DOCSLIB.ORG

Whole-Cell Response of the Pennate Diatom Phaeodactylum Tricornutum to Iron Starvation

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Whole-Cell Response of the Pennate Diatom Phaeodactylum Tricornutum to Iron Starvation Whole-cell response of the pennate diatom Phaeodactylum tricornutum to iron starvation Andrew E. Allen*†, Julie LaRoche‡§, Uma Maheswari*, Markus Lommer‡, Nicolas Schauer¶, Pascal J. Lopez*, Giovanni Finazziʈ, Alisdair R. Fernie¶, and Chris Bowler*§** *Centre National de la Recherche Scientifique Unite Mixte de Recherche 8186, Dept of Biology, Ecole Normale Supe´rieure, 46 rue d’Ulm, 75005 Paris, France; ‡Leibniz-Institut fu¨r Meereswissenschaften, 24105 Kiel, Germany; ¶Max Planck Institute of Molecular Plant Physiology, Am Muhlenberg 1, 14476 Potsdam-Golm, Germany; ʈCentre National de la Recherche Scientifique Unite Mixte de Recherche 7141, Universite´Paris 6 Institut de Biologie Physico-Chimique, 13 rue Pierre et Marie Curie, 75005 Paris, France; and **Stazione Zoologica, Villa Comunale, I 80121 Naples, Italy Edited by David M. Karl, University of Hawaii, Honolulu, HI, and approved May 3, 2008 (received for review December 4, 2007) Marine primary productivity is iron (Fe)-limited in vast regions of Table 1. General cellular, physiological, and biochemical the contemporary oceans, most notably the high nutrient low characteristics of Fe-limited P. tricornutum cells and cultures chlorophyll (HNLC) regions. Diatoms often form large blooms upon Fe-limited/ the relief of Fe limitation in HNLC regions despite their prebloom Parameter Fe-limited Fe-replete Fe-replete low cell density. Although Fe plays an important role in controlling Ϯ Ϯ Ϯ diatom distribution, the mechanisms of Fe uptake and adaptation Growth rate 0.18 0.05 0.88 0.01 0.2 0.06 Ferric reductase assay, 0.717 Ϯ 0.03 0.020 Ϯ 0.004 35.9 Ϯ 7.3 to low iron availability are largely unknown. Through a combina- AU per cell tion of nontargeted transcriptomic and metabolomic approaches, Ferric reductase assay, 0.01 0.0002 50 we have explored the biochemical strategies preferred by Phaeo- AU/␮m3 dactylum tricornutum at growth-limiting levels of dissolved Fe. Carbon fixation, 0.010 Ϯ 0.006 0.141 Ϯ 0.022 0.07 Ϯ 0.04 Processes carried out by components rich in Fe, such as photosyn- pmol C per thesis, mitochondrial electron transport, and nitrate assimilation, cell ϫ hour ␮ were down-regulated. Our results show that this retrenchment is Cell diameter, m 2.5 3.5 0.71 Cell volume, ␮m3 60 100 0.60 compensated by nitrogen (N) and carbon (C) reallocation from Chl per cell, pg per cell 0.22 0.5 0.44 protein and carbohydrate degradation, adaptations to chlorophyll Chl per volume, fg/␮m3 3.67 5.0 0.73 biosynthesis and pigment metabolism, removal of excess electrons Fv/Fm 0.18 Ϯ 0.1 0.5 Ϯ 0.05 0.36 Ϯ 0.2 by mitochondrial alternative oxidase (AOX) and non-photochem- PSII 1.2 Ϯ 0.14 1 1.2 Ϯ 0.14 ical quenching (NPQ), and augmented Fe-independent oxidative PSI 0.43 Ϯ 0.1 1.0 0.43 Ϯ 0.10 Ϯ Ϯ stress responses. Iron limitation leads to the elevated expression Cytochrome b6f 0.75 0.13 1.0 0.75 0.13 Cytochrome c 0.7 Ϯ 0.05 1.0 0.70 Ϯ 0.05 of at least three gene clusters absent from the Thalassiosira 6 NPQ 4.8 Ϯ 0.8 3.1 Ϯ 0.51 1.5 Ϯ 0.4 pseudonana genome that encode for components of iron capture AOX activity 0.6 Ϯ 0.15 0.25 Ϯ 0.18 2.4 Ϯ 1.83 and uptake mechanisms. Photosystem and electron carrier concentrations are given in relative units normalized to Fe-replete levels. AOX activity is given as a percentage of total genome ͉ metabalomics ͉ photosynthesis ͉ transcriptomics ͉ nutrients respiration (see SI Methods for details). Fe levels in Fe-limited and Fe-replete cultures corresponded to 13.4 pmol⅐literϪ1 FeЈ and 2.6 nmol⅐literϪ1 FeЈ, he oxidizing conditions of contemporary marine ecosystems respectively. Tresult in exceedingly low levels of dissolved Fe (1), and the cellular Fe demand of