Ammonia Generation by Tryptophan Synthase Drives a Key Genetic Difference Between Genital and Ocular Chlamydia Trachomatis Isolates

Home , Tryptophan synthase

Ammonia generation by tryptophan synthase drives a key genetic difference between genital and ocular Chlamydia trachomatis isolates

Shardulendra P. Sherchanda and Ashok Aiyara,1

aDepartment of Microbiology, Immunology, and Parasitology, Louisiana State University Health Sciences Center New Orleans, New Orleans, LA 70112

Edited by Ralph R. Isberg, Tufts University School of Medicine, Boston, MA, and approved April 19, 2019 (received for review December 19, 2018) A striking difference between genital and ocular clinical isolates of the microbiome at the site of infection produces indole, permitting Chlamydia trachomatis is that only the former express a functional chlamydial tryptophan synthase to generate tryptophan and thus tryptophan synthase and therefore can synthesize tryptophan by circumvent host-imposed tryptophan starvation (3, 4, 6, 7). The indole salvage. Ocular isolates uniformly cannot use indole due to composition of the cervicovaginal microbiome indicates the pres- inactivating mutations within tryptophan synthase, indicating a ence of indole-producing genera during dysbiotic conditions, pro- selection against maintaining this enzyme in the ocular environ- viding a strong reason for genital isolates to maintain an active ment. Here, we demonstrate that this selection occurs in two tryptophan synthase (6, 7). In contrast, factors that drive the loss of steps. First, specific indole derivatives, produced by the human gut tryptophan synthase in the majority of oculotropic strains are un- microbiome and present in serum, rapidly induce expression of C. tra- clear and the focus of this report (5). chomatis tryptophan synthase, even under conditions of tryptophan Tryptophan synthase has two α-subunits, encoded by trpA, and sufficiency. We demonstrate that these indole derivatives function by two β-subunits, encoded by trpB (11, 12). Comprehensive studies acting as de-repressors of C. trachomatis TrpR. Second, trp operon de- by Caldwell et al. (3), evaluating the tryptophan synthase status repression is profoundly deleterious when infected cells are in an indole- of a large number of clinical genital and ocular isolates, revealed deficient environment, because in the absence of indole, tryptophan that no clinical ocular isolates encoded an active tryptophan synthase deaminates serine to pyruvate and ammonia. We have used synthase. With rare exception, this failure arose from point biochemical and genetic approaches to demonstrate that expression mutations in either trpA or trpB (3). In most bacteria, tryptophan of wild-type tryptophan synthase is required for the bactericidal synthase catalyzes two reactions termed α and β. In the α reac- production of ammonia. Pertinently, although these indole deriva- tion, which is catalyzed solely by TrpA (11, 12), indole-3-glycerol tives de-repress the trpRBA operon of C. trachomatis strains with phosphate undergoes a retro-aldol cleavage to release indole and trpA or trpB mutations, no ammonia is produced, and no deleterious glyceraldehyde-3-phosphate (G3P) (13). Indole is channeled to effects are observed. Our studies demonstrate that tryptophan syn- TrpB by TrpA (11, 14), to undergo a β-replacement reaction with thase can catalyze the ammonia-generating β-elimination reaction serine to generate tryptophan (11, 13). In addition to β-replacement, within any live bacterium. Our results also likely explain previous in vitro studies using tryptophan synthase from Escherichia coli observations demonstrating that the same indole derivatives inhibit demonstrated that, in the absence of indole, TrpB deaminates the growth of other pathogenic bacterial species, and why high serum levels of these indole derivatives are favorable for the prog- Significance nosis of diseased conditions associated with bacterial dysbiosis. Chlamydia trachomatis is a human bacterial pathogen that Chlamydia trachomatis | genital and ocular serovars | tryptophan synthase causes distinct pathologies upon infecting ocular and urogen- β-elimination | serine deamination | trp operon de-repression ital compartments. Previous studies have shown that all urogenital strains can express tryptophan synthase, an enzyme he bacterium Chlamydia trachomatis is an obligate intracel- they use to synthesize tryptophan by salvaging indole pro- Tlular pathogen that causes urogenital and ocular infections of duced by other bacterial species in the infection microenvi- humans. Distinct serovars of C. trachomatis, classified based on ronment. In stark contrast, all ocular strains of Chlamydia their outer membrane proteins, are associated with infections at trachomatis lack tryptophan synthase, typically because of these sites. Ocular infections are associated with serovars A–C, inactivating point mutations. Here, we suggest why ocular while urogenital infections are associated with serovars D–K. strains lose tryptophan synthase activity; activation of this Genetic and sequence studies indicate that the genomes of enzyme in an indole-deficient environment, like the eye, re- oculotropic and genitotropic strains are >99% identical with two sults in the deleterious production of ammonia. By identifying striking differences (1). Urogenital strains encode an intact cy- the mechanism that underlies this effect, our findings provide totoxin with a GTPase-inactivating domain (CT166) (2) and, in strategies to target infections by Chlamydia and other bacteria. addition, encode a functional tryptophan synthase that provides them the capacity to synthesize tryptophan via indole salvage (3, Author contributions: S.P.S. and A.A. designed research, performed research, contributed 4). The observation that urogenital C. trachomatis isolates ex- new reagents/analytic tools, analyzed data, and wrote the paper. press a functional tryptophan synthase extends to genital serovar The authors declare no conflict of interest. B isolates, indicating a strong selective pressure to maintain the This article is a PNAS Direct Submission. capacity to salvage indole in the urogenital environment (3, 5). Published under the PNAS license. C. trachomatis is a tryptophan auxotroph and cannot synthesize Data deposition: Predicted structures for TrpR and tryptophan synthase from C. tracho- tryptophan de novo. The capacity of urogenital isolates to syn- matis D/UW-3/CX have been deposited in the Zenodo data repository, https://doi.org/10. thesize tryptophan via indole salvage is proposed to reveal an 5281/zenodo.2662318. intricate interplay between C. trachomatis, the IFN-γ–induced See Commentary on page 12136. host enzyme indoleamine 2,3-dioxygenase (IDO1), and the 1To whom correspondence should be addressed. Email: [email protected]. microbiome at the site of infection (3, 4, 6, 7). When induced, This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. IDO1 degrades tryptophan to kynurenine, thereby starving 1073/pnas.1821652116/-/DCSupplemental. Chlamydia (8–10). The antibacterial effect of IFN-γ is hampered if Published online May 16, 2019.

