more, compared with that of a wild-type 5 Accession No. BAE02673) and the ferredoxin gene of Sul strain or non-modified strain. folobus solfataricus, which is present at nucleotide numbers The activities of ferredoxin and flavodoxin can be mea from 2345414 to 2345728 in the genome of Sulfolobus sol Sured by adding them to a suitable oxidation-reduction reac fataricus. Furthermore, the gene may be those cloned from tion system. For example, reducing ferredoxin with ferre Chlorobium, Desulfobacter, Aquifex, Hydrogenobacter, doxin NADP reductase and quantifying the reduction of 10 Thermoproteus, Pyrobaculum bacteria, or the like on the cytochrome C by the reduced ferredoxin is disclosed by basis of homology to the genes exemplified above, or those Boyer et al. (Boyer, M. E. et al., 2006, Biotechnol. Bioeng. cloned from Y-proteobacteria Such as those of the genus 94:128-138). Furthermore, the activity of flavodoxin can be Enterobacter, Klebsiella, Serratia, Erwinia, and Yersinia, measured by the same method, but using flavodoxin NADP" coryneform bacteria Such as Corynebacterium glutamicum reductase. 15 and Brevibacterium lactofermentum, Pseudomonas bacteria Genes encoding ferredoxin or flavodoxin are known from Such as Pseudomonas aeruginosa, Mycobacterium bacteria many species, and any of these can be used so long as the Such as Mycobacterium tuberculosis, and so forth. ferredoxin or flavodoxin encoded by the genes can be utilized Any of the genes described herein may have conservative by pyruvate synthase and an electron donor recycling system. mutations, and may be homologues or artificially modified For example, in Escherichia coli, the fax gene encodes ferre genes so long as the functions of the encoded proteins are not doxin which has a 2Fe-2S cluster (Ta, D.T. and Vickery, L.E., degraded. That is, the genes described herein may encode a 1992, J. Biol. Chem., 267: 11120-11125), and the yfhL gene conservative variant of the proteins having amino acid encodes ferredoxin which has a 4Fe-4S cluster. Furthermore, sequences of the known proteins or wild-type proteins, and the fldA gene (Osborne C. et al., 1991, J. Bacteriol., 173: may include one or more Substitutions, deletions, insertions, 1729-1737) and the fldB gene (Gaudu, P. and Weiss, B., 2000, 25 or additions of one or several amino acid residues at one or J. Bacteriol., 182:1788-1793) are known to encode fla several positions. Although the number of the “one or sev Vodoxin. In the genome sequence of Corynebacterium eral amino acid residues may differ depending on their posi glutamicum (Genbank Accession No. BAO0036), multiple tion in the three-dimensional structure or the types of amino ferredoxin genes were found at nucleotide numbers from acid residues of the proteins, it is preferably 1 to 20, more 562643 to 562963 (fdx Genbank Accession No. 30 preferably 1 to 10, particularly preferably 1 to 5. BAB97942), and nucleotide numbers from 1148953 to These substitutions are preferably conservative substitu 1149270 (fer Genbank Accession No. BAB98495). Fur tions that are neutral mutations so to preserve the function of thermore, in Chlorobium tepidum, many ferredoxin genes the protein. A conservative mutation is a mutation wherein have been identified, for example, ferredoxin I and ferredoxin Substitution takes place mutually among Phe, Trp and Tyr, if II are of the 4Fe-4S type, which acts as the electron acceptor 35 the Substitution site is anaromatic amino acid; among Leu, Ile for pyruvate synthase (Yoon, K. S., Bobst, C., Hemann, C. F., and Val, if the substitution site is a hydrophobic amino acid; Hille, R, and Tabita, F. R 2001, J. Biol. Chem..., 276:44027 between Gln and ASn, if it is a polar amino acid; among Lys, 44036). Ferredoxin or flavodoxin native to or derived from Arg and His, if it is a basic amino acid; between Asp and Glu, bacteria having the reductive TCA cycle, such as the ferre if it is an acidic amino acid; and between Ser and Thr, if it is doxin gene of Hydrogenobacter thermophilus, can also be 40 an amino acid having a hydroxyl group. used. Specific examples of conservative substitutions include: The ferredoxin gene of Escherichia coli includes the fax substitution of Seror Thr for Ala; substitution of Gln, His or gene at nucleotide numbers from 2654770 to 2655105 Lys for Arg; substitution of Glu, Gln, Lys, His or Asp for Asn; (complementary Strand) in the genome sequence of the substitution of Asn., Glu or Gln for Asp; substitution of Seror Escherichia coli K-12 strain (Genbank Accession No. 45 Ala for Cys; substitution of Asn., Glu, Lys, His, Asp or Arg for U00096) and shown in SEQID NO:9, and the yfhL gene at Gln; substitution of Gly, Asn., Gln, Lys or Asp for Glu: Sub nucleotide numbers from 2697685 to 2697945 also from stitution of Pro for Gly; substitution of Asn. Lys, Gln, Arg or K-12, and shown in SEQ ID NO: 11. The amino acid Tyr for His; substitution of Leu, Met, Val or Phe for Ile: sequences of Fdx and YfhL are shown in SEQ ID NOS: 10 substitution of Ile, Met, Val or Phe for Leu; substitution of and 12 (Genbank Accession Nos. AAC75578 and 50 ASn, Glu, Gln, His or Arg for Lys; substitution of Ile, Leu, Val AAC75615, respectively). The flavodoxin gene of Escheri or Phe for Met; substitution of Trp, Tyr, Met, Ile or Leu for chia coli includes the gene at nucleotide numbers from Phe; substitution of Thr or Ala for Ser; substitution of Ser or 710688 to 710158 (complementary strand) in the genome Ala for Thr; substitution of Phe or Tyr for Trp; substitution of sequence of the Escherichia coli K-12 strain (Genbank His, Phe or Trp for Tyr; and substitution of Met, Ile or Leu for Accession No. U00096) and shown in SEQID NO: 13, and 55 Val. The above-mentioned amino acid substitution, deletion, the fldB gene at nucleotide numbers from 3037877 to insertion, addition, inversion etc. may be the result of a natu 3038398 also from K-12, and shown in SEQID NO: 15. The rally-occurring mutation or variation due to an individual amino acid sequences encoded by the flaA gene and the flaB difference, or a difference of species of a bacterium. gene are shown in SEQID NOS: 14 and 16 (Genbank Acces Furthermore, a gene may be used which has codon Substi sion Nos. AAC73778 and AAC75933, respectively). 60 tutions that can be easily used in the chosen host into which The ferredoxin gene of Chlorobium tepidum includes the the gene is introduced. Similarly, so long as the gene main ferredoxin I gene at nucleotide numbers from 1184078 to tains its function, it may be extended or shortened at either the 1184266 in the genome sequence of Chlorobium tepidum N-terminus and/or C-terminus by, for example, 50 or less, (Genbank Accession No. NC 002932) and shown in SEQID preferably 20 or less, more preferably 10 or less, particularly NO: 17, and the ferredoxin II gene at nucleotide numbers 65 preferably 5 or less, of the number of amino acid residues. from 1184476 to 1184664 also from Chlorobium tepidum and A gene encoding a conservative variant can be obtained by, shown in SEQ ID NO: 19. The amino acid sequences of for example, modifying the nucleotide sequence by site-spe US 7,833,761 B2 19 20 cific mutagenesis so that the encoded protein includes Substi The NADP oxidoreductase gene of Euglena gracilis can tutions, deletions, insertions, or additions of amino acid resi be obtained by PCR using primers prepared on the basis of the dues at specific sites. Furthermore, it can also be obtained by nucleotide sequence of SEQ ID NO: 5, for example, the the conventionally known mutagenesis techniques, such as by primers shown in SEQID NOS: 40 and 41, and the chromo treating the gene with hydroxylamine or the like in vitro and Somal DNA of Euglena gracilis as the template. irradiating the microorganism containing the gene with ultra The flavodoxin NADP reductase gene of Escherichia coli violet light, or treating the microorganism with a known can be obtained by PCR using primers prepared on the basis mutagen such as N-methyl-N'-nitro-N-nitrosoguanidine of the nucleotide sequence of SEQID NO: 7, for example, the (NTG) or ethyl methanesulfonate (EMS). Moreover, the sub primers shown in SEQID NOS: 42 and 43, and the chromo stitutions, deletions, insertions, additions, inversions etc. of 10 somal DNA of Escherichia coli as the template. amino acid residues as described above include those due to a The ferredoxin gene fax of Escherichia coli can be naturally occurring mutation or variation based on the differ obtained by PCR using primers prepared on the basis of the ence of individuals or species of the microorganism contain nucleotide sequence of SEQ ID NO: 9, for example, the ing the gene. Whether the gene(s) encodes pyruvate synthase, primers shown in SEQID NOS: 44 and 45, and the chromo ferredoxin-NADP" reductase, ferredoxin, or flavodoxin can 15 somal DNA of Escherichia coli as the template. be confirmed by, for example, introducing each gene into a The flavodoxin gene fldA of Escherichia coli can be microorganism, and measuring the activity of each protein. obtained by PCR using primers prepared on the basis of the The gene may be a DNA which hybridizes with a DNA nucleotide sequence of SEQID NO: 13, and the flavodoxin having any one of the aforementioned nucleotide sequences, gene fldB of Escherichia coli can be obtained by PCR using or a probe prepared from a DNA which has anyone of these primers prepared on the basis of the nucleotide sequence of nucleotide sequences, under Stringent conditions and which SEQ ID NO: 15, and the chromosomal DNA of Escherichia encodes pyruvate synthase, ferredoxin-NADP" reductase, coli as the template, respectively. ferredoxin, or flavodoxin. Furthermore, the ferredoxin I gene of Chlorobium tepidum The term “stringent conditions' refers to conditions where can be obtained by PCR using primers prepared on the basis a so-called specific hybrid is formed and a non-specific hybrid 25 of the nucleotide sequence of SEQID NO: 17, and the ferre is not formed. Examples thereof include conditions where doxin II gene of Chlorobium tepidum can be obtained by PCR DNAs having high homology, for example, at least 70%, using primers prepared on the basis of the nucleotide preferably 80%, more preferably 90%, and further more pref sequence of SEQ ID NO: 19, with using the chromosomal erably 95% homology, hybridize with each other and DNAS DNA of Chlorobium tepidum as the template in both cases. having homology less than the value do not hybridize with 30 Genes derived from other microorganisms can also be each other, and specifically include conditions corresponding obtained from the chromosomal DNA or a chromosomal to a salt concentration and temperature of washing which are DNA library from the chosen microorganism by PCR using, typical of Southern hybridization, e.g., washing at 60° C. as primers, oligonucleotides prepared based on the sequences 1xSSC, 0.1% SDS, preferably 60° C., 0.1XSSC, 0.1% SDS, of the aforementioned gene or sequences of genes or proteins more preferably 68° C., 0.1xSSC, 0.1% SDS, once or pref 35 known in the chosen microorganism; or hybridization using erably twice or three times. an oligonucleotide prepared based on Such sequence as men The probe may have a partial sequence of the gene. Such a tioned above as a probe. A chromosomal DNA can be pre probe can be prepared by PCR using oligonucleotides pre pared from a microorganism that serves as a DNA donor by pared based on the nucleotide sequence of each gene as prim the method of Saito and Miura (Saito H. and Miura K, 1963, ers according to a method well known to a person skilled in 40 Biochem. Biophys. Acta, 72:619-629, Experiment Manual the art, and a DNA fragment containing each gene as the for Biotechnology, edited by The Society for Biotechnology, template. When a DNA fragment of a length of about 300 bp Japan, p. 97-98, Baifukan Co., Ltd., 1992) or the like. is used as the probe, the conditions of washing after hybrid The expression of the gene and genes of L-amino acid ization can be, for example, 50° C., 2xSSC, and 0.1% SDS. synthesis systems can be increased by increasing the copy 45 number of the gene by transformation or homologous recom The aforementioned descriptions concerning the conserva bination, or modifying an expression control sequence of the tive variant is also applied to the enzymes and genes described gene as described above. Furthermore, the expression of the above which are used to impart L-amino acid-producing abil gene can also be increased by amplifying an activator which ity. increases expression of the gene, and/or by eliminating or The modification for enhancing expression of the gene can 50 attenuating a regulator which reduces expression of the gene. be performed in the same manner as that described to enhance Methods for increasing gene expression will be explained the expression of a target gene which is used to impart the below. L-amino acid-producing ability. The gene can be obtained by To increase the copy number of a target gene, for example, PCR using the chromosomal DNA of the microorganism as the gene can be cloned on an appropriate vector and then used the template. 55 to transform a host microorganism. For example, the pyruvate synthase gene of Chlorobium The vector used for transformation may be a plasmid which tepidum can be obtained by PCR (polymerase chain reaction) autonomously replicates in the host microorganism. (see White, T.J., Arnheim, N., and Erlich, H.A. 1989, Trends Examples of a plasmid which is able to autonomously repli Genet., 5:185-189) using primers prepared on the basis of the cate in Enterobacteriaceae include puC19, puC18, pBR322, nucleotide sequence of SEQ ID NO: 1, for example, the 60 RSF1010, pHSG299, pHSG298, pHSG399, pHSG398, primers shown in SEQ ID NOS: 35 and 36, and using the pSTV28, pSTV29 (pHSG and pSTV vectors are available chromosomal DNA of Chlorobium tepidum as the template. from Takara Bio Inc.), pMW119, pMW 118, pMW219, The pyruvate synthase gene of Escherichia coli can be pMW218 (pMW vectors are available from Nippon Gene obtained by PCR using primers prepared on the basis of the Co., Ltd.), and so forth. Furthermore, plasmids for coryne nucleotide sequence of SEQ ID NO: 3, for example, the 65 form bacteria include paM330 (Japanese Patent Laid-open primers shown in SEQID NOS: 38 and 39, and the chromo No. 58-67699), pHM1519 (Japanese Patent Laid-open No. somal DNA of Escherichia coli as the template. 58-77895), pSFK6 (Japanese Patent Laid-open No. 2000 US 7,833,761 B2 21 22 262288), pVK7 (USP2003-0175912A), pAJ.655, p.AJ611, strength of promoters are described in an article by Goldstein pAJ1844 (Japanese Patent Laid-open No. 58-192900), pCG1 and Doi (Goldstein, M. A. and Doi R H., 1995, Biotechnol. (Japanese Patent Laid-open No. 57-134500), pCG2 (Japa Annu. Rev. 1:105-128), etc. nese Patent Laid-open No. 58-35197), pCG4, pCG11 (Japa Moreover, it is also possible to substitute several nucle nese Patent Laid-open No. 57-183799), pHK4 (Japanese otides in the promoter region of a gene, so that the promoter Patent Laid-open No. 5-7491), and so forth. Moreover, a has an appropriate strength, as disclosed in International DNA fragment which is able to impart the ability to autono Patent Publication WO00/18935. Substitution of the expres mously replicate to a plasmid in a coryneform bacterium can sion regulatory sequence can be performed, for example, in be cut from these vectors and inserted into the aforemen the same manner as in gene Substitution using a temperature 10 sensitive plasmid. Examples of vectors having a temperature tioned vectors for Escherichia coli, and then can be used as a sensitive replication origin which can be used for Escherichia so-called shuttle vector which is able to autonomously repli coli or Pantoea anamatis include, for example, the tempera cate in both Escherichia coli and coryneform bacteria. In ture-sensitive plasmid pMAN997 described in International addition, a phage DNA may also be used as the vector instead Publication WO99/03988, its derivatives, and so forth. Fur of a plasmid. 15 thermore, Substitution of an expression regulatory sequence Examples of transformation methods include treating can also be performed by methods which employ linear DNA, recipient cells with calcium chloride so to increase perme such as “Red-driven integration' using Red recombinase of ability of the DNA, which has been reported for Escherichia phage (Datsenko, K. A. and Wanner, B. L., 2000, Proc. Natl. coli K-12 (Mandel, M. and Higa, A., 1970, J. Mol. Biol. Acad. Sci. USA., 97:6640-6645), by combining the Red 53:159-162), and preparing competent cells from cells which driven integration method and the w phage excision system are at the growth phase, followed by transformation with (Cho, E. H., Gumport, R.I., Gardner, J. F. 2002, J. Bacteriol. DNA, which has been reported for Bacillus subtilis (Duncan, 184:5200-5203) (WO2005/010175), and so forth. The modi C. H., Wilson, G. A. andYoung, F. E. 1977, Gene, 1:153-167). fication of an expression regulatory sequence can be com Alternatively, a method of making DNA-recipient cells into bined with increasing gene copy number described above. protoplasts or spheroplasts, which can easily take up recom 25 Furthermore, it is known that substitution of several nucle binant DNA, followed by introducing the recombinant DNA otides in a spacer between the ribosome (RBS) into the cells, which is known to be applicable to Bacillus and the start codon, in particular, the sequences immediately subtilis, actinomycetes and yeasts (Chang, S, and Choen, S. upstream of the start codon, profoundly affects the mRNA N., 1979, Mol. Gen. Genet, 168:111-115; Bibb, M. J. et al., translatability. Translation can be enhanced by modifying 1978, Nature, 274:398-400; Hinnen, A., Hicks, J. B. and Fink, 30 these sequences. G. R. 1978, Proc. Natl. Sci., USA, 75:1929-1933) can also be When pyruvate synthase consists of multiple subunits, the employed. In addition, microorganisms can also be trans expression of the genes encoding the subunits may be indi formed by the electric pulse method (Japanese Patent Laid vidually enhanced, or may be simultaneously enhanced as a open No. 2-207791). polycistron. Furthermore, when the genes are introduced into 35 a microorganism by using a vector, the genes encoding the The copy number of the target gene can also be increased Subunits may be carried on a single vector molecule, or may by introducing multiple copies of the gene into the chromo be separately carried on different vector molecules. Also Somal DNA of the microorganism by homologous recombi when the genes encoding the Subunits are inserted into the nation (MillerI, J. H. Experiments in Molecular Genetics, chromosome, the genes may be simultaneously inserted into 1972, Cold Spring Harbor Laboratory) using multiple copies 40 the same site on the genome, or may be separately inserted at of a sequence as targets in the chromosomal DNA. Sequences different sites. present in multiple copies on the chromosomal DNA include, Furthermore, pyruvate dehydrogenase activity may be but are not limited to, repetitive DNAs, and inverted repeats reduced, in addition to enhancing pyruvate synthase activity present at the end of a transposable element. Also, as dis or pyruvate:NADH oxidoreductase activity. closed in Japanese Patent Laid-open No. 2-109985, it is pos 45 Pyruvate dehydrogenase (henceforth also referred to as sible to incorporate the target gene into a transposon, and “PDH) activity means an activity for catalyzing the reaction allow it to be transferred to introduce multiple copies of the of oxidatively decarboxylating pyruvic acid to produce gene into the chromosomal DNA. The target gene can also be acetyl-CoA. The aforementioned reaction is catalyzed by introduced into the bacterial chromosome by Mu phage three kinds of enzymes, PDH (Elp, pyruvate dehydrogenase, (Japanese Patent Laid-openNo. 2-109985), or the like. Trans 50 EC: 1.2.4.1, aceE gene, SEQ ID NO: 46), dihydrolipoyl fer of a target gene to a chromosome can be confirmed by transacetylase (E2p, EC:2.3.1.12, aceF gene, SEQ ID NO: Southern hybridization using a part of the gene as a probe. 48), and dihydrolipoamide dehydrogenase (E3, EC: 1.8.1.4, When the copy number of a gene is increased, the copy lpdA gene, SEQ ID NO: 50). That is, these three subunits number is not particularly limited so long as activity of the catalyze the following reactions, respectively, and the activity product of the target gene is enhanced. However, when the 55 for catalyzing the total reaction resulting from these three target gene is native to the chosen microorganism, the copy reactions is called PDH activity. PDH activity can be mea number is preferably 2 or more. When the target gene is not sured according to the method of Visser and Strating (Visser, native to the chosen microorganism, the copy number of the J. and Strating, M., 1982, Methods Enzymol. 89:391-399). gene may be 1, but it may also be 2 or more. Elp: Pyruvate--dihydrolipoyllysine-residue succinyl Expression of the target gene may also be increased by 60 transferaselipoyllysine-dihydrolipoyllysine-residue replacing an expression regulatory sequence of the target acetyltransferaseS-acetyldihydrolipoyllysine+CO, gene. Such as promoter, on the chromosomal DNA or plasmid E2p: CoA--enzyme N6-(S-acetyldihydrolipoyl) with a promoter which has an appropriate strength. For lysine-acetyl-CoA--enzyme N6-(dihydrolipoyl)lysine example, the thr promoter, lac promoter, trp promoter, trc E3: Protein N6-(dihydrolipoyl)lysine--NAD" protein N6 promoter, pI promoter, tac promoter, etc., are known as pro 65 (lipoyl)lysine+NADH+H" moters frequently used to increase expression of a target gene. To decrease or eliminate enzyme activity, for example, a Examples of strong promoters and methods for evaluating the part of or the entire coding region may be deleted from one or US 7,833,761 B2 23 24 more of the aceE, aceF and lpdA genes, or an expression When the microorganism is cultured under anaerobic or control sequence Such as a promoter or Shine Dargarno (SD) microaerobic conditions, it may be already have been modi sequence can be modified, or the like. The expression can also fied so that it does not produce any organic acid or ethanol be reduced by modifying a non-translation region other than under the anaerobic or microaerobic conditions, in addition to expression control regions. Furthermore, the entire gene, enhancing the pyruvate synthase activity or pyruvate:NADH including the upstream and downstream regions of the genes oxidoreductase activity. Examples of the organic acids on the chromosome, may be deleted. In addition, an amino include lactic acid, formic acid, and acetic acid. The method acid Substitution (missense mutation), a stop codon (non for modifying a microorganism so that organic acidorethanol sense mutation), or a frame shift mutation which adds or is not produced include by disrupting the gene encoding deletes one or two nucleotides may be introduced into the 10 lactate dehydrogenase (Verumi, G. N. et al., 2002, J. Indus enzyme coding region on the chromosome by genetic recom trial Microbiol. Biotechnol., 28:325-332: Japanese Patent bination (Journal of Biological Chemistry, 272:8611-8617 Laid-open No. 2005-95169). (1997), Proceedings of the National Academy of Sciences, <2> Method for Producing an L-Amino Acid USA, 95551 1-5515 (1998), Journal of Biological Chemistry, The microorganism is cultured in a medium to produce and 266, 20833-20839 (1991)). 15 cause accumulation of an L-amino acid in the medium or To reduce the intracellular enzymatic activity, a part or all cells, and collecting the L-amino acid from the medium or of an expression control sequence Such as promoter region, a cells. coding region or a non-coding region of the gene on the A batch culture, fed-batch culture, and/or continuous cul chromosome may be deleted, or another sequence may be ture may be used. Ethanol or an aliphatic acid may be added inserted into these regions by homologous recombination. to the starting medium or feed medium, or both. However, these modifications may be accomplished by A fed-batch culture refers to a culture method in which the known mutatagenesis techniques, such as exposure to X-rays medium is continuously or intermittently fed into the culture or UV irradiation, or treatment with a mutagen Such as N-me vessel, and the medium is not extracted until the end of the thyl-N'-nitro-N-nitrosoguanidine, etc., so long as the PDH culture. A continuous culture means a method in which the activity is reduced by the modification. 25 medium is continuously or intermittently fed into the culture The expression control sequence is preferably modified by vessel, and the medium is extracted from the vessel (usually one or more nucleotides, more preferably two or more nucle in a volume equivalent to the volume of the fed medium) at the otides, particularly preferably three or more nucleotides. same time. A starting medium indicates the medium used in When a coding region is deleted, it may be in the N-terminus the batch culture, the fed-batch culture, or continuous culture region, an internal region, or the C-terminus region, or even 30 before feeding the feed medium, that is, the medium used at the entire coding region, so long as the function of the enzyme the start of the culture. A feed medium indicates the medium protein is reduced. Deletion of a longer region will usually which is supplied to the fermentation tank in the fed-batch ensure inactivation of the gene. Furthermore, the reading culture or continuous culture. Abatch culture means a method frames upstream and downstream of the deleted region are in which fresh medium is prepared for every culture, and the not preferably the same. 35 strain is inoculated into the medium, and the medium is not Also, when another sequence is inserted into the coding added until harvest. region, the sequence may be inserted anywhere, and inserting A substance from which acetyl-CoA can be produced with a longer region will usually ensure inactivation of the gene. out a decarboxylation reaction is preferred as the carbon The reading frames upstream and downstream of the insertion Source, and specific examples include ethanol, aliphatic site are not preferably the same. The other sequence is not 40 acids, aliphatic acid esters including fats and oils which gen particularly limited so long as the sequence reduces ordeletes erate an aliphatic acid upon decomposition, and so forth. the function of the enzyme protein, and examples include a Examples of using ethanol or an aliphatic acid as the carbon transposon carrying an antibiotic resistance gene or a gene source will be described below. useful for L-amino acid production. Ethanol is a monohydric alcohol represented by the A gene on the chromosome can be modified as described 45 molecular formula CH-OH, and may be used alone, or may above by, for example, preparing a deletion-type version of be present as a mixture in the medium, Such as the ethanol the gene in which apartial sequence of the gene is deleted, and which is produced in ethanol fermentation in the medium etc. transforming a bacterium with a DNA containing the dele Aliphatic acids are monovalent carboxylic acids repre tion-type gene to cause homologous recombination between sented by the general formula CHCOOH. So long as it is the deletion-type gene and the native gene on the chromo 50 able to be assimilated by the bacteria having L-amino acid some, and thereby substitute the deletion-type gene for the producing ability, it may be of any length, and may contain gene on the genome. The enzyme protein encoded by the aliphatic acids of any length at any ratio. Preferred aliphatic deletion-type gene has a conformation different from that of acids are oleic acid (CHCOOH) and palmitic acid the wild-type enzyme protein, if it is even produced, and thus (CHCOOH), and oleic acid is particularly preferred. A the function is reduced or deleted. These types of gene dis 55 mixture of long chainaliphatic acids containing oleic acid can ruption can be performed by methods using a linear DNA be obtained by hydrolysis of fats and oils. Oleic acid can be Such as Red-driven integration, and Red-driven integration in obtained as a hydrolysate of fats and oils such as palm oil, and combination with an excision system derived from w phage, oleic acid extracted from oils, vegetable oils, waste or by using a plasmid containing a temperature-sensitive rep cooking oils, other blended fats and oils, or foodstuffs con lication origin, or a plasmid capable of conjugative transfer, 60 taining fats such as chocolate may be used. The aliphatic acid utilizing a Suicide vector which does not have a replication may be a free acid, oran alkali metal salt, Such as sodium salts origin usable in the chosen host (U.S. Pat. No. 6,303,383, JP and potassium salts, or an ammonium salt. 05-007491 A) etc. Ethanol oraliphatic acids may be present in the medium at The aforementioned description concerning reduction of any concentration so long as the chosenbacterium canassimi the PDH activity is also applied to “reduction of activity” of 65 late it as the carbon source. When it is used as the sole carbon the other enzymes described above, or “destruction of the source in the medium, it is present in an amount of 20% w/v. other genes described above. or less, more preferably 10% w/v or less, still more preferably US 7,833,761 B2 25 26 2% w/v or less. Furthermore, ethanol or aliphatic acids may where ethanol or aliphatic acid temporarily runs short. The be present in the medium at any concentration so long as it can term “temporarily’ means that, for example, the aliphatic be assimilated as the carbon Source by the chosen bacterium. acid may run short for a period corresponding to 10%, 20%, When it is used as the sole carbon source in the medium, it is or 30% at most, of the entire fermentation period. desirably present in the medium in an amount of 0.001% w/v. As for the other components to be added to the medium, or more, preferably 0.05% w/v or more, more preferably typical media ingredients such as a nitrogen source, inorganic 0.1% w/v or more. ions, and if needed, other organic components in addition to As for the feed medium, when ethanol or aliphatic acid is the carbon source can be used. Examples of the nitrogen used as the sole carbon Source, it is preferably present in the Source present in the medium include ammonia, ammonium medium in an amount of 10% w/v or less, more preferably 5% 10 salts such as ammonium Sulfate, ammonium carbonate, w/v or less, still more preferably 1% w/v or less, and it is ammonium chloride, ammonium phosphate, ammonium preferably present in the medium in an amount of 0.001% w/v. acetate and urea, nitrates, and so forth Ammonia gas and or more, more preferably 0.05% w/v or more, still more aqueous ammonia used to adjust the pH can also be utilized as preferably 0.1% w/v or more. the nitrogen Source. Furthermore, peptone, yeast extract, Although the concentration of ethanol can be measured by 15 meat extract, malt extract, corn steep liquor, soybean hydroly various methods, the enzymatic method is convenient and sate, and so forth can also be utilized. The medium may common (Swift R., 2003, Addiction,98:73-80). The concen contain one or more of these nitrogen sources. These nitrogen tration of aliphatic acid can be measured by known methods Sources can also be used for both the starting medium and the such as gas chromatography and HPLC (TrAC Trends Anal. feed medium. Furthermore, the same nitrogen Source can be Chem., 2002, 21:686-697; Lin J. T., Snyder L. R., and used for both the starting medium and the feed medium, or the McKeon, T.A., 1998, J. Chromatogr. A., 808:4349). nitrogen source of the feed medium may be different from Furthermore, the medium may contain a mixture of ethanol that of the starting medium. and an aliphatic acid. The concentrations of ethanol and ali The medium preferably contains a phosphoric acid source phatic acid which are added may be any concentration so long and a Sulfur source in addition to the carbon source, the as the chosen bacterium can assimilate them as the carbon 25 nitrogen Source, and Sulfur. As the phosphoric acid source, Source. However, when a mixture of ethanol and an aliphatic potassium dihydrogenphosphate, dipotassium hydrogen acid is used as the sole carbon Source in the medium, it is phosphate, phosphate polymers such as pyrophosphoric acid preferably present in an amount of 20% w/v or less, more and so forth can be utilized. Although the sulfur source may preferably 10% w/v or less, still more preferably 2% w/v or be any Substance containing Sulfur atoms, Sulfuric acid salts less, in terms of the total concentration. Furthermore, a mix 30 Such as Sulfates, thiosulfates and Sulfites, and Sulfur-contain ture of ethanol and an aliphatic acid may be present in the ing amino acids such as cysteine, cystine and glutathione are medium at any concentration so long as it can be assimilated desirable, and ammonium sulfate is especially desirable. as the carbon source by the bacterium. However, when a Furthermore, the medium may contain a growth promoting mixture of ethanol and an aliphatic acid is used as the sole factor, such as a nutrient with a growth promoting effect, in carbon Source in the medium, it is desirably contained in the 35 addition to the carbon Source, nitrogen source and Sulfur. As medium in an amount of 0.001% w/v or more, preferably the growth promoting factor, trace metals, amino acids, Vita 0.05% w/v or more, more preferably 0.1% w/v or more, in mins, nucleic acids as well as peptone, casamino acid, yeast terms of the total concentration of ethanol and oleic acid. extract, soybean protein degradation product and so forth Any ratio of ethanol and aliphatic acid may be present so containing the foregoing Substances can be used. Examples of long as they are at Such concentrations that the chosen bac 40 the trace metals include iron, manganese, magnesium, cal teria can assimilate them as the carbon source. However, the cium, and so forth Examples of the vitamins include vitamin aliphatic acid is generally mixed at a ratio of about 2 or less, B. vitamin B. vitamin B, nicotinic acid, nicotinamide, preferably about 1.5 or less, preferably about 1 or less, based Vitamin B and so forth. These growth promoting factors on ethanol, which is taken as 1. Although the lower limit of the may be present in the starting medium or the feed medium. mixing ratio of the aliphatic acid is not particularly limited in 45 Furthermore, when an auxotrophic mutant that requires an the case of mixing the aliphatic acid, the aliphatic acid is amino acid or the like for growth thereof is used, it is prefer preferably mixed at a ratio of 0.05 or more, desirably 0.1 or able to Supplement the required nutrient to the medium. In more, based on ethanol, which is taken as 1. particular, since the L-lysine biosynthetic pathway is In addition to ethanol or aliphatic acid, or both, other car enhanced and L-lysine degrading ability is often attenuated in bon Sources may also be added to the medium, for example, 50 L-lysine-producing bacteria, one or more of L-threonine, Such as Saccharides such as glucose, fructose, Sucrose, lac L-homoserine, L-isoleucine, and L-methionine are prefer tose, galactose, blackstrap molasses, and starch hydrolysate, ably added. The starting medium and the feed medium may polyhydric alcohols such as glycerol and organic acids Such have the same or different medium composition. Further as fumaric acid, citric acid, and Succinic acid. Glucose, more, when the feed medium is fed at multiple stages, the Sucrose, fructose, and glycerol are especially preferred. As 55 compositions of the feed medium fed at the various stages glycerol, crude glycerol produced in biodiesel fuel produc may be the same or different. tion can also be used. The carbon source may be one kind of The culture is preferably performed as an aeration culture Substance or a mixture of two or more kinds of Substances. at a fermentation temperature of 20 to 45° C., particularly When other carbon sources are used, the ratio of ethanol, preferably at 33 to 42° C. The oxygen concentration is aliphatic acid, or a mixture of ethanol and aliphatic acid in the 60 adjusted to 5 to 50%, desirably about 10%. Furthermore, the carbon source is preferably 10% by weight or more, more aeration culture is preferably performed with the pH adjusted preferably 30% by weight or more, still more preferably 50% to 5 to 9. If pH is lowered during the culture, for example, by weight or more. calcium carbonate or an alkali Such as ammonia gas and Ethanol or aliphatic acid may be present at a certain con aqueous ammonia is added to neutralize the culture. When stant concentration throughout the culture process, or it may 65 culture is performed under such conditions preferably for be added only to the starting medium or the feed medium. If about 10 to 120 hours, a marked amount of L-amino acid other carbon sources are sufficient, there may be a period accumulates in the culture medium. Although the concentra US 7,833,761 B2 27 28 tion of L-amino acid which accumulates is not limited so long amino acids, when an auxotrophic mutant strain is used, it is as it is higher than that observed with wild-type strains and the preferable to supplement the required nutrient. Furthermore, L-amino acid can be isolated and collected from the medium, the feed medium may consist of one type of medium, or a it may be 50 g/L or higher, desirably 75 g/L or higher, more mixture of two or more types of media. When two or more desirably 100 g/L or higher. types offeed media are used, the media may be mixed and fed When the target amino acid is a basic amino acid, the by using one feed can, or the media may be separately fed by fermentation is performed with the pH of the medium con using two or more feed cans. trolled to be 6.5 to 9.0 during the culture and to be 7.2 to 9.0 When the continuous culture method is used for the present at the end of the culture. Furthermore, the internal pressure in invention, the medium may be extracted and fed simulta the fermentation tank is controlled to be positive during the 10 neously, or a part of the medium may be extracted, and then fermentation, or carbon dioxide or a mixed gas containing the medium may be fed. Furthermore, the method may also be carbon dioxide is supplied to the medium so that there is a a continuous culture method in which the culture medium culture period that bicarbonate ions and/or carbonate ions are containing L-amino acids and bacterial cells is extracted, and present in an amount of 2 g/L or larger in the medium, and only the cells are returned to the fermenter for reuse (French thereby the bicarbonate ions and/or carbonate ions can be 15 Patent No. 2669935). As the method for continuously or used as counter ions of cations mainly consisting of the basic intermittently feeding a nutrient source, the same method as amino acid (refer to JP 2002-065287A). used in the fed-batch culture is used. The L-amino acid can be collected by a known collection The continuous culture method reusing bacterial cells method from the culture medium after the culture. For intermittently or continuously extracts the fermentation example, the L-amino acid can be collected by an ion medium when the amino acid concentration reaches a prede exchange resin method or precipitation method, or after the termined level, extracting only L-amino acid and re-circulat bacterial cells are removed from the culture medium by cen ing filtration residues containing bacterial cells into the fer trifugation or the like, the L-amino acid is collected by con menter, and it can be performed by referring to, for example, centration for crystallization. French Patent No. 2669935. The culture of the microorganism may be performed as a 25 When the culture medium is intermittently extracted, it is seed culture and a main culture in order to ensure accumula preferred that some of the L-amino acid is extracted when the tion of the L-amino acid higher than a certain level. The seed L-amino acid concentration reaches a predetermined level. culture may be performed as a shaking culture using a flask or and a fresh medium is fed to continue the culture. Further the like, or batch culture, and the main culture may be per more, as for the volume of the medium to be added, the culture formed as fed-batch culture or continuous culture. Alterna 30 is preferably performed so that the final volume of the tively, both the seed culture and the main culture may be medium after the addition of the medium is equal to the performed as batch culture. volume of the culture medium before the extraction. The term When a fed-batch culture or continuous culture is per “equal used herein means that the volume after the addition formed, the feed medium may be intermittently fed so that the of the medium corresponds to about 93 to 107% of the volume Supply of ethanol, aliphatic acid or other carbon sources is 35 of the medium before the extraction. temporarily stopped. The supply of the feed medium is pref When the culture medium is continuously extracted, the erably stopped for, at maximum, 30% or less, desirably 20% extraction is preferably stared at the same time as, or after the or less, particularly desirably 10% or less, of the feeding time. feeding of, the nutrient medium. For example, within 5 hours, When the feed medium is intermittently fed, the feed medium desirably 3 hours, more desirably 1 hour, after the start of the may be initially added over a predetermined time, and the 40 feeding, the extraction is started. Furthermore, the extraction second and following additions may be controlled so that it is volume of the culture medium is preferably equal to the started when pH increases or the dissolved oxygen concen Volume of the fed medium. tration is detected by a computer upon depletion of the carbon Source in the fermentation medium during an addition EXAMPLES stopped period prior to a certain medium-addition period, and 45 thus the Substrate concentration in the culture tank is always Hereinafter, the present invention will be more specifically automatically maintained at a low level (U.S. Pat. No. 5,912, explained with reference to the following non-limiting 113). examples. The feed medium used for the fed-batch culture preferably contains ethanol or an aliphatic acid, another carbon Source, 50 Example 1 and a nutrient having a growth promoting effect (growth promoting factor), and may be controlled so that the concen Construction of Alcohol Dehydrogenase (AdhE) tration of the aliphatic acid in the fermentation medium is at Mutated Strain Derived from Escherichia coli a predetermined concentration or lower. The expression "pre determined concentration or lower” means that the medium is 55 An Escherichia coli strain having mutant alcoholdehydro prepared so that the aliphatic acid concentration in the genase AdhE was constructed so as to obtain an aerobically medium becomes 10% w/v or lower, preferably 5% w/v or ethanol assimilable Escherichia coli strain. The nucleotide lower, more preferably 1% w/v or lower. sequence of the wild-type AdhE gene (adhE) derived from As the other carbon Source, glucose, Sucrose, fructose and Escherichia coli and the encoded amino acid sequence are glycerol are preferred. As the growth promoting factor, nitro 60 shown in SEQID NOS: 21 and 22, respectively. gen sources, phosphoric acid, amino acids and so forth are <1-1> Construction of Escherichia coli MG1655::P, preferred. As the nitrogen Source, ammonia, ammonium salts adhE Strain Such as ammonium sulfate, ammonium carbonate, ammo Substitution of the P. promoter for the promoter region nium chloride, ammonium phosphate, ammonium acetate of the Escherichia coli adhE gene was performed by “Red and urea, nitrates and so forth can be used. Furthermore, as the 65 driven integration', which was developed by Datsenko and phosphoric acid source, potassium dihydrogenphosphate and Wanner (Datsenko, K.A. and Wanner, B.L., 2000, Proc. Natl. dipotassium hydrogenphosphate can be used. As for the Acad. Sci. USA., 97:6640-6645) using the excision system US 7,833,761 B2 29 30 derived from phage (Cho, E. H., Gumport, R.I., and Gard remove the temperature-sensitive plasmid pKD46 and ner, J. F., 2002, J. Bacteriol., 184:5200-5203). thereby obtain an MG 1655AadhE strain. By this technique, a genetic recombinant strain can be constructed in one step using a PCR product obtained by <1-3> Construction of Mutant Alcohol Dehydrogenase using primers designed so as to contain a part of a target gene (AdhE*) at the 5' end and apart of antibiotic resistance gene at the 3' In order to introduce the Glu568Lys (E568K) mutation into end. By further using the excision system derived from w AdhE, PCR was performed using the primer of SEQID NO: phage in combination, it is possible to eliminate the antibiotic 32 which is complementary to nucleotide sequences of 1662 resistance gene which had been integrated into the genetic to 1701 and 1703 to 1730 of the adhE gene and containing a recombinant strata 10 g->a mutation at the nucleotide of position 1702, the primer A fragment containing the P. promoter and the cat gene of SEQID NO:33 which is homologous to the 3' end region encoding the chloramphenicol resistance (Cm') gene was of the adhE gene, and the genome of the Escherichia coli amplified by PCR using the genome of the Escherichia coli MG1655 strain as the template. For PCR, Gene Amp PCR MG1655 P, xylE strain described in WO2006/043730 as System 2700 Amplificatory (Applied Biosystems) and the template and the primers shown in SEQID NOS: 23 and 15 24. The primer of SEQ ID NO: 23 has a sequence comple Pyrobest DNA Polymerase (Takara Shuzo) were used. The mentary to the upstream region of the adhE gene, and the amplification fragment of 1.05 kbp was purified and collected primer of SEQID NO: 23 has a sequence complementary to by agarose gel electrophoresis. a 5' region of the adhE gene. PCR was performed using the genome of the Escherichia The sequence of the P. promoter is shown in SEQID coli MG 1655::PadhE strain as the template, the primer NO: 25. For PCR, Gene Amp PCR System 2700 Amplifica shown in SEQID NO: 34 and the 1.05 kbp fragment having tory (Applied Biosystems) and Taq DNA polymerase (Fer the mutation as another primer. The primer of SEQID NO:34 mentas) were used. The amplified fragment was purified and corresponds to the sequence from 402 to 425bp upstream collected by agarose gel electrophoresis. This fragment was from the start codon of the adhE gene. For PCR, Gene Amp introduced into the Escherichia coli MG 1655/pKD46 strain 25 PCR System 2700 Amplificatory (Applied Biosystems) and harboring the plasmid pKD46 having a temperature-sensitive TakaRa LA DNA Polymerase (Takara Shuzo) were used. replication ability by electroporation. The amplification fragment of 4.7 kbp was purified and col The strain was grown on M9 medium plates (Sambrook.J., lected by agarose gel electrophoresis. Fritsch, E. F., and Maniatis, T, 1989, Molecular Cloning A Laboratory Manual/Second Edition, Cold Spring Harbor 30 In order to replace the wild-type adhE gene with the mutant Laboratory Press, New York) containing 2% ethanol for 36 adhE gene, the 4.7 kbp fragment containing the Cm' gene and hours, and about 100 clones appeared. PCR amplification was the mutant adhE gene downstream of the P promoter performed using the primers shown in SEQID NOS: 26 and (cat-PadhE) was introduced into the MG 655AadhE/ 27, and then the nucleotide sequence of the amplified product pKD46 strain by electroporation according to the method of was determined. It was confirmed that one of the clones 35 Datsenko and Wanner. The clones were selected on the M9 contained the Cm' gene in the promoter region of the adhE plate medium containing 2% ethanol as the Sole carbon gene, and this clone was cultured at 37° C. to eliminate the Source. By sequencing the adhE gene of the grown clone, temperature-sensitive plasmid pKD46 and thereby obtain an Glu568Lys (gag-aag), Ile554Ser (atc-agc), Glu22Gly (gaa MG 1655::PadhE strain. gga), Met236Val (atg-gtg), Tyra-61CyS (tac-tgc) and <1-2D Construction of Escherichia coli MG 1655AadhE 40 Ala786Val (gca-gta) were identified, and this clone was des Strain ignated MG1655::P, adhE*. The adhE gene of wild-type Escherichia coli MG 1655 (ATCC 700926) was replaced with an inactivated adhE gene The MG 1655Atdh rhtA Strain was transformed via P by the method developed by Datsenko and Wanner. A frag transduction with P1 phage (Miller, J. H., 1972, Experi ment containing the kan gene encoding the kanamycin resis 45 ments in Molecular Genetics, Cold Spring Harbor Lab. Press, tance (Kan') marker was amplified by PCR using the plasmid Plainview, N.Y.) using the Escherichia coli MG655::P-- pACYC177 (GenBank/EMBL accession number X06402, adhE* strain as a donor, and MG1655AtdhrhtA* PadhE* Fermentas) as the template and the primers shown in SEQID was obtained. The MG 1655Atdh, rhtA*strain corresponds to NOS: 28 and 29. The primer of SEQ ID NO: 28 has a the MG 1655 strain, but the tdh gene encoding threonine sequence of 40 bases complementary to the region 318 bp 50 dehydrogenase is disrupted by the method of Datsenko and upstream of the adhE gene, and the primer of SEQID NO: 29 Wanner and a rhtA23 mutation is introduced therein, which has the sequence of 41 bases complementary to the region on imparts resistance to high concentrations of threonine in a the 3' side of the adhE gene. For PCR, Gene Amp PCR System minimal medium to the rhtA gene (Livshits, V.A., Zakataeva, 2700 Amplificatory (Applied Biosystems) and Taq DNA N. P., Aleshin, V.V., Vitushkina, M.V., 2003, Res. Microbiol., Polymerase (Fermentas) were used. The amplified fragment 55 154:123-135). was purified and collected by agarose gel electrophoresis. <1-4 Construction of Alcohol Dehydrogenase (AdhE) This fragment was introduced into the Escherichia coli MG 1655/pKD46 strain harboring the plasmid pKD46 by Mutated Strain Derived from Escherichia coli WC196AmeZ electroporation. Strain PCR amplification was performed by using the primers 60 In order to impart ethanol assimilability to an L-lysine shown in SEQID NOS:30 and 31 to confirm the presence of producing bacterium, the L-lysine-producing bacterium the Kim' gene in clones grown on the LB plate medium WC196AmeZ/pCABD2 strain described in International (Sambrook, J., Fritsch, E. F., and Maniatis, T., 1989, Molecu Patent Publication WO2005/010175 was subjected to P1 lar Cloning A Laboratory Manual/Second Edition, Cold transduction using MG 1655Atdh rhtA adhE* as a donor to Spring Harbor Laboratory Press, New York) containing 20 65 obtain a WC196Amez adhE*/pCABD2 strain. pCABD2 is ug/ml of kanamycin. One of clones confirmed to contain the the plasmid described in U.S. Pat. No. 6,040,160, and has the Kim' gene in the adhE gene region was cultured at 37° C. to dap A* gene which imparts resistance to feedback inhibition US 7,833,761 B2 31 32 by L-lysine, the lysC* gene which imparts resistance to feed the cell was set on a spectrophotometer (U-3210 Spectropho back inhibition by L-lysine, the dapB gene, and ddh gene. tometer, Hitachi). A pyruvic acid solution was added by using a syringe to start the reaction. The reaction continued at 37°C. Example 2 for 30 minutes, and absorbance was periodically measured at 578 nm to examine the change in the reduced methylviologen Construction of a Plasmid to Express the Pyruvate amount. The results are shown in Table 1. In the table, the unit Synthase Gene of Chlorobium tepidum and of the specific activity is U/mg protein. One unit is defined as Measurement of the Activity activity for reducing 1 nmol of methylviologen per 1 minute.