modern phytoplankton is frequently in excess of Fe availability (1, 2). This paradox reflects the likelihood that The recently completed genome sequence of P. tricornutum their biochemical machinery evolved in the Fe-replete, reducing (http://genome.jgi-psf.org/Phatr2/Phatr2.home.html) sheds light on Proterozoic oceans. Fe limitation is a major factor controlling some important differences between P. tricornutum and T. phytoplankton growth in the large, perennially high nutrient low pseudonana, which may account for their respective thresholds for chlorophyll (HNLC) regions in the subarctic Pacific, equatorial Fe limitation. We evaluated the whole-cell response of P. tricornu- Pacific, and Southern Oceans (3–5) and may be important in the tum to Fe limitation with multiple approaches combining gene North Atlantic (6). expression profiling and comparative genomics with gas chroma- Marine diatoms are the most important eukaryotic phytoplank- tography-mass spectroscopy (GC-MS)-aided nontargeted metabo- Ϸ ton for carbon sequestration, contributing 40% of global oceanic lomic analysis and a range of physiological measurements. Genes organic carbon production per year. More than 70% of blooms stimulated by mesoscale in situ Fe fertilization of Fe-limited HNLC waters were dominated by diatoms (7), indicating that diatoms Author contributions: A.E.A., J.L., P.J.L., and C.B. designed research; A.E.A., J.L., U.M., M.L., persist in chronically Fe-limited environments and resume rapid N.S., and G.F. performed research; J.L., P.J.L., G.F., A.R.F., and C.B. contributed new reagents/analytic tools; A.E.A., J.L., U.M., M.L., N.S., G.F., and A.R.F. analyzed data; and growth when the limitation pressure is alleviated. The tolerance of A.E.A., J.L., and C.B. wrote the paper. diatoms to Fe limitation varies widely between species (8–11). The authors declare no conflict of interest. Phaeodactylum tricornutum is highly tolerant to Fe limita- This article is a PNAS Direct Submission. tion and can grow in steady-state laboratory cultures at iron Data deposition: The data reported in this paper have been deposited in the Gene levels 50 times lower than those tolerated by the centric diatom Expression Omnibus (GEO) database, www.ncbi.nlm.nih.gov/geo (accession no. GSE8675). Thalassiosira pseudonana (12). Steady-state growth of P. tri- †Present address: J. Craig Venter Institute, 10355 Science Center Drive, San Diego, CA 92121. ⅐ Ϫ1 Ј cornutum is Fe limited in the range of 10–30 pmol liter Fe §To whom correspondence may be addressed. E-mail: [email protected] or (FeЈ is the sum of all unchelated Fe species) (Table 1), similar [email protected]. to T. oceanica and Pseudonitzschia spp., two open ocean This article contains supporting information online at www.pnas.org/cgi/content/full/ diatoms that are commonly found in the most severely Fe 0711370105/DCSupplemental. limited regions of the world’s oceans (13). © 2008 by The National Academy of Sciences of the USA 10438–10443 ͉ PNAS ͉ July 29, 2008 ͉ vol. 105 ͉ no. 30 www.pnas.org͞cgi͞doi͞10.1073͞pnas.0711370105 Downloaded by guest on October 1, 2021 Fig. 1. Hypothetical cellular pathways and processes in iron-limited pennate diatom cells. All roman green or red type depicts gene transcripts found to be up- or down-regulated, respectively. Italicized and underlined green type indicates metabolites found to be enriched relative to total protein in iron-limited cells. DF, diffusion factor; EPS, extracellular polymeric substances; FR, ferric reductase; HMA, heavy metal-associated; PCD, programmed cell death; ROS, reactive oxygen species. responsive to Fe limitation were identified through a statistically- carbon fluxes into the cell and toward RuBisCO are adjusted to verified quantitative comparison (14) of 8,669 expressed sequenced match reductant supply. In accordance, Calvin/Benson cycle- tags (ESTs) derived from Fe-limited P. tricornutum