12468–12477 | PNAS | June 18, 2019 | vol. 116 | no. 25 www.pnas.org/cgi/doi/10.1073/pnas.1821652116 Downloaded by guest on September 27, 2021 serine via β-elimination to generate ammonia and pyruvate (SI results clearly indicate that expression of trpBA in the absence of Appendix,Fig.S1)(15–17). The ammonia product of this alternative indole is severely deleterious to C. trachomatis. reaction can be directly antibacterial if it saponifies bacterial lipids Our studies reveal that the ammonia-generating β-elimination SEE COMMENTARY (18–20). Alternatively, as first shown for Helicobacter pylori,am- reaction can occur when tryptophan synthase is expressed within monia kills infected human cells that express the NMDA receptor a live bacterium. Finally, the widely reported antiinflammatory (21). Given the negative implications of the ammonia-generating properties associated with these indole derivatives may result β-elimination reaction, it is unsurprising that it is biochemically from the bacterial burden-reducing consequence of inducing curtailed in two ways. First, β-elimination proceeds at a slower rate tryptophan synthase activity in an indole-poor environment. than the tryptophan-generating β-replacement reaction (22, 23). Thus, it is not favored if indole is present. Second, β-elimination is Results suppressed by allosteric interactions within tryptophan synthase. Indole-3-Propionic Acid and Indole-β-Acrylic Acid Are Predicted to De- Biochemical studies using Salmonella typhimurium tryptophan syn- repress the C. trachomatis trpRBA Operon. The C. trachomatis thase indicate that the G3P product of the α reaction remains trpRBA operon is expressed in conditions where tryptophan is bound to TrpA forcing an interaction between loop 6 of TrpA with limiting (33, 34), presumably because the TrpR apo-repressor is no helix 6 of TrpB (23–27). This allosteric change further decreases the longer associated with its corepressor, tryptophan (33, 34). Al- rate of β-elimination. Confirming this, mutations placed in S. though C. trachomatis TrpR has diverged from its E. coli homolog typhimurium tryptophan synthase that disrupt the TrpA/TrpB allo- (SI Appendix,Fig.S2A), we sought to test whether it could be de- steric interaction permit β-elimination to proceed (23–27). Relevant repressed by the same indole derivatives as E. coli TrpR. For E. to C. trachomatis tryptophan synthase, studies indicate that the coli TrpR, indole-3-propionic acid (IPA) and indole-β-acrylic acid TrpA/TrpB allosteric interaction is not favored for two reasons: (i) (IAA) bind the apo-repressor more tightly than tryptophan but TrpA cannot catalyze the α reaction (4); ergo, it is never bound to block TrpR from binding trp operator (37, 39). Lawson and Sigler G3P; and (ii) loop 6 of chlamydial TrpA has mutations (4), which (38) demonstrated that, although IPA and tryptophan bind the when placed in S. typhimurium tryptophan synthase eliminate al- same pocket, IPA’s carboxylic acid group repels trpR from the losteric control (25). phosphodiester backbone of the trp operator. Marmorstein et al. These observations led us to posit that ammonia generation by (37, 39) revealed that IAA de-represses the trp operon similarly. β-elimination may be a negative selection against C. trachomatis To evaluate whether this mechanism of corepressor and de- tryptophan synthase in an indole-free environment; in this repressor association were applicable to chlamydial TrpR, we

regard, studies reveal the conjunctival microbiome to be domi- modeled the structure of chlamydial TrpR with SWISS-MODEL MICROBIOLOGY nated by non–indole-producing genera, such as Streptococcus, (59), based on the structure of E. coli TrpR (60). Our model (SI Corynebacterium, Pseudomonas, and Serratia (28–32). Akin to Appendix,Fig.S2B) indicates the predicted structure of chlamydial many other Gram-negative bacteria, expression of the chla- TrpR closely resembles E. coli TrpR. The corepressor binding mydial trpBA genes are tightly regulated by the tryptophan re- pocket (SI Appendix,Fig.S3) is highly conserved. For C. tracho- pressor (TrpR) (33–35). When associated with its corepressor, matis TrpR, the indole ring of tryptophan is sandwiched between tryptophan, TrpR prevents transcription by tightly binding the trp the aliphatic chains of arginines 44 and 74 from one TrpR operator. Transcription of the trp operon is induced when C. monomer, and the carboxylic acid group projects toward leucine trachomatis-infected cells are subjected to tryptophan depletion, 31, serine 34, and leucine 33 from the other TrpR monomer. for instance, by exposure to IFN-γ (3, 36). We did not detect Given this structural conservation, we tested the effect of IAA and increased levels of ammonia in media supernatants under these IPA on C. trachomatis viability and trpRBA expression. conditions, possibly because they disfavor translation of TrpB, which has multiple tryptophan residues. Therefore, we sought IPA and IAA Are Deleterious to Genital C. trachomatis and De-repress alternative conditions that permit tryptophan synthase expres- trpRBA Expression. HeLa cells, cultured in complete media, were sion without depleting tryptophan. infected with the wild-type C. trachomatis genital strain D/UW-3/ Molecular studies conducted with Escherichia coli TrpR in- CX at a multiplicity of infection (m.o.i.) of 1 and immediately ex- dicate that some indole derivatives de-repress the trp operon by posed to increasing concentrations of IAA or IPA. Extracts of in- displacing tryptophan from TrpR, while simultaneously pre- fected cells were evaluated for inclusion-forming unit (IFU) venting it from binding the trp operator (37–39). Recent studies recovery as described in Materials and Methods (Fig. 1A). IAA and have demonstrated that some of these indole derivatives are IPA reduced IFU recovery in a concentration-dependent manner. naturally produced by the human gut microbiome and reach For both compounds, IFU recovery was reduced by ∼2.5 logs at concentrations ranging from 1 to 7 μM in blood (40–43). Curi- 600 μM. A reduction by ≥1 log was observed at 100 μMIAAand ously, these same derivatives act, via an unknown mechanism, as 200 μM IPA. As observed previously (44–46), concentrations of antibacterials against Legionella pneumophila (44–46) and My- IAA and IPA >3 mM were cytotoxic. We evaluated trpRBA de- cobacterium tuberculosis (47, 48), and possess antiinflammatory repression by quantifying trpB expression relative to 16S rRNA at properties (40, 49–51). High levels of these indole derivatives in 24 h postinfection (h.p.i.) 100 μMIAAor200μMofIPAincreased peripheral circulation correlate with protection against inflam- trpB expression by >1 log relative to control media (Fig. 1B). matory bowel disease, Crohn’s disease, and type 2 diabetes (49, Therefore, as seen for E. coli (61, 62), IAA and IPA de-repress the 52–55); one of them was in clinical trials as an antiinflammatory C. trachomatis trpRBA operon even during tryptophan sufficiency. that reduces Alzheimer’s disease progression (56, 57). The decrease in IFU could result from either reduced replication Our results indicate that these indole derivatives effectively kill within infected cells or fewer infected cells. To distinguish these urogenital C. trachomatis in vitro. They rapidly induce trpBA ex- possibilities, primary inclusions were stained at 36 h.p.i. (Fig. 1C). pression, concomitant with a rise in ammonia levels when indole is IAA and IPA reduced inclusion size (SI Appendix,TableS1) not provided. Furthermore, while these derivatives are deleterious without changing the fraction of infected cells. to a wild-type genital isolate of C. trachomatis, they have no effect on an ocular isolate or an engineered genital isolate that both lack Indole-3-Lactic Acid Has No Effect on Genital C. trachomatis and Does tryptophan synthase (58). We interpret our results to indicate that Not De-repress the trpRBA Operon. In women, the primary site for trp operon de-repression in the absence of indole underlies the genital C. trachomatis infections is the endocervix (63), a micro- genetic selection against tryptophan synthase in oculotropic C. environment that often contains Lactobacillus spp. (64), some of trachomatis strains. While it remains unclear whether the indole which can produce indole-3-lactic acid (ILA) (40). ILA resembles derivatives described by us drive trpBA de-repression in vivo, our IPA in structure, with the sole difference being that a hydrogen in