<2-1> Construction of a Plasmid to Express the Pyruvate 10 Synthase Gene of Chlorobium tepidum Chlorobium tepidum is a meso- to thermophilic Reaction mixture: autotrophic bacterium, and its optimum growth temperature MgCl2 1 mM is 48°C. The genome sequence of the Chlorobium tepidum Dithiothreitol 1 mM TLS strain has been elucidated by Eisen et al. (Eisen, J. A. et 15 Methylviologen 5 mM CoA O.25 mM al, 2002, Proc. Natl. Acad. Sci. USA, 99:9509-9514). The Pyruvic acid 10 mM pyruvate synthase gene was isolated from this strain, and a (added immediately before start of measurement) plasmid expressing it was constructed. HEPES (pH 8.0) 50 mM <2-2> Measurement of Pyruvate Synthase Activity in a Strain Expressing the Pyruvate Synthase Gene of Chlorobium tepidum PCR was performed using the chromosomal DNA of the TABLE 1 Chlorobium tepidum TLS strain (ATCC 49652) as the tem Plasmid Specific activity plate and the oligonucleotides shown in SEQID NOS: 35 and 36 to amplify a pyruvate synthase gene fragment. The gene 25 fragment was digested with SacI, and inserted into the SacI pMW-Pthr-PS 1.2 site of pSTV28 (Takara Bio) to construct a plasmid, which was designated pSTV-PS. After it was confirmed that the pyruvate synthase gene contained no PCR error over the full Example 3 length by using BigDye Terminators v1. Cycle Sequencing 30 Kit, the pyruvate synthase gene was excised from pSTV-PS Construction of a Plasmid to Express the Pyruvate with SacI, and inserted into the SacI site of pMW-Pthr to Synthase Gene of Chlorobium tepidum, Flavodoxin construct plasmid pMW-Pthr-PS. pMW-Pthr corresponds to NADP Reductase Gene of Escherichia coli, and the vector pMW219 (Nippon Gene) having the promoter Ferredoxin Gene of Escherichia coli region (Pthr) of the threonine operon (thrABC) of the 35 Escherichia coli K-12 strain between the HindIII site and the By using the flavodoxin NADP" reductase gene of Escheri Xbal site and which is capable of expressing the gene cloned chia coli (fr) and the ferredoxin gene of Escherichia coli (fax) downstream of the promoter. The promoter sequence of the as coenzyme regenerating systems, a plasmid simultaneously chosen threonine operon is shown in SEQID NO:37. expressing all three genes, including the pyruvate synthase pMW-Pthr-PS and the control vector pMW-Pthr were 40 gene, was constructed. introduced into the WC196AcadAAldc/pCABD2 strain by <3-1> Construction of a Vector to Amplify the Flavodoxin electroporation, respectively, and transformants were NADP Reductase Gene of E. coli obtained on the basis of the kanamycin resistance, and the PCR was performed using the chromosomal DNA of the E. presence of the plasmids was confirmed. The Strain express coli MG 1655 strain as the template and the oligonucleotides ing the pyruvate synthase gene of Chlorobium tepidum was 45 shown in SEQ ID NOS: 42 and 43. The gene fragment was designated WC196AcadAAldc/pCABD2/pMW-Pthr-PS, and digested with SmaI and inserted into the SmaI site of pMW the control strain was designated WC196AcadAAldc/ Pithr to construct a plasmid for amplifying the flavodoxin pCABD2/pMW-Pthr. NADP" reductase gene, which was designated pMW-Pthr The aforementioned strains were each inoculated into LB fpr. medium containing 20 mg/l of streptomycin and 40 mg/l of 50 <3-3> Construction of a Plasmid to Amplify the Ferre kanamycin, and cultured overnight at 37° C. with shaking. doxin (fax) gene of E. coli The cells were collected by centrifugation and suspended in a PCR was performed using the chromosomal DNA of the E. 50 mM HEPES buffer (pH 8.0). The cells in the suspension coli MG 1655 strain as the template and the oligonucleotides were disrupted by using an ultrasonicator, the Suspension was shown in SEQ ID NOS: 44 and 45. The gene fragment was centrifuged at 15000 rpm for 15 minutes, and the supernatant 55 digested with EcoRI, and inserted into the EcoRI site of was used as a crude enzyme solution. pMW-Pthr to construct a plasmid to amplify the ferredoxin Protein concentration in the crude enzyme solution was (fdx) gene, pMW-Pthr-fdx. measured by using Protein Assay CBB Solution (Nakalai <3-4> Construction of a Plasmid to Amplify the Pyruvate Tesque), and the crude enzyme solution containing 250 ug of Synthase Gene of C. tepidum, the Flavodoxin NADP Reduc the total protein was used to measure the activity. 60 tase Gene, and the Ferredoxin (fx) Gene of E. coli The activity was measured as follows.2 ml of the following pMW-Pthr-fpr was digested with SmaI, and their gene reaction Solution was added to the crude enzyme solution. fragment was ligated with pMW-Pthr-fdx which had been The reaction Solution containing all the ingredients except for treated with SmaI to obtain pMW-Pthr-fpr-fdx. Then, pMW pyruvic acid was first added to a cell for spectrometry, and the Pthr-PS was digested with SacI and the PS gene fragment was cell was sealed with a rubber stopper and an aluminum cap. 65 ligated with pMW-Pthr-fpr-fax which had been treated with The oxygen concentration was reduced in the cell by injecting SacI to construct a plasmid to express the pyruvate synthase argon gas into the cell for 5 minutes using a syringe, and then gene of C. tepidum and enhance expression of the flavodoxin US 7,833,761 B2 33 NADP" reductase and the ferredoxin (fdx) genes of E. coli, and was named pMW-Pthr-fpr-PS-fax. TABLE 2 In the aforementioned plasmids, the pyruvate synthase gene of C. tepidum is transcribed from Pthr, and the other L-lysine Live cell genes are also transcribed by read through from Pthr. Strain (g/1) count (10 ml) WC196AmezipCABD2/pMW-Pthr 1.77 22.3 Example 4 WC196AmezipCABD2/pMW-Pthr-fpr-PS-fix 2.35 13.6 Effect on the L-Lysine-Producing Ability of a Strain with Enhanced Expression of the Pyruvate Synthase 10 Example 5 Gene of Chlorobium tepidum, Flavodoxin NADP" Reductase Gene of Escherichia coli, and Ferredoxin Construction of a Plasmid to Express the Pyruvate Gene of Escherichia coli. Using Oleic Acid as the Synthase Gene of Escherichia coli and Measurement Carbon Source of Activity 15 <4-1> Introduction of the Plasmid to Amplify The Pyru An expression plasmid for the ydbK gene, which is vate Synthase Gene of Chlorobium tepidum, Flavodoxin homologous to the pyruvate synthase gene found in the NADP Reductase Gene of Escherichia coli, and Ferredoxin genome of Escherichia coli MG 1655 strain, was constructed, Gene of Escherichia coli into the WC196AmeZ Strain and the activity was measured. pMW-Pthr-fpr-PS-fdx and the control vector pMW-Pthr 20 <5-1> Construction of a Plasmid to Express the Pyruvate were introduced into WC196AmeZ/pCABD2 by electropora Synthase Gene of Escherichia coli tion, respectively, and transformants were obtained on the PCR was performed using the chromosomal DNA of the basis of the kanamycin resistance, and introduction of the Escherichia coli MG 1655 strain as the template and the oli plasmids were confirmed. The strain expressing the pyruvate gonucleotides shown in SEQID NOS: 38 and 39. The gene synthase gene of Chlorobium tepidum, the flavodoxin 25 fragment was digested with KpnI and the digested fragment NADP" reductase gene of Escherichia coli and the ferredoxin was inserted into the KpnI site of pSTV28 (Takara Bio) to gene of Escherichia coli was designated WC196AmeZ/ construct a plasmid, which was designated pSTV-ydbKAfter pCABD2/pMW-Pthr-fpr-PS-fdx, and the control strain was it was confirmed that the pyruvate synthase gene contained no designated WC196AmeZ/pCABD2/pMW-Pthr. PCR error over the full length by using BigDye Terminators <4-2> Effect on L-Lysine-Producing Ability of the Strain 30 v1.1 Cycle Sequencing Kit, the pyruvate synthase gene was with Enhanced Expression of the Pyruvate Synthase Gene of excised from pSTV-ydbK with KpnI, and inserted into the Chlorobium tepidum, Flavodoxin NADP Reductase Gene of Kpnl site of pMW-Pthr to construct the plasmid pMW-Pthr Escherichia coli, and Ferredoxin Gene of Escherichia coli ydbK Using Oleic Acid as the Carbon Source <5-2> Measurement of Pyruvate Synthase Activity in a Both WC196Amez/pCABD2/pMW-Pthr and 35 Strain Expressing the Pyruvate Synthase Gene of Escherichia WC196AmeZ/pCABD2/pMW-Pthr-fpr-PS-fdx were inocu coli lated onto the LB plate medium, respectively, and precultured pMW-Pthr-ydbK and the control vector pMW-Pthr were overnight at 37°C. The cells corresponding to /s of the plate introduced into the WC196AcadAAldc/pCABD2 strain by were inoculated into 20 ml of the oleic acid medium having electroporation, respectively, and transformants were the following composition in a 500 ml-volume Sakaguchi 40 obtained on the basis of the kanamycin resistance, and intro flask, and aerobically cultured at a stirring rate of 120 rpm at duction of the plasmids was confirmed. The strain expressing 37° C. for 72 hours. The L-lysine that accumulated in the the pyruvate synthase gene of Escherichia coli was desig medium was measured by using Biosensor BF-5 (Oji Scien nated WC196AcadAAldc/pCABD2/pMW-Pthr-ydbK, and tific Instruments). The live cell count in the medium was also the control strain was designated WC196AcadAAldc/ measured. Averages of the values obtained in the culture 45 pCABD2/pMW-Pthr. performed in duplicate are shown in Table 2. Improvement in The aforementioned strains were each inoculated into LB L-lysine accumulation was observed for the strain in which medium containing 20 mg/l of streptomycin and 40 mg/l of expression of pyruvate synthase gene of Chlorobium tepi kanamycin, and cultured overnight at 37° C. with shaking. dum, flavodoxin NADP" reductase gene of Escherichia coli The cells were collected by centrifugation, and the activity and ferredoxin gene of Escherichia coli were enhanced, com- 50 was measured in the same manner as that for the Strain pared with the control. expressing the pyruvate synthase gene of Chlorobium tepi dum described in Example 2. The results are shown in Table 3. Whereas the activity of pyruvate synthase was not con firmed for the control strain WC196AcadAAldc/pCABD2/ Composition of oleic acid medium: 55 pMW-Pthr, 8.0U/mg was confirmed for the strain expressing Sodium oleate 20 g/L the pyruvate synthase gene of Escherichia coli, MgSO4·7HO 1.0 g/L WC196AcadAAldc/pCABD2/pMW-Pthr-ydbK. The results (NH4)2SO 12 g/L are shown in Table 3. The unit of the specific activity is the KH2PO 0.5 g/L same as that used in Table 1. Yeast extract 1.0 g/L 60 FeSO4·7HO 0.01 g/L MnSO 5H2O 0.01 g/L TABLE 3 Kanamycin 40 mg/L. Streptomycin 20 mg/L. Plasmid Specific activity Calcium carbonate 30 g/L pMW-Pthr O.O pH 7.0 (adjusted with KOH) 65 pMW-Pthr-ydbK 8.0 Sterilization conditions: 115°C., 10 minutes US 7,833,761 B2 35 36 Example 6 Construction of a Plasmid to Express the Pyruvate Synthase Gene of Escherichia coli, Flavodoxin Composition of ethanol medium: NADP Reductase Gene of Escherichia coli, and Ethanol 20 ml L. Ferredoxin Gene of Escherichia coli MgSO 7H2O 1.0 g/L (NH4)2SO 12 g/L KH2PO 0.5 g/L The plasmid pMW-Pthr-fpr containing the flavodoxin Yeast extract 1.0 g/L FeSO4·7H2O 0.01 g/L NADP" reductase gene of Escherichia coli described in 10 MnSO 5H2O 0.01 g/L Example 3 was digested with SmaI, and the obtained fpr gene Kanamycin 40 mg/L. fragment was ligated with the plasmid pMW-Pthr-fdx con Streptomycin 20 mg/L. taining the ferredoxin gene of Escherichia coli treated with Calcium carbonate 30 g/L SmaI to obtain pMW-Pthr-fpr-fdx. Then, pMW-Pthr-ydbK pH 7.0 (adjusted with KOH) was digested with KpnI, and the ydbK gene fragment was 15 Sterilization conditions: 115°C., 10 minutes ligated with pMW-Pthr-fpr-fax treated with KpnI to construct a plasmid to enhance expression of the pyruvate synthase gene of Escherichia coli, flavodoxin NADP reductase gene TABLE 4 of Escherichia coli and ferredoxin fax gene, pMW-Pthr-fpr Lys EtOH ydbK-fax. Strain (g) (V/V 9%) OD620 WC196Amez adhE*/pCABD2/pMW-Pthr 2.47 O.OO 14.7 Example 7 WC196Amez adhE*/pCABD2/ 2.89 O.OO 9.3 Effect on L-Lysine-Producing Ability of a Strain with Enhanced Expression of the Pyruvate Synthase 25 Gene of Escherichia coli, Flavodoxin NADP" Example 8 Reductase Gene of Escherichia coli and Ferredoxin Gene of Escherichia coli Using Ethanol as the Construction of the Plasmid to Express the Carbon Source pyruvate:NADP. Oxidoreductase Gene of Euglena 30 gracilis and Measurement of Activity <7-1> Introduction of the Plasmid to Amplify the Pyruvate Euglena gracilis is a photosynthetic protist, with an opti Synthase Gene of Escherichia coli, Flavodoxin NADP" mum growth temperature of 27°C. The pyruvate:NADP" Reductase Gene of Escherichia coli and Ferredoxin Gene of oxidoreductase gene was isolated from this organism, and a Escherichia coli into WC196AmeZ adhE Strain 35 plasmid expressing this gene was constructed. pMW-Pthr-fpr-ydbK-fdx and the control vectorpMW-Pthr <8-1> Construction of the Plasmid to Express the pyruvat were introduced into WC196Amez adhE*/pCABD2 by elec e:NADP. Oxidoreductase Gene of Euglena gracilis troporation, respectively, and transformants were obtained on PCR was performed by using the chromosomal DNA of the basis of the kanamycin resistance, and introduction of the 40 Euglena gracilis as the template and the oligonucleotides plasmids were confirmed. The strain expressing the pyruvate shown in SEQ ID NOS: 40 and 41. The gene fragment was synthase gene of Escherichia coli was designated digested with KpnI, and the digested fragment was inserted WC196Amez adhE*/pCABD2/pMW-Pthr-fpr-ydbK-fdx, into the KpnI site of puC19 (Takara Bio) to construct a and the control strain was designated WC196Amez adhE*/ plasmid, which was designated puC-PNO. After it was con pCABD2/pMW-Pthr. 45 firmed that the pyruvate:NADP oxidoreductase gene con <7-2> Effect on L-Lysine-Producing Ability of the Strain tained no PCR error over the full length by using BigDye with Enhanced Expression of the Pyruvate Synthase Gene of Terminators v1. I Cycle Sequencing Kit, the pyruvate:NADP" Escherichia coli, Flavodoxin NADP Reductase Gene of oxidoreductase gene was excised from puC-PNO with KpnI, Escherichia coli and Ferredoxin Gene of Escherichia coli and inserted into the KpnI site of pMW-Pthr to construct the Using Ethanol as the Carbon Source> 50 plasmid pMW-Pthr-PNO. Both WC196Amez adhE*/pCABD2/pMW-Pthr and <8-2> Confirmation of Expression of pyruvate:NADP WC196Amez adhE*/pCABD2/pMW-Pthr-fpr-ydbK-fdx Oxidoreductase were inoculated onto LB plate medium, respectively, and pMW-Pthr-PNO and the control vector pMW-Pthr were cultured overnight at 37°C. The cells corresponding to /s of introduced into the WC196AcadAAldc/pCABD2 strain by the plate were inoculated into 20 ml of the ethanol medium 55 electroporation, respectively, and transformants were having the following composition in a 500 ml-volume Sak obtained on the basis of the kanamycin resistance, and intro aguchi flask, and aerobically cultured at a stirring rate of 120 duction of the plasmids was confirmed. The strain expressing rpm at 37°C. for 96 hours. L-lysine which accumulated in the the pyruvate:NADP' oxidoreductase gene of Euglena graci medium and residual ethanol were measured by using a Bio lis was designated WC196AcadAAldc/pCABD2/pMW-Pthr sensor BF-5 (Oji Scientific Instruments). The turbidity of the 60 PNO, and the control strain was designated medium was also measured. Averages of the values obtained WC196AcadAAldc/pCABD2/pMW-Pthr. in the culture performed in duplicate are shown in Table 4. The aforementioned strains were each inoculated into LB Improved production of L-lysine was observed for the strain medium containing 20 mg/l of streptomycin and 40 mg/l of with enhanced expression of the pyruvate synthase gene of kanamycin, and cultured overnight at 37°C. with shaking. 1 Escherichia coli, flavodoxin NADP" reductase gene of 65 ml of the medium was inoculated into 20 ml of LB medium Escherichia coli and ferredoxin gene of Escherichia coli, containing 20 mg/l of Streptomycin and 40 mg/l of kanamy compared with the control. cin, and cultured at 37°C. for 5 hours with shaking. The cells US 7,833,761 B2 37 38 were collected by centrifugation and Suspended in 1 ml of <10-2D Effect on L-Lysine-Producing Ability of the Strain PBS. The cells in the suspension were disrupted by using an with Enhanced Expression of the pyruvate:NADP. Oxi ultrasonicator, the suspension was centrifuged at 15000 rpm doreductase Gene of Euglena gracilis Using Oleic Acid as the for 15 minutes, and the Supernatant was used as a crude Carbon Source extract Protein concentration in the crude extract was mea Both WC196Amez/pCABD2/pMW-Pthr and sured by using Protein Assay CBB Solution (Nakalai WC196AmeZ/pCABD2/pMW-Pthr-PNO were inoculated Tesque), and the crude extract containing 10 ug of protein was used to prepare the samples. Each sample was prepared by onto the LB plate medium, respectively, and cultured over adding NuPAGE LDS Sample Buffer (Invitrogen) to the night at 37°C. The cells corresponding to /s of the plate were crude extractata concentration of 1.1.x, then adding NuPAGE 10 inoculated into 20 ml of the oleic acid medium having the Sample Reducing Agent (Invitrogen) to a final concentration following composition in a 500 ml-volume Sakaguchi flask of 10%, and heating the mixture at 70° C. for 10 minutes. The and aerobically cultured at a stirring rate of 120 rpm at 37°C. prepared sample was Subjected to electrophoresis using for 72 hours. L-lysine which accumulated in the medium was measured by using a Biosensor BF-5 (Oji Scientific Instru NuPAGE Tris-Acetate Gel 3-8% (Invitrogen). MagicMark 15 XPWestern Protein Standard (Invitrogen) was used as mark ments). The live cell count in the medium was also measured. CS. Averages of the values obtained in the culture performed in The gel after electrophoresis was transferred to a mem duplicate are shown in Table 5. Improvement in the produc brane by using iBlot Gel Transfer Device (Invitrogen). After tion of L-lysine was observed for the strain in which expres the transfer, the process from blocking to detection were sion of pyruvate:NADP oxidoreductase gene of Euglena performed by using WesternBreeze Chemiluminescent West gracilis was enhanced, compared with the control. ern Blot Immunodetection Kit (Invitrogen). First, the mem brane was subjected to a blocking treatment for 30 minutes, washed twice with purified water and incubated in an anti Composition of oleic acid medium: PNO serum solution diluted 1000 times for 1 hour. The mem 25 Sodium oleate 20 g/L brane was washed 3 times with a washing Solution, and incu MgSO 7H2O 1.0 g/L bated in a second antibody solution for 30 minutes. The (NH4)2SO 12 g/L membrane was washed 3 times with a washing Solution and KH2PO 0.5 g/L further twice with purified water, sprinkled with a detection Yeast extract 1.0 g/L 30 FeSO4·7H2O 0.01 g/L reagent, and Subjected to detection using Lumino-image Ana MnSO 5H2O 0.01 g/L lyzer LAS-1000 (Fuji Photo Film). The results are shown in Kanamycin 40 mg/L FIG.1. Aband presumed to be PNO was detected around 200 Streptomycin 20 mg/L. kD for the WC196AcadAAldc/pCABD2/pMW-Pthr-PNO Calcium carbonate 30 g/L strain, whereas a band was not detected for the control strain 35 pH 7.0 (adjusted with KOH) WC196AcadAAldc/pCABD2/pMW-Pthr. Sterilization conditions: 115°C., 10 minutes

