DOCSLIB.ORG

Function and Regulation of the Postsynaptic Exchange Factor, Kalirin-7 Megan B

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

University of Connecticut OpenCommons@UConn Doctoral Dissertations University of Connecticut Graduate School 4-2-2015 Function and Regulation of the Postsynaptic Exchange Factor, Kalirin-7 Megan B. Miller University of Connecticut, [email protected] Follow this and additional works at: https://opencommons.uconn.edu/dissertations Recommended Citation Miller, Megan B., "Function and Regulation of the Postsynaptic Exchange Factor, Kalirin-7" (2015). Doctoral Dissertations. 698. https://opencommons.uconn.edu/dissertations/698 Function and Regulation of the Postsynaptic Exchange Factor, Kalirin-7 Megan B. Miller, Ph.D. University of Connecticut, 2015 Abstract Through studies of a single RhoGEF, Kalirin-7, the work presented herein provides insight into several of the key mechanisms underlying postsynaptic neurotransmission in the central nervous system. Much of this work has focused on the significance of non-enzymatic functions of Kal7, highlighting the importance of spatial and temporal control of multi-domain proteins and the postsynaptic protein/ lipid interactome. Our work on Kalrn promoter usage and phosphorylation (Chapters 5 & 6) expands upon our understanding of synaptic protein diversity and regulation. Additionally, Kalrn promoter switching has implications for the poorly-understood mechanisms by which cytoskeletal dynamics and membrane trafficking are coordinated at the postsynaptic density (PSD). Combined with our biochemical characterization of the Sec14 domain (Chapter 4), our exploration of Kalrn promoter usage also touches upon the importance of synaptic lipid metabolism. Thus, by enhancing our knowledge of the functions and regulatory mechanisms of Kal7, we highlight the extraordinary intricacies of postsynaptic signaling and the necessity for precise control of multiple cellular events. Furthermore, we provide a large body of evidence to support the notion that large, multi-domain proteins serve diverse roles at the synapse, which are crucial for normal brain function. i Function and Regulation of the Postsynaptic Exchange Factor, Kalirin-7 Megan Bridget Miller B.S., The Ohio State University, 2005 Ph.D., University of Connecticut, 2015 A Dissertation Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy at the University of Connecticut 2015 ii APPROVAL PAGE Doctor of Philosophy Dissertation Function and Regulation of the Postsynaptic Exchange Factor, Kalirin-7 Presented by: Megan B. Miller, B.S., Ph.D. Major Advisor _________________________________________________________________ Betty A. Eipper, Ph.D. Associate Advisor ______________________________________________________________ Kimberly L. Dodge-Kafka, Ph.D. Associate Advisor ______________________________________________________________ Eric S. Levine, Ph.D. Associate Advisor ______________________________________________________________ Richard E. Mains, Ph.D. University of Connecticut 2015 iii Acknowledgments First and foremost, I would like to thank my outstanding thesis advisors, Dr. Betty Eipper and Dr. Richard Mains. They have shown me unrivaled support and guidance every step of the way, while still allowing me to pursue my own intellectual curiosities. Looking back, I think one of the greatest lessons they have taught me is the value of an open-minded and enthusiastic approach to science. One would be hard-pressed to find two people who love what they do more than Dick and Betty. In addition to being excellent scientists, Dick and Betty are also model mentors. Their dedication to the well-being and career development of their trainees is apparent. Because of them, I feel confident in my ability to pursue interesting questions with the highest level of integrity, and for that I am beyond appreciative. I must also thank all of the other members of my lab for their support and comradery along the way. I feel extremely fortunate to have been a part of such a positive and enriching group. I would especially like to thank Yanping Wang and Darlene D’Amato for their incredible technical support and Dr. K.S. Vishwanatha who was integral to the biophysical studies presented in this dissertation. I would also like to thank my thesis committee members, Dr. Levine and Dr. Dodge-Kafka, for their honest feedback over the years. Thanks also to Dr. Yi Wu and the people at the KECK Neuroproteomics facility at Yale for their continued support and ongoing collaborations. Of course none of this would have been possible without the UConn Health Center Biomedical Science PhD program, the Graduate Programs Committee, the Department of Neuroscience and graduate program and all of the individuals who work so hard to assure an iv excellent educational experience for students. In particular, I would like to thank Dr. Barbara Kream, Stephanie Rauch, Swapna Das and Jody Gridley for their