Sherchand and Aiyar PNAS | June 18, 2019 | vol. 116 | no. 25 | 12469 Downloaded by guest on September 27, 2021 IPA is substituted by a hydroxyl group in ILA. This difference conditions, supernatant levels of ammonia/ammonium were in- blocks ILA from de-repressing the trp operon (37, 39) but does not distinguishable between infected and uninfected cells. Both IPA prevent ILA from activating host receptors like the aryl hydro- and IAA dramatically raised supernatant ammonia/ammonium carbon receptor (AhR) (40, 50, 51, 53), which is also activated by levels only for infected cells, such that they ranged between 40 and IPA and IAA (40, 50, 51, 53). We tested ILA’s effect on C. tra- 60 μM at 24 h.p.i. In contrast, ILA, which does not de-repress the chomatis because it can be in the natural infection microenvi- trpRBA operon, did not induce ammonia production. These results ronment, and distinguish effects manifested via host cell changes directly prove that serine β-elimination by tryptophan synthase oc- vs. directly on C. trachomatis. ILA did not affect IFU recovery curs within live bacteria when indole is absent. Furthermore, those (Fig. 2A) and did not induce the expression of trpBA (Fig. 2B)or indole derivatives that induce ammonia production are deleterious alter inclusion formation (Fig. 2C and SI Appendix, Table S1). to C. trachomatis. We directly tested whether ammonia was dele- These data corroborate the interpretation that IPA and IAA terious to C. trachomatis by adding it (as NH4OH) to cell culture negatively impact C. trachomatis through de-repression of trypto- media immediately after infection. As shown (SI Appendix,Fig. phan synthase, rather than by affecting host cell physiology. S4A), ammonia interfered with IFU recovery in a concentration- dependent manner. Ammonia also affected chlamydial inclusion IPA and IAA Induce Ammonia Production by Genital C. trachomatis- development (SI Appendix,Fig.S4B). Infected Cells. Because β-elimination on serine catalyzed by tryptophan synthase creates ammonia (SI Appendix, Fig. S1) (15– Indole Blocks the Deleterious Effect of IPA and IAA on C. trachomatis. 17), we tested whether C. trachomatis-infected cells exposed to In vitro studies indicate that the indole-consuming β-replacement IPA and IAA produced ammonia. Ammonia is membrane per- reaction is favored over the ammonia-generating β-elimination meant (65, 66) and equilibrates in an aqueous environment to reaction on serine (22, 23). Indeed, a central tenet to our hy- ammonium hydroxide. Therefore, cell supernatants were tested pothesis is that β-elimination only occurs when indole is absent. for their ammonia and ammonium levels (Fig. 3). Under control We tested whether indole blocks the deleterious effect of IPA and

Fig. 1. IAA and IPA de-repress the C. trachomatis trpRBA operon with deleterious effects. (A) IAA and IPA reduce C. trachomatis D/UW-3/CX IFUs recovered in a dose-dependent manner. HeLa cells were infected with D/UW-3/CX as described (Materials and Methods), following which indicated amounts of IAA or IPA were added. IFU recovery was evaluated at 42 h.p.i. Structures of IAA and IPA are shown as Insets within graphs. (B) IAA and IPA de-repress the C. trachomatis D/UW-3/CX trpRBA operon. RNA extracted at 24 h.p.i. from cells infected with D/UW-3/CX under control conditions or after IAA (100 μM) or IPA (200 μM) exposure. TrpRBA expression was evaluated by RT-qPCR for trpB.(C) IAA and IPA reduce the size of primary inclusions formed by D/UW-3/CX in HeLa cells. Inclusions were stained in cells fixed at 36 h.p.i. as described (Materials and Methods). Chlamydial inclusions are green, while DNA counterstained with Hoechst 33342 is blue. (Scale bar: 20 μm.) *P < 0.05, using the Wilcoxon rank sum test, and **P < 0.01, using the same test.

12470 | www.pnas.org/cgi/doi/10.1073/pnas.1821652116 Sherchand and Aiyar Downloaded by guest on September 27, 2021 engineered point mutant that inactivates trpB constructed in the same genetic background (D/UW-3/CX) as our wild-type strain (58). IAA and IPA did not affect A2497 or the D trpB mutant at SEE COMMENTARY concentrations that reduce IFU recovery for D/UW-3/CX by ≥1 log (Fig. 5A). Consistent with this, IPA and IAA also did not affect primary inclusion formation or size for A2497 or D trpB mut (Fig. 5B and SI Appendix, Table S1), but de-repressed the trpRBA operon in both strains as revealed by RT-qPCR for trpB (Fig. 5C). Finally, consistent with neither strain producing a functional tryptophan synthase, IPA and IAA did not induce them to make ammonia (Fig. 5D). Therefore, for C. trachomatis, ammonia production by β-elimination requires both TrpA and TrpB subunits of tryptophan synthase. The data obtained with A2497 and D trpB mut clearly indicate that tryptophan synthase activity in the absence of indole is highly deleterious to C. trachomatis. Furthermore, trpRBA de-repression in an indole-free environment is likely relevant to the selection and survival of oculotropic C. trachomatis strains.

Physiological Oxygen Tension Permits Physiological Concentrations of IPA and IAA to Be Effective Against Genital C. trachomatis. Our findings indicate that de-repression of trpBA in the absence of indole is deleterious to genital C. trachomatis, and that this process may be driven by indole derivatives produced by the gut microbiome. However, the concentrations of these derivatives found in serum are between 1 and 2 logs lower than the concentrations we and others have used for experiments in vitro (41,

42, 44–47, 49, 50). Our attempts to dissect this discrepancy were MICROBIOLOGY directed by our observation that IAA and IPA had half-lives of ∼6 h in cell culture, independent of the vehicle used to solubilize them. Studies evaluating the neuroprotective properties of IPA in cell culture reveal that while protecting against oxidative radicals, it is oxidized to kynuric acid (57), the structure of which renders it incompatible with functioning as a de-repressor for TrpR. While conducting studies on viral transactivators, we observed that epithelial cells cultured under normoxia (20% O2)produce oxidative radicals including hydroxyl radicals and superoxides. This production was decreased by culturing cells under hypoxic Fig. 2. ILA is not deleterious to C. trachomatis D/UW-3/CX and does not de- repress the trpRBA operon. (A) D/UW-3/CX–infected HeLa cells were exposed to ILA as indicated, and IFU recovery was evaluated at 42 h.p.i. The structure of ILA is shown as an Inset.(B) ILA does not de-repress the D/UW-3/CX trpRBA operon. trpRBA expression was evaluated as described in Fig. 1. (C) Exposure to ILA does not affect the size of primary inclusions formed by D/ UW-3/CX. Infected cells exposed to the indicated ILA concentration were fixed and stained at 36 h.p.i. as described in Fig. 1. (Scale bar: 20 μm.)

IAA (Fig. 4). Provision of 50 μM indole concurrently with IPA and IAA completely restored inclusion size (Fig. 4A)andIFUre- covery (Fig. 4B). Indole also reduced supernatant ammonia levels to control levels (Fig. 4C). Importantly, indole did not prevent IPA and IAA from de-repressing trpRBA (Fig. 4D), indicating that indole blocks the deleterious effect of IPA and IAA by shifting catalysis from β-elimination to β-replacement.

