DOCSLIB.ORG

Expression in Stromal Cells Within the Microenvironment of T and NK Cell Lymphomas: Association with Tumor Dormancy and Activation

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Expression in Stromal Cells Within the Microenvironment of T and NK Cell Lymphomas: Association with Tumor Dormancy and Activation pISSN 1598-2998, eISSN 2005-9256 Cancer Res Treat. 2020;52(4):1273-1282 https://doi.org/10.4143/crt.2020.032 Original Article Open Access Forkhead Box C1 (FOXC1) Expression in Stromal Cells within the Microenvironment of T and NK Cell Lymphomas: Association with Tumor Dormancy and Activation Ji Hae Nahm, MD, PhD Purpose Woo Ick Yang, MD, PhD Forkhead box C1 (FOXC1) is critical for maintaining bone marrow microenvironments dur- Sun Och Yoon, MD, PhD ing hematopoiesis, but its role in hematological malignancies remains obscure. Here, we investigated whether FOXC1 regulates tumor dormancy and activation in the microenviron- ments of T and natural killer (NK) cell lymphomas. Materials and Methods One hundred and twenty cases of T and NK cell lymphomas were included; the immu- nohistochemical expression of FOXC1 was investigated in stromal cells, and numbers of FOXC1+ stromal cells were counted. Furthermore, the expression of phosphorylated p38 Department of Pathology, (p-p38) and phosphorylated ERK1/2 (p-ERK1/2) in tumor cells was investigated using Severance Hospital, Yonsei University immunohistochemistry. College of Medicine, Seoul, Korea Results FOXC1 was variably expressed in C-X-C motif chemokine 12–associated reticular stromal cells, histiocytes, (myo)fibroblasts, and endothelial cells. The phenotypes of cases were categorized as dormant (high p-p38/low p-ERK1/2; n=30, 25.0%), active (high p-ERK1/2/ low p-p38; n=25, 20.8%), or intermediate (others; n=65, 54.2%). Lower FOXC1+ stromal cell infiltration was associated with the dormant phenotype, the precursor T lymphoblastic + + + + + + + + + + + + + + + + + + + + + leukemia/lymphoma subtype, and inferior overall survival rates, whereas higher FOXC1 Correspondence: Sun Och Yoon, MD, PhD stromal cell infiltration was associated with the active phenotype and favorable patient + Department + + + + + of + Pathology, + + + + Severance+ + + + +Hospital, + + + + + + + + + + + + + + + + + + + + + + + + prognosis (p < 0.05 for all). + Yonsei + + + University + + + + College+ + + of+ Medicine,+ + + + + + + + + 50-1 + + Yonsei-ro, + + + + Seodaemun-gu, + + + + + + + + + + + + + Conclusion Seoul 03722, Korea + + + + + + + + + + + + + + + + + + + + These results suggested that FOXC1+ stromal cells within the microenvironments of T and + Tel: + + 82-2-2228-1763 + + + + + + + + + + + + + + + + + + Fax: + + 82-2-362-0860 + + + + + + + + + + + + + + + + + NK cell lymphomas might be related to tumor phenotypes. + E-mail: + + + [email protected] + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + Key words + Received + + + + January + + + 13,+ + 2020 + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + FOXC1, T and NK cell lymphomas, Tumor microenvironment, Stromal cells, Dormancy, Accepted July 3, 2020 p38, ERK + Published + + + + Online+ + + July+ + 3, + 2020 + + + + + + + + + + + + + + + + + + + + + + + + + + + + + Introduction tiation [6]. FOXC1 expression has been studied in epithelial tumor cells, such as those of nasopharyngeal carcinoma, The tumor microenvironment plays an important role in breast cancer, prostate cancer, and melanoma, and it plays tumorigenesis and tumor progression by fostering a cross- a regulatory role in the biological behavior of these tumors talk among tumor cells and several types of stromal cells via [7,8]. A recent study revealed that FOXC1 is preferentially various signaling pathways [1]. Recent studies have shown expressed in C-X-C motif