Example 9 TABLE 5 Construction of the Plasmid to Express the 40 Live cell pyruvate:NADP. Oxidoreductase Gene of Euglena Strain Lys (g/l) count (10/ml) gracilis WC196AmezipCABD2/pMW-Pthr 1.77 22.3 WC196AmezipCABD2/pMW-Pthr-PNO 2.41 15.9 The pyruvate:NADP oxidoreductase gene fragment was excised from the plasmid puC-PNO described in Example 8 45 with KpnI and inserted into the KpnI site of pMW-Pthr to Example 11 construct the plasmid pMW-Pthr-PNO. Example 10 Effect on L-Lysine-Producing Ability of the Strain 50 with Enhanced Expression of the pyruvate:NADP" Effect on L-Lysine-Producing Ability of the Strain Oxidoreductase Gene of Euglena gracilis Using with Enhanced Expression of the pyruvate:NADP" Ethanol as the Carbon Source Oxidoreductase Gene of Euglena gracilis Using Oleic Acid as the Carbon Source 55 <11-12 Introduction of the Plasmid for Amplification of pyruvate:NADP. Oxidoreductase Gene of Euglena gracilis <10-1D Introduction of the Plasmid for Amplification of into WC196AmeZ adhE pyruvate:NADP. Oxidoreductase Gene of Euglena gracilis pMW-Pthr-PNO and the control vector pMW-Pthr were into the WC196AmeZ Strain introduced into WC196Amez adhE*/pCABD2 by electropo pMW-Pthr-PNO and the control vector pMW-Pthr were 60 introduced into WC196AmeZ/pCABD2 by electroporation, ration, respectively, and transformants were obtained on the respectively, and transformants were obtained on the basis of basis of the kanamycin resistance, and introduction of the the kanamycin resistance, and introduction of the plasmids plasmids was confirmed. The strain expressing the pyruvate: were confirmed. The strain expressing the pyruvate:NADP" NADP' oxidoreductase gene of Euglena gracilis was desig oxidoreductase gene of Euglena gracilis was designated 65 nated WC196Amez adhE*/pCABD2/pMW-Pthr-PNO, and WC196AmeZ/pCABD2/pMW-Pthr-PNO, and the control the control strain was designated WC196Amez adhE*/ strain was designated WC196Amez/pCABD2/pMW-Pthr. pCABD2/pMW-Pthr. US 7,833,761 B2 39 40 <11-2> Effect on L-Lysine-Producing Ability of the Strain SEQID NO: 11: Nucleotide sequence of E. coli ferredoxin with Enhanced Expression of the pyruvate:NADP. Oxi (yfhL) gene doreductase Gene of Euglena gracilis Using Ethanol as the SEQID NO: 12: Amino acid sequence encoded by E. coli Carbon Source ferredoxin(yfhL) gene Both WC196Amez adhE*/pCABD2/pMW-Pthr and SEQID NO: 13: Nucleotide sequence of E. coli flavodoxin WC196Amez adhE*/pCABD2/pMW-Pthr-PNO were each (fldA) gene inoculated onto LB plate medium, and precultured overnight SEQID NO: 14: Amino acid sequence encoded by E. coli at 37° C. The cells corresponding to /s of the plate were flavodoxin(fldA) gene inoculated into 20 ml of the ethanol medium having the SEQID NO: 15: Nucleotide sequence of E. coli flavodoxin following composition in a 500 ml-volume Sakaguchi flask 10 (fldB) gene and aerobically cultured at a stirring rate of 120 rpm at 37°C. SEQID NO: 16: Amino acid sequence encoded by E. coli for 96 hours. After 96 hours, 1 ml of the medium was sampled, flavodoxin(fldB) gene and L-lysine which had accumulated in the medium was SEQID NO: 17: Nucleotide sequence of C. tepidum ferre measured by using a Biosensor BF-5 (Oji Scientific Instru doxin I gene ments). The turbidity of the medium was also measured. 15 SEQ ID NO: 18: Amino acid sequence encoded by C. Averages of the values obtained in the culture performed in tepidum ferredoxin I gene duplicate are shown in Table 6. Improvement in the produc SEQID NO: 19: Nucleotide sequence of C. tepidum ferre tion of L-lysine was observed in the strain with enhanced doxin II gene expression of the pyruvate:NADP' oxidoreductase gene of SEQ ID NO: 20: Amino acid sequence encoded by C. Euglena gracilis, compared with the control. tepidum ferredoxin II gene SEQ ID NO: 21: Nucleotide sequence of E. coli alcohol dehydrogenase gene SEQID NO: 22: Amino acid sequence encoded by E. coli Composition of ethanol medium: alcohol dehydrogenase gene Ethanol 20 mL. 25 SEQ ID NO. 23: P promoter and chloramphenicol MgSO4·7HO 1.0 g/L resistance (Cm') gene amplification primer 1 (NH4)2SO 12 g/L SEQ ID NO: 24: P promoter and chloramphenicol KH2PO 0.5 g/L Yeast extract 1.0 g/L resistance (Cm') gene amplification primer 2 FeSO4·7HO 0.01 g/L SEQID NO: 25: Nucleotide sequence of P. promoter MnSO 5H2O 0.01 g/L 30 SEQ ID NO: 26: P promoter and chloramphenicol Kanamycin 40 mg/L. resistance (Cm') gene amplification primer 3 Streptomycin 20 mg/L SEQ ID NO: 27: P promoter and chloramphenicol Calcium carbonate 30 g/L resistance (Cm') gene amplification primer 4 pH 7.0 (adjusted with KOH) SEQID NO:28: Kanamycin resistance (Cm) gene ampli Sterilization conditions: 115°C., 10 minutes 35 fication primer 1 SEQID NO:29: Kanamycin resistance (Cm) gene ampli fication primer 2 TABLE 6 SEQID NO:30: Kanamycin resistance (Cm) gene ampli Lys EtOH fication primer 3 Strain (g) (V/V 9%) OD620 40 SEQID NO:31: Kanamycin resistance (Cm) gene ampli WC196Amez adhE*/pCABD2/pMW-Pthr 2.47 O.OO 14.7 fication primer 4 WC196Amez adhE*/pCABD2/ 2.89 O.OO 9.3 SEQ ID NO: 32: E. coli mutant alcohol dehydrogenase gene amplification primer 1 SEQ ID NO: 33: E. coli mutant alcohol dehydrogenase Explanation of Sequence Listing: 45 gene amplification primer 2 SEQID NO: 1: Nucleotide sequence of C. tepidum pyru SEQ ID NO. 34: E. coli mutant alcohol dehydrogenase vate synthase gene gene amplification primer 3 SEQID NO: 2: Amino acid sequence of C. tepidum pyru SEQID NO:35: C. tepidum pyruvate synthase gene ampli vate synthase 50 fication primer 1 SEQ ID NO:3: Nucleotide sequence of E. coli pyruvate SEQID NO:36: C. tepidum pyruvate synthase gene ampli synthase gene fication primer 2 SEQID NO: 4: Amino acid sequence of E. coli pyruvate SEQID NO:37: Threonine operon promoter sequence synthase SEQID NO:38: E. coli pyruvate synthase gene amplifica tion primer 1 SEQID NO. 5: Nucleotide sequence of E. gracilis pyru 55 SEQID NO:39: E. coli pyruvate synthase gene amplifica vate:NADP" oxidoreductase gene tion primer 2 SEQID NO: 6: Amino acid sequence of E. gracilis pyru SEQID NO: 40: E. gracilis pyruvate:NADP" oxidoreduc vate:NADP" oxidoreductase gene tase gene amplification primer 1 SEQID NO: 7: Nucleotide sequence of E. coli flavodoxin 60 SEQID NO: 41: E. gracilis pyruvate:NADP" oxidoreduc NADP" reductase(fpr) gene tase gene amplification primer 2 SEQID NO: 8: Amino acid sequence encoded by E. coli E. SEQID NO:42: E. coli flavodoxin NADP" reductase gene coli flavodoxin NADP reductase(fpr) gene amplification primer 1 SEQID NO: 9: Nucleotide sequence of E. coli ferredoxin SEQID NO:43: E. coli flavodoxin NADP" reductase gene (fdx) gene 65 amplification primer 2 SEQID NO: 10: Amino acid sequence encoded by E. coli SEQID NO: 44: E. coli fax gene amplification primer 1 ferredoxin(fdx) gene SEQID NO. 45: E. coli fax gene amplification primer 2 US 7,833,761 B2