laudable dedication. Finally, I thank all of my friends and family for their immeasurable support and understanding over the years. To my parents, Mark and Lou Miller: I would have never had the courage to pursue this degree if it were not for the lifetime of unwavering support I have received from you. It was you who first instilled in me the value of hard work, and you have never discouraged me from chasing outlandish dreams. I owe this and all future success to you. To my sister (brother) Molly, thanks for reminding me to see the humor in life when I get too serious. You will never know how much our silly conversations or absurd brotherly memories have meant to my sanity. And lastly, to my extraordinary fiancé, Giulio Chiuini: I honestly could not have done this without you. From late-night study snacks and gentle reminders to eat vegetables to nearly constant words of encouragement and an all-too-frequent shoulder to cry on, you were ALWAYS there for me. The level support you consistently show me is beyond selfless, and I truly hope that I can somehow begin to return the favor. Words cannot begin to describe how eternally grateful I am to have you in my life. From the bottom of my heart: thank you and I love you. v Table of Contents Chapter 1: .................................................................................................................................................... 1 Introduction ................................................................................................................................................... 1 Spine dynamics are controlled by RhoGTPases and their regulators ....................................................... 3 The postsynaptic RhoGEF, Kalirin-7........................................................................................................ 4 Chapter 2 ..................................................................................................................................................... 7 Rho GEFs in synaptic physiology and behavior ........................................................................................... 7 Abstract .................................................................................................................................................... 7 Introduction ............................................................................................................................................. 7 Dual Rho GEFs (Kalirin and Trio) ....................................................................................................... 8 Discovery and expression ..................................................................................................................... 8 Protein structure and signaling .......................................................................................................... 10 Behavior .............................................................................................................................................. 11 Electrophysiology and synaptic function ............................................................................................ 14 Disease relevance ............................................................................................................................... 15 T-cell lymphoma invasion and metastasis family (Tiam1 and Tiam2) ............................................ 16 Discovery and expression ................................................................................................................... 16 Protein structure and function ............................................................................................................ 16 Behavior .............................................................................................................................................. 18 Electrophysiology and synaptic function ............................................................................................ 18 Disease relevance ................................................................................................................................ 21 Phosphatidylinositol (3,4,5)-trisphosphate-dependent Rac Exchange Factor Family (P-Rex1 and P-Rex2) ................................................................................................................................................... 21 Discovery and expression ................................................................................................................... 21 Protein structure and function ............................................................................................................ 22 Behavior .............................................................................................................................................
Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
  • The Drug Sensitivity and Resistance Testing (DSRT) Approach

