Anti-SEK1 / MKK4 Phospho (Ser80) Antibody (ARG51673)
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent -
Profiling Data
Compound Name DiscoveRx Gene Symbol Entrez Gene Percent Compound Symbol Control Concentration (nM) JNK-IN-8 AAK1 AAK1 69 1000 JNK-IN-8 ABL1(E255K)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317I)-nonphosphorylated ABL1 87 1000 JNK-IN-8 ABL1(F317I)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317L)-nonphosphorylated ABL1 65 1000 JNK-IN-8 ABL1(F317L)-phosphorylated ABL1 61 1000 JNK-IN-8 ABL1(H396P)-nonphosphorylated ABL1 42 1000 JNK-IN-8 ABL1(H396P)-phosphorylated ABL1 60 1000 JNK-IN-8 ABL1(M351T)-phosphorylated ABL1 81 1000 JNK-IN-8 ABL1(Q252H)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(Q252H)-phosphorylated ABL1 56 1000 JNK-IN-8 ABL1(T315I)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(T315I)-phosphorylated ABL1 92 1000 JNK-IN-8 ABL1(Y253F)-phosphorylated ABL1 71 1000 JNK-IN-8 ABL1-nonphosphorylated ABL1 97 1000 JNK-IN-8 ABL1-phosphorylated ABL1 100 1000 JNK-IN-8 ABL2 ABL2 97 1000 JNK-IN-8 ACVR1 ACVR1 100 1000 JNK-IN-8 ACVR1B ACVR1B 88 1000 JNK-IN-8 ACVR2A ACVR2A 100 1000 JNK-IN-8 ACVR2B ACVR2B 100 1000 JNK-IN-8 ACVRL1 ACVRL1 96 1000 JNK-IN-8 ADCK3 CABC1 100 1000 JNK-IN-8 ADCK4 ADCK4 93 1000 JNK-IN-8 AKT1 AKT1 100 1000 JNK-IN-8 AKT2 AKT2 100 1000 JNK-IN-8 AKT3 AKT3 100 1000 JNK-IN-8 ALK ALK 85 1000 JNK-IN-8 AMPK-alpha1 PRKAA1 100 1000 JNK-IN-8 AMPK-alpha2 PRKAA2 84 1000 JNK-IN-8 ANKK1 ANKK1 75 1000 JNK-IN-8 ARK5 NUAK1 100 1000 JNK-IN-8 ASK1 MAP3K5 100 1000 JNK-IN-8 ASK2 MAP3K6 93 1000 JNK-IN-8 AURKA AURKA 100 1000 JNK-IN-8 AURKA AURKA 84 1000 JNK-IN-8 AURKB AURKB 83 1000 JNK-IN-8 AURKB AURKB 96 1000 JNK-IN-8 AURKC AURKC 95 1000 JNK-IN-8 -
Comparative Analysis of Protein Expression Concomitant with DNA Methyltransferase 3A Depletion in a Melanoma Cell Line
American Journal of Analytical Chemistry, 2011, 2, 539-572 doi:10.4236/ajac.2011.25064 Published Online September 2011 (http://www.SciRP.org/journal/ajac) Comparative Analysis of Protein Expression Concomitant with DNA Methyltransferase 3A Depletion in a Melanoma Cell Line Shengnan Tang1,#, Xiaoyan Liu1,#, Tonghua Li1*, Haoyue Wang2, Jiangming Sun1, Qian Qiao1, Jun Yao3, Jian Fei2 1Department of Chemistry, Tongji University, Shanghai, China 2School of Life Science & Technology, Tongji University, Shanghai, China 3School of Medicine, Fudan University, Shanghai, China E-mail: *[email protected] Received March 17, 2011; revised May 3, 2011; accepted June 1, 2011 Abstract DNA methyltransferase 3A (Dnmt3a), a de novo methyltransferase, has attracted a great deal of attention for its important role played in tumorigenesis. We have previously demonstrated that melanoma is unable to grow in-vivo in conditions of Dnmt3a depletion in a mouse model. In this study, we cultured the Dnmt3a depletion B16 melanoma (Dnmt3a-D) cell line to conduct a comparative analysis of protein expression con-comitant with Dnmt3a depletion in a melanoma cell line. After two-dimensional separation, by gel elec- tro-phoresis and liquid chromatography, combined with mass spectrometry analysis (1DE-LC-MS/MS), the re-sults demonstrated that 467 proteins were up-regulated and 535 proteins were down-regulated in the Dnmt3a-D cell line compared to the negative control (NC) cell line. The Genome Ontology (GO) and KEGG pathway were used to further analyze the altered proteins. KEGG pathway analysis indicated that the MAPK signaling pathway exhibited a greater alteration in proteins, an interesting finding due to the close rela- tion-ship with tumorigenesis. -
Supplementary Table 1