SEQID NO: 46: Nucleotide sequence of E. coli pyruvate SEQ ID NO: 53: Amino acid sequence of malic enzyme dehydrogenase Ep1 subunit gene (aceE) encoded by E. coli SfcA gene SEQID NO: 47: Amino acid sequence of E. coli pyruvate SEQ ID NO. 54: Nucleotide sequence of gene (b2463) dehydrogenase Ep1 subunit encoding E. coli malic enzyme 5 SEQ ID NO: 55: Amino acid sequence of malic enzyme SEQ ID NO:48: Nucleotide sequence of E. coli pyruvate encoded by E. coli b2463 gene dehydrogenase E2 subunit gene (aceF) SEQID NO: 49: Amino acid sequence of E. coli pyruvate INDUSTRIAL APPLICABILITY dehydrogenase E2 subunit B y uS1nging theune mim1croorganism offth une presentti 1nvenuon, ti an d SS ID NO : 5.U: Nulls site of E. coli pyruvate 10 L-amino acid can be efficiently produced by fermentation. ehydrogenase E3 subunit gene (lpdA) Moreover, according to a preferred embodiment of the SEQ ID NO:51: Amino acid sequence of E. coli pyruvate method of the present invention, the method of the present dehydrogenase E3 subunit invention is an environmentally-friendly method which can SEQ ID NO: 52: Nucleotide sequence of gene (SfcA) reduce carbon dioxide emission by Suppressing decarboxy encoding E. coli malic enzyme lation and utilizing carbon dioxide fixation.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS: 55

<21 Os SEQ ID NO 1 &211s LENGTH: 355.8 &212s. TYPE: DNA <213> ORGANISM: Chlorobium tepidum 22 Os. FEATURE: <221s NAME/KEY: CDS <222s. LOCATION: (1) ... (3558)

<4 OOs SEQUENCE: 1 atg acc C9g aca ttic aag aca atg gag ggg aat gala gct Ctt gct cat 48 Met Thr Arg Thr Phe Llys Thr Met Glu Gly Asn Glu Ala Lieu Ala His 1. 5 1O 15

gtc gcc tat cqc act aat gaa gtc atc. tcg at a tac ccg att acc cc.g 96 Val Ala Tyr Arg Thr Asn Glu Val Ile Ser Ile Tyr Pro Ile Thr Pro 2O 25 3 O

gca tot ccg atg gga gag tact co gac gca tig gcc gct gtc gat gta 144 Ala Ser Pro Met Gly Glu Tyr Ser Asp Ala Trp Ala Ala Val Asp Wall 35 4 O 45

aaa aat atc tig ggit acc gtg cca ctic gtc. aat gag atg cag agc gaa 192 Lys Asn Ile Trp Gly Thr Val Pro Leu Val Asn Glu Met Glin Ser Glu SO 55 60

gcc ggit gcc gcc gcc gcc gtt Cac ggc gcg ttg cag acc ggc gcg Ctg 24 O Ala Gly Ala Ala Ala Ala Wal His Gly Ala Lieu. Glin Thr Gly Ala Lieu. 65 70 7s 8O

acg acc acc titc acg gcc tot cag gigt ct c tta citg atg atc cc.g aac 288 Thir Thr Thr Phe Thr Ala Ser Glin Gly Lieu. Leu Lleu Met Ile Pro Asn 85 90 95

atg tac aag at C gcc ggit gala Ctg acc CCC to gtg att Cac gitg tca 336 Met Tyr Lys Ile Ala Gly Glu Lieu. Thr Pro Cys Val Ile His Val Ser 1OO 105 110

gcc ct tcg ctg gcc gcg cag gog Ctc. tcg at a tt C to gaC cac ggit 384 Ala Arg Ser Lieu Ala Ala Glin Ala Lieu. Ser Ile Phe Cys Asp His Gly 115 12O 125

gac gitg atgtcg gtC agg ggc acc ggc titc gcg Ctg Ct c gct tcc tit 432 Asp Wal Met Ser Val Arg Gly Thr Gly Phe Ala Lieu. Lieu Ala Ser Cys 13 O 135 14 O

tog gta Cag gag gta atg gac atg gcg Ctg att tog cag gcc gca acg 48O Ser Val Glin Glu Val Met Asp Met Ala Lieu. Ile Ser Glin Ala Ala Thr 145 15 O 155 16 O

ctic gaa tog cqc gtg cca ttc ctd cac titc ttic gac ggc titc cqc acg 528 Lieu. Glu Ser Arg Val Pro Phe Lieu. His Phe Phe Asp Gly Phe Arg Thr 1.65 17 O 17s

US 7,833,761 B2 49

- Continued Asp Arg Lieu Lys Glu Gly Lieu. Asn Pro Lieu Gln Lieu. Asp Ser Lys 15 2O 25 aag ccg aaa atg ccg gtC gog gag titc ctgaac atg gag aac cqc 3.429 Llys Pro Llys Met Pro Val Ala Glu Phe Lieu. Asn Met Glu Asn Arg 3O 35 4 O ttic aga at a citg aag aag acc cac ccc gat Ctg gcc aag aag tac 3474 Phe Arg Ile Lieu Lys Llys Thr His Pro Asp Lieu Ala Lys Llys Tyr 45 SO 55 ttic gag gca at C cag cac gag gtc. aat gcc cqc tig gca cac tac 3519 Phe Glu Ala Ile Gln His Glu Val Asn Ala Arg Trp Ala His Tyr 60 65 70 gaa cac ctic gcc aac ct tcg att gala ggc gala gca taa 35.58 Glu. His Lieu Ala Asn Arg Ser Ile Glu Gly Glu Ala

<210s, SEQ ID NO 2 &211s LENGTH: 1185 212. TYPE: PRT <213> ORGANISM: Chlorobium tepidum <4 OOs, SEQUENCE: 2 Met Thr Arg Thr Phe Lys Thr Met Glu Gly Asn Glu Ala Leu Ala His 1. 5 1O 15 Val Ala Tyr Arg Thr Asn Glu Val Ile Ser Ile Tyr Pro Ile Thr Pro 2O 25 3O Ala Ser Pro Met Gly Glu Tyr Ser Asp Ala Trp Ala Ala Val Asp Wall 35 4 O 45 Lys Asn Ile Trp Gly Thr Val Pro Leu Val Asn Glu Met Glin Ser Glu SO 55 6 O Ala Gly Ala Ala Ala Ala Wal His Gly Ala Lieu. Glin Thr Gly Ala Lieu 65 70 7s 8O Thir Thir Thr Phe Thr Ala Ser Glin Gly Lieu. Leu Lleu Met Ile Pro Asn 85 90 95 Met Tyr Lys Ile Ala Gly Glu Lieu. Thr Pro Cys Val Ile His Val Ser 1OO 105 11 O Ala Arg Ser Lieu Ala Ala Glin Ala Lieu. Ser Ile Phe Cys Asp His Gly 115 12 O 125 Asp Wal Met Ser Val Arg Gly Thr Gly Phe Ala Lieu. Lieu Ala Ser Cys 13 O 135 14 O Ser Val Glin Glu Val Met Asp Met Ala Lieu. Ile Ser Glin Ala Ala Thr 145 150 155 160 Lieu. Glu Ser Arg Val Pro Phe Lieu. His Phe Phe Asp Gly Phe Arg Thr 1.65 17O 17s Ser His Glu Ile Ser Lys Ile Glu Val Lieu. Ser Asp Glu Glin Ile Arg 18O 185 19 O Ser Met Ile Asin Asp Glu Lieu Val Phe Ala His Arg Met Arg Arg Met 195 2OO 2O5 Ser Pro Asp Ala Pro Ile Ile Arg Gly Thr Ser Glin Asn Pro Asp Val 21 O 215 22O Tyr Phe Glin Ala Arg Glu Ser Val Asn Llys Tyr Tyr Glu Ala Cys Pro 225 23 O 235 24 O Ser Ile Thr Glin Lys Ala Met Asp Glin Phe Ala Lys Lieu. Thr Gly Arg 245 250 255 Ser Tyr Lys Lieu. Tyr Glin Tyr Tyr Gly Ala Pro Asp Ala Asp Arg Ile 26 O 265 27 O Ile Ile Met Met Gly Ser Gly Ala Glu Thir Ala Lieu. Glu Thr Val Glu US 7,833,761 B2 51 52

- Continued

27s 28O 285

Luell Asn Asn His Gly Glu Wall Gly Luell Wall Lys Wall Arg Luell 29 O 295 3 OO

Phe Arg Pro Phe Asp Wall Ala Thir Phe Ile Ala Ser Lell Pro Ser Ser 3. OS 310 315 32O

Wall Ser Ile Ala Wall Lell Asp Arg Wall Glu Pro Gly Ser Ala 3.25 330 335

Gly Glu Pro Luell Tyr Lell Asp Wall Wall Asn Ala Wall Ala Glu Ser 34 O 345 35. O

Glin Glu Gly Cys Ala Ser Met Pro Ser Wall Lell Gly Gly Arg 355 360 365

Gly Luell Ser Ser Lys Glu Phe Thir Pro Ala Met Wall Ala Ile Phe 37 O 375 38O

Asp Asn Met Asn Ala Glu Ser Pro Asn His Phe Thir Wall Gly Ile 385 390 395 4 OO

Asp Asp Asp Wall Thir Ser Luell Ala Asp Glu Thir Phe Ser 4 OS 415

Ile Glu Pro Asp Ser Wall Phe Arg Ala Luell Phe Gly Luell Gly Ser 425 43 O

Asp Gly Thir Wall Gly Ala Asn Lys Asn Ser Ile Ile Ile Gly Glu 435 44 O 445

Asn Thir Asp Asn Tyr Ala Glin Gly Phe Phe Wall Tyr Asp Ser 450 45.5 460

Ala Gly Ser Ile Thir Thir Ser His Luell Arg Phe Gly Pro Glu Glin Ile 465 470 48O

Arg Ser Thir Lell Ile Thir Glu Ala Glin Phe Wall Gly His His 485 490 495

Trp Wall Phe Luell Glu Met Ile Asp Wall Ala Asn Lell Lys Glin Gly SOO 505

Gly Thir Luell Luell Ile Asn Ser Ala Ala Pro Asp Wall Wall Trp Ser 515 525

Luell Pro Arg Pro Wall Glin Glin His Luell Ile Asp Glin Ala 53 O 535 54 O

Lell Thir Ile Asp Ala Wall Ala His Glu Ser Gly Met Gly 5.45 550 555 560

Glin Arg Ile Asn Thir Ile Met Glin Ala Cys Phe Phe Ala Ile Ser Gly 565 st O sts

Wall Luell Pro Arg Glu Glu Ala Ile Glu Ile Asp Ala Ile Arg 585 59 O

His Thir Tyr Gly Lys Gly Asp Glu Wall Wall Glin Glin Asn Ile 595 605

Ala Wall Asp Asn Thir Lell Ala Asn Luell His Glu Wall Ile Gly Ala 610 615

Wall Ala Asp Ser Thir Lys Glu Luell Arg Ser Pro Ile Wall Gly Asp Ala 625 630 635 64 O

Pro Glu Phe Wall Cys Asn Wall Luell Ala Lys Ile Ile Ala Gly Glu Gly 645 650 655

Asp Ser Ile Pro Wall Ser Luell Pro Ala Asp Gly Thir Tyr Pro Luell 660 665 67 O

Gly Thir Thir Phe Glu Arg Asn Luell Ala Glin Glu Ile Pro Wall 675 685

Trp Ala Pro Glu Lell Ile Glu Gly Cys Ser Met Wall Cys 69 O. 695 7 OO US 7,833,761 B2 53

- Continued

Pro His Ala Ala Ile Arg Ile Llys Val Tyr Glu Pro Llys His Lieu. Glu 7 Os 71O 71s 72O Asn Ala Pro Ala Thr Phe Llys Ser Lieu. Asp Ala Lys Ala Lys Asn Trp 72 73 O 73 Glu Gly Met Arg Tyr Thr Val Glin Ile Ala Pro Glu Asp Cys Thr Gly 740 74. 7 O Cys Glin Lieu. Cys Val Asn Ala Cys Pro Ala Arg Asp Llys Glin Val Glu 7ss 760 765 Gly Arg Lys Ala Lieu. Asn Met His Glu Glin Ala Pro Lieu. Arg Glu Thir 770 775 78O Glu Ser Ala Cys Trp Ser Phe Phe Ile Asn Lieu Pro Glu Phe Asp Arg 78s 79 O 79. 8OO Asn Lys Ile Asin Glin Arg Lieu. Ile Lys Glu Glin Gln Lieu. Glin Glin Pro 805 810 815 Lieu. Phe Glu Phe Ser Gly Ala Cys Ser Gly Cys Gly Glu Thr Pro Tyr 82O 825 83 O Val Llys Lieu Met Thr Glin Lieu. Phe Gly Asp Arg Lieu Val Ile Gly Asn 835 84 O 845 Ala Thr Gly Cys Ser Ser Ile Tyr Gly Gly Asn Lieu Pro Thr Thr Pro 850 855 860 Tyr Ala Ala Asn Pro Glin Gly Lieu. Gly Pro Thr Trp Ser Asn Ser Lieu. 865 87O 87s 88O Phe Glu Asp Thir Ala Glu Phe Ala Lieu. Gly Phe Arg Ile Ser Ile Asp 885 890 895 Lys Glin Glin Glin Phe Ala Lys Glu Lieu Val Lys Llys Lieu Ala Gly Asp 9 OO 905 91 O Ile Gly Glu Asn Lieu Ala Thr Ala Ile Lieu. Asn Ala Thr Glin Asn. Ser 915 92 O 925 Glu Pro Glu Ile Phe Glu Glin Arg Glu Arg Val Ala Val Lieu Lys Asp 93 O 935 94 O Llys Lieu. Glin Gln Met Lys Ser Asp Asp Ala Lys Asn Lieu. Lieu Ala Val 945 950 955 96.O Ala Asp Met Lieu Val Llys Llys Ser Val Trp Ala Val Gly Gly Asp Gly 965 97O 97. Trp Ala Tyr Asp Ile Gly Tyr Gly Gly Lieu. Asp His Val Thir Ala Ser 98O 985 99 O Gly Lys Asn Val Asn Met Lieu Val Lieu. Asp Thr Glu Val Tyr Ser Asn 995 1OOO 1005 Thr Gly Gly Glin Ala Ser Lys Ala Thr Pro Lys Ala Ala Ile Ala O1O O15 O2O Llys Phe Ala Ala Ala Gly Arg Ile Ala Thr Llys Lys Asp Lieu. Gly O25 O3 O O35 Lieu. Ile Ser Met Ser Tyr Gly Asn Ala Tyr Val Ala Ser Val Ala O4 O O45 OSO Lieu. Gly Ala Arg Asp Glu Glin Thir Lieu. Arg Ala Phe Ile Glu Ala O55 O6 O O65 Glu Ala Tyr Asp Gly Pro Ser Ile Ile Ile Ala Tyr Ser His Cys Of O O7 O8O Ile Ala His Gly Phe Asp Lieu. Ser Met Gly Lieu. Glu. His Gln Lys O85 O9 O O95 Ala Ala Val Asp Ser Gly His Trp Lieu. Lieu. Tyr Arg Tyr Asn Pro 1 OO 105 11 O

US 7,833,761 B2 63 64

- Continued

1155 1160 1165 gaa aaa agc aac acc gat taa 3525 Glu Lys Ser Asn. Thir Asp 1170

<210s, SEQ ID NO 4 &211s LENGTH: 1174 212. TYPE: PRT <213> ORGANISM: Escherichia coli

<4 OOs, SEQUENCE: 4

Met Ile Thir Ile Asp Gly Asn Gly Ala Wall Ala Ser Wall Ala Phe Arg 1. 5 15

Thir Ser Glu Wall Ile Ala Ile Pro Ile Thir Pro Ser Ser Thir Met 2O 25

Ala Glu Glin Ala Asp Ala Trp Ala Gly Asn Gly Lell Lys Asn Wall Trp 35 4 O 45

Gly Asp Thr Pro Arg Val Val Glu Met Glin Ser Glu Ala Gly Ala Ile SO 55 6 O

Ala Thr Val His Gly Ala Lieu Glin Thir Gly Ala Lell Ser Thir Ser Phe 65 70

Thir Ser Ser Glin Gly Lieu. Leu Luell Met Ile Pro Thir Lell Lys Luell 85 90 95

Ala Gly Glu Lieu. Thr Pro Phe Wall Luell His Wall Ala Ala Arg Thir Wall 1OO 105 11 O

Ala Thr His Ala Lieu. Ser Ile Phe Gly Asp His Ser Asp Wall Met Ala 115 12 O 125

Val Arg Glin Thr Gly Cys Ala Met Luell Ala Ala Asn Wall Glin Glu 13 O 135 14 O

Ala Glin Asp Phe Ala Lieu. Ile Ser Glin Ile Ala Thir Lell Ser Arg 145 150 155 160

Wall Pro Phe Ile His Phe Phe Asp Gly Phe Arg Thir Ser His Glu Ile 1.65 17O

Asn Lys Ile Val Pro Lieu Ala Asp Asp Thir Ile Lell Asp Lel Met Pro 18O 185 19 O

Glin Val Glu Ile Asp Ala His Arg Ala Arg Ala Lell Asn Glu His 195

Pro Val Ile Arg Gly. Thir Ser Ala Asn Pro Asp Thir Phe Glin Ser 21 O 215 22O

Arg Glu Ala Thir ASn Pro Trp Asn Ala Wall Asp His Wall Glu 225 23 O 235 24 O

Glin Ala Met Asn Asp Phe Ser Ala Ala Thir Gly Arg Glin Glin Pro 245 250 255

Phe Glu Tyr Tyr Gly His Pro Glin Ala Glu Arg Wall Ile Ile Luell Met 26 O 265 27 O

Gly Ser Ala Ile Gly Thr Cys Glu Glu Wall Wall Asp Glu Luell Luell Thir 27s 285

Arg Gly Glu, Llys Val Gly Val Luell Wall Arg Lell Tyr Arg Pro Phe 29 O 295 3 OO

Ser Ala Lys His Lieu. Lieu. Glin Ala Luell Pro Gly Ser Wall Arg Ser Wall 3. OS 310 315

Ala Val Lieu. Asp Arg Thr Lys Glu Pro Gly Ala Glin Ala Glu Pro Luell 3.25 330 335

Tyr Lieu. Asp Val Met Thr Ala Luell Ala Glu Ala Phe Asn Asn Gly Glu 34 O 345 35. O US 7,833,761 B2 65 66

