Identification of Mapk Gene Family in Lateolabrax Maculatus and Their Expression Profiles in Response to Hypoxia and Salinity Ch
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Prioritization and Comprehensive Analysis of Genes Associated with Melanoma
ONCOLOGY LETTERS 18: 127-136, 2019 Prioritization and comprehensive analysis of genes associated with melanoma CHENG FENG, MING BAI, HAILIN ZHANG, ANG ZENG and WENCHAO ZHANG Department of Plastic Surgery, Peking Union Medical College Hospital, Beijing 100730, P.R. China Received August 13, 2018; Accepted February 28, 2019 DOI: 10.3892/ol.2019.10284 Abstract. Melanoma is a malignant tumor derived from accuracy and appropriate treatment due to medical advances, melanocytes, which occurs mostly in the skin. A major chal- its pathogenesis and natural course remain unclear. lenge in cancer research is the biological interpretation of the Melanoma is a malignant type of tumor, which may be complexity of cancer somatic mutation profiles. The aim of the composed of epidermal melanocytes, nevocytes or dermal present study was to obtain a comprehensive understanding of melanocytes. Epidemiology studies revealed that melanoma the formation and development of melanoma and to identify its is likely to be caused by hereditary factors and environmental associated genes. In the present study, a pipeline was proposed risk factors, including sex, age, ethnicity and geographic loca- for investigating key genes associated with melanoma based tion (6,7). This is in line with the most vital and potentially on the Online Mendelian Inheritance in Man and Search Tool reversible risk factor of malignant melanoma arising from for the Retrieval of Interacting Genes/Proteins databases an interaction between environmental exposure and genetic through a random walk model. Additionally, functional enrich- susceptibility. Gandini et al (8) revealed the association ment analysis was performed for key genes associated with between melanoma and ultraviolet (UV)-irradiation, and melanoma. -
MAPK1/MAPK3 Monoclonal Antibody, Clone Sb46b
MAPK1/MAPK3 monoclonal antibody, clone SB46b Catalog # : MAB3337 規格 : [ 500 ug ] List All Specification Application Image Product Mouse monoclonal antibody raised against recombinant Western Blot Description: MAPK1/MAPK3. Immunogen: Recombinant protein corresponding to human MAPK1/MAPK3. Host: Mouse enlarge Reactivity: Human Immunoprecipitation Specificity: human Erk 1 and human Erk2. Form: Liquid Isotype: IgG2a Recommend Western Blot (1-2 ug/mL) Usage: Immunoprecipitation (10-15ug) The optimal working dilution should be determined by the end user. Storage Buffer: In 100 mM BBS, pH 8.0 Storage Store at 4°C. Instruction: Datasheet: Download Publication Reference 1. Hydrophobic as well as charged residues in both MEK1 and ERK2 are important for their proper docking. Xu Be, Stippec S, Robinson FL, Cobb MH.J Biol Chem. 2001 Jul 13;276(28):26509-15. Epub 2001 May 14. 2. Mitogen-activated protein (MAP) kinase pathways: regulation and physiological functions. Pearson G, Robinson F, Beers Gibson T, Xu BE, Karandikar M, Berman K, Cobb MH.Endocr Rev. 2001 Apr;22(2):153-83. 3. Molecular cloning, expression, and characterization of the human mitogen-activated protein kinase p44erk1. Charest DL, Mordret G, Harder KW, Jirik F, Pelech SL.Mol Cell Biol. 1993 Aug;13(8):4679-90. Applications Western Blot Page 1 of 3 2021/6/20 Human PBMC (Lane 1) and spleen lysate (Lane 2) was stained with MAPK1/3 monoclonal antibody, clone SB46b (Cat # MAB3337). Goat anti-Mouse IgG2a was used to develop. Immunoprecipitation MAPK1 MAPK3 Gene Information Entrez GeneID: 5595 Gene Name: MAPK3 Gene Alias: ERK1,HS44KDAP,HUMKER1A,MGC20180,P44ERK1,P44MAPK,PRKM3 Gene mitogen-activated protein kinase 3 Description: Omim ID: 601795 Gene Ontology: Hyperlink Gene Summary: The protein encoded by this gene is a member of the MAP kinase family. -