SI Table S1. Broad protein kinase selectivity for PF-2771. Kinase, PF-2771 % Inhibition at 10 μM Service Kinase, PF-2771 % Inhibition at 1 μM Service rat RPS6KA1 (RSK1) 39 Dundee AURKA (AURA) 24 Invitrogen IKBKB (IKKb) 26 Dundee CDK2 /CyclinA 21 Invitrogen mouse LCK 25 Dundee rabbit MAP2K1 (MEK1) 19 Dundee AKT1 (AKT) 21 Dundee IKBKB (IKKb) 16 Dundee CAMK1 (CaMK1a) 19 Dundee PKN2 (PRK2) 14 Dundee RPS6KA5 (MSK1) 18 Dundee MAPKAPK5 14 Dundee PRKD1 (PKD1) 13 Dundee PIM3 12 Dundee MKNK2 (MNK2) 12 Dundee PRKD1 (PKD1) 12 Dundee MARK3 10 Dundee NTRK1 (TRKA) 12 Invitrogen SRPK1 9 Dundee MAPK12 (p38g) 11 Dundee MAPKAPK5 9 Dundee MAPK8 (JNK1a) 11 Dundee MAPK13 (p38d) 8 Dundee rat PRKAA2 (AMPKa2) 11 Dundee AURKB (AURB) 5 Dundee NEK2 11 Invitrogen CSK 5 Dundee CHEK2 (CHK2) 11 Invitrogen EEF2K (EEF-2 kinase) 4 Dundee MAPK9 (JNK2) 9 Dundee PRKCA (PKCa) 4 Dundee rat RPS6KA1 (RSK1) 8 Dundee rat PRKAA2 (AMPKa2) 4 Dundee DYRK2 7 Dundee rat CSNK1D (CKId) 3 Dundee AKT1 (AKT) 7 Dundee LYN 3 BioPrint PIM2 7 Invitrogen CSNK2A1 (CKIIa) 3 Dundee MAPK15 (ERK7) 6 Dundee CAMKK2 (CAMKKB) 1 Dundee mouse LCK 5 Dundee PIM3 1 Dundee PDPK1 (PDK1) (directed 5 Invitrogen rat DYRK1A (MNB) 1 Dundee RPS6KB1 (p70S6K) 5 Dundee PBK 0 Dundee CSNK2A1 (CKIIa) 4 Dundee PIM1 -1 Dundee CAMKK2 (CAMKKB) 4 Dundee DYRK2 -2 Dundee SRC 4 Invitrogen MAPK12 (p38g) -2 Dundee MYLK2 (MLCK_sk) 3 Invitrogen NEK6 -3 Dundee MKNK2 (MNK2) 2 Dundee RPS6KB1 (p70S6K) -3 Dundee SRPK1 2 Dundee AKT2 -3 Dundee MKNK1 (MNK1) 2 Dundee RPS6KA3 (RSK2) -3 Dundee CHEK1 (CHK1) 2 Invitrogen rabbit MAP2K1 (MEK1) -4 Dundee -
TRIM67 Inhibits Tumor Proliferation and Metastasis by Mediating
Journal of Cancer 2020, Vol. 11 6025 Ivyspring International Publisher Journal of Cancer 2020; 11(20): 6025-6037. doi: 10.7150/jca.47538 Research Paper TRIM67 inhibits tumor proliferation and metastasis by mediating MAPK11 in Colorectal Cancer Ying Liu1*, Guiqi Wang1*, Xia Jiang1*, Wei Li1, Congjie Zhai1, Fangjian Shang1, Shihao Chen1, Zengren Zhao1 and Weifang Yu2 1. Department of General Surgery, Hebei Key Laboratory of Colorectal Cancer Precision Diagnosis and Treatment, The First Hospital of Hebei Medical University, Donggang Road No.89, Shijiazhuang, Hebei 050031, P.R. China. 2. Department of Endoscopy Center, The First Hospital of Hebei Medical University, Donggang Road No.89, Shijiazhuang, Hebei 050031, P.R. China. *These authors contributed equally to this work. Corresponding authors: Prof. Zengren Zhao or Weifang Yu, The First Hospital of Hebei Medical University, Donggang Road No.89, Shijiazhuang, Hebei 050031, P.R. China; Tel: +86 0311 85917217; E-mail: [email protected] or [email protected]. © The author(s). This is an open access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/). See http://ivyspring.com/terms for full terms and conditions. Received: 2020.04.28; Accepted: 2020.08.04; Published: 2020.08.18 Abstract Purpose: We recently reported that tripartite motif-containing 67 (TRIM67) activates p53 to suppress colorectal cancer (CRC). However, the function and mechanism of TRIM67 in the inhibition of CRC cell proliferation and metastasis remains to be further elucidated. Methods: We detected the expression of TRIM67 in CRC tissues compared with normal tissues and confirmed its relationship with clinicopathological features. -
Supplementary Material DNA Methylation in Inflammatory Pathways Modifies the Association Between BMI and Adult-Onset Non- Atopic