- Continued

Arg Glu Thir Luell Pro Arg Wall Ile Gly Gly Arg Tyr Gly Lieu. Ser Ser 355 360 365

Glu Phe Gly Pro Asp Cys Wall Luell Ala Wall Phe Ala Glu Luell Asn 37 O 375

Ala Ala Pro Ala Arg Phe Thir Wall Gly Ile Tyr Asp Asp Wall 385 390 395 4 OO

Thir Asn Luell Ser Lell Pro Lell Pro Glu Asn Thir Lell Pro Asn Ser Ala 4 OS 415

Luell Glu Ala Lell Phe Gly Luell Gly Ser Asp Gly Ser Wall Ser 425 43 O

Ala Thir Lys Asn Asn Ile Ile Ile Gly ASn Ser Thir Pro Trp 435 44 O 445

Ala Glin Gly Tyr Phe Wall Tyr Asp Ser Lys Ala Gly Gly Luell Thir 450 45.5 460

Wall Ser His Luell Arg Wall Ser Glu Glin Pro Ile Arg Ser Ala Luell 465 470

Ile Ser Glin Ala Asp Phe Wall Gly His Glin Lell Glin Phe Ile Asp 485 490 495

Glin Met Ala Glu Arg Luell Lys Pro Gly Gly Ile Phe Luell Luell SOO 505

Asn Thir Pro Ser Ala Asp Glu Wall Trp Ser Arg Lell Pro Glin Glu 515 52O 525

Wall Glin Ala Wall Lell Asn Glin Ala Arg Phe Wall Ile Asn 53 O 535 54 O

Ala Ala Ile Ala Arg Glu Gly Luell Ala Ala Arg Ile Asn Thir 5.45 550 555 560

Wall Met Glin Met Ala Phe Phe His Luell Thir Glin Ile Lell Pro Gly Asp 565 st O sts

Ser Ala Luell Ala Glu Lell Glin Gly Ala Ile Ala Ser Tyr Ser Ser 585 59 O

Gly Glin Asp Lell Wall Glu Arg Asn Trp Glin Ala Lell Ala Luell Ala 595 605

Arg Glu Ser Wall Glu Glu Wall Pro Luell Glin Pro Wall Asn Pro His Ser 610 615

Ala Asn Arg Pro Pro Wall Wall Ser Asp Ala Ala Pro Asp Phe Wall Lys 625 630 635 64 O

Thir Wall Thir Ala Ala Met Lell Ala Gly Luell Gly Asp Ala Luell Pro Wall 645 650 655

Ser Ala Luell Pro Pro Asp Gly Thir Trp Pro Met Gly Thir Thir Arg Trp 660 665 67 O

Glu Arg Asn Ile Ala Glu Glu Ile Pro Ile Trp Lys Glu Glu Luell 675 685

Thir Glin Asn His Cys Wall Ala Ala Cys Pro His Ser Ala Ile 69 O. 695 7 OO

Arg Ala Wall Wall Pro Pro Glu Ala Met Glu Asn Ala Pro Ala Ser 7 Os

Lell His Ser Luell Asp Wall Ser Arg Asp Met Arg Gly Glin Lys 72 73 O 73

Wall Luell Glin Wall Ala Pro Glu Asp Cys Thir Gly Asn Luell Wall 740 74. 7 O

Glu Wall Cys Pro Ala Asp Arg Glin Asn Pro Glu Ile Ala Ile 7ss 760 765 US 7,833,761 B2 67

- Continued Asn Met Met Ser Arg Lieu. Glu. His Val Glu Glu Glu Lys Ile Asn Tyr 770 775 78O Asp Phe Phe Lieu. Asn Lieu Pro Glu Ile Asp Arg Ser Llys Lieu. Glu Arg 78s 79 O 79. 8OO Ile Asp Ile Arg Thr Ser Gln Lieu. Ile Thr Pro Leu Phe Glu Tyr Ser 805 810 815 Gly Ala Cys Ser Gly Cys Gly Glu Thr Pro Tyr Ile Llys Lieu. Lieu. Thr 82O 825 83 O Glin Lieu. Tyr Gly Asp Arg Met Lieu. Ile Ala Asn Ala Thr Gly Cys Ser 835 84 O 845 Ser Ile Tyr Gly Gly Asn Lieu Pro Ser Thr Pro Tyr Thr Thr Asp Ala 850 855 860 Asn Gly Arg Gly Pro Ala Trp Ala Asn. Ser Lieu. Phe Glu Asp Asn Ala 865 87O 87s 88O Glu Phe Gly Lieu. Gly Phe Arg Lieu. Thr Val Asp Gln His Arg Val Arg 885 890 895 Val Lieu. Arg Lieu. Lieu. Asp Glin Phe Ala Asp Llys Ile Pro Ala Glu Lieu 9 OO 905 91 O Lieu. Thir Ala Lieu Lys Ser Asp Ala Thr Pro Glu Val Arg Arg Glu Glin 915 92 O 925 Val Ala Ala Lieu. Arg Glin Glin Lieu. Asn Asp Val Ala Glu Ala His Glu 93 O 935 94 O Lieu. Lieu. Arg Asp Ala Asp Ala Lieu Val Glu Lys Ser Ile Trp Lieu. Ile 945 950 955 96.O Gly Gly Asp Gly Trp Ala Tyr Asp Ile Gly Phe Gly Gly Lieu. Asp His 965 97O 97. Val Lieu. Ser Lieu. Thr Glu Asn Val Asn. Ile Lieu Val Lieu. Asp Thr Glin 98O 985 99 O Tyr Ser Asn Thr Gly Gly Glin Ala Ser Lys Ala Thr Pro Leu Gly 995 1OOO 1005 Ala Val Thr Llys Phe Gly Glu. His Gly Lys Arg Lys Ala Arg Llys O1O O15 O2O Asp Leu Gly Val Ser Met Met Met Tyr Gly His Val Tyr Val Ala O25 O3 O O35 Glin Ile Ser Lieu. Gly Ala Glin Lieu. Asn Glin Thr Val Lys Ala Ile O4 O O45 OSO Gln Glu Ala Glu Ala Tyr Pro Gly Pro Ser Lieu. Ile Ile Ala Tyr O55 O6 O O65 Ser Pro Cys Glu Glu. His Gly Tyr Asp Lieu Ala Lieu. Ser His Asp Of O O7 O8O Gln Met Arg Gln Lieu. Thir Ala Thr Gly Phe Trp Pro Leu Tyr Arg O85 O9 O O95 Phe Asp Pro Arg Arg Ala Asp Glu Gly Lys Lieu Pro Lieu Ala Lieu. 1 OO O5 11 O Asp Ser Arg Pro Pro Ser Glu Ala Pro Glu Glu Thir Lieu. Lieu. His 115 2O 125 Glu Glin Arg Phe Arg Arg Lieu. Asn. Ser Glin Gln Pro Glu Val Ala 13 O 35 14 O Glu Gln Lieu. Trp Lys Asp Ala Ala Ala Asp Lieu. Glin Lys Arg Tyr 145 SO 155 Asp Phe Lieu Ala Gln Met Ala Gly Lys Ala Glu Lys Ser Asn Thr 16 O 65 17 O Asp

US 7,833,761 B2 81 82

- Continued

Wall Ala Luell Tyr Ser Thir Ile Ile Gly Glin Asp Lys Gly Lys Glu Pro 25

Thir Gly Arg Thir Tyr Thir Ser Gly Pro Pro Ala Ser His Ile Glu 35 4 O 45

Wall Pro His His Wall Thir Wall Pro Ala Thir Asp Arg Thir Pro Asn Pro SO 55 6 O

Asp Ala Glin Phe Phe Glin Ser Wall Asp Gly Ser Glin Ala Thir Ser His 65 70

Wall Ala Ala Lell Ser Asp Thir Ala Phe Ile Pro Ile Thir Pro 85 90 95

Ser Ser Wall Met Gly Lell Ala Asp Wall Trp Met Ala Glin Gly Arg 105 11 O

Asn Ala Phe Gly Wall Wall Asp Wall Arg Glu Met Glin Ser Glu 115 12 O 125

Ala Gly Ala Ala Gly Lell His Gly Ala Luell Ala Ala Gly Ala Ile 13 O 135 14 O

Ala Thir Thir Phe Thir Ser Glin Gly Luell Luell Lell Met Ile Pro Asn 145 155 160

Met Ile Ala Glu Luell Met Pro Ser Wall Ile His Wall Ala 1.65 17O 17s

Ala Arg Glu Luell Ala His Ala Luell Ser Ile Phe Gly Gly His Ala 18O 185 19 O

Asp Wall Met Ala Wall Arg Glin Thir Gly Trp Ala Met Lell Ser His 195

Thir Wall Glin Glin Ser His Asp Met Ala Luell Ile Ser His Wall Ala Thir 21 O 215 22O

Lell Ser Ser Ile Pro Phe Wall His Phe Phe Asp Gly Phe Arg Thir 225 23 O 235 24 O

Ser His Glu Wall Asn Ile Met Luell Pro Ala Glu Luell 245 250 255

Luell Wall Pro Pro Gly Thir Met Glu Glin His Trp Ala Arg Ser Luell 26 O 265 27 O

Asn Pro Met His Pro Thir Ile Arg Gly Thir ASn Glin Ser Ala Asp Ile 285

Phe Glin Asn Met Glu Ser Ala Asn Glin Tyr Tyr Thir Asp Luell Ala 29 O 295 3 OO

Glu Wall Wall Glin Glu Thir Met Asp Glu Wall Ala Pro Ile Gly Arg 3. OS 310 315

His Ile Phe Glu Tyr Wall Gly Ala Pro Asp Ala Glu Glu Wall 3.25 330 335

Thir Wall Luell Met Gly Ser Gly Ala Thir Thir Wall Asn Glu Ala Wall Asp 34 O 345 35. O

Lell Luell Wall Gly Lys Wall Gly Ala Wall Lell Wall His Luell 355 360 365

Arg Pro Trp Ser Thir Lys Ala Phe Glu Lys Wall Lell Pro Thir 37 O 375

Wall Arg Ile Ala Ala Lell Asp Arg Lys Glu Wall Thir Ala Luell 385 390 395 4 OO

Gly Glu Pro Luell Tyr Lell Asp Wall Ser Ala Thir Lell Asn Luell Phe Pro 4 OS 41O 415

Glu Arg Glin Asn Wall Wall Ile Gly Gly Arg Gly Luell Gly Ser 42O 425 43 O US 7,833,761 B2 83 84

- Continued

Asp Phe Ile Pro Glu His Ala Luell Ala Ile Tyr Ala Asn Luell Ala 435 44 O 445

Ser Glu Asn Pro Ile Glin Arg Phe Thir Wall Gly Ile Thir Asp Asp Wall 450 45.5 460

Thir Gly Thir Ser Wall Pro Phe Wall Asn Glu Arg Wall Asp Thir Luell Pro 465 470

Glu Gly Thir Arg Glin Wall Phe Trp Gly Ile Gly Ser Asp Gly Thir 485 490 495

Wall Gly Ala Asn Arg Ser Ala Wall Arg Ile Ile Gly Asp Asn Ser Asp SOO 505

Lell Met Wall Glin Ala Phe Glin Phe Asp Ala Phe Lys Ser Gly Gly 515 525

Wall Thir Ser Ser His Lell Arg Phe Gly Pro Pro Ile Thir Ala Glin 53 O 535 54 O

Tyr Luell Wall Thir Asn Ala Asp Ile Ala Cys His Phe Glin Glu Tyr 5.45 550 555 560

Wall Arg Phe Asp Met Lell Asp Ala Ile Arg Glu Gly Gly Thir Phe 565 st O sts

Wall Luell Asn Ser Arg Trp Thir Thir Glu Asp Met Glu Glu Ile Pro 585 59 O

Ala Asp Phe Arg Arg Lell Ala Glin Wall Arg Phe Asn 595 605

Wall Asp Ala Arg Ile Cys Asp Ser Phe Gly Lell Gly Arg Ile 610 615

Asn Met Luell Met Glin Ala Phe Phe Luell Ser Gly Wall Luell Pro 625 630 635 64 O

Lell Ala Glu Ala Glin Arg Lell Luell Asn Glu Ser Ile Wall His Glu 645 650 655

Gly Gly Gly Wall Wall Glu Met ASn Glin Ala Wall Wall Asn 660 665 67 O

Ala Wall Phe Ala Gly Asp Lell Pro Glin Glu Wall Glin Wall Pro Ala Ala 675 685

Trp Ala Asn Ala Wall Asp Thir Ser Thir Arg Thir Pro Thir Gly Ile Glu 69 O. 695 7 OO

Phe Wall Asp Ile Met Arg Pro Luell Met Asp Phe Gly Asp Glin 7 Os

Lell Pro Wall Ser Wall Met Thir Pro Gly Gly Thir Phe Pro Wall Gly Thir 72 73 O 73

Thir Glin Ala Lys Arg Ala Ile Ala Ala Phe Ile Pro Glin Trp Ile 740 74. 7 O

Pro Ala Asn Thir Glin Asn Tyr Ser Wall Pro His 760 765

Ala Thir Ile Arg Pro Phe Wall Luell Thir Glin Glu Wall Glin Luell Ala 770 775

Pro Glu Ser Phe Wall Thir Arg Ala Gly Asp Glin Gly Met 79 O 79.

Asn Phe Arg Ile Glin Wall Ala Pro Glu Asp Thir Gly Glin Wall 805 810 815

Wall Glu Thir Pro Asp Asp Ala Luell Glu Met Thir Asp Ala Phe 825 83 O

Thir Ala Thir Pro Wall Glin Arg Thir Asn Trp Glu Phe Ala Ile Wall 835 84 O 845

Pro Asn Arg Gly Thir Met Thir Asp Arg Ser Lell Gly Ser Glin US 7,833,761 B2 85 86

- Continued

850 855 860

Phe Glin Glin Pro Leu. Lell Glu Phe Ser Gly Ala Cys Glu Gly Cys Gly 865 88O

Glu Thir Pro Tyr Val Lieu. Lieu. Thr Glin Luell Phe Gly Glu Arg Thr 885 890 895

Wall Ile Ala Asn Ala Thir Gly Cys Ser Ser Ile Trp Gly Gly Thir Ala 9 OO 905 91 O

Gly Lieu Ala Pro Tyr Thir Thir Asn Ala Gly Gln Gly Pro Ala Trp 915 92 O 925

Gly Asn. Ser Lieu. Phe Glu Asp Asn Ala Glu Phe Gly Phe Gly Ile Ala 93 O 935 94 O

Wall Ala Asn Ala Glin Lys Arg Ser Arg Wall Arg Asp Cys Ile Lieu. Glin 945 950 955 96.O

Ala Wall Glu Wall Ala Asp Glu Gly Luell Th Thir Luell Lieu Ala 965 97.

Glin Trp Lieu. Glin Asp Trp Asn Thr Gly Asp Thir Lieu. Lys Tyr Glin 98O 985 99 O

Asp Glin Ile Ile Ala Gly Lieu Ala Glin Glin Arg Ser Lys Asp Pro Leu 995 1OOO 1 OOS

Lell Glu Glin Ile Tyr Gly Met Lys Asp Met Luell Pro Asn Ile Ser Glin 1010 1 O15 1 O2O

Trp Ile Ile Gly Gly Asp Gly Trp Ala Asn Asp Ile Gly Phe Gly Gly 1025 103 O 1035 104 O

Lell Asp His Wall Lieu. Ala Ser Gly Glin Asn Luell Asn. Wall Luell Wall Lieu 1045 1OSO 105.5

Asp Thr Glu Met Tyr Ser Asn Thr Gly Gly Glin Ala Ser Lys Ser Thr 106 O 1065 1OO

His Met Ala Ser Wall Ala Llys Phe Ala Lieu. Gly Gly Lys Arg Thr Asn 1075 108O 1085

Lys Lys Asn Lieu. Thir Glu Met Ala Met Ser Tyr Gly Asn Val Tyr Val 1090 1095 11OO

Ala Thr Wal Ser His Gly Asn Met Ala Glin Cys Wall Lys Ala Phe Val 1105 111 O 1115 112 O

Glu Ala Glu Ser Tyr Asp Gly Pro Ser Lieu. Ile Val Gly Tyr Ala Pro 1125 113 O 1135 Cys Ile Glu. His Gly Lieu. Arg Ala Gly Met Ala Arg Met Val Glin Glu 114 O 1145 1150

Ser Glu Ala Ala Ile Ala Thr Gly Tyr Trp Pro Lieu. Tyr Arg Phe Asp 1155 1160 1165

Pro Arg Lieu Ala Thr Glu Gly Lys Asn Pro Phe Glin Lieu. Asp Ser Lys 1170 1175 118O Arg Ile Lys Gly Asn Lieu. Glin Glu Tyr Lieu. Asp Arg Glin Asn Arg Tyr 1185 119 O 11.95 12 OO

Val Asn Lieu Lys Lys Asn Asn Pro Lys Gly Ala Asp Lieu. Lieu Lys Ser 12O5 121 O 1215

Glin Met Ala Asp Asn Ile Thir Ala Arg Phe Asn Arg Tyr Arg Arg Met 122 O 1225 1230

Lieu. Glu Gly Pro Asn Thir Lys Ala Ala Ala Pro Ser Gly Asn His Val 1235 124 O 1245

Thir Ile Leu Tyr Gly Ser Glu Thr Gly Asn Ser Glu Gly Lieu Ala Lys 1250 1255 126 O Glu Lieu Ala Thr Asp Phe Glu Arg Arg Glu Tyr Ser Val Ala Val Glin 1265 127 O 1275 128O US 7,833,761 B2 87 88

- Continued

Ala Lieu. Asp Asp Ile Asp Wall Ala Asp Lieu. Glu Asn Met Gly Phe Val 1285 129 O 1295 Val Ile Ala Val Ser Thr Cys Gly Glin Gly Glin Phe Pro Arg Asn Ser 13 OO 13 OS 1310 Glin Lieu. Phe Trp Arg Glu Lieu. Glin Arg Asp Llys Pro Glu Gly Trp Lieu. 1315 132O 1325 Lys Asn Lieu Lys Tyr Thr Val Phe Gly Lieu. Gly Asp Ser Thr Tyr Tyr 1330 1335 134 O Phe Tyr Cys His Thr Ala Lys Glin Ile Asp Ala Arg Lieu Ala Ala Lieu. 1345 1350 1355 1360 Gly Ala Glin Arg Val Val Pro Ile Gly Phe Gly Asp Asp Gly Asp Glu 1365 1370 1375 Asp Met Phe His Thr Gly Phe Asn Asn Trp Ile Pro Ser Val Trp Asn 1380 385 1390 Glu Lieu Lys Thr Lys Thr Pro Glu Glu Ala Leu Phe Thr Pro Ser Ile 1395 14 OO 14 Os Ala Val Glin Lieu. Thr Pro Asn Ala Thr Pro Glin Asp Phe His Phe Ala 1410 1415 142O Lys Ser Thr Pro Val Lieu Ser Ile Thr Gly Ala Glu Arg Ile Thr Pro 1425 1430 1435 144 O Ala Asp His Thr Arg Asn. Phe Val Thir Ile Arg Trp Llys Thr Asp Lieu 1445 1450 1455 Ser Tyr Glin Val Gly Asp Ser Leu Gly Val Phe Pro Glu Asn Thr Arg 1460 465 1470 Ser Val Val Glu Glu Phe Lieu. Glin Tyr Tyr Gly Lieu. ASn Pro Lys Asp 1475 148O 1485 Val Ile Thir Ile Glu Asn Lys Gly Ser Arg Glu Lieu Pro His Cys Met 1490 1495 15OO Ala Val Gly Asp Lieu. Phe Thr Llys Val Lieu. Asp Ile Lieu. Gly Llys Pro 1505 1510 1515 152O Asn Asn Arg Phe Tyr Llys Thr Lieu. Ser Tyr Phe Ala Val Asp Lys Ala 1525 153 O 1535 Glu Lys Glu Arg Lieu Lleu Lys Ile Ala Glu Met Gly Pro Glu Tyr Ser 1540 1545 1550 Asn Ile Leu Ser Glu Thr Tyr His Tyr Ala Asp Ile Phe His Met Phe 1555 1560 1565 Pro Ser Ala Arg Pro Thr Lieu. Glin Tyr Lieu. Ile Glu Met Ile Pro Asn 1570 1575 1580 Ile Llys Pro Arg Tyr Tyr Ser Ile Ser Ser Ala Pro Ile His Thr Pro 1585 1590 1595 16OO Gly Glu Val His Ser Lieu Val Lieu. Ile Asp Thir Trp Ile Thr Lieu Ser 1605 1610 1615 Gly Llys His Arg Thr Gly Lieu. Thr Cys Thr Met Lieu. Glu. His Leu Gln 162O 1625 1630 Ala Gly Glin Val Val Asp Gly Cys Ile His Pro Thr Ala Met Glu Phe 1635 164 O 1645 Pro Asp His Glu Lys Pro Val Val Met Cys Ala Met Gly Ser Gly Lieu. 1650 1655 1660 Ala Pro Phe Val Ala Phe Lieu. Arg Asp Gly Ser Thr Lieu. Arg Lys Glin 1665 1670 1675 168O Gly Lys Llys Thr Gly Asn Met Ala Lieu. Tyr Phe Gly Asn Arg Tyr Glu 1685 1690 1695

US 7,833,761 B2 91 92

- Continued gaa Ctg gala agc acg att ggc Ctg cc.g atg aat a.a.a. gaa acc agc Cat 624 Glu Luell Glu Ser Thir Ile Gly Luell Pro Met ASn Glu Thir Ser His 195 2OO 2O5 gtg atg tgc ggc aat C Ca cag atg gtg cgc gat a Ca Cala cag ttg 672 Wall Met Luell Cys Gly Asn Pro Glin Met Wall Arg Asp Thir Glin Glin Luell 21 O 215 22O

Ctg a.a.a. gag acc cgg Cag atg acg a.a.a. Cat tta cgt cgc cga cc.g ggc 72 O Lell Lys Glu Thir Glin Met Thir His Luell Arg Arg Arg Pro Gly 225 23 O 235 24 O

Cat atg aca gcg gag Cat tac tgg taa 747 His Met Thir Ala Glu His Trp 245

<210s, SEQ ID NO 8 &211s LENGTH: 248 212. TYPE : PRT &213s ORGANISM: Escherichia coli

<4 OOs, SEQUENCE:

Met Ala Asp Trip Wall Thir Gly Wall Thir Wall Glin Asn Trp Thir 1. 15

Asp Ala Luell Phe Ser Lell Thir Wall His Ala Pro Wall Lell Pro Phe Thir 2O 25

Ala Gly Glin Phe Thir Lell Gly Luell Glu Ile Asp Gly Glu Arg Wall 35 4 O 45

Glin Arg Ala Ser Wall Asn Ser Pro Asp Asn Pro Asp Luell Glu SO 55 6 O

Phe Luell Wall Thir Wall Pro Asp Gly Luell Ser Pro Arg Luell Ala 65 70

Ala Luell Pro Gly Asp Glu Wall Glin Wall Ser Glu Ala Ala Gly 85 95

Phe Phe Wall Luell Asp Glu Wall Pro His Glu Thir Lell Trp Met Luell 105 11 O

Ala Thir G Thir Ala Ile Gly Pro Luell Ser Ile Lell Glin Luell Gly : 12 O 125

Asp Asp Arg Phe Lys Asn Luell Wall Luell Wall His Ala Ala Arg 13 O 135 14 O

Tyr Ala Asp Lell Ser Luell Pro Luell Met Glin Glu Luell Glu Lys 145 150 155 160

Arg Gly Lys Lell Arg Ile Glin Thir Wall Wall Ser Arg Glu Thir 1.65

Ala Ala Ser Lell Thir Gly Arg Ile Pro Ala Lell Ile Glu Ser Gly 18O 185 19 O

Glu Luell Ser Thir Ile Gly Luell Pro Met ASn Glu Thir Ser His

Wall Met Luell Gly Asn Pro Glin Met Wall Arg Asp Thir Glin Glin Luell 21 O 215 22O