chemokine 12 (CXCL12)–associated that the tumor microenvironment is involved in regulating reticular cells (CAR cells), and might promote CAR cell deve- tumor dormancy and activation [2,3]. FOX genes, encoding lopment, upregulating CXCL12 and stem cell factor expres- transcription factors of a family characterized by the presence sion [9]. CAR cells play essential roles in the tumor microenvi- of a forkhead box (Fox) DNA-binding domain, play key roles ronment and are involved in the regulation of hematopoietic in developmental processes during embryogenesis and tis- stem cells and disseminated tumor cells within the bone mar- sue differentiation [4,5]. The gene encoding forkhead box C1 row, affecting retention in the bone marrow, quiescence, and (FOXC1), located at 6p25, is involved in the pathogenesis of repopulation [10,11]. This connection between CAR cells and Hodgkin lymphoma, via the deregulation of B-cell differen- FOXC1 indicates that FOXC1 expression in the tumor micro- │ https://www.e-crt.org │ Copyright ⓒ 2020­­­ by the Korean Cancer Association 1273 This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Cancer Res Treat. 2020;52(4):1273-1282 environment is critical and specific for hematopoietic stem stage, International Prognostic Index (IPI) risk score, lactate cell niche formation and maintenance [12]. Although FOXC1 dehydrogenase (LDH) level, bone marrow involvement, has a potential role in stromal cells in regulating cell dor- and follow-up data were obtained from electronic medical mancy and activation within the tumor microenvironment, records, and prognostic implications were analyzed for 120 similar to CAR cells, studies on FOXC1 expression in stro- patients with available clinical data. The mean follow-up mal cells within tumor microenvironments of hematological period after diagnosis was 14 months (range, 1 to 184 malignancies are limited. months). The clinicopathological features of the patients are The imbalance in activation of the p38 mitogen-activated summarized in S1 Table. protein kinase (MAPK) pathways and extracellular signal regulated kinase (ERK) MAPK pathways plays a key role 2. TMA construction and immunohistochemical evalua- in the establishment of tumor dormancy and activation. In tion dormant tumors, phosphorylated p38 MAPK is generally TMA construction and immunohistochemical staining of more active than phosphorylated ERK MAPK, and vice versa TMA blocks were performed following a standard protocol with respect to tumor activation [2,3]. Studies also show that using a Ventana automatic immunostainer (Ventana, Bench- the p38 and ERK MAPK pathways are involved in normal mark, Tuscan, AZ) as previously described [18]. The follow- immature T cell differentiation. Increased p38 MAPK activa- ing primary antibodies were used: FOXC1 (1:50, Abcam, tion blocks T cell differentiation, whereas increased ERK1/ Cambridge, UK), CXCL12 (1:50, CXCL12/SDF1, R&D Sys- ERK2 activation is required for T cell differentiation [13,14]. tems, Minneapolis, MN), phosphorylated p38 (p-p38; 1:100, Here, we hypothesized that FOXC1 might be involved in phospho T180+Y182, Abcam), phosphorylated ERK1 and regulating tumor dormancy and activation within the tumor ERK2 (p-ERK1/2; 1:100, Erk1 [pT202/pY204]+Erk2 [pT185/ microenvironments of T cell and natural killer (NK) cell lym- pY187], Abcam), CD163 (1:100, clone MRQ-26, Cell Marque, phomas, which occur frequently at various extramedullary Rocklin, CA), CD68 (1:150, clone PG-M1, Dako, Glostrup, sites, disseminate regularly into the bone marrow, and are Denmark), CD34 (1:50, clone QBEnd 10, Dako), S100 (1:2,000, clinically aggressive [15]. In the present study, we investigated Dako), and α-smooth muscle actin (1:500, clone 1A4, Dako). the implications of FOXC1 expression in the