IPA and IAA Do Not Affect a C. trachomatis Serovar A Strain that Lacks Intact TrpA, or an Engineered C. trachomatis Serovar D Point Mutant that Lacks TrpB. Tryptophan synthase is inactivated in oculotropic C. trachomatis strains predominantly by mutations in trpA or trpB, with trpA mutations being more frequent (3). Fig. 3. Ammonia is produced by C. trachomatis D/UW-3/CX–infected cells Studies by the groups of McClarty and Caldwell, demonstrate exposed to IPA and IAA, but not ILA. Cells were infected with D/UW-3/CX as that while C. trachomatis TrpA lacks catalytic activity, it is es- described (Materials and Methods). Indicated concentrations of IPA, IAA, sential for TrpB to catalyze β-replacement (4). Consistent with and ILA were added immediately postinfection. Ammonia levels in supernatants were evaluated at 24 h.p.i. as described (Materials and Methods). this, although tryptophan depletion induces TrpB production in The white bars indicate ammonia levels detected in supernatants from un- oculotropic C. trachomatis trpA mutants (3, 4), they are not infected cells under the specified condition. The gray bars indicate ammonia indole-rescuable (3, 4). We evaluated the effect of IPA and IAA levels detected in supernatants from infected cells under the specified con- on an oculotropic C. trachomatis trpA mutant (A2497), or an dition. **P < 0.01, using the Wilcoxon rank sum test.

Sherchand and Aiyar PNAS | June 18, 2019 | vol. 116 | no. 25 | 12471 Downloaded by guest on September 27, 2021 Fig. 4. Indole blocks the deleterious effect of IAA and IPA on C. trachomatis D/UW-3/CX. (A) Fifty micromolar indole along with the indicated concentration of IAA or IPA was added to D/UW-3/CX–infected HeLa cells. Inclusions were stained as described in Fig. 1. (B) IFU recovery was evaluated at 42 h.p.i. from cells infected with D/UW-3/CX and exposed to IAA and IPA alone (gray bars), or in combination with 50 μM indole (white bars). (C) Indole blocks the production of ammonia by HeLa cells infected with D/UW-3/CX and treated with IPA or IAA. Infected cells were treated with IAA (100 μM) or IPA (200 μM) alone, or together with 50 μM indole, following which supernatant ammonia levels were measured at 24 h.p.i. (D) Indole does not prevent de-repression of the D/UW-3/CX trpRBA operon by IAA and IPA. Infected HeLa cells were exposed to 50 μM indole alone (white bar), or in combination with 100 μM IAA or 200 μM IPA (gray bars). TrpRBA expression was evaluated as described. **P < 0.01, using the Wilcoxon rank sum test.

conditions (4% O2)(67–69). Our findings correspond to observa- Discussion tions made by others with HeLa cells, in that oxidative radicals have The selective pressures that cause the loss of tryptophan synthase been observed at significant levels during normoxic culture (70); in activity in oculotropic C. trachomatis isolates are enigmatic. We contrast, hypoxia relieves oxidative stress and increases the viability have shown that trpRBA operon de-repression in an indole-poor of HeLa cells (71). In this regard, physiological oxygen tensions in environment is a powerful selection against expression of tryp- the majority of human tissues range from 0 to 5% O2; for example, tophan synthase. Under these conditions, tryptophan synthase – vaginal oxygen tension is typically 1 2% O2, rising briefly to 5% O2 generates ammonia via serine deamination, as by demonstrated during sexual stimulation (72); a similar range has been observed for Crawford and Miles and colleagues (12, 15, 16) in vitro. Our cervical and uterine oxygen tension (73). Conjunctival oxygen ten- results prove that serine deamination occurs when tryptophan – sion is also low, ranging 0.5 1% O2 (74, 75). Therefore, we tested synthase is expressed in indole-free conditions. Using conditions the function of IPA and IAA on genital C. trachomatis under hyp- that shift tryptophan synthase’s activity from β-elimination to oxic conditions (4% O2). These results are shown in Fig. 6. Under β-replacement, our results ascribe deleterious effects to the these conditions, 5 μM IPA and IAA reduced IFU recovery by former. Finally, our results indicate that both the TrpA and TrpB ∼1log(Fig.6A) and effectively de-repressed trpBA (Fig. 6B). We subunits of C. trachomatis tryptophan synthase are needed for also observed the generation of ammonia, albeit at a lower level serine deamination, akin to requirements for β-replacement (4). (Fig. 6C). This decrease either reflects reduced activity of tryptophan Mutation in either is protective, explaining why oculotropic synthase under these conditions or that ammonia is blown off during strains have mutations in either trpA or trpB (3). gas exchanges conducted every 4 h to maintain 4% O2. Finally, the We used IPA and IAA to de-repress the trp operon because these provision of indole rescued the effect of IPA and IAA under hypoxia indole derivatives are known gut microbiome products that are (Fig. 6D), confirming observations made under normoxic conditions. found in peripheral circulation in low micromolar concentrations

12472 | www.pnas.org/cgi/doi/10.1073/pnas.1821652116 Sherchand and Aiyar Downloaded by guest on September 27, 2021 SEE COMMENTARY MICROBIOLOGY

Fig. 5. IAA and IPA do not affect C. trachomatis strains that lack tryptophan synthase activity. (A) HeLa cells were infected with a trpA mutant C. trachomatis serovar A strain (A2497), or a derivative of C. trachomatis D/UW-3/CX with an inactivating point mutation in trpB (D trpB mut). Infected cells were exposed to 100 μM IAA or 200 μM IPA for 42 h, following which IFU recovery was evaluated. (B) IAA and IPA do not affect primary inclusion formation by A2497 or D trpB mut. HeLa cells infected with the indicated strain were exposed to control media or IPA and IAA for 36 h following which chlamydial inclusions were stained. (Scale bar: 20 μm.) (C) IAA and IPA de-repress the trpRBA operon in A2497 and D trpB mut. HeLa cells, infected with A2497 or D trpB mut, were treated with 100 μM IAA or 200 μM IPA for 24 h, following which trpRBA expression was evaluated. (D) IPA and IAA do not induce ammonia production from HeLa cells infected with A2497 or D trpB mut. HeLa cells infected with A2497 or D trpB mut were treated with 100 μM IAA or 200 μM IPA for 24 h, following which ammonia levels in cell supernatants were evaluated. Control conditions are indicated by the white bar, while ammonia levels after IPA and IAA exposureare indicated by the gray bars. **P < 0.01, using the Wilcoxon rank sum test.