Lell Glu Thir Glin Met Thir His Luell Arg Arg Arg Pro Gly 225 23 O 235 24 O

His Met Thir Ala Glu His Trp 245

SEO ID NO 9 LENGTH: 336 TYPE: DNA ORGANISM: Escherichia coli FEATURE:

US 7,833,761 B2 97 98

- Continued tat ttic tgc gac gca ttg ggc acc atc cqc gac atc att gala cc.g cgc 336 Phe Cys Asp Ala Lell Gly Thir Ile Arg Asp Ile Ile Glu Pro Arg 1OO 105 11 O ggit gca acc at C gtt ggit CaC tgg cca act gC9 ggc tat Cat ttic gala 384 Gly Ala Thir Ile Wall Gly His Trp Pro Thr Ala Gly Tyr His Phe Glu 115 12 O 125 gca to a a.a.a. ggt Ctg gca gat gac gaC cac titt gtC get Ctg gct at C 432 Ala Ser Gly Lell Ala Asp Asp Asp His Phe Val Gly Luell Ala Ile 13 O 135 14 O gac gala gac cgt Cag cc.g gaa ct g acc gct gaa cgt gta gala a.a.a. tgg Asp Glu Asp Arg Glin Pro Glu Lieu. Thir Ala Glu Arg Val Glu Trp 145 150 155 160 gtt a.a.a. cag att tot gaa gag ttg cat ct c gac gaa att citc. aat gcc 528 Wall Glin Ile Ser Glu Glu Lieu. His Lieu. Asp Glu Ile Luell Asn Ala 1.65 17O 17s tga 531

<210s, SEQ ID NO 14 &211s LENGTH: 176 212. TYPE : PRT <213> ORGANISM: Escherichia coli

<4 OOs, SEQUENCE: 14

Met Ala Ile Thr Gly Ile Phe Phe Gly Ser Asp Thr Gly Asn Thir Glu 1. 5 1O 15

Asn Ile Ala Lys Met Ile Glin Lys Glin Lieu. Gly Wall Ala Asp 25

Wall His Asp Ile Ala Ser Ser Lys Glu Asp Lieu. Glu Ala Asp 35 4 O 45

Ile Luell Luell Luell Gly Ile Pro Thir Trp Tyr Tyr Gly Glu Ala Glin SO 55 6 O

Asp Trp Asp Asp Phe Phe Pro Thir Lieu. Glu Glu Ile Asp Phe Asn Gly 65 70

Luell Wall Ala Lell Phe Gly Glin Glu Asp Ala Glu 85 90 95

Phe Asp Ala Lell Gly Thir Ile Arg Asp Ile Ile Glu Pro Arg 105 11 O

Gly Ala Thir Ile Wall Gly His Trp Pro Thr Ala Gly Tyr His Phe Glu 115 12 O 125

Ala Ser Gly Lell Ala Asp Asp Asp His Phe Val Gly Luell Ala Ile 13 O 135 14 O

Asp Glu Asp Arg Glin Pro Glu Lieu. Thir Ala Glu Arg Val Glu Trp 145 150 155 160

Wall Glin Ile Ser Glu Glu Lieu. His Lieu. Asp Glu Ile Luell Asn Ala 1.65 17O 17s

SEO ID NO 15 LENGTH: 522 TYPE: DNA ORGANISM: Escherichia coli FEATURE: NAME/KEY: CDS LOCATION: (1) . . (522)

<4 OOs, SEQUENCE: 15 atgaat atg ggit ct t t t t tact ggit to c agc acc tdt tac acc gala atg 48 Met Asn Met Gly Lieu. Phe Tyr Gly Ser Ser Thr Cys Tyr Thr Glu Met 1. 5 15 gcg gCa gala aaa. atc cqc gat att at C ggc cca gaa citg gtg acc tta 96 US 7,833,761 B2 99 100

- Continued

Ala Ala Glu Lys Ile Arg Asp Ile Ile Gly Pro Glu Lieu. Wall. Thir Luell 2O 25

Cat aac citc. aag gac gac t cc cc.g a.a.a. tta atg gag Cag tac gat gtg 144 His Asn Luell Lys Asp Asp Ser Pro Luell Met Glu Glin Tyr Asp Wall 35 4 O 45 citc. att Ctg ggt atc. cc.g a CC tgg gat titt ggt gaa atc. cag gala gac 192 Lell Ile Luell Gly Ile Pro Thir Trp Asp Phe Gly Glu Ile Glin Glu Asp SO 55 6 O tgg gala gcc gt C tgg gat Cag citc. gac gac Ctg aac citt gala ggt a.a.a. 24 O Trp Glu Ala Wall Trp Asp Glin Luell Asp Asp Luell Asn Lell Glu Gly Lys 65 70 7s 8O att gtt gcg Ctg tat 999 citt ggc gat Cala gga tac ggc gag tgg 288 Ile Wall Ala Luell Tyr Gly Lell Gly Asp Glin Luell Gly Tyr Gly Glu Trp 85 90 95 tto citc. gat gcg citc. ggit atg Ctg Cat gac a.a.a. citc. tcg acc a.a.a. ggc 336 Phe Luell Asp Ala Lell Gly Met Luell His Asp Lell Ser Thir Gly 1OO 105 11 O gtg aag ttic gt C ggc tac tgg CC a acg gala gga tat gaa titt acc agc 384 Wall Lys Phe Wall Gly Tyr Trp Pro Thir Glu Gly Tyr Glu Phe Thir Ser 115 12 O 125 cc.g a.a.a. cc.g gtg att gct gac 999 Cala Ctg titc gtg ggit Ctg gcg Ctg 432 Pro Lys Pro Wall Ile Ala Asp Gly Glin Luell Phe Wall Gly Luell Ala Luell 13 O 135 14 O gat gala act aac Cag tat gac citt agc gac gag cgt att cag agc tgg Asp Glu Thir Asn Glin Tyr Asp Luell Ser Asp Glu Arg Ile Glin Ser Trp 145 150 155 160 tgc gag Cala at C citc. aac gaa atg gCa gag Cat tac gcc tga 522 Cys Glu Glin Ile Lell Asn Glu Met Ala Glu His Ala 1.65 17O

SEQ ID NO 16 LENGTH: 173 TYPE : PRT ORGANISM: Escherichia coli

< 4 OOs SEQUENCE: 16

Met Asn Met Gly Lell Phe Gly Ser Ser Thir Thir Glu Met 1. 5 1O 15

Ala Ala Glu Lys Ile Arg Asp Ile Ile Gly Pro Glu Lell Wall Thir Luell 25

His Asn Luell Lys Asp Asp Ser Pro Luell Met Glu Glin Tyr Asp Wall 35 4 O 45

Lell Ile Luell Gly Ile Pro Thir Trp Asp Phe Gly Glu Ile Glin Glu Asp SO 55 6 O

Trp Glu Ala Wall Trp Asp Glin Luell Asp Asp Luell Asn Lell Glu Gly Lys 65 70

Ile Wall Ala Luell Tyr Gly Lell Gly Asp Glin Luell Gly Tyr Gly Glu Trp 85 90 95

Phe Luell Asp Ala Lell Gly Met Luell His Asp Lell Ser Thir Gly 105 11 O

Wall Phe Wall Gly Tyr Trp Pro Thir Glu Gly Tyr Glu Phe Thir Ser 115 12 O 125

Pro Lys Pro Wall Ile Ala Asp Gly Glin Luell Phe Wall Gly Luell Ala Luell 13 O 135 14 O

Asp Glu Thir Asn Glin Tyr Asp Luell Ser Asp Glu Arg Ile Glin Ser Trp 145 150 155 160

Glu Glin Ile Lell Asn Glu Met Ala Glu His Ala 1.65 17O US 7,833,761 B2 101 102

- Continued

SEO ID NO 17 LENGTH: 522 TYPE: DNA ORGANISM: Chlorobium tepidum FEATURE: NAME/KEY: CDS LOCATION: (1) . . (522)

< 4 OOs SEQUENCE: 17 atg aat atg ggt citt titt tac ggt to c agc acc tgt tac acc gala atg 48 Met Asn Met Gly Lell Phe Gly Ser Ser Thir Cys Thir Glu Met 1. 1O 15 gcg gca gala a.a.a. atc. cgc gat att at C ggc CCa gaa Ctg gtg acc tta 96 Ala Ala Glu Lys Ile Arg Asp Ile Ile Gly Pro Glu Lell Wall Thir Luell 2O 25 3O

Cat aac citc. aag gac gac t cc cc.g a.a.a. tta atg gag Cag tac gat gtg 144 His Asn Luell Lys Asp Asp Ser Pro Luell Met Glu Glin Asp Wall 35 4 O 45 citc. att Ctg ggt atc. cc.g a CC tgg gat titt ggt gaa atc. cag gala gac 192 Lell Ile Luell Gly Ile Pro Thir Trp Asp Phe Gly Glu Ile Glin Glu Asp SO 55 6 O tgg gala gcc gt C tgg gat Cag citc. gac gac Ctg aac citt gala ggt a.a.a. 24 O Trp Glu Ala Wall Trp Asp Glin Luell Asp Asp Luell Asn Lell Glu Gly Lys 65 70 7s 8O att gtt gcg Ctg tat 999 citt ggc gat Cala Ctg gga tac ggc gag tgg 288 Ile Wall Ala Luell Tyr Gly Lell Gly Asp Glin Luell Gly Gly Glu Trp 85 90 95 tto citc. gat gcg citc. ggit atg Ctg Cat gac a.a.a. citc. tcg acc a.a.a. ggc 336 Phe Luell Asp Ala Lell Gly Met Luell His Asp Lell Ser Thir Gly 1OO 105 11 O gtg aag ttic gt C ggc tac tgg CC a acg gala gga tat gaa titt acc agc 384 Wall Lys Phe Wall Gly Trp Pro Thir Glu Gly Glu Phe Thir Ser 115 12 O 125 cc.g a.a.a. cc.g gtg att gct gac 999 Cala Ctg titc gtg ggit Ctg gcg Ctg 432 Pro Lys Pro Wall Ile Ala Asp Gly Glin Luell Phe Wall Gly Luell Ala Luell 13 O 135 14 O gat gala act aac Cag tat gac citt agc gac gag cgt att cag agc tgg Asp Glu Thir Asn Glin Tyr Asp Luell Ser Asp Glu Arg Ile Glin Ser Trp 145 150 155 160 tgc gag Cala at C citc. aac gaa atg gca gag Cat tac gcc tga 522 Glu Glin Ile Lell Asn Glu Met Ala Glu His Ala 1.65 17O

<210s, SEQ ID NO 18 &211s LENGTH: 173 212. TYPE : PRT &213s ORGANISM: Chlorobium tepidum

<4 OOs, SEQUENCE: 18

Met Asn Met Gly Lell Phe Gly Ser Ser Thir Thir Glu Met 1. 5 15

Ala Ala Glu Lys Ile Arg Asp Ile Ile Gly Pro Glu Lell Wall Thir Luell 2O 25

His Asn Luell Lys Asp Asp Ser Pro Luell Met Glu Glin Asp Wall 35 4 O 45

Lell Ile Luell Gly Ile Pro Thir Trp Asp Phe Gly Glu Ile Glin Glu Asp SO 55 6 O

Trp Glu Ala Wall Trp Asp Glin Luell Asp Asp Luell Asn Lell Glu Gly 65 70 7s US 7,833,761 B2 103 104

- Continued Ile Val Ala Lieu. Tyr Gly Lieu. Gly Asp Glin Luell Gly Tyr Gly Glu Trp 85 90 95

Phe Lieu. Asp Ala Lieu. Gly Met Luell His Asp Lell Ser Thir Lys Gly 1OO 105 11 O

Val Llys Phe Val Gly Tyr Trp Pro Thir Glu Gly Tyr Glu Phe Thir Ser 115 12 O 125

Pro Llys Pro Val Ile Ala Asp Gly Glin Luell Phe Wall Gly Luell Ala Lieu 13 O 135 14 O

Asp Glu Thir Asn Glin Tyr Asp Luell Ser Asp Glu Arg Ile Glin Ser Trp 145 150 155 160

Cys Glu Glin Ile Lieu. Asn. Glu Met Ala Glu His Ala 1.65 17O

<210s, SEQ ID NO 19 &211s LENGTH: 189 &212s. TYPE: DNA <213> ORGANISM: Chlorobium tepidum 22 Os. FEATURE: <221s NAME/KEY: CDS <222s. LOCATION: (1) . . (189)

<4 OOs, SEQUENCE: 19 atg goa citg tat atc acc gaa gala tgc acc tac tgc ggit gct tgc gala 48 Met Ala Leu Tyr Ile Thr Glu Glu Cys Thir Gly Ala Cys Glu 1. 5 1O 15 c cc gaa toc ccg acc aac got at C to c gct ggc agc gag at C tac gtt 96 Pro Glu. Cys Pro Thr Asn Ala Ile Ser Ala Gly Ser Glu Ile 2O 25 3O atc gat gcc gca toc togc aac gag gcc ggt titt gct gac tot cot 144 Ile Asp Ala Ala Ser Cys Asn Glu Cys Ala Gly Phe Ala Asp Ser Pro 35 4 O 45 gct tcc gtt gct gtc. tcc cc.g gca gag tgc atc. gtt Cag ggc tga 189 Ala Cys Val Ala Val Cys Pro Ala Glu Cys Ile Wall Glin Gly SO 55 6 O

<210s, SEQ ID NO 2 O &211s LENGTH: 62 212. TYPE: PRT <213> ORGANISM: Chlorobium tepidum <4 OOs, SEQUENCE: 2O Met Ala Leu Tyr Ile Thr Glu Glu Cys Thir Gly Ala Cys Glu 1. 5 1O 15

Pro Glu. Cys Pro Thr Asn Ala Ile Ser Ala Gly Ser Glu Ile Tyr Val 2O 25 3O

Ile Asp Ala Ala Ser Cys Asn Glu Cys Ala Gly Phe Ala Asp Ser Pro 35 4 O 45

Ala Cys Val Ala Val Cys Pro Ala Glu Ile Wall Glin Gly SO 55 6 O

<210s, SEQ ID NO 21 &211s LENGTH: 2676 &212s. TYPE: DNA <213> ORGANISM: Escherichia coli 22 Os. FEATURE: <221s NAME/KEY: CDS <222s. LOCATION: (1) ... (2676)

<4 OOs, SEQUENCE: 21 atg got gtt act aat gtc gct gala Ctt aac goa Citc gta gag cqt gta 48 Met Ala Wall. Thir Asn. Wall Ala Glu Lieu. Asn Ala Lieu Val Glu Arg Val 1. 5 15

US 7,833,761 B2 111 112

- Continued

Lell Ala Met Ala Wall Ala Glu Ser Gly Met Gly Ile Wall Glu Asp SO 55 6 O

Lys Wall Ile Asn His Phe Ala Ser Glu Tyr Ile Tyr Asn Ala Tyr 65 70 7s

Asp Glu Thir Gly Wall Luell Ser Glu Asp Asp Thir Phe Gly 85 90 95

Thir Ile Thir Ile Ala Glu Pro Ile Gly Ile Ile Gly Ile Wall Pro 1OO 105 11 O

Thir Thir Asn Pro Thir Ser Thir Ala Ile Phe Ser Lell Ile Ser Luell 115 12 O 125

Thir Arg Asn Ala Ile Ile Phe Ser Pro His Pro Arg Ala Asp 13 O 135 14 O

Ala Thir Asn Ala Ala Asp Ile Wall Luell Glin Ala Ala Ile Ala Ala 145 150 155 160

Gly Ala Pro Asp Lell Ile Gly Trp Ile Asp Glin Pro Ser Wall Glu 1.65 17O 17s

Lell Ser Asn Ala Lell Met His His Pro Asp Ile Asn Lell Ile Luell Ala 18O 185 19 O

Thir Gly Gly Pro Gly Met Wall Lys Ala Ala Ser Ser Gly Pro 195

Ala Ile Gly Wall Gly Ala Gly Asn Thir Pro Wall Wall Ile Asp Glu Thir 21 O 215 22O

Ala Asp Ile Ala Wall Ala Ser Wall Luell Met Ser Thir Phe 225 23 O 235 24 O

Asp Asn Gly Wall Ile Ala Ser Glu Glin Ser Wall Wall Wall Wall Asp 245 250 255

Ser Wall Asp Ala Wall Arg Glu Arg Phe Ala Thir His Gly Gly Tyr 26 O 265 27 O

Lell Luell Glin Gly Lys Glu Lell Lys Ala Wall Glin Asp Wall Ile Luell Lys 285

Asn Gly Ala Luell Asn Ala Ala Ile Wall Gly Glin Pro Ala Ile 29 O 295 3 OO

Ala Glu Luell Ala Gly Phe Ser Wall Pro Glu ASn Thir Ile Luell Ile 3. OS 310 315

Gly Glu Wall Thir Wall Wall Asp Glu Ser Glu Pro Phe Ala His Glu Lys 3.25 330 335

Lell Ser Pro Thir Lell Ala Met Arg Ala Asp Phe Glu Asp Ala 34 O 345 35. O

Wall Glu Lys Ala Glu Lell Wall Ala Met Gly Gly Ile Gly His Thir 355 360 365

Ser Cys Luell Thir Asp Glin Asp Asn Glin Pro Ala Arg Wall Ser Tyr 37 O 375

Phe Gly Glin Met Lys Thir Ala Arg Ile Luell Ile Asn Thir Pro Ala 385 390 395 4 OO

Ser Glin Gly Gly Ile Gly Asp Luell Asn Phe Lell Ala Pro Ser 4 OS 415

Lell Thir Luell Gly Cys Gly Ser Trp Gly Gly ASn Ser Ile Ser Glu Asn 42O 425 43 O

Wall Gly Pro His Lell Ile Asn Lys Thir Wall Ala Arg Ala 435 44 O 445

Glu Asn Met Luell Trp His Lys Luell Pro Lys Ser Ile Phe Arg Arg 450 45.5 460 US 7,833,761 B2 113 114

- Continued

Gly Ser Luell Pro Ile Ala Lell Asp Glu Wall Ile Thr Asp Gly His Lys 465 470

Arg Ala Luell Ile Wall Thir Asp Arg Phe Luell Phe Asn Asn Gly Tyr Ala 485 490 495

Asp Glin Ile Thir Ser Wall Lell Ala Ala Gly Wall Glu Thir Glu Wall SOO 505

Phe Phe Glu Wall Glu Ala Asp Pro Thir Luell Ser Ile Wall Arg Lys Gly 515 525

Ala Glu Luell Ala Asn Ser Phe Pro Asp Wall Ile Ile Ala Luell Gly 53 O 535 54 O

Gly Gly Ser Pro Met Asp Ala Ala Ile Met Trp Wall Met Glu 5.45 550 555 560

His Pro Glu Thir His Phe Glu Glu Luell Ala Luell Arg Phe Met Asp Ile 565 st O sts

Arg Arg Ile Tyr Phe Pro Lys Met Gly Wall Ala Met 58O 585 59 O

Ile Ala Wall Th Thir Thir Ser Gly Thir Gly Ser Glu Wall Thir Pro Phe 595 605

Ala Wall Wall Thir Asp Asp Ala Thir Gly Glin Lys Tyr Pro Luell Ala Asp 610 615

Tyr Ala Luell Thir Pro Asp Met Ala Ile Wall Asp Ala Asn Luell Wall Met 625 630 635 64 O

Asp Met Pro Llys Ser Lell Ala Phe Gly Gly Lell Asp Ala Wall Thir 645 650 655

His Ala Met Glu Ala Wall Ser Wall Luell Ala Ser Glu Phe Ser Asp 660 665 67 O

Gly Glin Ala Lieu. Glin Ala Lell Lys Luell Luell Lys Glu Tyr Luell Pro Ala 675 685

Ser Tyr His Glu Gly Ser Lys Asn Pro Wall Ala Arg Glu Arg Wall His 69 O. 695 7 OO

Ser Ala Ala Thir Ile Ala Gly Ile Ala Phe Ala Asn Ala Phe Luell Gly 7 Os

Wall His Ser Met Ala His Luell Gly Ser Glin Phe His Ile Pro 72 73 O 73

His Gly Luell Ala Asn Ala Lell Luell Ile ASn Wall Ile Arg Asn 740 74. 7 O

Ala Asn Asp Asn. Pro Thir Glin Thir Ala Phe Ser Glin Asp Arg 760 765

Pro Glin Ala Arg Arg Arg Tyr Ala Glu Ile Ala Asp His Luell Gly Luell 770 775

Ser Ala Pro Gly Asp Arg Thir Ala Ala Ile Glu Luell Luell Ala 79 O 79.