cells with related genes downstream of RuBisCO, such as plastid localized 104,783 ESTs derived from cells grown in 11 different (all iron- glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and plastid replete) culture conditions (www.biologie.ens.fr/diatomics/EST). A fructose bisphosphate aldolases (FBA) I and II were up-regulated partial genome microarray and qRT-PCR provided further assess- under Fe stress (Fig. 1 and Table S1), likely in response to ment and verification of differential regulation, leading to the reductions in substrate abundance. identification of 212 up-regulated and 26 down-regulated genes. Higher levels of expression of genes encoding galactokinase and The represented acclimation strategies were grouped into three endo-1,3-beta-glucanase under Fe limitation (Fig. 1 and Table S1) categories: down-regulation, compensation, and acquisition. point to increased degradation of carbohydrates relative to Fe- replete conditions. Significant increases in cellular glucose and in Results and Discussion the intermediate sugars maltose and trehalose (Fig. S2 and Table Down-Regulation of Photosynthesis. Low Fe supply leads to cellular S2), coupled with the elevated levels of genes encoding the cytosolic energy limitation in P. tricornutum (15) and causes significant enzymes phosphofructokinase, GAPDH, and phosphoglycerate changes in carbon metabolism. Carbon fixation rates per cell were mutase (Fig. 1 and Table S1) are strong indicators that the 14-fold lower in Fe-limited P. tricornutum cells compared with conversion of polysaccharides to glucose fuels increased glycolytic Fe-replete cells (Table 1). This difference remained significant activity under Fe limitation (Fig. 1). The altered cell size (Table 1 (8-fold) despite normalization to the smaller cell volume observed and Fig. S1) and the observed increase in expression of genes in Fe-limited conditions [Table 1 and supporting information (SI) putatively encoding polysaccharide-associated cell surface proteins Fig. S1]. Reductions in cell volume, chlorophyll (Chl) per cell, (e.g., integrins, fasciclins and mucins) (Fig.
Load more

Recommended publications
  • Molecular Characterization of Galactokinase Deficiency In
    J Hum Genet (1999) 44:377–382 © Jpn Soc Hum Genet and Springer-Verlag 1999377 ORIGINAL ARTICLE Minoru Asada · Yoshiyuki Okano · Takuji Imamura Itsujin Suyama · Yutaka Hase · Gen Isshiki Molecular characterization of galactokinase deficiency in Japanese patients Received: May 19, 1999 / Accepted: August 21, 1999 Abstract Galactokinase (GALK) deficiency is an autoso- Key words Galactosemia · Galactokinase (GALK) · Muta- mal recessive disorder, which causes cataract formation in tion · Genotype · Phenotype children not maintained on a lactose-free diet. We charac- terized the human GALK gene by screening a Japanese genomic DNA phage library, and found that several nucle- otides in the 59-untranslated region and introns 1, 2, and 5 in Introduction our GALK genomic analysis differed from published data. A 20-bp tandem repeat was found in three places in intron Galactokinase (GALK: McKUSICK 230200) is the first 5, which were considered insertion sequences. We identified enzyme in the Leloir pathway of galactose metabolism; it five novel mutations in seven unrelated Japanese patients catalyzes the phosphorylation of galactose to galactose- with GALK deficiency. There were three missense muta- 1-phosphate. GALK deficiency, first described in 1965 tions and two deletions. All three missense mutations (Gitzelmann 1965), is an autosomal recessive genetic disor- (R256W, T344M, and G349S) occurred at CpG dinucle- der with an incidence of 1/1,000,000 in Japan (Aoki and otides, and the T344M and G349S mutations occurred in Wada 1988) on newborn mass screening and an incidence of the conserved region. The three missense mutations led to a 1/1,000,000 in Caucasians (Segal and Berry 1995).