tumor microen- To identify FOXC1+ and CXCL12+ stromal cells, the number vironments of T and NK cell lymphomas, focusing on tumor of spindled reticular cells with positive immunoexpression dormancy and activation with respect to the p38 MAPK and in the cytoplasm was counted in at least five fields of the cap- ERK MAPK pathways. tured microscopic photographs at 400× magnification and the average cell number was obtained. The cutoff for high FOXC1+ stromal cell infiltration was defined as the number Materials and Methods of FOXC1+ stromal cells that surpassed the median value of the 120 tested cases. To evaluate p-p38 and p-ERK1/2 immu- 1. Case selection and clinicopathological analysis noexpression in tumor cells, moderate to strongly stained In total, 120 cases of T and NK cell lymphomas diagnosed nuclei of tumor cells were counted and divided by the total at the Severance Hospital from 1999 to 2013 were selected. cell count of the same field. These markers were also counted Consecutive patients with pathological diagnoses of T and in at least five high-power fields using photographs and the NK cell lymphomas based on biopsied or excised specimens average proportion was obtained. Protein expression was were included in this study. Patients with remaining tissue divided into high and low using median values. inadequate to construct tissue microarrays (TMAs) or per- form immunohistochemical staining were excluded. The 3. Genetic analyses using acute myeloid leukemia cases included subtypes were 35 cases of peripheral T cell lym- based on the Cancer Genome Atlas Network data phoma, not otherwise specified (PTCL, NOS), 39 cases of The mRNA expression levels of FOXC1, p38 MAPKs (MAP- extranodal natural killer/T cell lymphoma (NKTL), 12 cases K11, MAPK14, MAPK12, and MAPK13), ERK MAPKs (MAP- of angioimmunoblastic T cell lymphoma (AITL), 20 cases of K1/ERK2 and MAPK3/ERK1), and DUSP1 (MAPK phos- anaplastic large-cell lymphoma (ALCL), anaplastic lympho- phatase 1, MKP-1; the regulator of MAPK phosphorylation) ma kinase (ALK)-positive,
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Anti-SEK1 / MKK4 Phospho (Ser80) Antibody (ARG51673)
    Product datasheet [email protected] ARG51673 Package: 100 μl, 50 μl anti-SEK1 / MKK4 phospho (Ser80) antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes SEK1 / MKK4 phospho (Ser80) Tested Reactivity Hu, Ms, Rat Tested Application ICC/IF, IHC-P, WB Host Rabbit Clonality Polyclonal Isotype IgG Target Name SEK1 / MKK4 Antigen Species Human Immunogen Peptide sequence around phosphorylation site of serine 80 (T-H-S(p)-I-E) derived from Human SEK1/MKK4. Conjugation Un-conjugated Alternate Names MEK 4; MAPK/ERK kinase 4; PRKMK4; SAPKK-1; SAPK/ERK kinase 1; SKK1; JNK-activating kinase 1; EC 2.7.12.2; MEK4; MAP kinase kinase 4; c-Jun N-terminal kinase kinase 1; SEK1; SAPKK1; MAPKK4; Stress- activated protein kinase kinase 1; JNKK1; MKK4; SERK1; SAPK kinase 1; Dual specificity mitogen- activated protein kinase kinase 4; JNKK; MAPKK 4 Application Instructions Application table Application Dilution ICC/IF 1:100 - 1:200 IHC-P 1:50 - 1:100 WB 1:500 - 1:1000 Application Note * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Calculated Mw 44 kDa Properties Form Liquid Purification Antibodies were produced by immunizing rabbits with KLH-conjugated synthetic phosphopeptide. Antibodies were purified by affinity-chromatography using epitope-specific phosphopeptide. In addition, non-phospho specific antibodies were removed by chromatogramphy using non- phosphopeptide. Buffer PBS (without Mg2+ and Ca2+, pH 7.4), 150mM NaCl, 0.02% Sodium azide and 50% Glycerol. Preservative 0.02% Sodium azide Stabilizer 50% Glycerol www.arigobio.com 1/3 Concentration 1 mg/ml Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week.