Anti-SEK1 / MKK4 Phospho (Ser80) Antibody (ARG51673)
Product datasheet [email protected] ARG51673 Package: 100 μl, 50 μl anti-SEK1 / MKK4 phospho (Ser80) antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes SEK1 / MKK4 phospho (Ser80) Tested Reactivity Hu, Ms, Rat Tested Application ICC/IF, IHC-P, WB Host Rabbit Clonality Polyclonal Isotype IgG Target Name SEK1 / MKK4 Antigen Species Human Immunogen Peptide sequence around phosphorylation site of serine 80 (T-H-S(p)-I-E) derived from Human SEK1/MKK4. Conjugation Un-conjugated Alternate Names MEK 4; MAPK/ERK kinase 4; PRKMK4; SAPKK-1; SAPK/ERK kinase 1; SKK1; JNK-activating kinase 1; EC 2.7.12.2; MEK4; MAP kinase kinase 4; c-Jun N-terminal kinase kinase 1; SEK1; SAPKK1; MAPKK4; Stress- activated protein kinase kinase 1; JNKK1; MKK4; SERK1; SAPK kinase 1; Dual specificity mitogen- activated protein kinase kinase 4; JNKK; MAPKK 4 Application Instructions Application table Application Dilution ICC/IF 1:100 - 1:200 IHC-P 1:50 - 1:100 WB 1:500 - 1:1000 Application Note * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Calculated Mw 44 kDa Properties Form Liquid Purification Antibodies were produced by immunizing rabbits with KLH-conjugated synthetic phosphopeptide. Antibodies were purified by affinity-chromatography using epitope-specific phosphopeptide. In addition, non-phospho specific antibodies were removed by chromatogramphy using non- phosphopeptide. Buffer PBS (without Mg2+ and Ca2+, pH 7.4), 150mM NaCl, 0.02% Sodium azide and 50% Glycerol. Preservative 0.02% Sodium azide Stabilizer 50% Glycerol www.arigobio.com 1/3 Concentration 1 mg/ml Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
N-Glycan Trimming in the ER and Calnexin/Calreticulin Cycle
Neurotransmitter receptorsGABA and A postsynapticreceptor activation signal transmission Ligand-gated ion channel transport GABAGABA Areceptor receptor alpha-5 alpha-1/beta-1/gamma-2 subunit GABA A receptor alpha-2/beta-2/gamma-2GABA receptor alpha-4 subunit GABAGABA receptor A receptor beta-3 subunitalpha-6/beta-2/gamma-2 GABA-AGABA receptor; A receptor alpha-1/beta-2/gamma-2GABA receptoralpha-3/beta-2/gamma-2 alpha-3 subunit GABA-A GABAreceptor; receptor benzodiazepine alpha-6 subunit site GABA-AGABA-A receptor; receptor; GABA-A anion site channel (alpha1/beta2 interface) GABA-A receptor;GABA alpha-6/beta-3/gamma-2 receptor beta-2 subunit GABAGABA receptorGABA-A receptor alpha-2receptor; alpha-1 subunit agonist subunit GABA site Serotonin 3a (5-HT3a) receptor GABA receptorGABA-C rho-1 subunitreceptor GlycineSerotonin receptor subunit3 (5-HT3) alpha-1 receptor GABA receptor rho-2 subunit GlycineGlycine receptor receptor subunit subunit alpha-2 alpha-3 Ca2+ activated K+ channels Metabolism of ingested SeMet, Sec, MeSec into H2Se SmallIntermediateSmall conductance conductance conductance calcium-activated calcium-activated calcium-activated potassium potassium potassiumchannel channel protein channel protein 2 protein 1 4 Small conductance calcium-activatedCalcium-activated potassium potassium channel alpha/beta channel 1 protein 3 Calcium-activated potassiumHistamine channel subunit alpha-1 N-methyltransferase Neuraminidase Pyrimidine biosynthesis Nicotinamide N-methyltransferase Adenosylhomocysteinase PolymerasePolymeraseHistidine basic -
YAP and TAZ Mediators at the Crossroad Between Metabolic and Cellular Reprogramming