    [Show full text]
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • A Theoretical Study of the Tryptophan Synthase Enzyme Reaction Network
    A Theoretical Study of the Tryptophan Synthase Enzyme Reaction Network Dissertation zur Erlangung des akademischen Grades doctor rerum naturalium (Dr. rer. nat.) im Fach Chemie Spezialisierung: Physikalische und theoretische Chemie Eingereicht an der Mathematisch-Naturwissenschaftlichen Fakult¨at der Humboldt-Universit¨at zu Berlin von Dimitri Loutchko Pr¨asidentin der Humboldt-Universit¨atzu Berlin Prof. Dr.-Ing. Dr. Sabine Kunst Dekan der Mathematisch-Naturwissenschaftlichen Fakult¨at Prof. Dr. Elmar Kulke 1. Gutachter: Prof. Dr. Gerhard Ertl 2. Gutachter: Prof. Dr. Klaus Rademann 3. Gutachter: Prof. Dr. Yannick de Decker Tag der m¨undlichen Pr¨ufung:09.07.2018 ii Abstract iii Abstract The channeling enzyme tryptophan synthase provides a paradigmatic example of a chemical nanomachine. It catalyzes the biosynthesis of tryptophan from serine and indole glycerol phos- phate. As a single macromolecule, it possesses two distinct catalytic subunits and implements 13 different elementary reaction steps. A complex pattern of allosteric regulation is involved in its operation. The catalytic activity in a subunit is enhanced or inhibited depending on the state of the other subunit. The gates controlling arrival and release of the ligands can become open or closed depending on the chemical states. The intermediate product indole is directly channeled within the protein from one subunit to another, so that it is never released into the solution around it. In this thesis, the first single-molecule kinetic model of the enzyme is proposed and analyzed. All its transition rate constants are extracted from available experimental data, and thus, no fitting parameters are employed. Numerical simulations reveal strong correlations in the states of the active centers and the emergent synchronization of intramolecular processes in tryptophan synthase.
    [Show full text]
  • Hereditary Galactokinase Deficiency J
    Arch Dis Child: first published as 10.1136/adc.46.248.465 on 1 August 1971. Downloaded from Alrchives of Disease in Childhood, 1971, 46, 465. Hereditary Galactokinase Deficiency J. G. H. COOK, N. A. DON, and TREVOR P. MANN From the Royal Alexandra Hospital for Sick Children, Brighton, Sussex Cook, J. G. H., Don, N. A., and Mann, T. P. (1971). Archives of Disease in Childhood, 46, 465. Hereditary galactokinase deficiency. A baby with galactokinase deficiency, a recessive inborn error of galactose metabolism, is des- cribed. The case is exceptional in that there was no evidence of gypsy blood in the family concerned. The investigation of neonatal hyperbilirubinaemia led to the discovery of galactosuria. As noted by others, the paucity of presenting features makes early diagnosis difficult, and detection by biochemical screening seems desirable. Cataract formation, of early onset, appears to be the only severe persisting complication and may be due to the biosynthesis and accumulation of galactitol in the lens. Ophthalmic surgeons need to be aware of this enzyme defect, because with early diagnosis and dietary treatment these lens changes should be reversible. Galactokinase catalyses the conversion of galac- and galactose diabetes had been made in this tose to galactose-l-phosphate, the first of three patient (Fanconi, 1933). In adulthood he was steps in the pathway by which galactose is converted found to have glycosuria as well as galactosuria, and copyright. to glucose (Fig.). an unexpectedly high level of urinary galactitol was detected. He was of average intelligence, and his handicaps, apart from poor vision, appeared to be (1) Galactose Gackinase Galactose-I-phosphate due to neurofibromatosis.