Supplementary Material DNA Methylation in Inflammatory Pathways Modifies the Association between BMI and Adult-Onset Non- Atopic Asthma Ayoung Jeong 1,2, Medea Imboden 1,2, Akram Ghantous 3, Alexei Novoloaca 3, Anne-Elie Carsin 4,5,6, Manolis Kogevinas 4,5,6, Christian Schindler 1,2, Gianfranco Lovison 7, Zdenko Herceg 3, Cyrille Cuenin 3, Roel Vermeulen 8, Deborah Jarvis 9, André F. S. Amaral 9, Florian Kronenberg 10, Paolo Vineis 11,12 and Nicole Probst-Hensch 1,2,* 1 Swiss Tropical and Public Health Institute, 4051 Basel, Switzerland; [email protected] (A.J.); [email protected] (M.I.); [email protected] (C.S.) 2 Department of Public Health, University of Basel, 4001 Basel, Switzerland 3 International Agency for Research on Cancer, 69372 Lyon, France; [email protected] (A.G.); [email protected] (A.N.); [email protected] (Z.H.); [email protected] (C.C.) 4 ISGlobal, Barcelona Institute for Global Health, 08003 Barcelona, Spain; [email protected] (A.-E.C.); [email protected] (M.K.) 5 Universitat Pompeu Fabra (UPF), 08002 Barcelona, Spain 6 CIBER Epidemiología y Salud Pública (CIBERESP), 08005 Barcelona, Spain 7 Department of Economics, Business and Statistics, University of Palermo, 90128 Palermo, Italy; [email protected] 8 Environmental Epidemiology Division, Utrecht University, Institute for Risk Assessment Sciences, 3584CM Utrecht, Netherlands; [email protected] 9 Population Health and Occupational Disease, National Heart and Lung Institute, Imperial College, SW3 6LR London, UK; [email protected] (D.J.); [email protected] (A.F.S.A.) 10 Division of Genetic Epidemiology, Medical University of Innsbruck, 6020 Innsbruck, Austria; [email protected] 11 MRC-PHE Centre for Environment and Health, School of Public Health, Imperial College London, W2 1PG London, UK; [email protected] 12 Italian Institute for Genomic Medicine (IIGM), 10126 Turin, Italy * Correspondence: [email protected]; Tel.: +41-61-284-8378 Int. -
Deep Multiomics Profiling of Brain Tumors Identifies Signaling Networks
ARTICLE https://doi.org/10.1038/s41467-019-11661-4 OPEN Deep multiomics profiling of brain tumors identifies signaling networks downstream of cancer driver genes Hong Wang 1,2,3, Alexander K. Diaz3,4, Timothy I. Shaw2,5, Yuxin Li1,2,4, Mingming Niu1,4, Ji-Hoon Cho2, Barbara S. Paugh4, Yang Zhang6, Jeffrey Sifford1,4, Bing Bai1,4,10, Zhiping Wu1,4, Haiyan Tan2, Suiping Zhou2, Laura D. Hover4, Heather S. Tillman 7, Abbas Shirinifard8, Suresh Thiagarajan9, Andras Sablauer 8, Vishwajeeth Pagala2, Anthony A. High2, Xusheng Wang 2, Chunliang Li 6, Suzanne J. Baker4 & Junmin Peng 1,2,4 1234567890():,; High throughput omics approaches provide an unprecedented opportunity for dissecting molecular mechanisms in cancer biology. Here we present deep profiling of whole proteome, phosphoproteome and transcriptome in two high-grade glioma (HGG) mouse models driven by mutated RTK oncogenes, PDGFRA and NTRK1, analyzing 13,860 proteins and 30,431 phosphosites by mass spectrometry. Systems biology approaches identify numerous master regulators, including 41 kinases and 23 transcription factors. Pathway activity computation and mouse survival indicate the NTRK1 mutation induces a higher activation of AKT down- stream targets including MYC and JUN, drives a positive feedback loop to up-regulate multiple other RTKs, and confers higher oncogenic potency than the PDGFRA mutation. A mini-gRNA library CRISPR-Cas9 validation screening shows 56% of tested master regulators are important for the viability of NTRK-driven HGG cells, including TFs (Myc and Jun) and metabolic kinases (AMPKa1 and AMPKa2), confirming the validity of the multiomics inte- grative approaches, and providing novel tumor vulnerabilities. -
A Novel JAK1 Mutant Breast Implant-Associated Anaplastic Large Cell Lymphoma Patient-Derived Xenograft Fostering Pre- Clinical Discoveries