    [Show full text]
  • TRIM67 Inhibits Tumor Proliferation and Metastasis by Mediating
    Journal of Cancer 2020, Vol. 11 6025 Ivyspring International Publisher Journal of Cancer 2020; 11(20): 6025-6037. doi: 10.7150/jca.47538 Research Paper TRIM67 inhibits tumor proliferation and metastasis by mediating MAPK11 in Colorectal Cancer Ying Liu1*, Guiqi Wang1*, Xia Jiang1*, Wei Li1, Congjie Zhai1, Fangjian Shang1, Shihao Chen1, Zengren Zhao1 and Weifang Yu2 1. Department of General Surgery, Hebei Key Laboratory of Colorectal Cancer Precision Diagnosis and Treatment, The First Hospital of Hebei Medical University, Donggang Road No.89, Shijiazhuang, Hebei 050031, P.R. China. 2. Department of Endoscopy Center, The First Hospital of Hebei Medical University, Donggang Road No.89, Shijiazhuang, Hebei 050031, P.R. China. *These authors contributed equally to this work. Corresponding authors: Prof. Zengren Zhao or Weifang Yu, The First Hospital of Hebei Medical University, Donggang Road No.89, Shijiazhuang, Hebei 050031, P.R. China; Tel: +86 0311 85917217; E-mail: [email protected] or [email protected]. © The author(s). This is an open access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/). See http://ivyspring.com/terms for full terms and conditions. Received: 2020.04.28; Accepted: 2020.08.04; Published: 2020.08.18 Abstract Purpose: We recently reported that tripartite motif-containing 67 (TRIM67) activates p53 to suppress colorectal cancer (CRC). However, the function and mechanism of TRIM67 in the inhibition of CRC cell proliferation and metastasis remains to be further elucidated. Methods: We detected the expression of TRIM67 in CRC tissues compared with normal tissues and confirmed its relationship with clinicopathological features.
    [Show full text]
  • Supplementary Material DNA Methylation in Inflammatory Pathways Modifies the Association Between BMI and Adult-Onset Non- Atopic
    Supplementary Material DNA Methylation in Inflammatory Pathways Modifies the Association between BMI and Adult-Onset Non- Atopic Asthma Ayoung Jeong 1,2, Medea Imboden 1,2, Akram Ghantous 3, Alexei Novoloaca 3, Anne-Elie Carsin 4,5,6, Manolis Kogevinas 4,5,6, Christian Schindler 1,2, Gianfranco Lovison 7, Zdenko Herceg 3, Cyrille Cuenin 3, Roel Vermeulen 8, Deborah Jarvis 9, André F. S. Amaral 9, Florian Kronenberg 10, Paolo Vineis 11,12 and Nicole Probst-Hensch 1,2,* 1 Swiss Tropical and Public Health Institute, 4051 Basel, Switzerland; [email protected] (A.J.); [email protected] (M.I.); [email protected] (C.S.) 2 Department of Public Health, University of Basel, 4001 Basel, Switzerland 3 International Agency for Research on Cancer, 69372 Lyon, France; [email protected] (A.G.); [email protected] (A.N.); [email protected] (Z.H.); [email protected] (C.C.) 4 ISGlobal, Barcelona Institute for Global Health, 08003 Barcelona, Spain; [email protected] (A.-E.C.); [email protected] (M.K.) 5 Universitat Pompeu Fabra (UPF), 08002 Barcelona, Spain 6 CIBER Epidemiología y Salud Pública (CIBERESP), 08005 Barcelona, Spain 7 Department of Economics, Business and Statistics, University of Palermo, 90128 Palermo, Italy; [email protected] 8 Environmental Epidemiology Division, Utrecht University, Institute for Risk Assessment Sciences, 3584CM Utrecht, Netherlands; [email protected] 9 Population Health and Occupational Disease, National Heart and Lung Institute, Imperial College, SW3 6LR London, UK; [email protected] (D.J.); [email protected] (A.F.S.A.) 10 Division of Genetic Epidemiology, Medical University of Innsbruck, 6020 Innsbruck, Austria; [email protected] 11 MRC-PHE Centre for Environment and Health, School of Public Health, Imperial College London, W2 1PG London, UK; [email protected] 12 Italian Institute for Genomic Medicine (IIGM), 10126 Turin, Italy * Correspondence: [email protected]; Tel.: +41-61-284-8378 Int.