    The Drug Sensitivity and Resistance Testing (DSRT) Approach

    A phenotypic screening and machine learning platform eciently identifies triple negative breast cancer-selective and readily druggable targets Prson Gautam 1 Alok Jaiswal 1 Tero Aittokallio 1, 2 Hassan Al Ali 3 Krister Wennerberg 1,4 Identifying eective oncogenic targets is challenged by the complexity of genetic alterations in 1Institute for Molecular Medicine Finland (FIMM), HiLIFE, University of Helsinki, Finland cancer and their poorly understood relation to cell function and survival. There is a need for meth- Current kinome coverage of kinase inhibitors in TNBC exhibit diverse kinase dependencies MFM-223 is selectively addicted to FGFR2 2Department of Mathematics and Statistics, University of Turku, Finland 3The Miami Project to Cure Paralysis, Peggy and Harold Katz Family Drug Discovery Center, A A Sylvester Comprehensive Cancer Center, and Department of Neurological Surgery and Medicine ods that rapidly and accurately identify “pharmacologically eective” targets without the require- clinical evaluation TN Kinases MFM-223 CAL-120 MDA-MB-231 TNBC TNBC TNBC TNBC TNBC TNBC HER2+ 100 University of Miami Miller School of Medicine, Miami, FL 33136, USA. non- HER2+ FGFR1 0.97 0.00 0.00 MFM-223 BL1 BL2 M MSL IM LAR ER+, PR+ 50 ment for priori knowledge of complex signaling networks. We developed an approach that uses ma- cancerous FGFR2 56.46 0.00 0.00 CAL-120 25 4 MDA-MB-231 Biotech Research & Innovation Centre (BRIC) and Novo Nordisk Foundation Center HCC1937 CAL-85-1 CAL-120 MDA-MB-231 DU4475 CAL-148 MCF-10A SK-BR-3 BT-474 FGFR3 25.10 0.00 0.00 0 chine learning to relate results from unbiased phenotypic screening of kinase inhibitors to their bio- for Stem Cell Biology (DanStem), University of Copenhagen, Denmark HCC1599 HDQ-P1 BT-549 MDA-MB-436 MFM-223 FGFR4 0.00 0.00 0.00 MAXIS*Bk Clinical status MDA-MB-468 CAL-51 Hs578T MDA-MB-453 score chemical activity data.
  • Enzymatic Encoding Methods for Efficient Synthesis Of

    Enzymatic Encoding Methods for Efficient Synthesis Of

    (19) TZZ__T (11) EP 1 957 644 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.: of the grant of the patent: C12N 15/10 (2006.01) C12Q 1/68 (2006.01) 01.12.2010 Bulletin 2010/48 C40B 40/06 (2006.01) C40B 50/06 (2006.01) (21) Application number: 06818144.5 (86) International application number: PCT/DK2006/000685 (22) Date of filing: 01.12.2006 (87) International publication number: WO 2007/062664 (07.06.2007 Gazette 2007/23) (54) ENZYMATIC ENCODING METHODS FOR EFFICIENT SYNTHESIS OF LARGE LIBRARIES ENZYMVERMITTELNDE KODIERUNGSMETHODEN FÜR EINE EFFIZIENTE SYNTHESE VON GROSSEN BIBLIOTHEKEN PROCEDES DE CODAGE ENZYMATIQUE DESTINES A LA SYNTHESE EFFICACE DE BIBLIOTHEQUES IMPORTANTES (84) Designated Contracting States: • GOLDBECH, Anne AT BE BG CH CY CZ DE DK EE ES FI FR GB GR DK-2200 Copenhagen N (DK) HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI • DE LEON, Daen SK TR DK-2300 Copenhagen S (DK) Designated Extension States: • KALDOR, Ditte Kievsmose AL BA HR MK RS DK-2880 Bagsvaerd (DK) • SLØK, Frank Abilgaard (30) Priority: 01.12.2005 DK 200501704 DK-3450 Allerød (DK) 02.12.2005 US 741490 P • HUSEMOEN, Birgitte Nystrup DK-2500 Valby (DK) (43) Date of publication of application: • DOLBERG, Johannes 20.08.2008 Bulletin 2008/34 DK-1674 Copenhagen V (DK) • JENSEN, Kim Birkebæk (73) Proprietor: Nuevolution A/S DK-2610 Rødovre (DK) 2100 Copenhagen 0 (DK) • PETERSEN, Lene DK-2100 Copenhagen Ø (DK) (72) Inventors: • NØRREGAARD-MADSEN, Mads • FRANCH, Thomas DK-3460 Birkerød (DK) DK-3070 Snekkersten (DK) • GODSKESEN,
  • Discovery of the Novel Autophagy Inhibitor Aumitin That Targets Mitochondrial Complex I

    Discovery of the Novel Autophagy Inhibitor Aumitin That Targets Mitochondrial Complex I