Cancers 2019 S1 of S18 Supplementary Materials: A Novel JAK1 Mutant Breast Implant-Associated Anaplastic Large Cell Lymphoma Patient-Derived Xenograft Fostering Pre- Clinical Discoveries Danilo Fiore, Luca Vincenzo Cappelli, Paul Zumbo, Jude M. Phillip, Zhaoqi Liu, Shuhua Cheng, Liron Yoffe, Paola Ghione, Federica Di Maggio, Ahmet Dogan, Inna Khodos, Elisa de Stanchina, Joseph Casano, Clarisse Kayembe, Wayne Tam, Doron Betel, Robin Foa’, Leandro Cerchietti, Raul Rabadan, Steven Horwitz, David M. Weinstock and Giorgio Inghirami A B C Figure S1. (A) Histology micrografts on IL89 PDTX show overall similarity between T1 T3 and T7 passages (upper panels). Immunohistochemical stains with the indicated antibodies (anti-CD3, anti- CD25 and anti-CD8 [x20]) (lower panels). (B) Flow cytometry panel comprehensive of the most represented surface T-cell lymphoma markers, including: CD2, CD3, CD4, CD5, CD8, CD16, CD25, CD30, CD56, TCRab, TCRgd. IL89 PDTX passage T3 is here depicted for illustration purposes. (C) Analysis of the TCR gamma specific rearrangement clonality in IL89 diagnostic sample and correspondent PDTX after 1 and 5 passages (T1 and T5). A WT Primary p.G1097D IL89 T1 p.G1097D IL89 T5 p.G1097D IL89 cell line B Figure S2. (A) Sanger sequencing confirms the presence of the JAK1 p.G1097D mutation in IL89 PDTX samples and in the cell line, but the mutation is undetectable in the primary due to the low sensitivity of the technique. (B) Manual backtracking of mutations in the primary tumor using deep sequencing data allowed for the identification of several hits at a very low VAF compared to the PDTX-T5. A B IL89 CTRL 30 CTRL Ruxoli?nib S 20 M Ruxoli?nib A R G 10 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 1 1 1 1 1 WEEKS AFTER ENGRAFTMENT Figure S3. -
Genomics and Functional Genomics of Malignant Pleural Mesothelioma
International Journal of Molecular Sciences Review Genomics and Functional Genomics of Malignant Pleural Mesothelioma Ece Cakiroglu 1,2 and Serif Senturk 1,2,* 1 Izmir Biomedicine and Genome Center, Izmir 35340, Turkey; [email protected] 2 Department of Genome Sciences and Molecular Biotechnology, Izmir International Biomedicine and Genome Institute, Dokuz Eylul University, Izmir 35340, Turkey * Correspondence: [email protected] Received: 22 July 2020; Accepted: 20 August 2020; Published: 1 September 2020 Abstract: Malignant pleural mesothelioma (MPM) is a rare, aggressive cancer of the mesothelial cells lining the pleural surface of the chest wall and lung. The etiology of MPM is strongly associated with prior exposure to asbestos fibers, and the median survival rate of the diagnosed patients is approximately one year. Despite the latest advancements in surgical techniques and systemic therapies, currently available treatment modalities of MPM fail to provide long-term survival. The increasing incidence of MPM highlights the need for finding effective treatments. Targeted therapies offer personalized treatments in many cancers. However, targeted therapy in MPM is not recommended by clinical guidelines mainly because of poor target definition. A better understanding of the molecular and cellular mechanisms and the predictors of poor clinical outcomes of MPM is required to identify novel targets and develop precise and effective treatments. Recent advances in the genomics and functional genomics fields have provided groundbreaking insights into the genomic and molecular profiles of MPM and enabled the functional characterization of the genetic alterations. This review provides a comprehensive overview of the relevant literature and highlights the potential of state-of-the-art genomics and functional genomics research to facilitate the development of novel diagnostics and therapeutic modalities in MPM. -
P38β - MAPK11 and Its Role in Female Cancers Periklis Katopodis1,2* , Rachel Kerslake1 , Athanasios Zikopoulos3, Nefeli Beri4 and Vladimir Anikin2,5