H OH metabolites OH Review YAP and TAZ Mediators at the Crossroad between Metabolic and Cellular Reprogramming Giorgia Di Benedetto, Silvia Parisi , Tommaso Russo and Fabiana Passaro * Department of Molecular Medicine and Medical Biotechnology, University of Naples Federico II, 40, 80138 Napoli, Italy; [email protected] (G.D.B.); [email protected] (S.P.); [email protected] (T.R.) * Correspondence: [email protected] Abstract: Cell reprogramming can either refer to a direct conversion of a specialized cell into another or to a reversal of a somatic cell into an induced pluripotent stem cell (iPSC). It implies a peculiar modification of the epigenetic asset and gene regulatory networks needed for a new cell, to better fit the new phenotype of the incoming cell type. Cellular reprogramming also implies a metabolic rearrangement, similar to that observed upon tumorigenesis, with a transition from oxidative phosphorylation to aerobic glycolysis. The induction of a reprogramming process requires a nexus of signaling pathways, mixing a range of local and systemic information, and accumulating evidence points to the crucial role exerted by the Hippo pathway components Yes-Associated Protein (YAP) and Transcriptional Co-activator with PDZ-binding Motif (TAZ). In this review, we will first provide a synopsis of the Hippo pathway and its function during reprogramming and tissue regeneration, then we introduce the latest knowledge on the interplay between YAP/TAZ Citation: Di Benedetto, G.; Parisi, S.; and metabolism and, finally, we discuss the possible role of YAP/TAZ in the orchestration of the Russo, T.; Passaro, F. YAP and TAZ metabolic switch upon cellular reprogramming. -
IGF2BP1 Is a Targetable SRC/MAPK-Dependent Driver Of
bioRxiv preprint doi: https://doi.org/10.1101/2020.06.19.159905; this version posted June 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 IGF2BP1 is a targetable SRC/MAPK-dependent driver of invasive growth in ovarian 2 cancer 3 4 Authors: Nadine Bley1*$#, Annekatrin Schott1*, Simon Müller1, Danny Misiak1, Marcell 5 Lederer1, Tommy Fuchs1, Chris Aßmann1, Markus Glaß1, Christian Ihling2, Andrea Sinz2, 6 Nikolaos Pazaitis3, Claudia Wickenhauser3, Martina Vetter4, Olga Ungurs4, Hans-Georg 7 Strauss4, Christoph Thomssen4, Stefan Hüttelmaier1$. 8 9 10 Addresses: 11 1 Sect. Molecular Cell Biology, Inst. of Molecular Medicine, Charles Tanford Protein Center, 12 Medical Faculty, Martin Luther University Halle-Wittenberg, Kurt-Mothes-Str. 3A, 06120 Halle, 13 Germany 14 2 Dept. of Pharmaceutical Chemistry & Bioanalytics, Inst. of Pharmacy, Charles Tanford 15 Protein Center, Martin Luther University Halle-Wittenberg, Kurt-Mothes Str. 3A, 06120 Halle, 16 Germany 17 3 Inst. of Pathology, Medical Faculty, Martin Luther University Halle-Wittenberg, Magdeburger 18 Str. 14, 06112 Halle, Germany 19 4 Clinics for Gynecology, Medical Faculty, Martin Luther University Halle-Wittenberg, Ernst- 20 Grube-Str. 40, 06120 Halle, Germany 21 22 23 * These authors contributed equally to this work 24 $ shared corresponding authorship 25 # Correspondence: should be addressed to Nadine Bley 26 Running title: IGF2BP1-directed AJ disassembly depends on SRC activation 27 Disclosure of Potential Conflicts of Interests: the authors declare no conflicts of interest. -
Anti-EGFR Monoclonal Antibodies and EGFR Tyrosine Kinase Inhibitors As Combination Therapy for Triple-Negative Breast Cancer
