DOCSLIB.ORG

Peripheral Blood Gene Expression Profiles in Metabolic Syndrome, Coronary Artery Disease and Type 2 Diabetes

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Peripheral Blood Gene Expression Profiles in Metabolic Syndrome, Coronary Artery Disease and Type 2 Diabetes Genes and Immunity (2011) 12, 341–351 & 2011 Macmillan Publishers Limited All rights reserved 1466-4879/11 www.nature.com/gene ORIGINAL ARTICLE Peripheral blood gene expression profiles in metabolic syndrome, coronary artery disease and type 2 diabetes BL Grayson1, L Wang2 and TM Aune1,3 1Department of Microbiology and Immunology, Vanderbilt University School of Medicine, Nashville, TN, USA; 2Department of Biostatistics, Vanderbilt University School of Medicine, Nashville, TN, USA and 3Department of Medicine, Vanderbilt University School of Medicine, Nashville, TN, USA To determine if individuals with metabolic disorders possess unique gene expression profiles, we compared transcript levels in peripheral blood from patients with coronary artery disease (CAD), type 2 diabetes (T2D) and their precursor state, metabolic syndrome to those of control (CTRL) subjects and subjects with rheumatoid arthritis (RA). The gene expression profile of each metabolic state was distinguishable from CTRLs and correlated with other metabolic states more than with RA. Of note, subjects in the metabolic cohorts overexpressed gene sets that participate in the innate immune response. Genes involved in activation of the pro-inflammatory transcription factor, NF-kB, were overexpressed in CAD whereas genes differentially expressed in T2D have key roles in T-cell activation and signaling. Reverse transcriptase PCR validation confirmed microarray results. Furthermore, several genes differentially expressed in human metabolic disorders have been previously shown to participate in inflammatory responses in murine models of obesity and T2D. Taken together, these data demonstrate that peripheral blood from individuals with metabolic disorders display overlapping and non-overlapping patterns of gene expression indicative of unique, underlying immune processes. Genes and Immunity (2011) 12, 341–351; doi:10.1038/gene.2011.13; published online 3 March 2011 Keywords: coronary artery disease; gene expression profiles; gene set; metabolic syndrome; rheumatoid arthritis; type 2 diabetes Introduction tension or raised fasting plasma glucose. The prevalence of MetS in the United States is as high as 39% using the Type 2 diabetes (T2D) is a metabolic disorder of International Diabetes Federation criteria. Diagnosis of peripheral insulin resistance resulting in hyperglycemia MetS confers a 1.5–2.6 relative risk of developing CAD and ultimately decreased insulin secretion from the and a 3.5–7.5 relative risk of developing T2D. Addition- pancreas. Risk factors for T2D include obesity, physical ally, the Framingham study determined that a portion of inactivity and family history of metabolic disorders or these relative risks persist even in the absence of obesity. atherosclerosis.1 Diabetes currently affects 6.3% of the This trio of disorders poses a significant threat to public United States population and B90% of these cases are health in the United States. non-insulin dependent or T2D.2 Coronary artery disease Inflammatory processes are involved in the pathogen- (CAD) results from atherosclerotic plaque development esis of T2D and CAD. Visceral adipose tissue, present in coronary arteries. These fibrous, fatty deposits can in abundance in many patients with T2D, produces ultimately block the flow of blood resulting in angina inflammatory cytokines like interleukin (IL)-6 and tumor and/or myocardial infarction. Hyperlipidemia predis- necrosis factor (TNF)-a´ that are known to aid in the poses to the development of these plaques, making impairment of insulin signaling in adipocytes. These obesity and physical inactivity also risk factors for CAD.3 cytokines can activate a systemic immune response and The prevalence of CAD in the United States is 4.1%.4 recruit inflammatory cells, like lymphocytes, to visceral Metabolic syndrome (MetS 0) is a precursor state to both adipose tissue.14 In the case of CAD, the lesion is not T2D and CAD.5–13 The International Diabetes Federation visceral adipose tissue, but rather fatty deposits in the defines this pre-disease state as central obesity plus any