(40–43). Furthermore, the mechanism by which they act on E. coli studies. The majority of studies evaluating the effect of IPA and TrpR for trp de-repression (38) is known, permitting us to evaluate IAA on bacteria and host cells have employed them at concen- the possibility of their binding chlamydial TrpR before testing them trations that are 1–2 logs higher than their levels in serum (40–43). experimentally. Our findings demonstrate these two biologically Pertinently, we have found these compounds to be effective at relevant indole derivatives can de-repress the chlamydial trpRBA their serum concentrations provided physiological oxygen tension operon; our structural predictions suggest that de-repression occurs is maintained during in vitro culture. by their engaging TrpR (SI Appendix, Figs. S2 and S3), although IPA and IAA can alter host-cell physiology by binding re- an alternative mechanism of de-repression is not excluded by our ceptors like the AhR. However, their deleterious effect on

Sherchand and Aiyar PNAS | June 18, 2019 | vol. 116 | no. 25 | 12473 Downloaded by guest on September 27, 2021 Fig. 6. Physiological concentrations of IPA and IAA are deleterious to genital C. trachomatis under hypoxic (4% O2) conditions. (A) D/UW-3/CX–infected HeLa cells were treated with 5 and 15 μM of IAA or IPA and incubated in at 4% O2 as described in Materials and Methods. At 42 h.p.i., cells were harvested to measure IFUs released. (B) Physiological concentrations of IAA and IPA de-repress the D/UW-3/CX trpRBA operon. trpRBA expression was evaluated as described in Materials and Methods.(C) Ammonia is generated by D/UW-3/CX–infected cells incubated with physiological concentrations of IAA and IPA under hypoxic conditions. Ammonia levels were measured from supernatants obtained at 24 h.p.i. as described earlier. (D) Indole alleviates the deleterious effects of IAA and IPA on genital C. trachomatis growth. HeLa cells infected with genital C. trachomatis wereexposedto5and15μM of IAA and IPA concurrently with 50 μM indole and incubated under hypoxic conditions. IFU release was measured at 42 h.p.i. *P < 0.05, using the Wilcoxon rank sum test, and **P < 0.01, using the same test.

C. trachomatis does not result from such interactions because (i) L. pneumophila and M. tuberculosis. Should that prove true, the their effect is unabated when C. trachomatis-infected cells are simple point mutations in trpA and trpB that permit C. tracho- exposed to IPA or IAA in the presence of cycloheximide, which matis ocular strains to evade this deleterious effect dictates that inhibits host-cell protein translation; and (ii) ILA, an indole caution be used while considering IPA as an antibacterial. derivative structurally close to IPA and IAA, binds cellular re- IPA and IAA are proposed as beneficial indole derivatives ceptors bound by them, but has no effect on C. trachomatis. produced by desirable genera within the gut microbiome (40, Confirming the mechanism ascribed to IPA and IAA, ILA does 53). Studies have correlated IPA and IAA levels with better not de-repress the C. trachomatis trpRBA operon. Our findings prognosis for individuals with type 2 diabetes, Crohn’s disease, with IPA and IAA may explain the previously observed effects of and inflammatory bowel disease (49, 52–55). IPA was also in these molecules on Legionella pneumophila (44–46). IPA and clinical trials for its effect against Alzheimer’s disease (56, 57). In IAA reduce L. pneumophila growth under axenic conditions as these conditions, IPA is believed to function as an antiin- well as intracellularly within monocytes. Analogous to C. tra- flammatory. We suggest in conditions associated with bacterial chomatis, IPA and IAA may be bactericidal by inducing trypto- dysbiosis, such as Crohn’s disease and inflammatory bowel dis- phan synthase, which deaminates serine. A recent screen of gut ease, IPA may be directly bactericidal by inducing tryptophan microbiome metabolites identified IPA as a prominent antitu- synthase and serine deamination. Its observed antiinflammatory bercular compound that was effective against Mycobacterium effects in conditions like type 2 diabetes may arise from reducing tuberculosis (47). While no mechanism was described, it was the overall bacterial burden via this mechanism. proposed that IPA be considered for inclusion in antitubercular IAA is produced by Clostridium sporogenes,andPeptos- therapy (47). The approaches we used can be used to determine treptococcus spp. including P. russellii, P. anaerobius,andP. stomatis whether trp de-repression underlies IPA’s bactericidal effects on (40, 42, 49). IPA is produced by the same Peptostreptococcus spp.,