    [Show full text]
  • Deep Multiomics Profiling of Brain Tumors Identifies Signaling Networks
    ARTICLE https://doi.org/10.1038/s41467-019-11661-4 OPEN Deep multiomics profiling of brain tumors identifies signaling networks downstream of cancer driver genes Hong Wang 1,2,3, Alexander K. Diaz3,4, Timothy I. Shaw2,5, Yuxin Li1,2,4, Mingming Niu1,4, Ji-Hoon Cho2, Barbara S. Paugh4, Yang Zhang6, Jeffrey Sifford1,4, Bing Bai1,4,10, Zhiping Wu1,4, Haiyan Tan2, Suiping Zhou2, Laura D. Hover4, Heather S. Tillman 7, Abbas Shirinifard8, Suresh Thiagarajan9, Andras Sablauer 8, Vishwajeeth Pagala2, Anthony A. High2, Xusheng Wang 2, Chunliang Li 6, Suzanne J. Baker4 & Junmin Peng 1,2,4 1234567890():,; High throughput omics approaches provide an unprecedented opportunity for dissecting molecular mechanisms in cancer biology. Here we present deep profiling of whole proteome, phosphoproteome and transcriptome in two high-grade glioma (HGG) mouse models driven by mutated RTK oncogenes, PDGFRA and NTRK1, analyzing 13,860 proteins and 30,431 phosphosites by mass spectrometry. Systems biology approaches identify numerous master regulators, including 41 kinases and 23 transcription factors. Pathway activity computation and mouse survival indicate the NTRK1 mutation induces a higher activation of AKT down- stream targets including MYC and JUN, drives a positive feedback loop to up-regulate multiple other RTKs, and confers higher oncogenic potency than the PDGFRA mutation. A mini-gRNA library CRISPR-Cas9 validation screening shows 56% of tested master regulators are important for the viability of NTRK-driven HGG cells, including TFs (Myc and Jun) and metabolic kinases (AMPKa1 and AMPKa2), confirming the validity of the multiomics inte- grative approaches, and providing novel tumor vulnerabilities.
    [Show full text]
  • P38β - MAPK11 and Its Role in Female Cancers Periklis Katopodis1,2* , Rachel Kerslake1 , Athanasios Zikopoulos3, Nefeli Beri4 and Vladimir Anikin2,5
    Katopodis et al. Journal of Ovarian Research (2021) 14:84 https://doi.org/10.1186/s13048-021-00834-9 RESEARCH Open Access p38β - MAPK11 and its role in female cancers Periklis Katopodis1,2* , Rachel Kerslake1 , Athanasios Zikopoulos3, Nefeli Beri4 and Vladimir Anikin2,5 Abstract Background: The p38MAPK family of Mitogen Activated Protein Kinases are a group of signalling molecules involved in cell growth, survival, proliferation and differentiation. The widely studied p38α isoform is ubiquitously expressed and is implicated in a number of cancer pathologies, as are p38γ and p38δ. However, the mechanistic role of the isoform, p38β, remains fairly elusive. Recent studies suggest a possible role of p38β in both breast and endometrial cancer with research suggesting involvement in bone metastasis and cancer cell survival. Female tissue specific cancers such as breast, endometrial, uterine and ovary account for over 3,000,000 cancer related incidents annually; advancements in therapeutics and treatment however require a deeper understanding of the molecular aetiology associated with these diseases. This study provides an overview of the MAPK signalling molecule p38β (MAPK11) in female cancers using an in-silico approach. Methods: A detailed gene expression and methylation analysis was performed using datasets from cBioportal, CanSar and MEXPRESS. Breast, Uterine Endometrial, Cervical, Ovarian and Uterine Carcinosarcoma TCGA cancer datasets were used and analysed. Results: Data using cBioportal and CanSAR suggest that expression of p38β is lower in cancers: BRCA, UCEC, UCS, CESC and OV compared to normal tissue. Methylation data from SMART and MEXPRESS indicate significant probe level variation of CpG island methylation status of the gene MAPK11.