www.impactjournals.com/oncotarget/ Oncotarget, Vol. 7, No. 45 Research Paper Anti-EGFR monoclonal antibodies and EGFR tyrosine kinase inhibitors as combination therapy for triple-negative breast cancer Abderrahim El Guerrab1,2, Mahchid Bamdad2,3, Fabrice Kwiatkowski1, Yves-Jean Bignon1,2,*, Frédérique Penault-Llorca1,2,*, Corinne Aubel1,2 1Centre Jean Perrin - ERTICa-EA4677, BP392, 63011 Clermont-Ferrand Cedex, France 2Clermont Université - Université d’Auvergne - ERTICa-EA4677, Faculté de Médecine, BP38, 63001 Clermont-Ferrand Cedex, France 3Clermont Université - Université d’Auvergne - ERTICa-EA4677, Institut Universitaire de Technologie, Département Génie Biologique, Ensemble Universitaire des Cézeaux, BP86, 63172 Aubière Cedex, France *These authors have contributed equally to this work Correspondence to: Yves-Jean Bignon, email: [email protected] Keywords: triple-negative breast cancer, epidermal growth factor receptor, anti-EGFR targeted therapy, cytotoxicity, cell cycle Received: November 09, 2015 Accepted: August 22, 2016 Published: September 15, 2016 ABSTRACT Triple-negative breast cancer (TNBC) is characterized by overexpression of epidermal growth factor receptor (EGFR) and activation of its downstream signaling pathways. Dual targeting of EGFR using one monoclonal antibody (mAb; cetuximab or panitumumab) and one tyrosine kinase inhibitor (EGFR-TKI; gefitinib or erlotinib) is a potential therapeutic approach. We investigated the effect of these therapies in EGFR-expressing TNBC cell lines that do or do not harbor the main activating mutations of EGFR pathways. Cell lines were sensitive to EGFR-TKIs, whereas mAbs were active only in MDA-MB-468 (EGFR amplification) and SUM-1315 (KRAS and PTEN wild-type) cells. MDA-MB-231 (KRAS mutated) and HCC-1937 (PTEN deletion) cells were resistant to mAbs. -
Modulation of NF-Κb Signalling by Microbial Pathogens
REVIEWS Modulation of NF‑κB signalling by microbial pathogens Masmudur M. Rahman and Grant McFadden Abstract | The nuclear factor-κB (NF‑κB) family of transcription factors plays a central part in the host response to infection by microbial pathogens, by orchestrating the innate and acquired host immune responses. The NF‑κB proteins are activated by diverse signalling pathways that originate from many different cellular receptors and sensors. Many successful pathogens have acquired sophisticated mechanisms to regulate the NF‑κB signalling pathways by deploying subversive proteins or hijacking the host signalling molecules. Here, we describe the mechanisms by which viruses and bacteria micromanage the host NF‑κB signalling circuitry to favour the continued survival of the pathogen. The nuclear factor-κB (NF-κB) family of transcription Signalling targets upstream of NF‑κB factors regulates the expression of hundreds of genes that NF-κB proteins are tightly regulated in both the cyto- are associated with diverse cellular processes, such as pro- plasm and the nucleus6. Under normal physiological liferation, differentiation and death, as well as innate and conditions, NF‑κB complexes remain inactive in the adaptive immune responses. The mammalian NF‑κB cytoplasm through a direct interaction with proteins proteins are members of the Rel domain-containing pro- of the inhibitor of NF-κB (IκB) family, including IκBα, tein family: RELA (also known as p65), RELB, c‑REL, IκBβ and IκBε (also known as NF-κBIα, NF-κBIβ and the NF-κB p105 subunit (also known as NF‑κB1; which NF-κBIε, respectively); IκB proteins mask the nuclear is cleaved into the p50 subunit) and the NF-κB p100 localization domains in the NF‑κB complex, thus subunit (also known as NF‑κB2; which is cleaved into retaining the transcription complex in the cytoplasm. -
TRIM67 Inhibits Tumor Proliferation and Metastasis by Mediating