12474 | www.pnas.org/cgi/doi/10.1073/pnas.1821652116 Sherchand and Aiyar Downloaded by guest on September 27, 2021 and a broader spectrum of Clostridium spp. including C. sporogenes, TrpR (accession no. AKD90255) using T-COFFEE (80) with default parameters. C. botulinum, C. caloritolerans, C. cadaveris,andC. paraputrificum SWISS-MODEL (59) was used to create a structural model for C. trachomatis (40, 42, 49, 76–78). We were curious how IPA- and IAA-producing TrpR based on the structure of E. coli TrpR (Protein Data Bank ID code 3WRP) SEE COMMENTARY species evaded their bactericidal effects. Pertinently, no bacterial (60). Structures were visualized using EzMol (81). Predicted structures for TrpR and tryptophan synthase from C. trachomatis D/UW-3/CX can be obtained species that makes IAA or IPA has a trp operon or trpR. Thus, IPA from the Zenodo repository (https://doi.org/10.5281/zenodo.2662318). and IAA producers are immune to the mechanism by which these compounds are bactericidal. For this reason, we believe that IPA Cell Culture, Media Additives, and C. trachomatis Infections. HeLa cells were and IAA are made as antibiotics that permit colonization by specific cultured as described (82, 83). Postinfection, they were fed DMEM synthe- species over other species competing for the same niche. sized as described earlier (82, 83), supplemented with 5% triple-dialyzed calf The invariant capacity of genital C. trachomatis to maintain an serum. Indicated concentrations of indole derivatives, prepared freshly in active tryptophan synthase is thought to exemplify a pathogen fi- DMSO, were added to postinfection media. IPA (Sigma; catalog #57400), IAA nessing metabolites produced by a niche-specific microbiome to (Sigma; catalog # I2273), ILA (Sigma; catalog #I5508), and indole (Sigma; evade an IFN-γ–driven protective host immune response (3, 6, 7). catalog #I3408) were stored under vacuum. The C. trachomatis strains Indole produced by dysbiotic genital microbiomes can be salvaged serovar D (D/UW-3/CX), D trpB-null (single point mutation of TrpB subunit of by C. trachomatis to evade tryptophan starvation imposed by IFN-γ tryptophan synthase), and serovar A (A2497) were used as indicated. Cells were infected as described previously at a m.o.i. of 1 (82, 83). IFU recovery (3, 6, 7). While indole-producing bacterial species can be isolated was measured at 42 h.p.i. as described previously (82, 83). from vaginal samples (6), IFN-γ levels found at infection sites are likely insufficient by themselves to drive tryptophan starvation (6, Immunofluorescence, Imaging, and Inclusion Area Measurement. Control and 63, 79). Although a role for other cytokines in driving tryptophan infected cells were stained using a FITC-conjugated anti-chlamydial LPS an- starvation is likely, it should be noted that significant levels of cer- tibody (Merifluor; catalog #500111; Meridian Bioscience) as described pre- vicovaginal tryptophan continue to be detected in the majority of viously (82, 83). Stained cells were imaged as described previously (82, 83); women who have spontaneously cleared their chlamydial infection images were analyzed using Fiji, version 2 (84). At least 75 inclusions were (79). Therefore, we suggest that clearance may result from a com- sized for each experimental condition. bination of multiple factors, including (i) a protective immune re- – trpB sponse that decreases tryptophan availability; and (ii) de-repression Reverse-Transcriptase qPCR for Gene Expression. mRNA extracted from of trpRBA by indole derivatives. Lowered tryptophan and de- infected cells at 24 h.p.i. using the RNeasy kit (Qiagen; catalog #74104) was used to prepare cDNA using the iScript gDNA Clear cDNA Synthesis kit (Bio- repression both promote expression of tryptophan synthase. The Rad; catalog #1725035). qPCRs were performed using the SsoAdvanced outcome of tryptophan synthase expression remains dependent on Universal SYBR Green Supermix kit (Bio-Rad; catalog #1725271). Reactions MICROBIOLOGY the prevalent genital microbiome. Genital microbiomes that lack were run in a Bio-Rad CFX 384. The following primers were used for am- indole producers, such as the “normal” vaginal microbiome, favor plification: CT-16SrRNA_F, TGAGGAGTACACTCGCAAG; CT-16SrRNA_R, C. trachomatis clearance by (i) preventing tryptophan synthesis via GCGGAAAACGACATTTCTGC; CT-trpB_F, GTGGAACGACAGAAACC; and CT- indole salvage; and (ii) permitting serine deamination to prevail trpB_R, GGCCGATCCTAAGCAATAG. TrpB mRNA levels were quantified rel- over indole-requiring β-replacement. In contrast, dysbiotic micro- ative to 16S rRNA levels as described (75). biomes with indole producers will hinder clearance by (i)permitting tryptophan synthesis via indole salvage; and (ii) creating conditions Ammonia/Ammonium Quantification. Cell supernatants were recovered at μ that favor indole-requiring β-replacement over serine deamination. 24 h.p.i., 0.2 m filtered, following which ammonia/ammonium was mea- It should also be noted that because tryptophan and de-repressors sured using an Ammonia Assay Kit (Sigma; catalog #AA0100-1KT). compete for binding TrpR (37–39), dysbiotic genital microbiomes Infections Under Physiological O Conditions. A premixed gas mixture (91% N , will also decrease the efficacy of de-repressors by increasing intra- 2 2 5% CO2,4%O2) was used in these experiments as described previously. inclusion tryptophan concentration. Media applied to cells were preexposed to a 4% O2 atmosphere in sealed In summary, our studies reveal that expression of tryptophan modular chambers for at least 24 h for equilibration. HeLa cells were spin synthase can be deleterious to C. trachomatis if it occurs in an infected as described above. Infected cells were fed preequilibrated control indole-poor environment. The paucity of indole producers in the media, or media containing IPA or IAA. Cells were placed in sealed cham- ocular microbiome likely provides a strong selective pressure bers, flushed for at least 5 min with the gas mixture, and placed in a 37 °C against maintaining this enzyme in that environment. In contrast, incubator. Chambers were manually flushed with the gas mixture every 4 h. for genital infections, indole-producing dysbiotic microbiomes prevent immune clearance by two closely related mechanisms Exposure to Ammonia. HeLa cells were infected as described above and exposed that reflect the activities of tryptophan synthase. The presence of to the indicated concentration of ammonia, which was added to media as ammonium hydroxide. Because ammonia is volatile, control and ammonia-exposed indole blocks serine deamination and simultaneously permits cells were placed in chambers in separate incubators. Media ammonia concen- tryptophan biosynthesis to evade starvation. We have demon- trations were confirmed using the ammonia assay described above. strated that gut microbiome-produced indole derivatives can promote tryptophan synthase expression, with deleterious effects Statistical Analysis. Experiments were repeated a minimum of three inde- in the absence of indole. Our studies suggest a need to evaluate pendent times. Statistical significance was calculated with the Wilcoxon rank the genital microenvironment for the presence and levels of sum test (85), using MSTAT, version 6 (N. Drinkwater, McArdle Laboratory for molecules that can function as trpRBA de-repressors to de- Cancer Research, University of Wisconsin Medical School, Madison, WI). termine their contribution toward clearance, and the mechanism by which they synergize with IFN-γ. ACKNOWLEDGMENTS. We thank our colleagues Drs. Angela Amedee, Victoria Burke, Arthur Haas, and Patricia Mott for their suggestions and discussions during the course of our experiments. We are especially grate- Materials and Methods ful to Dr. Harlan Caldwell for the kind gift of the D trpB mut strain of Structural Prediction of TrpR from C. trachomatis D/UW-3/CX. TrpR from C. C. trachomatis, whose use was essential to interpret our findings. This work trachomatis D/UW-3/CX (accession no. NP_219672) was aligned with E. coli was supported by National Institutes of Health Grant AI118860.

1. Carlson JH, Porcella SF, McClarty G, Caldwell HD (2005) Comparative genomic analysis of 4. Fehlner-Gardiner C, et al. (2002) Molecular basis defining human Chlamydia trachomatis Chlamydia trachomatis oculotropic and genitotropic strains. Infect Immun 73:6407–6418. tissue tropism. A possible role for tryptophan synthase. JBiolChem277:26893–26903. 2. Carlson JH, et al. (2004) Polymorphisms in the Chlamydia trachomatis cytotoxin locus 5. Andersson P, et al. (2016) Chlamydia trachomatis from Australian Aboriginal people with associated with ocular and genital isolates. Infect Immun 72:7063–7072. trachoma are polyphyletic composed of multiple distinctive lineages. Nat Commun 7:10688. 3. Caldwell HD, et al. (2003) Polymorphisms in Chlamydia trachomatis tryptophan 6. Aiyar A, et al. (2014) Influence of the tryptophan-indole-IFNγ axis on human genital synthase genes differentiate between genital and ocular isolates. J Clin Invest 111: Chlamydia trachomatis infection: Role of vaginal co-infections. Front Cell Infect 1757–1769. Microbiol 4:72.