Trp Luell Glu Thir Lieu. Ala Glu Luell Gly Ile Pro Ser Ile Arg 805 810 815

Glu Ala Gly Wall Glin Glu Ala Asp Phe Luell Ala Asn Wall Asp Luell 825 83 O

Ser Glu Asp Ala Phe Asp Asp Glin Thir Gly Ala Asn Pro Tyr 835 84 O 845

Pro Luell Ile Ser Glu Lell Lys Glin Ile Luell Luell Asp Thir Gly 850 855 860

Arg Asp Wall Glu Gly Glu Thir Ala Ala Lys Glu Ala Ala Pro 865 87O 88O

Ala Ala Glu Lys Ala Ser Ala US 7,833,761 B2 115 116

- Continued

885 890

<210s, SEQ ID NO 23 &211s LENGTH: 69 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: primer <4 OOs, SEQUENCE: 23 cgittattgtt atctagttgt gcaaaacatg ctaatgtagc attacgc.ccc gcc ct gccac 6 O t catcgcag 69

<210s, SEQ ID NO 24 &211s LENGTH: 58 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: primer <4 OOs, SEQUENCE: 24 attagtaa.ca gccataatgc tict cotgata atgttaalacc gct cacaatt coacacat 58

<210s, SEQ ID NO 25 &211s LENGTH: 183 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: hybrid promoter

<4 OOs, SEQUENCE: 25 ctagat ct ct caccitaccaa acaatgcc cc cct gcaaaaa ataaatt cat aaaaaacata 6 O cagata acca totg.cggtga taaattat ct ctdgcggtgt togacaattaa to atcggctic 12 O gtataatgtg tdgaattgttg agcggtttaa Cattatcagg agagcattat ggctgttact 18O aat 183

<210s, SEQ ID NO 26 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: primer <4 OOs, SEQUENCE: 26 acttgttctt gagtgaaact ggca 24

<210s, SEQ ID NO 27 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: primer <4 OOs, SEQUENCE: 27 alagacgc.gct gacaat acgc ct 22

<210s, SEQ ID NO 28 &211s LENGTH: 69 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: primer <4 OOs, SEQUENCE: 28 US 7,833,761 B2 117 118

- Continued cgittattgtt atctagttgt gcaaaacatg ctaatgtagc atcagaaaaa ct catcgagc 6 O atcaaatga 69

SEQ ID NO 29 LENGTH: 65 TYPE: DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: primer

SEQUENCE: 29 agc.cggagca gcttctittct tcgctgcagt ttcaccittct acgttgttgtc. tcaaaatct c 6 O tgatg 65

SEQ ID NO 3 O LENGTH: 24 TYPE: DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: primer

SEQUENCE: 3 O aagacgc.gct gacaatacgc ctitt 24

SEQ ID NO 31 LENGTH: 24 TYPE: DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: primer

SEQUENCE: 31 aaggggcc.gt titatgttgcc agac 24

SEQ ID NO 32 LENGTH: 69 TYPE: DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: primer

SEQUENCE: 32

Catgtgggitt atgitacgaac atc.cggaaac toactitcgala aagctggcgc tigcgcttitat 6 O ggat at CC9 69

SEQ ID NO 33 LENGTH: 24 TYPE: DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: primer

SEQUENCE: 33 aaggggcc.gt titatgttgcc agac 24

SEQ ID NO 34 LENGTH: 24 TYPE: DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: primer

SEQUENCE: 34 US 7,833,761 B2 119 120

- Continued aagacgc.gct gacaatacgc ctitt 24

<210s, SEQ ID NO 35 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: primer <4 OOs, SEQUENCE: 35 ttitt Ctagat aaggaggaat gacgt atgac ccgga cattcaagacaatgg a 51

<210s, SEQ ID NO 36 &211s LENGTH: 39 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: primer <4 OOs, SEQUENCE: 36 aaatctagat t cagottatgctt cqcct tc aatcgaacg 39

<210s, SEQ ID NO 37 &211s LENGTH: 344 &212s. TYPE: DNA <213> ORGANISM: Escherichia coli

<4 OO > SEQUENCE: 37 aagctttacg cgaacgagcc atgacattgc tgacgactict ggcagtggca gatgacatala 6 O aactggtcga Ctggittacaa Caacgc.ctgg ggcttittaga gcaacgagac acggcaatgt 12 O tgcaccgttt gctgcatgat attgaaaaaa at atcaccala ataaaaaacg cct tagtaag 18O tatttitt cag cittitt cattctgactgcaac gggcaatatg t citctgttgttg gattaaaaaa 24 O agagtgtctgataggagctt Ctgaactggit tacctg.ccgt. gagtaaatta aaattittatt 3OO gact tagg to actaaatact ttaac caata taggcgactic taga 344

<210s, SEQ ID NO 38 &211s LENGTH: 53 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: primer <4 OOs, SEQUENCE: 38 ttittctggta Cctaaggagg aatgacgt at gattact att gacggtaatg gcg 53

<210s, SEQ ID NO 39 &211s LENGTH: 4 O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: primer <4 OOs, SEQUENCE: 39 gagaga.ccgg gtacct taat cqgtgttgct tttitt cogct 4 O

<210s, SEQ ID NO 4 O &211s LENGTH: 49 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: primer <4 OOs, SEQUENCE: 4 O US 7,833,761 B2 121 122

- Continued aattgg tacc taagg aggaa tacg tatga C cagtggc.cc aaaaccggc 49

<210s, SEQ ID NO 41 &211s LENGTH: 42 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: 223 OTHER INFO RMATION: primer

<4 OOs, SEQUENCE: 41 gcgacgc.cta gctta gggta cct taccatg cct cqatatt gt 42

<210s, SEQ ID NO 42 &211s LENGTH: 35 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: 223 OTHER INFO RMATION: primer

<4 OOs, SEQUENCE: 42 Ctct Ctggcc ccggg citgat tdatttgatc gattg 35

<210s, SEQ ID NO 43 &211s LENGTH: 33 &212s. TYPE: DNA &213s ORGANISM: Artificial 22 Os. FEATURE: 223 OTHER INFO RMATION: primer

< 4 OO > SEQUENCE: 43 gagaga.cccc gggtt accag taatgctic cq ctg 33

<210s, SEQ ID NO 44 &211s LENGTH: 30 &212s. TYPE: DNA &213s ORGANISM: Artificial 22 Os. FEATURE: 223 OTHER INFO RMATION: primer

<4 OOs, SEQUENCE: 44 gcgcgaattic gigg.cg atgat gttgacgc.ca 3 O

<210s, SEQ ID NO 45 &211s LENGTH: 30 &212s. TYPE: DNA &213s ORGANISM: Artificial 22 Os. FEATURE: 223 OTHER INFO RMATION: primer

<4 OOs, SEQUENCE: 45 gcgc gaattic gtc. cc atact aacct ctdtt 3 O

<210s, SEQ ID NO 46 &211s LENGTH: 26 64 &212s. TYPE: DNA &213s ORGANISM: Escherichia coli 22 Os. FEATURE: <221 > NAMEAKEY: CDS &222s. LOCATION: (1) . . (2664)

<4 OOs, SEQUENCE: 46 atg tca gala C9t ttic cca aat gaC gtg gat CC9 atc gala act cqc gac 48 Met Ser Glu Arg Phe Pro Asn Asp Val Asp Pro Ile Glu Thir Arg Asp 1. 5 1O 15 tgg Ct c cag gC9 atc gaa ticg gtC at C cqt gaa gala ggt gtt gag cqt 96

US 7,833,761 B2 129 130

- Continued

SO 55 6 O

Pro Wall Glu Glu Glin Pro Glu Tyr Pro Gly ASn Lell Glu Luell Glu Arg 65 70 7s

Arg Ile Arg Ser Ala Ile Arg Trp Asn Ala Ile Met Thir Wall Luell Arg 85 90 95

Ala Ser Lys Asp Lell Glu Luell Gly Gly His Met Ala Ser Phe Glin 105 11 O

Ser Ser Ala Thir Ile Asp Wall Phe ASn His Phe Phe Arg Ala 115 12 O 125

Arg Asn Glu Glin Asp Gly Gly Asp Luell Wall Phe Glin Gly His Ile 13 O 135 14 O

Ser Pro Gly Wall Tyr Ala Arg Ala Phe Luell Glu Gly Arg Luell Thir Glin 145 150 155 160

Glu Glin Luell Asp Asn Phe Arg Glin Glu Wall His Gly Asn Gly Luell Ser 1.65 17O 17s

Ser Pro His Pro Lell Met Pro Glu Phe Trp Glin Phe Pro Thir 18O 185 19 O

Wall Ser Met Gly Lell Gly Pro Ile Gly Ala Ile Glin Ala Phe 195

Lell Lys Luell Glu His Arg Gly Luell Asp Thir Ser Glin Thir 21 O 215 22O

Wall Ala Phe Lell Gly Asp Gly Glu Met Asp Glu Pro Glu Ser Lys 225 23 O 235 24 O

Gly Ala Ile Thir Ile Ala Thir Arg Glu Lys Luell Asp Asn Luell Wall Phe 245 250 255

Wall Ile Asn Cys Asn Lell Glin Arg Luell Asp Gly Pro Wall Thir Gly Asn 26 O 265 27 O

Gly Ile Ile Asn Glu Lell Glu Gly Ile Phe Glu Gly Ala Gly Trp 285

Asn Wall Ile Wall Met Trp Gly Ser Arg Trp Asp Glu Luell Luell Arg 29 O 295 3 OO

Lys Asp Thir Ser Gly Lys Lell Ile Glin Luell Met Asn Glu Thir Wall Asp 3. OS 310 315

Gly Asp Glin Thir Phe Ser Asp Gly Ala Wall Arg Glu 3.25 330 335

His Phe Phe Gly Lys Pro Glu Thir Ala Ala Lell Wall Ala Asp Trp 34 O 345 35. O

Thir Asp Glu Glin Ile Trp Ala Luell Asn Arg Gly Gly His Asp Pro 355 360 365

Ile Ala Ala Phe Lys Ala Glin Glu Thir Gly Ala 37 O 375

Thir Wall Ile Lel Ala His Thir Ile Gly Tyr Gly Met Gly Asp Ala 385 390 395 4 OO

Ala Glu Gly Asn Ile Ala His Glin Wall Met Asn Met Asp 4 OS 415

Gly Wall Arg His Ile Arg Asp Arg Phe Asn Wall Pro Wall Ser Asp Ala 42O 425 43 O

Asp Ile Glu Lell Pro Ile Thir Phe Pro Glu Gly Ser Glu Glu 435 44 O 445

His Thir Lel His Ala Glin Arg Glin Luell His Gly Tyr Luell Pro 450 45.5 460

Ser Arg Glin Asn Phe Thir Glu Luell Glu Lell Pro Ser Luell Glin 465 470 47s 48O US 7,833,761 B2 131 132

- Continued

Asp Phe Gly Ala Lell Lell Glu Glu Glin Ser Lys Glu Ile Ser Thir Thir 485 490 495

Ile Ala Phe Wall Arg Ala Lell Asn Wall Met Luell Asn Lys Ser Ile SOO 505 51O

Asp Arg Luell Wall Pro Ile Ile Ala Asp Glu Ala Arg Thir Phe Gly 515 525

Met Glu Gly Luell Phe Arg Glin Ile Gly Ile Ser Pro Asn Gly Glin 53 O 535 54 O

Glin Tyr Thir Pro Glin Asp Arg Glu Glin Wall Ala Glu Asp 5.45 550 555 560

Glu Gly Glin Ile Lell Glin Glu Gly Ile ASn Glu Lell Gly Ala Gly 565 st O sts

Ser Trp Luell Ala Ala Ala Thir Ser Ser Thir Asn Asn Luell Pro 585 59 O

Met Ile Pro Phe Tyr Ile Tyr Ser Met Phe Gly Phe Glin Arg Ile 595 605

Gly Asp Luell Trp Ala Ala Gly Asp Glin Glin Ala Arg Gly Phe Luell 610 615

Ile Gly Gly Thir Ser Gly Arg Thir Thir Luell ASn Gly Glu Gly Luell Glin 625 630 635 64 O

His Glu Asp Gly His Ser His Ile Glin Ser Luell Thir Ile Pro Asn 645 650 655

Ile Ser Asp Pro Ala Ala Tyr Glu Wall Ala Wall Ile Met His 660 665 67 O

Asp Gly Luell Glu Arg Met Gly Glu Glin Glu Asn Wall 675 685

Ile Thir Thir Lell Asn Glu Asn Tyr His Met Pro Ala Met Pro Glu 69 O. 695 7 OO

Gly Ala Glu Glu Gly Ile Arg Gly Ile Tyr Lell Glu Thir Ile 7 Os

Glu Gly Ser Gly Lys Wall Glin Luell Luell Gly Ser Gly Ser Ile Luell 72 73 O 73

Arg His Wall Arg Glu Ala Ala Glu Ile Luell Ala Asp Tyr Gly Wall 740 74. 7 O

Gly Ser Asp Wall Tyr Ser Wall Thir Ser Phe Thir Glu Lell Ala Arg Asp 760 765

Gly Glin Asp Glu Arg Trp Asn Met Luell His Pro Lell Glu Thir Pro 770 775

Arg Wall Pro Ile Ala Glin Wall Met Asn Asp Ala Pro Ala Wall Ala 79 O 79.

Ser Thir Asp Met Lell Phe Ala Glu Glin Wall Arg Thir Tyr Wall 805 810 815

Pro Ala Asp Asp Tyr Arg Wall Luell Gly Thir Asp Gly Phe Gly Arg Ser 825 83 O

Asp Ser Arg Glu Asn Lell Arg His His Phe Glu Wall Asp Ala Ser Tyr 835 84 O 845

Wall Wall Wall Ala Ala Lell Gly Glu Luell Ala Arg Gly Glu Ile Asp 850 855 860

Lys Wall Wall Ala Asp Ala Ile Ala Phe Asn Ile Asp Ala Asp 865 87s 88O

Wall Asn Pro Arg Lell Ala 885

US 7,833,761 B2 137 138

- Continued

Ctg atg Ctg cc.g att tot citc. to c ttic gac CaC cgc gtg at C gac ggt 1824 Lell Met Luell Pro Ile Ser Lell Ser Phe Asp His Arg Wall Ile Asp Gly 595 6OO 605 gct gat ggt gcc cgt tto att acc at C att aac aac acg Ctg tot gac 1872 Ala Asp Gly Ala Arg Phe Ile Thir Ile Ile ASn Asn Thir Luell Ser Asp 610 615 62O att cgc cgt Ctg gtg atg taa 1893 Ile Arg Arg Luell Wall Met 625 630

<210s, SEQ ID NO 49 &211s LENGTH: 630 212. TYPE : PRT &213s ORGANISM: Escherichia coli

<4 OOs, SEQUENCE: 49

Met Ala Ile Glu Ile Wall Pro Asp Ile Gly Ala Asp Glu Wall Glu 1. 5 1O 15

Ile Thir Glu Ile Lell Wall Wall Gly Asp Wall Glu Ala Glu Glin 25

Ser Luell Ile Thir Wall Glu Gly Asp Lys Ala Ser Met Glu Wall Pro Ser 35 4 O 45

Pro Glin Ala Gly Ile Wall Lys Glu Ile Llys Wall Ser Wall Gly Asp SO 55 6 O

Thir Glin Thir Gly Ala Lell Met Ile Phe Asp Ser Ala Asp Gly Ala 65 70 8O

Ala Asp Ala Ala Pro Ala Ala Glu Glu Lys Glu Ala Ala Pro 85 90 95

Ala Ala Ala Pro Ala Ala Ala Ala Lys Asp Wall Asn Wall Pro Asp 105 11 O

Ile Gly Ser Asp Glu Wall Wall Thr Glu Ile Lell Wall Wall Gly 115 12 O 125

Asp Lys Wall Glu Ala Glu Ser Lieu. Ile Thir Wall Glu Asp 13 O 14 O

Ala Ser Met Glu Wall Pro Pro Phe Ala Gly Thir Wall Glu Ile 145 150 155 160

Wall Asn Wall Gly Asp Wall Ser Thr Gly Ser Lell Ile Met Wall 1.65 17O 17s

Phe Glu Wall Ala Gly Glu Ala Gly Ala Ala Ala Pro Ala Ala Glin 18O 185 19 O

Glu Ala Ala Pro Ala Ala Ala Pro Ala Pro Ala Ala Gly Wall Glu 195

Wall Asn Wall Pro Asp Ile Gly Gly Asp Glu Wall Glu Wall Thir Glu Wall 21 O 215

Met Wall Wall Gly Asp Wall Ala Ala Glu Glin Ser Luell Ile Thir 225 23 O 235 24 O

Wall Glu Asp Lys Ala Ser Met Glu Wall Pro Ala Pro Phe Ala Gly 245 250 255

Wall Wall Glu Lell Wall Asn Val Gly Asp Wall Lys Thir Gly 26 O 265 27 O

Ser Luell Ile Met Ile Phe Glu Wall Glu Gly Ala Ala Pro Ala Ala Ala 27s 285

Pro Ala Glin Glu Ala Ala Ala Pro Ala Pro Ala Ala Ala Glu 29 O 295 3 OO

Ala Pro Ala Ala Ala Pro Ala Ala Lys Ala Glu Gly Ser Glu Phe US 7,833,761 B2 139 140

- Continued

3. OS 310 315

Ala Glu Asn Asp Ala Wall His Ala Thir Pro Lell Ile Arg Arg Luell 3.25 330 335

Ala Arg Glu Phe Gly Wall Asn Luell Ala Lys Wall Gly Thir Gly Arg 34 O 345 35. O

Gly Arg Ile Lell Arg Glu Asp Wall Glin Ala Wall Glu Ala 355 360 365

Ile Lys Arg Ala Glu Ala Ala Pro Ala Ala Thir Gly Gly Gly Ile Pro 37 O 375

Gly Met Luell Pro Trp Pro Wall Asp Phe Ser Phe Gly Glu Ile 385 390 395 4 OO

Glu Glu Wall Glu Lell Gly Arg Ile Glin Lys Ile Ser Gly Ala Asn Luell 4 OS 415

Ser Arg Asn Trp Wall Met Ile Pro His Wall Thir His Phe Asp Thir 425 43 O

Asp Ile Thir Glu Lell Glu Ala Phe Arg Glin Glin Asn Glu Glu Ala 435 44 O 445

Ala Lys Arg Lell Asp Wall Ile Thir Pro Wall Wall Phe Ile Met 450 45.5 460

Lys Ala Wall Ala Ala Ala Lell Glu Glin Met Pro Arg Phe Asn Ser Ser 465 470

Lell Ser Glu Asp Gly Glin Arg Luell Thir Luell Ile Asn Ile 485 490 495

Gly Wall Ala Wall Asp Thir Pro Asn Gly Luell Wall Wall Pro Wall Phe SOO 505

Asp Wall Asn Lys Gly Ile Ile Glu Luell Ser Arg Glu Luell Met Thir 515 525

Ile Ser Ala Arg Asp Gly Luell Thir Ala Gly Glu Met Glin 53 O 535 54 O

Gly Gly Phe Thir Ile Ser Ser Ile Gly Gly Lell Gly Thir Thir His 5.45 550 555 560

Phe Ala Pro Ile Wall Asn Ala Pro Glu Wall Ala Ile Lell Gly Wall Ser 565 st O sts

Ser Ala Met Glu Pro Wall Trp Asn Gly Glu Phe Wall Pro Arg 585 59 O

Lell Met Luell Pro Ile Ser Lell Ser Phe Asp His Arg Wall Ile Asp Gly 595 605

Ala Asp Gly Ala Arg Phe Ile Thir Ile Ile ASn Thir Luell Ser Asp 610 615

Ile Arg Arg Luell Wall Met 625 630

SEO ID NO 5 O LENGTH: 1425 TYPE: DNA ORGANISM: Escherichia coli FEATURE: NAME/KEY: CDS LOCATION: (1) ... (1425)

<4 OOs, SEQUENCE: SO atg agt act gala atc. a.a.a. act cag gt C gtg gta citt 999 gca ggc cc c 48 Met Ser Thir Glu Ile Thir Glin Wal Wal Wall Lell Gly Ala Gly Pro 1. 5 15 gca ggt tac to c gct gcc tto cgt to got gat tta ggit Ctg gala acc 96 Ala Gly Ser Ala Ala Phe Arg Cys Ala Asp Lell Gly Luell Glu Thir

US 7,833,761 B2 143 144

- Continued Gly Llys Llys His Tyr Phe Asp Pro Llys Wall Ile Pro Ser Ile Ala 34 O 345 35. O a CC gala cca gala gtt gca t gtg ggit Ctg act gag a.a.a. gala gcg 104 Thir Glu Pro Glu Val Ala Trp Val Gly Luell Thir Glu Lys Glu Ala 355 360 365 gag aaa ggc at C agc tat gaa acc goc acc titc cc.g tgg gct gct tot 152 Glu Lys Gly Ile Ser Tyr Glu Thir Ala Thir Phe Pro Trp Ala Ala Ser 37 O 375 38O ggit cgit gct atc gct tcc gac tgc gca gac ggt atg a CC aag Ctg att 2OO Gly Arg Ala Ile Ala Ser Asp Cys Ala Asp Gly Met Thir Lys Luell Ile 385 390 395 4 OO tto gac aaa gaa tot cac cqt gtg at C ggt ggt gcg att gtC ggt act 248 Phe Asp Llys Glu Ser His Arg Wall Ile Gly Gly Ala Ile Wall Gly Thir 4 OS 41O 415 aac ggc ggc gag ctg. Ctg ggit gala atc ggc Ctg gca atc. gala atg ggt 296 Asn Gly Gly Glu Lieu. Lieu. Gly Glu Ile Gly Luell Ala Ile Glu Met Gly 42O 43 O tgt gat gct gala gac atc gca ct g acc at C CaC gcg CaC cc.g act Ctg 344 Cys Asp Ala Asp Ile Ala Lieu. Thir Ile His Ala His Pro Thir Luell 435 44 O 445

CaC gag tict gtg ggc Ctg gC9 gca gala gtg titc gaa ggit agc att acc 392 His Glu Ser Val Gly Lieu Ala Ala Glu Wall Phe Glu Gly Ser Ile Thir 450 45.5 460 gac Ctg ccg aac ccg aaa gC9 aag aag aag taa 425 Asp Lieu Pro Asn Pro Lys Ala Llys Llys Lys 465 470

<210s, SEQ ID NO 51 &211s LENGTH: 474 212. TYPE: PRT <213> ORGANISM: Escherichia coli

<4 OOs, SEQUENCE: 51

Met Ser Thr Glu Ile Llys Thr Glin Wall Wall Wall Lell Gly Ala Gly Pro 1. 5 15

Ala Gly Tyr Ser Ala Ala Phe Arg Cys Ala Asp Lell Gly Luell Glu Thir 2O 25 3O

Wall Ile Val Glu Arg Tyr Asn Thir Lieu. Gly Gly Wall Cys Luell Asn Wall 35 4 O 45

Gly Cys Ile Pro Ser Lys Ala Lieu. Luell His Wall Ala Wall Ile Glu SO 55 6 O

Glu Ala Lys Ala Lieu Ala Glu His Gly Ile Wall Phe Gly Pro Lys 65 70

Thir Asp Ile Asp Llys Ile Arg Thir Trp Lys Glu Wall Asn Glin 85 90 95

Lell Thr Gly Gly Lieu Ala Gly Met Ala Gly Arg Wall 1OO 105

Wall Asin Gly Lieu. Gly Llys Phe Thr Gly Ala ASn Thir Lell Wall Glu 115 12 O 125

Gly Glu Asn Gly Llys Thr Val Ile Asn Phe Asp Asn Ala Ile Ala 13 O 135 14 O

Ala Gly Ser Arg Pro Ile Glin Leul Pro Phe Ile Pro His Asp Pro 145 150 155 160

Arg Ile Trp Asp Ser Thr Asp Ala Lieu Glu Luell Glu Wall Pro Glu 1.65 17O 17s

Arg Lieu. Lieu Val Met Gly Gly Gly Ile Ile Gly Lell Glu Met Gly Thir 18O 185 19 O US 7,833,761 B2 145 146

- Continued Wall His Ala Lieu. Gly Ser Glin Ile Asp Wall Wall Glu Met Phe Asp 195 2OO 2O5

Glin Wall Ile Pro Ala Ala Asp Ile Wall Lys Wall Phe Thir Lys 21 O 215 22O

Arg Ile Ser Llys Phe Asn Luell Met Luell Glu Thir Lys Wall Thir Ala 225 23 O 235 24 O

Wall Glu Ala Glu Asp Gly Ile Tyr Wall Thir Met Glu Gly Lys Lys 245 250 255

Ala Pro Ala Glu Pro Glin Arg Ala Wall Lell Wall Ala Ile Gly 26 O 265 27 O

Arg Wall Pro Asn Gly Lys Asn Lieu. Asp Ala Gly Ala Gly Wall Glu 28O 285

Wall Asp Asp Arg Gly Phe Ile Arg Val Asp Glin Lell Arg Thir Asn 29 O 295 3 OO

Wall Pro His Ile Phe Ala Ile Gly Asp Ile Wall Gly Glin Pro Met Luell 3. OS 310 315

Ala His Gly Wal His Glu. Gly His Wall Ala Ala Glu Wall Ile Ala 3.25 330 335

Gly His Tyr Phe Asp Pro Llys Wall Ile Pro Ser Ile Ala Tyr 34 O 345 35. O

Thir Glu Pro Val Ala Trp Val Gly Luell Thir Glu Lys Glu Ala Lys 355 360 365

Glu Lys Gly Ser Tyr Glu Thir Ala Thir Phe Pro Trp Ala Ala Ser 37 O 375

Gly Arg Ala Ala Ser Asp Cys Ala Asp Gly Met Thir Luell Ile 385 390 395 4 OO

Phe Asp Ser His Arg Wall Ile Gly Gly Ala Ile Wall Gly Thir 4 OS 41O 415

Asn Gly Gly Lieu. Lieu. Gly Glu Ile Gly Luell Ala Ile Glu Met Gly 425 43 O

Asp Ala Asp Ile Ala Lieu. Thir Ile His Ala His Pro Thir Luell 435 44 O 445

His Glu Ser Wall Gly Lieu Ala Ala Glu Wall Phe Glu Gly Ser Ile Thir 450 45.5 460

Asp Luell Pro Asn Pro Lys Ala 465 470

SEO ID NO 52 LENGTH: 1698 TYPE: DNA ORGANISM: Escherichia coli FEATURE: NAME/KEY: CDS LOCATION: (1) ... (1698)