    Electronic Supplementary Material (ESI) for Chemical Science. This journal is © The Royal Society of Chemistry 2018 Discovery of the novel autophagy inhibitor Aumitin that targets mitochondrial complex I Lucas Robkea,b,c, Yushi Futamurad, Georgios Konstantinidise, Julian Wilkea,b, Harumi Aonod, Zhwan Mahmoudb, Nobumoto Watanabec,f, Yao-Wen Wue, Hiroyuki Osadac,d, Luca Laraiaa,g *, Herbert Waldmanna,b * a: Max-Planck-Institute of Molecular Physiology, department of Chemical Biology, Otto-Hahn-Str. 11, 44227 Dortmund (Germany); b: Faculty of Chemistry and Chemical Biology, TU Dortmund University, Otto-Hahn-Str. 4a, 44227 Dortmund (Germany); c: RIKEN-Max Planck Joint Research Division for Systems Chemical Biology, RIKEN CSRS, 2-1, Hirosawa, Wako, Saitama 351-0198 (Japan); d: Chemical Biology Research Group, RIKEN CSRS, 2-1, Hirosawa, Wako, Saitama 351-0198 (Japan); e: Chemical Genomics Centre of the Max-Planck-Society, Otto- Hahn-Str. 15, 44227 Dortmund (Germany); f: Bio-Active Compounds Discovery Research Unit, RIKEN CSRS, 2-1, Hirosawa, Wako, Saitama 351-0198 (Japan). g: present address: Department of Chemistry, Technical University of Denmark, Kemitorvet Building 207, Room 124, 2800 Kgs. Lyngby, Denmark. * [email protected], [email protected] SI-Table 1: Structure activity relationship of the di-aminopyrimidines. Starvation = starvation induced autophagy assay; Rapamycin = Rapamycin induced autophagy assay; Viability = survival assessed by means of an ADP-glow assay. > 10 = no inhibition at a test concentration of 10
  • Clinical Utility of Recently Identified Diagnostic, Prognostic, And

    Clinical Utility of Recently Identified Diagnostic, Prognostic, And

    Modern Pathology (2017) 30, 1338–1366 1338 © 2017 USCAP, Inc All rights reserved 0893-3952/17 $32.00 Clinical utility of recently identified diagnostic, prognostic, and predictive molecular biomarkers in mature B-cell neoplasms Arantza Onaindia1, L Jeffrey Medeiros2 and Keyur P Patel2 1Instituto de Investigacion Marques de Valdecilla (IDIVAL)/Hospital Universitario Marques de Valdecilla, Santander, Spain and 2Department of Hematopathology, MD Anderson Cancer Center, Houston, TX, USA Genomic profiling studies have provided new insights into the pathogenesis of mature B-cell neoplasms and have identified markers with prognostic impact. Recurrent mutations in tumor-suppressor genes (TP53, BIRC3, ATM), and common signaling pathways, such as the B-cell receptor (CD79A, CD79B, CARD11, TCF3, ID3), Toll- like receptor (MYD88), NOTCH (NOTCH1/2), nuclear factor-κB, and mitogen activated kinase signaling, have been identified in B-cell neoplasms. Chronic lymphocytic leukemia/small lymphocytic lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, Burkitt lymphoma, Waldenström macroglobulinemia, hairy cell leukemia, and marginal zone lymphomas of splenic, nodal, and extranodal types represent examples of B-cell neoplasms in which novel molecular biomarkers have been discovered in recent years. In addition, ongoing retrospective correlative and prospective outcome studies have resulted in an enhanced understanding of the clinical utility of novel biomarkers. This progress is reflected in the 2016 update of the World Health Organization classification of lymphoid neoplasms, which lists as many as 41 mature B-cell neoplasms (including provisional categories). Consequently, molecular genetic studies are increasingly being applied for the clinical workup of many of these neoplasms. In this review, we focus on the diagnostic, prognostic, and/or therapeutic utility of molecular biomarkers in mature B-cell neoplasms.
  • The TRAX, DISC1, and GSK3 Complex in Mental Disorders and Therapeutic Interventions Yu-Ting Weng1,2, Ting Chien1, I-I Kuan1 and Yijuang Chern1,2*