Sherchand and Aiyar PNAS | June 18, 2019 | vol. 116 | no. 25 | 12475 Downloaded by guest on September 27, 2021 7. Ziklo N, Huston WM, Taing K, Katouli M, Timms P (2016) In vitro rescue of genital 39. Marmorstein RQ, Joachimiak A, Sprinzl M, Sigler PB (1987) The structural basis for the strains of Chlamydia trachomatis from interferon-γ and tryptophan depletion with interaction between L-tryptophan and the Escherichia coli trp aporepressor. J Biol indole-positive, but not indole-negative Prevotella spp. BMC Microbiol 16:286. Chem 262:4922–4927. 8. Beatty WL, Belanger TA, Desai AA, Morrison RP, Byrne GI (1994) Tryptophan de- 40. Roager HM, Licht TR (2018) Microbial tryptophan catabolites in health and disease. pletion as a mechanism of gamma interferon-mediated chlamydial persistence. Infect Nat Commun 9:3294. Immun 62:3705–3711. 41. Alexeev EE, et al. (2018) Microbiota-derived indole metabolites promote human and 9. Ibana JA, et al. (2018) Chlamydia trachomatis-infected cells and uninfected-bystander murine intestinal homeostasis through regulation of interleukin-10 receptor. Am J cells exhibit diametrically opposed responses to interferon gamma. Sci Rep 8:8476. Pathol 188:1183–1194. 10. Shemer Y, Sarov I (1985) Inhibition of growth of Chlamydia trachomatis by human 42. Dodd D, et al. (2017) A gut bacterial pathway metabolizes aromatic amino acids into gamma interferon. Infect Immun 48:592–596. nine circulating metabolites. Nature 551:648–652. 11. Dunn MF, Niks D, Ngo H, Barends TR, Schlichting I (2008) Tryptophan synthase: The 43. Rosas HD, et al. (2015) A systems-level “misunderstanding”: The plasma metabolome workings of a channeling nanomachine. Trends Biochem Sci 33:254–264. in Huntington’s disease. Ann Clin Transl Neurol 2:756–768. 12. Miles EW (2013) The tryptophan synthase α2β2 complex: A model for substrate 44. Grossowicz N (1990) Phytohormones as specific inhibitors of Legionella pneumophila channeling, allosteric communication, and pyridoxal phosphate catalysis. J Biol Chem growth. Isr J Med Sci 26:187–190. 288:10084–10091. 45. Inoue H, Yajima Y, Kawano G, Nagasawa H, Sakuda S (2004) Isolation of indole-3- 13. Raboni S, Bettati S, Mozzarelli A (2009) Tryptophan synthase: A mine for enzymolo- aldehyde as a growth inhibitor of Legionella pneumophila from Diaion HP-20 resins gists. Cell Mol Life Sci 66:2391–2403. used to culture the bacteria. Biocontrol Sci 9:39–41. 14. Hyde CC, Miles EW (1990) The tryptophan synthase multienzyme complex: Exploring 46. Mandelbaum-Shavit F, Barak V, Saheb-Tamimi K, Grossowicz N (1991) Susceptibility of structure-function relationships with X-ray crystallography and mutagenesis. Bio- Legionella pneumophila grown extracellularly and in human monocytes to indole-3- – technology (N Y) 8:27–32. propionic acid. Antimicrob Agents Chemother 35:2526 2530. 15. Crawford IP, Ito J (1964) Serine deamination by the B protein of Escherichia coli 47. Negatu DA, et al. (2018) Whole-cell screen of fragment library identifies gut micro- tryptophan synthetase. Proc Natl Acad Sci USA 51:390–397. biota metabolite indole propionic acid as antitubercular. Antimicrob Agents Che- 16. Miles EW, Hatanaka M, Crawford IP (1968) A new thiol-dependent transamination mother 62:e01571-17. reaction catalyzed by the B protein of Escherichia coli tryptophan synthetase. Bio- 48. Kaufmann SHE (2018) Indole propionic acid: A small molecule links between gut chemistry 7:2742–2753. microbiota and tuberculosis. Antimicrob Agents Chemother 62:e00389-18. 17. Kumagai H, Miles EW (1971) The B protein of Escherichia coli tryptophan synthetase. 49. Wlodarska M, et al. (2017) Indoleacrylic acid produced by commensal Peptos- – II. New -elimination and -replacement reactions. Biochem Biophys Res Commun 44: treptococcus species suppresses inflammation. Cell Host Microbe 22:25 37.e6. 1271–1278. 50. Yisireyili M, Takeshita K, Saito S, Murohara T, Niwa T (2017) Indole-3-propionic acid 18. Cerruto-Noya CA, Goad CL, DeWitt CA (2011) Antimicrobial effect of ammonium suppresses indoxyl sulfate-induced expression of fibrotic and inflammatory genes in – hydroxide when used as an alkaline agent in the formulation of injection brine so- proximal tubular cells. Nagoya J Med Sci 79:477 486. lutions. J Food Prot 74:475–479. 51. Zelante T, et al. (2013) Tryptophan catabolites from microbiota engage aryl hydro- – 19. Mendonca AF, Amoroso TL, Knabel SJ (1994) Destruction of gram-negative food- carbon receptor and balance mucosal reactivity via interleukin-22. Immunity 39:372 385. borne pathogens by high pH involves disruption of the cytoplasmic membrane. 52. de Mello VD, et al. (2017) Indolepropionic acid and novel lipid metabolites are as- Appl Environ Microbiol 60:4009–4014. sociated with a lower risk of type 2 diabetes in the Finnish Diabetes Prevention Study. 20. Silipo A, Lanzetta R, Amoresano A, Parrilli M, Molinaro A (2002) Ammonium hy- Sci Rep 7:46337. droxide hydrolysis: A valuable support in the MALDI-TOF mass spectrometry analysis 53. Gao J, et al. (2018) Impact of the gut microbiota on intestinal immunity mediated by of lipid A fatty acid distribution. J Lipid Res 43:2188–2195. tryptophan metabolism. Front Cell Infect Microbiol 8:13. 21. Seo JH, Fox JG, Peek RM, Jr, Hagen SJ (2011) N-methyl D-aspartate channels link 54. Ranhotra HS, et al. (2016) Xenobiotic receptor-mediated regulation of intestinal ammonia and epithelial cell death mechanisms in Helicobacter pylori infection. Gas- barrier function and innate immunity. Nucl Receptor Res 3:101199. troenterology 141:2064–2075. 55. Tuomainen M, et al. (2018) Associations of serum indolepropionic acid, a gut micro- 22. Ahmed SA, Martin B, Miles EW (1986) Beta-elimination of indole from L-tryptophan biota metabolite, with type 2 diabetes and low-grade inflammation in high-risk in- catalyzed by bacterial tryptophan synthase: A comparison between reactions cata- dividuals. Nutr Diabetes 8:35. lyzed by tryptophanase and tryptophan synthase. Biochemistry 25:4233–4240. 56. Bendheim PE, et al. (2002) Development of indole-3-propionic acid (OXIGON) for 23. Ahmed SA, Ruvinov SB, Kayastha AM, Miles EW (1991) Mechanism of mutual acti- Alzheimer’s disease. J Mol Neurosci 19:213–217. vation of the tryptophan synthase alpha and beta subunits. Analysis of the reaction 57. Chyan YJ, et al. (1999) Potent neuroprotective properties against the Alzheimer beta- specificity and substrate-induced inactivation of active site and tunnel mutants of the amyloid by an endogenous melatonin-related indole structure, indole-3-propionic beta subunit. J Biol Chem 266:21548–21557. acid. J Biol Chem 274:21937–21942. 24. Brzovic PS, Hyde CC, Miles EW, Dunn MF (1993) Characterization of the functional 58. Kari L, et al. (2011) Generation of targeted Chlamydia trachomatis null mutants. Proc role of a flexible loop in the alpha-subunit of tryptophan synthase from Salmonella Natl Acad Sci USA 108:7189–7193. typhimurium by rapid-scanning, stopped-flow spectroscopy and site-directed muta- 59. Waterhouse A, et al. (2018) SWISS-MODEL: Homology modelling of protein structures – genesis. Biochemistry 32:10404 10413. and complexes. Nucleic Acids Res 46:W296–W303. 25. Raboni S, Bettati S, Mozzarelli A (2005) Identification of the geometric requirements 60. Lawson CL, et al. (1988) Flexibility of the DNA-binding domains of trp repressor. for allosteric communication between the alpha- and beta-subunits of tryptophan Proteins 3:18–31. – synthase. J Biol Chem 280:13450 13456. 61. Doolittle WF, Yanofsky C (1968) Mutants of Escherichia coli with an altered 26. Schneider TR, et al. (1998) Loop closure and intersubunit communication in trypto- tryptophanyl-transfer ribonucleic acid synthetase. J Bacteriol 95:1283–1294. – phan synthase. Biochemistry 37:5394 5406. 62. Gunsalus RP, Miguel AG, Gunsalus GL (1986) Intracellular Trp repressor levels in Es- 27. Weyand M, Schlichting I, Herde P, Marabotti A, Mozzarelli A (2002) Crystal structure cherichia coli. J Bacteriol 167:272–278. → “ ” of the beta Ser178 Pro mutant of tryptophan synthase. A knock-out allosteric 63. Lewis ME, et al. (2014) Morphologic and molecular evaluation of Chlamydia tracho- – enzyme. J Biol Chem 277:10653 10660. matis growth in human endocervix reveals distinct growth patterns. Front Cell Infect 28. Ozkan J, et al. (2019) Biogeography of the human ocular microbiota. Ocul Surf 17: Microbiol 4:71. – 111 118. 64. Filardo S, et al. (2017) Diversity of cervical microbiota in asymptomatic Chlamydia 29. Ozkan J, Coroneo M, Willcox M, Wemheuer B, Thomas T (2018) Identification and trachomatis genital infection: A pilot study. Front Cell Infect Microbiol 7:321. visualization of a distinct microbiome in ocular surface conjunctival tissue. Invest 65. Antonenko YN, Pohl P, Denisov GA (1997) Permeation of ammonia across bilayer lipid Ophthalmol Vis Sci 59:4268–4276. membranes studied by ammonium ion selective microelectrodes. Biophys J 72:2187– 30. Wen X, et al. (2017) The influence of age and sex on ocular surface microbiota in 2195. healthy adults. Invest Ophthalmol Vis Sci 58:6030–6037. 66. Walter A, Gutknecht J (1986) Permeability of small nonelectrolytes through lipid bi- 31. Ozkan J, et al. (2017) Temporal stability and composition of the ocular surface mi- layer membranes. J Membr Biol 90:207–217. crobiome. Sci Rep 7:9880. 67. Washington AT, Singh G, Aiyar A (2010) Diametrically opposed effects of hypoxia and 32. Zhou Y, et al. (2014) The conjunctival microbiome in health and trachomatous dis- oxidative stress on two viral transactivators. Virol J 7:93. ease: A case control study. Genome Med 6:99. 68. Aras S, Singh G, Johnston K, Foster T, Aiyar A (2009) Zinc coordination is required for 33. Carlson JH, Wood H, Roshick C, Caldwell HD, McClarty G (2006) In vivo and in vitro and regulates transcription activation by Epstein-Barr nuclear antigen 1. PLoS Pathog studies of Chlamydia trachomatis TrpR:DNA interactions. Mol Microbiol 59:1678– 5:e1000469. 1691. 69. Singh G, Aras S, Zea AH, Koochekpour S, Aiyar A (2009) Optimal transactivation by 34. Akers JC, Tan M (2006) Molecular mechanism of tryptophan-dependent transcrip- Epstein-Barr nuclear antigen 1 requires the UR1 and ATH1 domains. J Virol 83:4227– tional regulation in Chlamydia trachomatis. J Bacteriol 188:4236–4243. 4235.