    [Show full text]
  • Activation of Diverse Signalling Pathways by Oncogenic PIK3CA Mutations
    ARTICLE Received 14 Feb 2014 | Accepted 12 Aug 2014 | Published 23 Sep 2014 DOI: 10.1038/ncomms5961 Activation of diverse signalling pathways by oncogenic PIK3CA mutations Xinyan Wu1, Santosh Renuse2,3, Nandini A. Sahasrabuddhe2,4, Muhammad Saddiq Zahari1, Raghothama Chaerkady1, Min-Sik Kim1, Raja S. Nirujogi2, Morassa Mohseni1, Praveen Kumar2,4, Rajesh Raju2, Jun Zhong1, Jian Yang5, Johnathan Neiswinger6, Jun-Seop Jeong6, Robert Newman6, Maureen A. Powers7, Babu Lal Somani2, Edward Gabrielson8, Saraswati Sukumar9, Vered Stearns9, Jiang Qian10, Heng Zhu6, Bert Vogelstein5, Ben Ho Park9 & Akhilesh Pandey1,8,9 The PIK3CA gene is frequently mutated in human cancers. Here we carry out a SILAC-based quantitative phosphoproteomic analysis using isogenic knockin cell lines containing ‘driver’ oncogenic mutations of PIK3CA to dissect the signalling mechanisms responsible for oncogenic phenotypes induced by mutant PIK3CA. From 8,075 unique phosphopeptides identified, we observe that aberrant activation of PI3K pathway leads to increased phosphorylation of a surprisingly wide variety of kinases and downstream signalling networks. Here, by integrating phosphoproteomic data with human protein microarray-based AKT1 kinase assays, we discover and validate six novel AKT1 substrates, including cortactin. Through mutagenesis studies, we demonstrate that phosphorylation of cortactin by AKT1 is important for mutant PI3K-enhanced cell migration and invasion. Our study describes a quantitative and global approach for identifying mutation-specific signalling events and for discovering novel signalling molecules as readouts of pathway activation or potential therapeutic targets. 1 McKusick-Nathans Institute of Genetic Medicine and Department of Biological Chemistry, Johns Hopkins University School of Medicine, 733 North Broadway, BRB 527, Baltimore, Maryland 21205, USA.
    [Show full text]
  • Supplementary Data
    Journal of Alzheimer’s Disease 28 (2012) 1–3 1 IOS Press Supplementary Data Neuroinflammation, Hyperphosphorylated Tau, Diffuse Amyloid Plaques, and Down-Regulation of the Cellular Prion Protein in Air Pollution Exposed Children and Young Adults Lilian Calderon-Garcidue´ nas˜ a,b,∗, Michael Kavanaughb, Michelle Blockc, Amedeo D’Angiullid, Ricardo Delgado-Chavez´ e, Ricardo Torres-Jardon´ f , Angelica Gonzalez-Maciel´ a, Rafael Reynoso-Roblesa, Norma Osnayaa, Rodolfo Villarreal-Calderong, Ruixin Guoh, Zhaowei Huah, Hongtu Zhuh, George Perryi and Philippe Diazj aInstituto Nacional de Pediatr´ıa, Mexico City, Mexico bThe Center for Structural and Functional Neurosciences, The University of Montana, Missoula, MT, USA cVirginia Commonwealth University Medical Campus, Richmond, VA, USA dDepartment of Neuroscience, Carleton University, Ottawa, Ontario, Canada ePathology Department, Instituto Nacional de Cancerologia, Mexico City, Mexico f Centro de Ciencias de la Atm´osfera, Universidad Nacional Aut´onoma de Me´xico, Mexico City, Mexico gDavidson Honors College, The University of Montana, Missoula, MT, USA hDepartment of Biostatistics, Gillings School of Global Public Health, University of North Carolina, Chapel Hill, NC, USA iCollege of Sciences, University of Texas at San Antonio, San Antonio, TX, USA jCore Laboratory for Neuromolecular Production, The University of Montana, Missoula, MT, USA Handling Editor: Massimo Tabaton Accepted 17 August 2011 ∗Correspondence to: Lilian Calderon-Garcidue´ nas,˜ MD Ph.D., The Center for Structural and Functional Neuro- sciences, The University of Montana, 32 Campus Drive, 287 Skaggs Building, Missoula, MT 59812, USA. E-mail: [email protected]. ISSN 1387-2877/12/$27.50 © 2012 – IOS Press and the authors. All rights reserved 2 L.