    The TRAX, DISC1, and GSK3 Complex in Mental Disorders and Therapeutic Interventions Yu-Ting Weng1,2, Ting Chien1, I-I Kuan1 and Yijuang Chern1,2*

    Weng et al. Journal of Biomedical Science (2018) 25:71 https://doi.org/10.1186/s12929-018-0473-x REVIEW Open Access The TRAX, DISC1, and GSK3 complex in mental disorders and therapeutic interventions Yu-Ting Weng1,2, Ting Chien1, I-I Kuan1 and Yijuang Chern1,2* Abstract Psychiatric disorders (such as bipolar disorder, depression, and schizophrenia) affect the lives of millions of individuals worldwide. Despite the tremendous efforts devoted to various types of psychiatric studies and rapidly accumulating genetic information, the molecular mechanisms underlying psychiatric disorder development remain elusive. Among the genes that have been implicated in schizophrenia and other mental disorders, disrupted in schizophrenia 1 (DISC1) and glycogen synthase kinase 3 (GSK3) have been intensively investigated. DISC1 binds directly to GSK3 and modulates many cellular functions by negatively inhibiting GSK3 activity. The human DISC1 gene is located on chromosome 1 and is highly associated with schizophrenia and other mental disorders. A recent study demonstrated that a neighboring gene of DISC1, translin-associated factor X (TRAX), binds to the DISC1/GSK3β complex and at least partly mediates the actions of the DISC1/GSK3β complex. Previous studies also demonstrate that TRAX and most of its interacting proteins that have been identified so far are risk genes and/or markers of mental disorders. In the present review, we will focus on the emerging roles of TRAX and its interacting proteins (including DISC1 and GSK3β) in psychiatric disorders and the potential implications for developing therapeutic interventions. Keywords: TRAX, DISC1, GSK3β, Mental disorders, DNA damage, DNA repair, Oxidative stress, A2AR, PKA Background DNA repair) by interacting with various proteins [4–12].
  • Cyclin-Dependent Kinases and Their Role in Inflammation, Endothelial Cell Migration

    Cyclin-Dependent Kinases and Their Role in Inflammation, Endothelial Cell Migration

    Cyclin-Dependent Kinases and their role in Inflammation, Endothelial Cell Migration and Autocrine Activity Dissertation Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Shruthi Ratnakar Shetty Graduate Program in Pharmaceutical Sciences The Ohio State University 2020 Dissertation Committee Dale Hoyt, Advisor Liva Rakotondraibe Moray Campbell Keli Hu Copyrighted by Shruthi Ratnakar Shetty 2020 Abstract Inflammation is the body’s response to infection or injury. Endothelial cells are among the different players involved in an inflammatory cascade. In response to an inflammatory stimuli such as bacterial lipopolysaccharide (LPS), endothelial cells get activated which is characterized by the production of important mediators, such as inducible nitric oxide synthase (iNOS) which, catalyzes the production of nitric oxide (NO) and reactive nitrogen species and cyclooxygenase-2 (COX-2) that catalyzes the production of prostaglandins. Though the production of these mediators is required for an inflammatory response, it is important that their levels are regulated. Continued production of iNOS results in increased accumulation of reactive nitrogen species (RNS) that might lead to cytotoxicity, whereas lack of/suppression results in endothelial and vascular dysfunction. On the other hand, severe cardiovascular, intestinal and renal side effects are observed with significant suppression of COX-2. Thus, studying factors that could regulate the levels of iNOS and COX-2 could provide useful insights for developing novel therapeutic targets. Regulation of protein levels involves control of protein induction or turnover. Since protein induction requires transcription, in this dissertation we studied the role of a promoter of transcription “Cyclin- dependent kinase 7 (CDK7)” in iNOS and COX-2 protein induction.
  • Gephyrin: a Scaffold That Builds a Phase at the Inhibitory Postsynapses