    [Show full text]
  • Induction of Uridyl Transferase Mrna-And Dependency on GAL4 Gene Function (In Vitro Translation/Immunoprecipitation/GAL Gene Cluster/Positive Regulation) JAMES E
    Proc. Nati. Acad. Sci. USA Vol. 75, No. 6, pp. 2878-2882, June 1978 Genetics Regulation of the galactose pathway in Saccharomyces cerevisiae: Induction of uridyl transferase mRNA-and dependency on GAL4 gene function (in vitro translation/immunoprecipitation/GAL gene cluster/positive regulation) JAMES E. HOPPER*, JAMES R. BROACHt, AND LUCY B. ROWE* * Rosenstiel Basic Medical Sciences Research Center, Brandeis University, Waltham, Massachusetts 02154; and t Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 11724 Communicated by Norman H. Giles, April 10,1978 ABSTRACT In Saccharomyces cerevisiae, utilization of Genetic control of the inducible galactose pathway enzymes galactose requires four inducible enzyme activities. Three of involves the four structural genes GALI, GAL10, GAL7, and these activities (galactose-l-phosphate uridyl transferase, EC genes, GAL4, GAL81 (c), GAL80 2.7.7.10; uridine diphosphogalactose 4-epimerase, EC 5.1.3.2; GAL2 and four regulatory and galactokinase, EC 2.7.1.6) are specified by three tightly (i), and GALS.* Mutations in GALl, GAL10, GAL7, and GAL2 linked genes (GAL7, GALlO, and GALI, respectively) on chro- affect the individual appearance of galactokinase, epimerase, mosome II, whereas the fourth, galactose transport, is specified transferase, and galactose transport activities, respectively (6). by a gene (GALS) located on chromosome XIL Although classic Mutations defining the GALl, GAL10, and GAL7 genes have genetic analysis has revealed both positive and negative regu- invariably been recessive, and they map in three tightly linked latory genes that coordinately affect the appearance of ail four complementation groups near the centromere of chromosome enzyme activities, neither the basic events leading to the ap- pearance of enzyme activities nor the roles of the regulatory II (6, 9, 10).
    [Show full text]
  • Limits of Iron Fertilization
    LIMITS OF IRON FERTILIZATION Anand Gnanadesikan1, John P. Dunne1 and Irina Marinov2 1: NOAA Geophysical Fluid Dynamics Laboratory, PO Box 308, Princeton, NJ 08542 [email protected], [email protected] 2: Department of Earth, Atmosphere and Planetary Sciences, Massachusetts Institute of Technology, Cambridge, MA, [email protected] ABSTRACT Iron fertilization has been proposed as a cheap, controllable, and environmentally benign method for removing carbon dioxide from the atmosphere. While this is in fact the case in simple, 3-box models of the carbon cycle, more realistic models show that these claims fall short of reality. The fact that the efficiency of iron fertilization depends on the long term fate of the added iron and on the carbon associated with it makes tracking the effects of iron fertilization much more difficult and expensive than has been asserted. Additionally, advection of low nutrient water away from iron-rich areas can result in lowering production remotely, with potentially serious consequences. INTRODUCTION The idea of offsetting anthropogenic carbon dioxide emissions by fertilizing the ocean with iron has a number of superficially attractive features. A host of iron fertilization experiments have demonstrated that adding iron to surface waters leads to a local increase in productivity [see for example Coale et al., 1996]. Our own survey of the literature [Dunne et al. subm.] shows that this should be expected to lead to a local increase in particle export. It is claimed however, that this local increase in particle export would necessarily lead to an easily verifiable drawdown in atmospheric carbon dioxide. It is further claimed that the increase in export is controllable and environmentally benign, implying that the effects cease as soon as the fertilization stops.
    [Show full text]
  • Supplementary Materials