35. Wood H, et al. (2003) Regulation of tryptophan synthase gene expression in Chla- 70. Park WH (2014) Anti-apoptotic effect of caspase inhibitors on H2O2-treated HeLa cells mydia trachomatis. Mol Microbiol 49:1347–1359. through early suppression of its oxidative stress. Oncol Rep 31:2413–2421. 36. Belland RJ, et al. (2003) Transcriptome analysis of chlamydial growth during IFN- 71. Setty BA, et al. (2017) Hypoxia-induced proliferation of HeLa cells depends on epi- gamma-mediated persistence and reactivation. Proc Natl Acad Sci USA 100:15971– dermal growth factor receptor-mediated arginase II induction. Physiol Rep 5:e13175. 15976. 72. Wagner G, Levin R (1978) Oxygen tension of the vaginal surface during sexual stim- 37. Marmorstein RQ, Sigler PB (1989) Stereochemical effects of L-tryptophan and its an- ulation in the human. Fertil Steril 30:50–53. alogues on trp repressor’s affinity for operator-DNA. J Biol Chem 264:9149–9154. 73. Yedwab GA, Paz G, Homonnai TZ, David MP, Kraicer PF (1976) The temperature, pH, 38. Lawson CL, Sigler PB (1988) The structure of trp pseudorepressor at 1.65A shows why and partial pressure of oxygen in the cervix and uterus of women and uterus of rats indole propionate acts as a trp “inducer.” Nature 333:869–871. during the cycle. Fertil Steril 27:304–309.

12476 | www.pnas.org/cgi/doi/10.1073/pnas.1821652116 Sherchand and Aiyar Downloaded by guest on September 27, 2021 74. Nisam M, Albertson TE, Panacek E, Rutherford W, Fisher CJ, Jr (1986) Effects of hy- 80. Di Tommaso P, et al. (2011) T-coffee: A web server for the multiple sequence align- perventilation on conjunctival oxygen tension in humans. Crit Care Med 14:12–15. ment of protein and RNA sequences using structural information and homology ex- tension. Nucleic Acids Res 39:W13–W17.

75. Haljamäe H, Frid I, Holm J, Holm S (1989) Continuous conjunctival oxygen tension SEE COMMENTARY (PcjO2) monitoring for assessment of cerebral oxygenation and metabolism during 81. Reynolds CR, Islam SA, Sternberg MJE (2018) EzMol: A web server wizard for the rapid visualization and image production of protein and nucleic acid structures. J Mol Biol carotid artery surgery. Acta Anaesthesiol Scand 33:610–616. 430:2244–2248. 76. Elsden SR, Hilton MG, Waller JM (1976) The end products of the metabolism of ar- 82. Sherchand S, Ibana JA, Quayle AJ, Aiyar A (2016) Cell intrinsic factors modulate the omatic amino acids by Clostridia. Arch Microbiol 107:283–288. effects of IFNγ on the development of Chlamydia trachomatis. J Bacteriol Parasitol 7: 77. Wikoff WR, et al. (2009) Metabolomics analysis reveals large effects of gut microflora 282. – on mammalian blood metabolites. Proc Natl Acad Sci USA 106:3698 3703. 83. Sherchand SP, Ibana JA, Zea AH, Quayle AJ, Aiyar A (2016) The high-risk human 78. Williams BB, et al. (2014) Discovery and characterization of gut microbiota de- papillomavirus E6 oncogene exacerbates the negative effect of tryptophan starvation carboxylases that can produce the neurotransmitter tryptamine. Cell Host Microbe 16: on the development of Chlamydia trachomatis. PLoS One 11:e0163174. 495–503. 84. Rueden CT, et al. (2017) ImageJ2: ImageJ for the next generation of scientific image 79. Jordan SJ, et al. (2017) Lower levels of cervicovaginal tryptophan are associated with data. BMC Bioinformatics 18:529. natural clearance of Chlamydia in women. J Infect Dis 215:1888–1892. 85. Wilcoxon F (1945) Individual comparisons by ranking methods. Biom Bull 1:80–83. MICROBIOLOGY

Sherchand and Aiyar PNAS | June 18, 2019 | vol. 116 | no. 25 | 12477 Downloaded by guest on September 27, 2021