    [Show full text]
  • Establishment of a Temperature-Sensitive Model of Oncogene-Induced Senescence in Angiosarcoma Cells
    cancers Article Establishment of a Temperature-Sensitive Model of Oncogene-Induced Senescence in Angiosarcoma Cells Adilson da Costa 1,2, Michael Y. Bonner 3, Shikha Rao 1, Linda Gilbert 1,4, Maiko Sasaki 4 , Justin Elsey 1, Jamie MacKelfresh 1,5 and Jack L. Arbiser 1,4,6,* 1 Department of Dermatology, Emory University School of Medicine, Atlanta, GA 30322, USA; [email protected] (A.d.C.); [email protected] (S.R.); [email protected] (L.G.); [email protected] (J.E.); [email protected] (J.M.) 2 Department of Post-Graduate Studies, Instituto de Assistência Médica ao Servidor Público Estadual, Sao Paulo 04029-000, SP, Brazil 3 Department of Medical Biochemistry & Biophysics, Karolinska Institutet, 17177 Solna, Sweden; [email protected] 4 Atlanta Veterans Affairs Medical Center, Decatur, GA 30033, USA; [email protected] 5 Department of Pathology, Emory University School of Medicine, Atlanta, GA 30322, USA 6 Winship Cancer Institute of Emory University, Atlanta, GA 30322, USA * Correspondence: [email protected]; Tel.: +1-(404)-727-5063; Fax: +1-(404)-727-0923 Received: 11 December 2019; Accepted: 1 February 2020; Published: 8 February 2020 Abstract: Lesions with driver mutations, including atypical nevi and seborrheic keratoses, are very common in dermatology, and are prone to senescence. The molecular events that prevent senescent lesions from becoming malignant are not well understood. We have developed a model of vascular proliferation using a temperature-sensitive, large T antigen and oncogenic HRas. By elevating the temperature to 39 ◦C, we can turn off large T antigen and study the molecular events in cells with the Ras driver mutation.
    [Show full text]
  • MAPK14 (T106M) [GST-Tagged] Kinase
    MAPK14 (T106M) [GST-tagged] Kinase Alternate Names: Cytokine-Suppressive Anti-inflammatory Drug-Binding Protein 1, CSBP1, SAPK2A, p38-Alpha Cat. No. 66-0035-050 Quantity: 50 µg Lot. No. 30314 Storage: -70˚C FOR RESEARCH USE ONLY NOT FOR USE IN HUMANS CERTIFICATE OF ANALYSIS Page 1 of 2 Background Physical Characteristics Protein ubiquitylation and protein Species: human Protein Sequence: Please see page 2 phosphorylation are the two major mechanisms that regulate the func- Source: E. coli tions of proteins in eukaryotic cells. Quantity: 50 μg However, these different posttrans- lational modifications do not operate Concentration: 3.55 mg/ml independently of one another, but are frequently interlinked to enable bio- Formulation: 50 mM Tris/HCl pH7.5, 0.1 mM EGTA, 150 mM NaCl, 0.1% ß-Mercap- logical processes to be controlled in a toethanol, 270 mM sucrose, 0.03% Brij-35, more complex and sophisticated man- 1 mM Benzamidine, 0.2 mM PMSF ner. Studying how protein phosphory- lation events control the ubiquitin sys- Molecular Weight: ~67.6 kDa tem and how ubiquitylation regulates Purity: >85% by InstantBlue™ SDS-PAGE protein phosphorylation has become a focal point of the study of cell regula- Stability/Storage: 12 months at -70˚C; tion and human disease. MAP kinas- aliquot as required es are serine, threonine, and tyrosine specific protein kinases that regulate proliferation, gene expression, differ- entiation, mitosis, cell survival, and Quality Assurance apoptosis in response to stimuli, such Purity: Protein Identification: as mitogens, osmotic stress, heat 4-12% gradient SDS-PAGE Confirmed by mass spectrometry. shock and pro-inflammatory cytok- InstantBlue™ staining ines.