    Supplementary Materials Figure S1. Differentially abundant spots between the mid-log phase cells grown on xylan or xylose. Red and blue circles denote spots with increased and decreased abundance respectively in the xylan growth condition. The identities of the circled spots are summarized in Table 3. Figure S2. Differentially abundant spots between the stationary phase cells grown on xylan or xylose. Red and blue circles denote spots with increased and decreased abundance respectively in the xylan growth condition. The identities of the circled spots are summarized in Table 4. S2 Table S1. Summary of the non-polysaccharide degrading proteins identified in the B. proteoclasticus cytosol by 2DE/MALDI-TOF. Protein Locus Location Score pI kDa Pep. Cov. Amino Acid Biosynthesis Acetylornithine aminotransferase, ArgD Bpr_I1809 C 1.7 × 10−4 5.1 43.9 11 34% Aspartate/tyrosine/aromatic aminotransferase Bpr_I2631 C 3.0 × 10−14 4.7 43.8 15 46% Aspartate-semialdehyde dehydrogenase, Asd Bpr_I1664 C 7.6 × 10−18 5.5 40.1 17 50% Branched-chain amino acid aminotransferase, IlvE Bpr_I1650 C 2.4 × 10−12 5.2 39.2 13 32% Cysteine synthase, CysK Bpr_I1089 C 1.9 × 10−13 5.0 32.3 18 72% Diaminopimelate dehydrogenase Bpr_I0298 C 9.6 × 10−16 5.6 35.8 16 49% Dihydrodipicolinate reductase, DapB Bpr_I2453 C 2.7 × 10−6 4.9 27.0 9 46% Glu/Leu/Phe/Val dehydrogenase Bpr_I2129 C 1.2 × 10−30 5.4 48.6 31 64% Imidazole glycerol phosphate synthase Bpr_I1240 C 8.0 × 10−3 4.7 22.5 8 44% glutamine amidotransferase subunit Ketol-acid reductoisomerase, IlvC Bpr_I1657 C 3.8 × 10−16
    [Show full text]
  • An Iron Cycle Cascade Governs the Response of Equatorial Pacific Ecosystems to Climate Change
    Received: 19 June 2020 | Revised: 7 August 2020 | Accepted: 9 August 2020 DOI: 10.1111/gcb.15316 PRIMARY RESEARCH ARTICLE An iron cycle cascade governs the response of equatorial Pacific ecosystems to climate change Alessandro Tagliabue1 | Nicolas Barrier2 | Hubert Du Pontavice3,4 | Lester Kwiatkowski5 | Olivier Aumont5 | Laurent Bopp6 | William W. L. Cheung4 | Didier Gascuel3 | Olivier Maury2 1School of Environmental Sciences, University of Liverpool, Liverpool, UK Abstract 2MARBEC (IRD, Univ. Montpellier, CNRS, Earth System Models project that global climate change will reduce ocean net pri- Ifremer), Sète, France mary production (NPP), upper trophic level biota biomass and potential fisheries 3ESE, Ecology and Ecosystem Health, Institut Agro, Rennes, France catches in the future, especially in the eastern equatorial Pacific. However, projec- 4Nippon Foundation-Nereus Program, tions from Earth System Models are undermined by poorly constrained assumptions Institute for the Oceans and Fisheries, regarding the biological cycling of iron, which is the main limiting resource for NPP University of British Columbia, Vancouver, BC, Canada over large parts of the ocean. In this study, we show that the climate change trends 5LOCEAN, Sorbonne Université-CNRS-IRD- in NPP and the biomass of upper trophic levels are strongly affected by modifying MNHN, Paris, France assumptions associated with phytoplankton iron uptake. Using a suite of model ex- 6ENS-LMD, Paris, France periments, we find 21st century climate change impacts on regional NPP range from Correspondence −12.3% to +2.4% under a high emissions climate change scenario. This wide range Alessandro Tagliabue, School of Environmental Sciences, University of arises from variations in the efficiency of iron retention in the upper ocean in the Liverpool, Liverpool, UK.
    [Show full text]
  • Biochemistry Entry of Fructose and Galactose
    Paper : 04 Metabolism of carbohydrates Module : 06 Entry of Fructose and Galactose Dr. Vijaya Khader Dr. MC Varadaraj Principal Investigator Dr.S.K.Khare,Professor IIT Delhi. Paper Coordinator Dr. Ramesh Kothari,Professor UGC-CAS Department of Biosciences Saurashtra University, Rajkot-5, Gujarat-INDIA Dr. S. P. Singh, Professor Content Reviewer UGC-CAS Department of Biosciences Saurashtra University, Rajkot-5, Gujarat-INDIA Dr. Charmy Kothari, Assistant Professor Content Writer Department of Biotechnology Christ College, Affiliated to Saurashtra University, Rajkot-5, Gujarat-INDIA 1 Metabolism of Carbohydrates Biochemistry Entry of Fructose and Galactose Description of Module Subject Name Biochemistry Paper Name 04 Metabolism of Carbohydrates Module Name/Title 06 Entry of Fructose and Galactose 2 Metabolism of Carbohydrates Biochemistry Entry of Fructose and Galactose METABOLISM OF FRUCTOSE Objectives 1. To study the major pathway of fructose metabolism 2. To study specialized pathways of fructose metabolism 3. To study metabolism of galactose 4. To study disorders of galactose metabolism 3 Metabolism of Carbohydrates Biochemistry Entry of Fructose and Galactose Introduction Sucrose disaccharide contains glucose and fructose as monomers. Sucrose can be utilized as a major source of energy. Sucrose includes sugar beets, sugar cane, sorghum, maple sugar pineapple, ripe fruits and honey Corn syrup is recognized as high fructose corn syrup which gives the impression that it is very rich in fructose content but the difference between the fructose content in sucrose and high fructose corn syrup is only 5-10%. HFCS is rich in fructose because the sucrose extracted from the corn syrup is treated with the enzyme that converts some glucose in fructose which makes it more sweet.