Journal of Cancer 2020, Vol. 11 6025 Ivyspring International Publisher Journal of Cancer 2020; 11(20): 6025-6037. doi: 10.7150/jca.47538 Research Paper TRIM67 inhibits tumor proliferation and metastasis by mediating MAPK11 in Colorectal Cancer Ying Liu1*, Guiqi Wang1*, Xia Jiang1*, Wei Li1, Congjie Zhai1, Fangjian Shang1, Shihao Chen1, Zengren Zhao1 and Weifang Yu2 1. Department of General Surgery, Hebei Key Laboratory of Colorectal Cancer Precision Diagnosis and Treatment, The First Hospital of Hebei Medical University, Donggang Road No.89, Shijiazhuang, Hebei 050031, P.R. China. 2. Department of Endoscopy Center, The First Hospital of Hebei Medical University, Donggang Road No.89, Shijiazhuang, Hebei 050031, P.R. China. *These authors contributed equally to this work. Corresponding authors: Prof. Zengren Zhao or Weifang Yu, The First Hospital of Hebei Medical University, Donggang Road No.89, Shijiazhuang, Hebei 050031, P.R. China; Tel: +86 0311 85917217; E-mail: [email protected] or [email protected]. © The author(s). This is an open access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/). See http://ivyspring.com/terms for full terms and conditions. Received: 2020.04.28; Accepted: 2020.08.04; Published: 2020.08.18 Abstract Purpose: We recently reported that tripartite motif-containing 67 (TRIM67) activates p53 to suppress colorectal cancer (CRC). However, the function and mechanism of TRIM67 in the inhibition of CRC cell proliferation and metastasis remains to be further elucidated. Methods: We detected the expression of TRIM67 in CRC tissues compared with normal tissues and confirmed its relationship with clinicopathological features. -
Supplementary Material DNA Methylation in Inflammatory Pathways Modifies the Association Between BMI and Adult-Onset Non- Atopic
Supplementary Material DNA Methylation in Inflammatory Pathways Modifies the Association between BMI and Adult-Onset Non- Atopic Asthma Ayoung Jeong 1,2, Medea Imboden 1,2, Akram Ghantous 3, Alexei Novoloaca 3, Anne-Elie Carsin 4,5,6, Manolis Kogevinas 4,5,6, Christian Schindler 1,2, Gianfranco Lovison 7, Zdenko Herceg 3, Cyrille Cuenin 3, Roel Vermeulen 8, Deborah Jarvis 9, André F. S. Amaral 9, Florian Kronenberg 10, Paolo Vineis 11,12 and Nicole Probst-Hensch 1,2,* 1 Swiss Tropical and Public Health Institute, 4051 Basel, Switzerland; [email protected] (A.J.); [email protected] (M.I.); [email protected] (C.S.) 2 Department of Public Health, University of Basel, 4001 Basel, Switzerland 3 International Agency for Research on Cancer, 69372 Lyon, France; [email protected] (A.G.); [email protected] (A.N.); [email protected] (Z.H.); [email protected] (C.C.) 4 ISGlobal, Barcelona Institute for Global Health, 08003 Barcelona, Spain; [email protected] (A.-E.C.); [email protected] (M.K.) 5 Universitat Pompeu Fabra (UPF), 08002 Barcelona, Spain 6 CIBER Epidemiología y Salud Pública (CIBERESP), 08005 Barcelona, Spain 7 Department of Economics, Business and Statistics, University of Palermo, 90128 Palermo, Italy; [email protected] 8 Environmental Epidemiology Division, Utrecht University, Institute for Risk Assessment Sciences, 3584CM Utrecht, Netherlands; [email protected] 9 Population Health and Occupational Disease, National Heart and Lung Institute, Imperial College, SW3 6LR London, UK; [email protected] (D.J.); [email protected] (A.F.S.A.) 10 Division of Genetic Epidemiology, Medical University of Innsbruck, 6020 Innsbruck, Austria; [email protected] 11 MRC-PHE Centre for Environment and Health, School of Public Health, Imperial College London, W2 1PG London, UK; [email protected] 12 Italian Institute for Genomic Medicine (IIGM), 10126 Turin, Italy * Correspondence: [email protected]; Tel.: +41-61-284-8378 Int.