    [Show full text]
  • PRODUCTS and SERVICES Target List
    PRODUCTS AND SERVICES Target list Kinase Products P.1-11 Kinase Products Biochemical Assays P.12 "QuickScout Screening Assist™ Kits" Kinase Protein Assay Kits P.13 "QuickScout Custom Profiling & Panel Profiling Series" Targets P.14 "QuickScout Custom Profiling Series" Preincubation Targets Cell-Based Assays P.15 NanoBRET™ TE Intracellular Kinase Cell-Based Assay Service Targets P.16 Tyrosine Kinase Ba/F3 Cell-Based Assay Service Targets P.17 Kinase HEK293 Cell-Based Assay Service ～ClariCELL™ ～ Targets P.18 Detection of Protein-Protein Interactions ～ProbeX™～ Stable Cell Lines Crystallization Services P.19 FastLane™ Structures ～Premium～ P.20-21 FastLane™ Structures ～Standard～ Kinase Products For details of products, please see "PRODUCTS AND SERVICES" on page 1～3. Tyrosine Kinases Note: Please contact us for availability or further information. Information may be changed without notice. Expression Protein Kinase Tag Carna Product Name Catalog No. Construct Sequence Accession Number Tag Location System HIS ABL(ABL1) 08-001 Full-length 2-1130 NP_005148.2 N-terminal His Insect (sf21) ABL(ABL1) BTN BTN-ABL(ABL1) 08-401-20N Full-length 2-1130 NP_005148.2 N-terminal DYKDDDDK Insect (sf21) ABL(ABL1) [E255K] HIS ABL(ABL1)[E255K] 08-094 Full-length 2-1130 NP_005148.2 N-terminal His Insect (sf21) HIS ABL(ABL1)[T315I] 08-093 Full-length 2-1130 NP_005148.2 N-terminal His Insect (sf21) ABL(ABL1) [T315I] BTN BTN-ABL(ABL1)[T315I] 08-493-20N Full-length 2-1130 NP_005148.2 N-terminal DYKDDDDK Insect (sf21) ACK(TNK2) GST ACK(TNK2) 08-196 Catalytic domain
    [Show full text]
  • Proteome Profiler™ Human Phospho-MAPK Array
    Proteome Profiler™ Array Human Phospho-MAPK Array Kit Catalog Number ARY002 For the parallel determination of the relative levels of phosphorylation of Mitogen-Activated Protein Kinases (MAPKs) and other serine/threonine kinases. This package insert must be read in its entirety before using this product. FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. TABLE OF CONTENTS Contents Page INTRODUCTION 2 PRINCIPLE OF THE ASSAY . 2 TECHNICAL HINTS AND LIMITATIONS 2 MATERIALS PROVIDED . 3 OTHER MATERIALS REQUIRED 3 SAMPLE PREPARATION . 4 REAGENT PREPARATION 4 ARRAY PROTOCOL. .5 DATA ANALYSIS 6 PROFILING KINASE PHOSPHORYLATION . 7 SPECIFICITY - COMPETITION 9 SPECIFICITY - PATHWAY INHIBITION . 10 APPENDIX 11 MANUFACTURED AND DISTRIBUTED BY: R&D Systems, Inc. TELEPHONE: (800) 343-7475 614 McKinley Place NE (612) 379-2956 Minneapolis, MN 55413 FAX: (612) 656-4400 United States of America E-MAIL: [email protected] DISTRIBUTED BY: R&D Systems Europe, Ltd. 19 Barton Lane TELEPHONE: +44 (0)1235 529449 Abingdon Science Park FAX: +44 (0)1235 533420 Abingdon, OX14 3NB E-MAIL: [email protected] United Kingdom R&D Systems China Co. Ltd. 24A1 Hua Min Empire Plaza TELEPHONE: +86 (21) 52380373 726 West Yan An Road FAX: +86 (21) 52371001 Shanghai PRC 200050 E-MAIL: [email protected] INTRODUCTION Analyzing the phosphorylation status of all three major families of mitogen-activated protein kinases (MAPKs), the extracellular signal-regulated kinases (ERK1/2), c-Jun N-terminal kinases (JNK1 - 3), and different p38 isoforms (a/b/d/g), is essential in understanding the roles these signaling molecules play in mechanisms underlying cell function and disease.
    [Show full text]