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Directed Evolution of the Tryptophan Synthase Β-Subunit for Stand-Alone Function Recapitulates Allosteric Activation
    Directed evolution of the tryptophan synthase β-subunit for stand-alone function recapitulates allosteric activation Andrew R. Buller1, Sabine Brinkmann-Chen1, David K. Romney, Michael Herger, Javier Murciano-Calles, and Frances H. Arnold2 Division of Chemistry and Chemical Engineering, California Institute of Technology, Pasadena, CA 91125 Edited by Alan R. Fersht, Medical Research Council Laboratory of Molecular Biology, Cambridge, United Kingdom, and approved October 16, 2015 (received for review August 17, 2015) Enzymes in heteromeric, allosterically regulated complexes cata- associated with open, partially closed, and fully closed states lyze a rich array of chemical reactions. Separating the subunits of during the catalytic cycle (2, 4, 6). such complexes, however, often severely attenuates their catalytic TrpS is a naturally promiscuous enzyme complex: the model activities, because they can no longer be activated by their protein system from S. typhimurium catalyzes its β-substitution reaction partners. We used directed evolution to explore allosteric regula- with most haloindoles, methylindoles, and aminoindoles, along tion as a source of latent catalytic potential using the β-subunit of with an assortment of nonindole nucleophiles for C–S, C–N, and – tryptophan synthase from Pyrococcus furiosus (PfTrpB). As part of C C bond formation (7). Such noncanonical amino acids (NCAAs) its native αββα complex, TrpB efficiently produces tryptophan and have diverse applications in chemical biology (8), serve as inter- tryptophan analogs; activity drops considerably when it is used as mediates in the synthesis of natural products (9, 10), and are priv- a stand-alone catalyst without the α-subunit. Kinetic, spectro- ileged scaffolds for the development of pharmaceuticals (11).
    [Show full text]
  • (12) United States Patent (10) Patent No.: US 7,094,568 B2 Kozlowski Et Al
    US007094568B2 (12) United States Patent (10) Patent No.: US 7,094,568 B2 Kozlowski et al. (45) Date of Patent: Aug. 22, 2006 (54) METHOD FOR PRODUCING PROTEINS WO WO O1, 57198 A3 2, 2002 TAGGED AT THE N- OR C-TERMINUS (75) Inventors: Roland Kozlowski, Babraham (GB); OTHER PUBLICATIONS Michael B. McAndrew, Babraham (GB); Jonathan Michael Blackburn, Bordini, E., and Hamdan, M., “Investigation of Some Covalent and Cambridge (GB); Michelle Anne Noncovalent Complexes by Matrix-assisted Laser Desorption/Ion Mulder, Capetown (ZA); Mitali ization Time-of-flight and Electrospray Mass Spectrometry.” Rapid Commun. Mass Spectrom. 13:1143-1151, John Wiley & Sons, Ltd. Samaddar, Hyderabad (IN) (1999). Cai, J., et al., “Functional Expression of Multidrug Resistance (73) Assignee: Sense Proteomic Ltd., (GB) Protein 1 in Pichia pastoris.” Biochemistry 40:8307-8316, Ameri can Chemical Society (Jun. 2001). (*) Notice: Subject to any disclaimer, the term of this DeRisi, J., et al., “Use of a cDNA microarray to analyse gene patent is extended or adjusted under 35 expression patterns in human cancer,” Nat. Genet. 14:457-460, U.S.C. 154(b) by 477 days. Nature Publishing Co. (1996). Doellgast, G.J., et al., “Sensitive Enzyme-Linked Immunosorbent (21) Appl. No.: 10/114,334 Assay for Detection of Clostridium botulinum Neurotoxins A, B, and E Using Signal Amplification via Enzyme-Linked Coagulation (22) Filed: Apr. 3, 2002 Assay.” J. Clin. Microbiol. 3 1:2402-2409, American Society for Microbiology (1993). (65) Prior Publication Data Giuliani, C.D., et al., “Expression of an active recombinant lysine US 2003 FOOT3811 A1 Apr. 17, 2003 49 phospholipase A myotoxin as a fusion protein in bacteria.” Toxicon 39:1595-1600, Elsevier Science Ltd.
    [Show full text]