Katopodis et al. Journal of Ovarian Research (2021) 14:84 https://doi.org/10.1186/s13048-021-00834-9 RESEARCH Open Access p38β - MAPK11 and its role in female cancers Periklis Katopodis1,2* , Rachel Kerslake1 , Athanasios Zikopoulos3, Nefeli Beri4 and Vladimir Anikin2,5 Abstract Background: The p38MAPK family of Mitogen Activated Protein Kinases are a group of signalling molecules involved in cell growth, survival, proliferation and differentiation. The widely studied p38α isoform is ubiquitously expressed and is implicated in a number of cancer pathologies, as are p38γ and p38δ. However, the mechanistic role of the isoform, p38β, remains fairly elusive. Recent studies suggest a possible role of p38β in both breast and endometrial cancer with research suggesting involvement in bone metastasis and cancer cell survival. Female tissue specific cancers such as breast, endometrial, uterine and ovary account for over 3,000,000 cancer related incidents annually; advancements in therapeutics and treatment however require a deeper understanding of the molecular aetiology associated with these diseases. This study provides an overview of the MAPK signalling molecule p38β (MAPK11) in female cancers using an in-silico approach. Methods: A detailed gene expression and methylation analysis was performed using datasets from cBioportal, CanSar and MEXPRESS. Breast, Uterine Endometrial, Cervical, Ovarian and Uterine Carcinosarcoma TCGA cancer datasets were used and analysed. Results: Data using cBioportal and CanSAR suggest that expression of p38β is lower in cancers: BRCA, UCEC, UCS, CESC and OV compared to normal tissue. Methylation data from SMART and MEXPRESS indicate significant probe level variation of CpG island methylation status of the gene MAPK11. -
Expression in Stromal Cells Within the Microenvironment of T and NK Cell Lymphomas: Association with Tumor Dormancy and Activation
pISSN 1598-2998, eISSN 2005-9256 Cancer Res Treat. 2020;52(4):1273-1282 https://doi.org/10.4143/crt.2020.032 Original Article Open Access Forkhead Box C1 (FOXC1) Expression in Stromal Cells within the Microenvironment of T and NK Cell Lymphomas: Association with Tumor Dormancy and Activation Ji Hae Nahm, MD, PhD Purpose Woo Ick Yang, MD, PhD Forkhead box C1 (FOXC1) is critical for maintaining bone marrow microenvironments dur- Sun Och Yoon, MD, PhD ing hematopoiesis, but its role in hematological malignancies remains obscure. Here, we investigated whether FOXC1 regulates tumor dormancy and activation in the microenviron- ments of T and natural killer (NK) cell lymphomas. Materials and Methods One hundred and twenty cases of T and NK cell lymphomas were included; the immu- nohistochemical expression of FOXC1 was investigated in stromal cells, and numbers of FOXC1+ stromal cells were counted. Furthermore, the expression of phosphorylated p38 Department of Pathology, (p-p38) and phosphorylated ERK1/2 (p-ERK1/2) in tumor cells was investigated using Severance Hospital, Yonsei University immunohistochemistry. College of Medicine, Seoul, Korea Results FOXC1 was variably expressed in C-X-C motif chemokine 12–associated reticular stromal cells, histiocytes, (myo)fibroblasts, and endothelial cells. The phenotypes of cases were categorized as dormant (high p-p38/low p-ERK1/2; n=30, 25.0%), active (high p-ERK1/2/ low p-p38; n=25, 20.8%), or intermediate (others; n=65, 54.2%). Lower FOXC1+ stromal cell infiltration was associated with the dormant phenotype, the precursor T lymphoblastic + + + + + + + + + + + + + + + + + + + + + leukemia/lymphoma subtype, and inferior overall survival rates, whereas higher FOXC1 Correspondence: Sun Och Yoon, MD, PhD stromal cell infiltration was associated with the active phenotype and favorable patient + Department + + + + + of + Pathology, + + + + Severance+ + + + +Hospital, + + + + + + + + + + + + + + + + + + + + + + + + prognosis (p < 0.05 for all).