<4 OOs, SEQUENCE: 52 atg gala CC a a.a.a. aca aaa aaa. cag cqt tog citt atc. cott tac gct 48 Met Glu Pro Lys Thir Lys Llys Glin Arg Ser Luell Ile Pro Tyr Ala 1. 1O 15 ggc cott gta Ctg citg gaa titt ccg ttg ttg aat ggc agt gcc ttic 96 Gly Pro Wall Luell Lieu. Glu Phe Pro Leu Luell ASn Gly Ser Ala Phe 2O 25 3O agc atg gala gala cgc ct aac tt C aac Ctg Ctg 999 tta Ctg cc.g gala 144 Ser Met Glu Glu Arg Arg Asn Phe Asn Luell Luell Gly Lell Luell Pro Glu 35 4 O 45 gtg gt C gala acc atc gaa gaa caa gC9 gala cga gca tgg at C cag tat 192 Wall Wall Glu Thir Ile Glu Glu Glin Ala Glu Arg Ala Trp Ile Glin Tyr

US 7,833,761 B2 149 150

- Continued Ser Asp Val Lieu. Ser Lieu. Lieu. Asp Wall Wall Arg Asn Val Llys Pro Asp 37 O 375 att Ctg att ggc gtc. tca gga cag acc 999 Ctg titt acg gala gag at C 2OO Ile Lieu. Ile Gly Val Ser Gly Gn. Thir Gly Luell Phe Thir Glu Glu Ile 385 390 395 4 OO atc. cgt gag atg cat aaa cac tgt cc.g cgt cc.g atc. gtg atg cc.g Ctg 248 Ile Arg Glu Met His Llys His Cys Pro Arg Pro Ile Wall Met Pro Luell 4 OS 41O 415 tot aac ccg acg tca cqc gtg gala gCC aca cc.g Cag gac att at C gcc 296 Ser Asn Pro Thir Ser Arg Val Glu Ala Thir Pro Glin Asp Ile Ile Ala 42O 425 43 O tgg acc gala ggit aac gcg Ctg gt C goc acg ggc agc cc.g titt aat CC a 344 Trp Thr Glu Gly Asn Ala Lieu. Wall Ala Thir Gly Ser Pro Phe Asn Pro 435 44 O 445 gtg gta tog aaa gat aaa atc tact cott at C gcc Cag aac aac gcc 392 Wall Val Trp Lys Asp Llys Ile Tyr Pro Ile Ala Glin Asn Asn Ala 450 45.5 460 titt att tt C ccg ggc atc ggc Ctg ggt gtt att gct t cc ggc to a 44 O Phe Ile Phe Pro Gly Ile Gly Lieu. Gly Wall Ile Ala Ser Gly Ser 465 470 47s 48O cgt at C acc gat gag atg Ctg atgtcg gca agt gaa acg Ctg cag 488 Arg Ile Thr Asp Glu Met Leu Met Ser Ala Ser Glu Thir Luell Glin 485 490 495

to a cca ttg gtg citg aac ggc gala ggt atg gta Ctg cc.g gala Ctg 536 Ser Pro Lieu Wall Lieu. Asn Gly Glu Gly Met Wall Lell Pro Luell SOO 505 51O

gat att cag aaa gtc. tcc cgc gca att gcg titt gcg gtt a.a.a. 584 Asp Ile Glin Llys Val Ser Arg Ala Ile Ala Phe Ala Wall Lys 515 52O 525 atg gcg Cag cag Caa gC gttg gcg gtg a.a.a. acc tot gcc gala Ctg 632 Met Ala Glin Glin Glin Gly Val Ala Wall Thir Ser Ala Glu Luell 53 O 535 54 O

Cala cag gcc att gac gat aat tt C to Cala gcc gaa tac cgc gac tac Glin Glin Ala Ile Asp Asp Asn Phe Trp Glin Ala Glu Tyr Arg Asp Tyr 5.45 550 555 560 cgc cgt acc toc atc taa 698 Arg Arg Thr Ser Ile 565

<210s, SEQ ID NO 53 &211s LENGTH: 565 212. TYPE: PRT <213> ORGANISM: Escherichia coli

<4 OOs, SEQUENCE: 53

Met Glu Pro Llys Thr Llys Llys Glin Arg Ser Luell Tyr Ile Pro Tyr Ala 1. 5 15

Gly Pro Wall Lieu Lleu. Glu Phe Pro Leu Luell ASn Gly Ser Ala Phe 2O 25

Ser Met Glu Glu Arg Arg Asn Phe Asn Luell Luell Gly Lell Luell Pro Glu 35 4 O 45

Wall Wall Glu Thir Ile Glu Glu Glin Ala Glu Arg Ala Trp Ile Glin Tyr SO 55 6 O

Glin Gly Phe Llys Thr Glu Ile Asp Llys His Ile Lell Arg Asn Ile 65 70

Glin Asp Thr Asn. Glu Thir Lieu. Phe Tyr Arg Luell Wall Asn Asn His Luell 85 90 95

Asp Glu Met Met Pro Wall Ile Tyr Thr Pro Thir Wall Gly Ala Ala 1OO 105 11 O US 7,833,761 B2 151 152

- Continued

Glu Arg Phe Ser Glu Ile Arg Arg Ser Arg Gly Wall Phe Ile Ser 115 12 O 125

Glin Asn Arg His Asn Met Asp Asp Ile Luell Glin Asn Wall Pro Asn 13 O 135 14 O

His Asn Ile Wall Ile Wall Wall Thir Asp Gly Glu Arg Ile Luell Gly 145 150 155 160

Lell Gly Asp Glin Gly Ile Gly Gly Met Gly Ile Pro Ile Gly Lys Luell 1.65 17O

Ser Luell Thir Ala Gly Gly Ile Ser Pro Ala Thir Luell Pro 18O 185 19 O

Wall Wall Luell Asp Wall Gly Thir Asn Asn Glin Glin Lell Lell Asn Asp Pro 195

Lell Tyr Met Gly Trp Arg Asn Pro Arg Ile Thir Asp Asp Glu 21 O 215

Glu Phe Wall Asp Glu Phe Ile Glin Ala Wall Lys Glin Arg Trp Pro Asp 225 23 O 235 24 O

Wall Luell Luell Glin Phe Glu Asp Phe Ala Glin Asn Ala Met Pro Luell 245 250 255

Lell Asn Arg Tyr Arg Asn Glu Ile Cys Ser Phe Asn Asp Asp Ile Glin 26 O 265 27 O

Gly Thir Ala Ala Wall Thir Wall Gly Thir Luell Ile Ala Ala Ser Arg Ala 285

Ala Gly Gly Glin Lell Ser Glu Ile Wall Phe Lell Gly Ala Gly 29 O 295 3 OO

Ser Ala Gly Gly Ile Ala Glu Met Ile Ile Ser Glin Thir Glin Arg 3. OS 310 315

Glu Gly Luell Ser Glu Glu Ala Ala Arg Glin Wall Phe Met Wall Asp 3.25 330 335

Arg Phe Gly Luell Lell Thir Asp Met Pro ASn Lell Lell Pro Phe Glin 34 O 345 35. O

Thir Luell Wall Glin Arg Glu Asn Luell Ser Asp Trp Asp Thir Asp 355 360 365

Ser Asp Wall Luell Ser Lell Lell Asp Wall Wall Arg Asn Wall Pro Asp 37 O 375

Ile Luell Ile Gly Wall Ser Gly Glin Thir Gly Luell Phe Thir Glu Glu Ile 385 390 395 4 OO

Ile Arg Glu Met His His Pro Arg Pro Ile Wall Met Pro Luell 4 OS 415

Ser Asn Pro Thir Ser Arg Wall Glu Ala Thir Pro Glin Asp Ile Ile Ala 425 43 O

Trp Thir Glu Gly Asn Ala Lell Wall Ala Thir Gly Ser Pro Phe Asn Pro 435 44 O 445

Wall Wall Trp Asp Ile Pro Ile Ala Glin Asn Asn Ala 450 45.5 460

Phe Ile Phe Pro Gly Ile Gly Luell Gly Wall Ile Ala Ser Gly Ala Ser 465 470

Arg Ile Thir Asp Glu Met Lell Met Ser Ala Ser Glu Thir Luell Ala Glin 485 490 495

Ser Pro Luell Wall Lell Asn Gly Glu Gly Met Wall Lell Pro Glu Luell SOO 505

Asp Ile Glin Lys Wall Ser Arg Ala Ile Ala Phe Ala Wall Gly 515 52O 525

US 7,833,761 B2 159 160

- Continued

Lell Phe Lys Phe Ala Gly Ile Asp Wall Phe Asp Ile Glu Wall Asp 105 11 O

Glu Luell Asp Pro Asp Phe Ile Glu Wall Wall Ala Ala Luell Glu Pro 115 12 O 125

Thir Phe Gly Gly Ile Asn Lell Glu Asp Ile Lys Ala Pro Glu Phe 13 O 135 14 O

Tyr Ile Glu Glin Lell Arg Glu Arg Met ASn Ile Pro Wall Phe His 145 150 155 160

Asp Asp Glin His Gly Thir Ala Ile Ile Ser Thir Ala Ala Ile Luell Asn 1.65 17O 17s

Gly Luell Arg Wall Wall Glu Asn Ile Ser Asp Wall Arg Met Wall Wall 18O 185 19 O

Ser Gly Ala Gly Ala Ala Ala Ile Ala Met Asn Lell Luell Wall Ala 195

Lell Gly Luell Glin His Asn Ile Wall Wall Asp Ser Gly Wall 21 O 215

Ile Glin Gly Arg Glu Pro Asn Met Ala Glu Thir Ala Ala Tyr 225 23 O 235 24 O

Ala Wall Wall Asp Asp Gly Arg Thir Luell Asp Asp Wall Ile Glu Gly 245 250 255

Ala Asp Ile Phe Lell Gly Ser Gly Pro Wall Lell Thir Glin Glu 26 O 265 27 O

Met Wall Lys Met Ala Arg Ala Pro Met Ile Lell Ala Luell Ala Asn 27s 285

Pro Glu Pro Glu Ile Lell Pro Pro Luell Ala Glu Wall Arg Pro Asp 29 O 295 3 OO

Ala Ile Ile Thir Gly Arg Ser Asp Pro Asn Glin Wall Asn Asn 3. OS 310 315

Wall Luell Phe Pro Phe Ile Phe Arg Gly Ala Lell Asp Wall Gly Ala 3.25 330 335

Thir Ala Ile Asn Glu Glu Met Luell Ala Ala Wall Arg Ala Ile Ala 34 O 345 35. O

Glu Luell Ala His Ala Glu Glin Ser Glu Wall Wall Ala Ser Ala Gly 355 360 365

Asp Glin Asp Luell Ser Phe Gly Pro Glu Tyr Ile Ile Pro Pro Phe 37 O 375

Asp Pro Arg Luell Ile Wall Ile Ala Pro Ala Wall Ala Ala Ala 385 390 395 4 OO

Met Glu Ser Gly Wall Ala Thir Arg Pro Ile Ala Asp Phe Asp Wall Tyr 4 OS 415

Ile Asp Luell Thir Glu Phe Wall Tyr Thir Asn Lell Phe Met Lys 425 43 O

Pro Ile Phe Ser Glin Ala Arg Lys Ala Pro Arg Wall Wall Luell Pro 435 44 O 445

Glu Gly Glu Glu Ala Arg Wall Luell His Ala Thir Glin Glu Luell Wall Thir 450 45.5 460

Lell Gly Luell Ala Pro Ile Luell Ile Gly Arg Pro Asn Wall Ile Glu 465 470 47s

Met Arg Ile Glin Lys Lell Gly Luell Glin Ile Ala Gly Wall Asp Phe 485 490 495

Glu Ile Wall Asn Asn Glu Ser Asp Pro Arg Phe Glu Tyr Trp Thir SOO 505 51O US 7,833,761 B2 161 162

- Continued Glu Tyr Phe Glin Ile Met Lys Arg Arg Gly Val Thr Glin Glu Glin Ala 515 52O 525

Glin Arg Ala Lieu. Ile Ser Asn. Pro Thr Val Ile Gly Ala Ile Met Wall 53 O 535 54 O Glin Arg Gly Glu Ala Asp Ala Met Ile Cys Gly Thr Val Gly Asp Tyr 5.45 550 555 560 His Glu. His Phe Ser Val Val Lys Asn Val Phe Gly Tyr Arg Asp Gly 565 st O sts Val His Thir Ala Gly Ala Met Asn Ala Lieu. Lieu Lleu Pro Ser Gly Asn 58O 585 59 O

Thir Phe Ile Ala Asp Thr Tyr Val Asn Asp Glu Pro Asp Ala Glu Glu 595 6OO 605 Lieu Ala Glu Ile Thr Lieu Met Ala Ala Glu Thr Val Arg Arg Phe Gly 610 615 62O

Ile Glu Pro Arg Val Ala Lieu. Lieu. Ser His Ser Asn. Phe Gly Ser Ser 625 630 635 64 O Asp Cys Pro Ser Ser Ser Lys Met Arg Glin Ala Lieu. Glu Lieu. Val Arg 645 650 655 Glu Arg Ala Pro Glu Lieu Met Ile Asp Gly Glu Met His Gly Asp Ala 660 665 67 O

Ala Lieu Val Glu Ala Ile Arg Asn Asp Arg Met Pro Asp Ser Ser Luell 675 68O 685 Lys Gly Ser Ala Asn. Ile Lieu Val Met Pro Asn Met Glu Ala Ala Arg 69 O. 695 7 OO

Ile Ser Tyr Asn Lieu. Lieu. Arg Val Ser Ser Ser Glu Gly Val Thir Wall 7 Os 71O 71s 72O

Gly Pro Val Lieu Met Gly Val Ala Lys Pro Val His Val Lieu. Thir Pro 72 73 O 73

Ile Ala Ser Val Arg Arg Ile Val Asn Met Val Ala Lieu Ala Wall Wall 740 74. 7 O

Glu Ala Glin. Thir Glin Pro Leu 7ss

What is claimed is: 2. The method according to claim 1, wherein the medium 1. A method for producing an L-amino acid selected from as contains ethanol or an aliphatic acid as the carbon source. the group consisting of L-lysine, L-tryptophan, L-phenylala 3. The method according to claim 1, wherein the gene nine, L-valine, L-leucine, L-isoleucine and L-serine compris 1ng: encoding pyruvate synthase comprises a DNA selected from A) culturing in a medium a microorganism which has an the group consisting of ability to produce the L-amino acid, and 50 (a) a DNA comprising the nucleotide sequence shown in B) collecting the L-amino acid from the medium or the SEQID NO: 1, and microorganism, wherein said microorganism has been (b) a DNA which is able to hybridize with a sequence modified to increase an activity of pyruvate synthase by complementary to the nucleotide sequence shown in a method selected from the group consisting of: i) increasing the copy number of a gene encoding pyruvate ss SEQ ID NO: 1 under stringent conditions comprising synthase, washing at 68°C., 0.1xSSC, 0.1% SDS and encoding a ii) modifying an expression control sequence of the gene, polypeptide having pyruvate synthase activity. and 4. The method according to claim 1, wherein the microor iii) combinations thereof; ganism has been further modified to increase the activity of and wherein pyruvate synthase is selected from the group 60 ferredoxin-NADP"reductase by a method selected from the consisting of: group consisting of: (a) a polypeptide comprising the amino acid sequence a) increasing the copy number of a gene encoding ferro shown in SEQID NO: 2, and (b) a polypeptide comprising the amino acid sequence doxin-NADP"reductase, shown in SEQID NO: 2, but which includes between 1 65 b) modifying an expression control sequence of the gene, and 20 Substitutions, deletions, insertions, or additions, and and has pyruvate synthase activity. c) combinations thereof, US 7,833,761 B2 163 164 wherein said ferredoxin-NADP"reductase is selected from wherein said pyruvate dehydrogenase comprises an Elp Sub the group consisting of unit, E2p subunit and E3 subunit, and wherein said Elp (a) a polypeptide comprising the amino acid sequence of Subunit is selected from the group consisting of: SEQID NO: 8, and (a) a polypeptide comprising the amino acid sequence of (b) a polypeptide comprising the amino acid sequence of 5 SEQ ID NO: 8, but which includes between 1 and 20 SEQID NO:47, and Substitutions, deletions, insertions or additions, and has (b) a polypeptide comprising the amino acid sequence of ferrodoxin-NADP"reductase activity. SEQ ID NO: 47, but which includes between 1 and 20 5. The method according to claim 1, wherein the microor Substitutions, deletions, insertions and additions, and ganism has been further modified to increase production of 10 has pyruvate dehydrogenase activity; ferredoxin or flavodoxin by a method selected from the group wherein said E2p Subunit is selected from the group consist consisting of: ing of i) increasing the copy number of a gene encoding ferre (c) a polypeptide comprising the amino acid sequence of doxin or flavodoxin, SEQID NO:49, and ii) modifying an expression control sequence of the gene, 15 and (d) a polypeptide comprising the amino acid sequence of iii) combinations thereof, SEQ ID NO: 49, but which includes between 1 and 20 wherein said ferredoxin is selected from the group consisting Substitutions, deletions, insertions or additions, and of: dihydrolipoyl transacetylase activity; and (a) a polypeptide comprising the amino acid sequence of wherein said E3 subunit is selected from the group consisting SEQID NO: 10, of: (b) a polypeptide comprising the amino acid sequence of (e) a polypeptide comprising the amino acid sequence of SEQ ID NO: 10, but which includes between 1 and 20 SEQID NO:51, and Substitutions, deletions, insertions or additions, and has (f) a polypeptide comprising the amino acid sequence of ferredoxin activity, 25 (c) a polypeptide comprising the amino acid sequence of SEQ ID NO: 51, but which includes between 1 and 20 SEQID NO: 12, Substitutions, deletions, insertions or additions, and has (d) a polypeptide comprising the amino acid sequence of dihydrolipoamide dehydrogenase activity. SEQ ID NO: 12, but which includes between 1 and 20 7. The method according to claim 1, wherein the microor Substitutions, deletions, insertions or additions, and has 30 ganism has been further modified so that it can aerobically ferredoxin activity, assimilate ethanol by mutating the alcohol dehydrogenase (e) a polypeptide comprising the amino acid sequence of derived from Escherichia coli so that the glutamic acid at SEQID NO: 18, position 569 is replaced with an amino acid other than (f) a polypeptide comprising the amino acid sequence of glutamic acid and aspartic acid. SEQ ID NO: 18, but which includes between 1 and 20 8. The method according to claim 1, wherein the microor Substitutions, deletions, insertions or additions, and has ganism is a bacterium belonging to a genus selected from the ferredoxin activity, group consisting of Escherichia, Enterobacter, Pantoea, (g) a polypeptide comprising the amino acid sequence of Klebsiella, and Serratia. SEQID NO: 20, and (h) a polypeptide comprising the amino acid sequence of 40 9. The method according to claim 1, wherein the microor SEQ ID NO: 20, but which includes between 1 and 20 ganism is a coryneform bacterium. Substitutions, deletions, insertions or additions, and has 10. The method according to claim 1, wherein the micro ferredoxin activity; and organism is Escherichia coli. wherein said flavodoxin is selected from the group consisting 45 11. A method for producing an L-amino acid selected from of: the group consisting of L-lysine, L-tryptophan, L-phenylala (i) a polypeptide comprising the amino acid sequence of nine, L-valine, L-leucine, L-isoleucine and L-serine compris SEQID NO: 14, ing: () a polypeptide comprising the amino acid sequence of A) culturing in a medium a microorganism which has an SEQ ID NO: 14, but which includes between 1 and 20 50 ability to produce the L-amino acid, and Substitutions, deletions, insertions or additions, and has flavodoxin activity, B) collecting the L-amino acid from the medium or the (k) a polypeptide comprising the amino acid of SEQ NO: microorganism, wherein said microorganism has been 16, and modified to increase an activity of pyruvate synthase by (1) a polypeptide comprising the amino acid sequence of 55 a method selected from the group consisting of: SEQ ID NO: 16, but which includes between 1 and 20 i) increasing the copy number of a gene encoding pyruvate Substitutions, deletions, insertions or additions, and has synthase, flavodoxin activity. ii) modifying an expression control sequence of the gene, 6. The method according to claim 1, wherein the microor and ganism has been further modified to decrease pyruvate dehy 60 drogenase activity by a method selected from the group con iii) combinations thereof; sisting of: and wherein pyruvate synthase comprises the amino acid i) introducing a deletion or mutation into a gene encoding sequence shown in SEQID NO: 2. pyruvate dehydrogenase, 12. A method for producing an L-amino acid selected from ii) introducing a deletion or mutation into an expression 65 the group consisting of L-lysine, L-tryptophan, L-phenylala control sequence of the gene, and nine, L-valine, L-leucine, L-isoleucine and L-serine compris iii) combinations thereof; ing: US 7,833,761 B2 165 166 A) culturing in a medium a microorganism which has an ii) modifying an expression control sequence of the gene, ability to produce the L-amino acid, and and B) collecting the L-amino acid from the medium or the microorganism, wherein said microorganism has been iii) combinations thereof; modified to increase an activity of pyruvate synthase by 5 and wherein the gene encoding pyruvate synthase is a DNA method selected from the group consisting of: comprising the nucleotide sequence shown in SEQID NO: 1. i) increasing the copy number of a gene encoding pyruvate synthase, k . . . . UNITED STATES PATENT AND TRADEMARK OFFICE CERTIFICATE OF CORRECTION PATENT NO. : 7,833,761 B2 Page 1 of 1 APPLICATIONNO. : 12/202476 DATED : November 16, 2010 INVENTOR(S) : Masaru Terashita et al. It is certified that error appears in the above-identified patent and that said Letters Patent is hereby corrected as shown below:

Claim 4 should be amended as follows:

4. The method according to claim 1, wherein the microorganism has been further modified to increase the activity of ferredoxin-NADP+ reductase by a method selected from the group consisting of: a) increasing the copy number of a gene encoding ferredoxin-NADP+ reductase, b) modifying an expression control Sequence of the gene, and c) combinations thereof, wherein said ferredoxin-NADP+ reductase is selected from the group consisting of (a) a polypeptide comprising the amino acid sequence of SEQID NO: 8, and (b) a polypeptide comprising the amino acid sequence of SEQID NO: 8, but which includes between 1 and 20 Substitutions, deletions, insertions or additions, and has ferredoxin-NADP+ reductase activity.

Signed and Sealed this Eighth Day of March, 2011

David J. Kappos Director of the United States Patent and Trademark Office UNITED STATES PATENT AND TRADEMARK OFFICE CERTIFICATE OF CORRECTION PATENT NO. : 7,833,761 B2 Page 1 of 1 APPLICATIONNO. : 12/202476 DATED : November 16, 2010 INVENTOR(S) : Masaru Terashita et al. It is certified that error appears in the above-identified patent and that said Letters Patent is hereby corrected as shown below:

Column 162, line 57 - Column 163, line 8, Claim 4 should be amended as follows:

4. The method according to claim 1, wherein the microorganism has been further modified to increase the activity of ferredoxin-NADP+ reductase by a method selected from the group consisting of: a) increasing the copy number of a gene encoding ferredoxin-NADP+ reductase, b) modifying an expression control Sequence of the gene, and c) combinations thereof, wherein said ferredoxin-NADP+ reductase is selected from the group consisting of (a) a polypeptide comprising the amino acid sequence of SEQID NO: 8, and (b) a polypeptide comprising the amino acid sequence of SEQID NO: 8, but which includes between 1 and 20 Substitutions, deletions, insertions or additions, and has ferredoxin-NADP+ reductase activity.

This certificate supersedes the Certificate of Correction issued March 8, 2011.

Signed and Sealed this Twenty-ninth Day of March, 2011

David J. Kappos Director of the United States Patent and Trademark Office