    Gephyrin: a Scaffold That Builds a Phase at the Inhibitory Postsynapses

    www.nature.com/cr www.cell-research.com RESEARCH HIGHLIGHT OPEN Gephyrin: a scaffold that builds a phase at the inhibitory postsynapses Christian Hoffmann 1 and Dragomir Milovanovic 1 Cell Research (2021) 31:245–246; https://doi.org/10.1038/s41422-020-00440-2 The scaffolding protein gephyrin is a core component of many GPHN-E. Besides GlyR-β, TM3–4 loops of GABAAR α3-subunit also inhibitory synapses. Bai and colleagues now show that phase phase separates with GPHN-E suggesting liquid condensation to separation of gephyrin with the subunits of both glycine and be a general feature of inhibitory synapses (Fig. 1). The phase GABA receptors underlies the formation of postsynaptic separation occurs at the equimolar ratio of receptors and scaffold sheets at the inhibitory synapses. proteins, a range similar to their physiological concentrations.8 To assure precise processing of information, contacts between There are several implications of this study. First, the observa- neurons require the alignment of the release sites, presynaptic tion that different regions of the same proteins (GlyR-β and GPHN- terminals, with the ionotropic transmitter receptors at the E) are important for phase separation or direct binding, suggests postsynaptic plasma membrane. Downstream of these receptors, that these two processes could be regulated separately. The scaffold molecules, kinases and cytoskeleton components all positively charged region of GlyR-β (a.a. 354–383) and negatively orchestrate the signaling cascade induced by the neurotransmitter charged surface at the subdomain II of GPHN-E are essential for fl 1234567890();,: binding and ion in ux. Each neuron in the mammalian central condensate formation, despite hydrophobic interactions being nervous system relies on both the excitatory and inhibitory inputs.
  • New Insights in RBM20 Cardiomyopathy

    New Insights in RBM20 Cardiomyopathy

    Current Heart Failure Reports (2020) 17:234–246 https://doi.org/10.1007/s11897-020-00475-x TRANSLATIONAL RESEARCH IN HEART FAILURE (J BACKS & M VAN DEN HOOGENHOF, SECTION EDITORS) New Insights in RBM20 Cardiomyopathy D. Lennermann1,2 & J. Backs1,2 & M. M. G. van den Hoogenhof1,2 Published online: 13 August 2020 # The Author(s) 2020 Abstract Purpose of Review This review aims to give an update on recent findings related to the cardiac splicing factor RNA-binding motif protein 20 (RBM20) and RBM20 cardiomyopathy, a form of dilated cardiomyopathy caused by mutations in RBM20. Recent Findings While most research on RBM20 splicing targets has focused on titin (TTN), multiple studies over the last years have shown that other splicing targets of RBM20 including Ca2+/calmodulin-dependent kinase IIδ (CAMK2D) might be critically involved in the development of RBM20 cardiomyopathy. In this regard, loss of RBM20 causes an abnormal intracellular calcium handling, which may relate to the arrhythmogenic presentation of RBM20 cardiomyopathy. In addition, RBM20 presents clinically in a highly gender-specific manner, with male patients suffering from an earlier disease onset and a more severe disease progression. Summary Further research on RBM20, and treatment of RBM20 cardiomyopathy, will need to consider both the multitude and relative contribution of the different splicing targets and related pathways, as well as gender differences. Keywords RBM20 . Dilated cardiomyopathy . CaMKIIδ . Calcium handling . Gender differences . Titin Introduction (ARVC), where a small number of genes account for most of the genetic causes, DCM-causing mutations have been ob- Dilated cardiomyopathy (DCM), as defined by left ventricular served in a variety of genes of diverse ontology [2].
  • A Missense Mutation in the RSRSP Stretch of Rbm20 Causes Dilated

    A Missense Mutation in the RSRSP Stretch of Rbm20 Causes Dilated

    www.nature.com/scientificreports OPEN A missense mutation in the RSRSP stretch of Rbm20 causes dilated cardiomyopathy and atrial fbrillation in mice Kensuke Ihara1,2*, Tetsuo Sasano2, Yuichi Hiraoka3, Marina Togo‑Ohno4, Yurie Soejima5, Motoji Sawabe5, Megumi Tsuchiya6, Hidesato Ogawa6, Tetsushi Furukawa1 & Hidehito Kuroyanagi4* Dilated cardiomyopathy (DCM) is a fatal heart disease characterized by left ventricular dilatation and cardiac dysfunction. Recent genetic studies on DCM have identifed causative mutations in over 60 genes, including RBM20, which encodes a regulator of heart‑specifc splicing. DCM patients with RBM20 mutations have been reported to present with more severe cardiac phenotypes, including impaired cardiac function, atrial fbrillation (AF), and ventricular arrhythmias leading to sudden cardiac death, compared to those with mutations in the other genes. An RSRSP stretch of RBM20, a hotspot of missense mutations found in patients with idiopathic DCM, functions as a crucial part of its nuclear localization signals. However, the relationship between mutations in the RSRSP stretch and cardiac phenotypes has never been assessed in an animal model. Here, we show that Rbm20 mutant mice harboring a missense mutation S637A in the RSRSP stretch, mimicking that in a DCM patient, demonstrated severe cardiac dysfunction and spontaneous AF and ventricular arrhythmias mimicking the clinical state in patients. In contrast, Rbm20 mutant mice with frame‑shifting deletion demonstrated less severe phenotypes, although loss of RBM20‑dependent alternative splicing was indistinguishable. RBM20S637A protein cannot be localized to the nuclear speckles, but accumulated in cytoplasmic, perinuclear granule‑like structures in cardiomyocytes, which might contribute to the more severe cardiac phenotypes. Dilated cardiomyopathy (DCM) is a fatal cardiac disease characterized by enlargement of the cardiac chambers and impaired systolic function1.
  • TITLE PAGE Oxidative Stress and Response to Thymidylate Synthase

    TITLE PAGE Oxidative Stress and Response to Thymidylate Synthase

    Downloaded from molpharm.aspetjournals.org at ASPET Journals on October 2, 2021 -Targeted -Targeted 1 , University of of , University SC K.W.B., South Columbia, (U.O., Carolina, This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted.
  • And HPV18-Infected Early Stage Cervical Cancers and Normal

    And HPV18-Infected Early Stage Cervical Cancers and Normal

    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Virology 331 (2005) 269–291 www.elsevier.com/locate/yviro Gene expression profiles of primary HPV16- and HPV18-infected early stage cervical cancers and normal cervical epithelium: identification of novel candidate molecular markers for cervical cancer diagnosis and therapy Alessandro D. Santina,*, Fenghuang Zhanb, Eliana Bignottia, Eric R. Siegelc, Stefania Cane´ a, Stefania Bellonea, Michela Palmieria, Simone Anfossia, Maria Thomasd, Alexander Burnetta, Helen H. Kaye, Juan J. Romana, Timothy J. O’Briena, Erming Tianb, Martin J. Cannonf, John Shaughnessy Jr.b, Sergio Pecorellig aDivision of Gynecologic Oncology, University of Arkansas for Medical Sciences, Little Rock, AR 72205, USA bMyeloma Institute for Research and Therapy, University of Arkansas for Medical Sciences, Little Rock, AR 72205, USA cDepartment of Biostatistics, University of Arkansas for Medical Sciences, Little Rock, AR 72205, USA dDepartment of Pathology, University of Arkansas for Medical Sciences, Little Rock, AR 72205, USA eDepartment of Obstetrics and Gynecology, University of Arkansas for Medical Sciences, Little Rock, AR 72205, USA fDepartment of Microbiology and Immunology, University of Arkansas, Little Rock, AR 72205, USA gDivision of Gynecologic Oncology, University of Brescia, Brescia, Italy Received 2 July 2004; returned to author for revision 18 August 2004; accepted 9 September 2004 Available online 21 November 2004 Abstract With the goal of identifying genes with a differential pattern of expression between invasive cervical carcinomas (CVX) and normal cervical keratinocytes (NCK), we used oligonucleotide microarrays to interrogate the expression of 14,500 known genes in 11 primary HPV16 and HPV18-infected stage IB–IIA cervical cancers and four primary normal cervical keratinocyte cultures.