vasculature. These deposits contain fat-laden macro- two of the following four characteristics: hypertriglycer- phages and immunoreactive T cells.3 idemia, low high-density lipoprotein cholesterol, hyper- Gene expression profiling of blood or tissue samples is one way to assess cellular changes due to cell differ- entiation and aging,15,16 disease pathogenesis17–19 or Correspondence: Dr TM Aune, Department of Medicine, Vanderbilt pharmacological responses.20,21 One example of this is University School of Medicine, MCN T-3219, 1161 21st Avenue tumor typing; gene expression signatures are presently South, Nashville, TN 37232, USA. E-mail: [email protected] used to classify tumor types in breast cancer biopsies. Received 7 December 2010; revised and accepted 20 January 2011; This method can also be used to assess changes in published online 3 March 2011 peripheral whole blood of patients with common, Peripheral blood gene expression profiles in MetS, CAD and T2D BL Grayson et al 342 complex diseases.22–24 Individuals with autoimmune Results diseases (type 1 diabetes, multiple sclerosis, systemic lupus erythematosus and rheumatoid arthritis (RA)) Peripheral blood gene expression profiling using micro- display unique gene expression signatures in peripheral arrays has been shown sufficient to distinguish between whole blood. Portions of these signatures are expressed phenotypically distinct cohorts of patients.22–24 We in first degree unaffected relatives,25 however, disease- sought to determine if subjects with MetS, CAD or T2D specific signatures are also found in peripheral blood also possessed a gene expression signature in blood and are sufficient to distinguish individuals with disease sufficient to distinguish these subjects from CTRL from control (CTRL) individuals.26 Moreover, peripheral subjects and, if so, did this signature bear any resem- blood gene expression profiling can give insight into blance to the signature of an autoimmune disease, RA. To disease processes and suggest specific functional defects do so, we recruited subjects with MetS, CAD and T2D in cells. For example, peripheral blood gene expression (n ¼ 6, n ¼ 6, n ¼ 8, respectively), six subjects with RA, in patients with RA contains low transcript levels of the and nine subjects who had never been diagnosed with a tumor suppressor protein, p53. Consequently, T cells chronic illness, and were not presently taking medica- from patients with RA are resistant to g-radiation tions for any diagnosed state, to serve as the CTRL induced apoptosis, a p53 dependent pathway.27 Gene cohort. expression profiling may also aid in diagnosing patients We analyzed all 35 peripheral blood samples for gene who have these often difficult to diagnose diseases; expression using the human exonic evidence-based therefore, analysis of peripheral blood gene expression oligonucleotide array. Next, we normalized the data to represents one approach to assessing immune system a sum total intensity of 10 000, giving an average changes, predicting cellular defects and diagnosing intensity per oligonucleotide probe of 0.2. Genes, with patients with immune-related disease in a minimally an average intensity of greater than 0.2, were used as invasive way. data points for clustering analysis. The intensity values T2D, CAD and their precursor, and MetS are not of the filtered set of genes for each array were inputted autoimmune diseases but feature inflammation as a into The Institute for Genomic Research’s multi-experi- possible pathogenic component. The purpose of our ment viewer. studies was to assess if these diseases also possess unique Initially the samples were imported in sets of CTRL peripheral blood gene expression profiles and if so, what plus one disease or pre-disease state (RA, MetS, CAD or do the profiles indicate about the relationships among T2D, respectively) and then all samples were imported MetS, CAD and T2D. To address this question, we together. Using the Support Tree function, we created a compared profiles of each disease state to CTRL subjects, dendrogram based on unsupervised clustering of each to an autoimmune disease, RA, and to each other. group of samples by similarity (Figure 1). In other words, 100% support 90-100% support 80-90% support RA 01 RA 02 RA 03 RA 04 RA 05 RA 06 70-80% support MetS 03 MetS 01 MetS 02 MetS 04 MetS 05 MetS 06 CTRL 05 CTRL 07 CTRL 03 CTRL 05 CTRL 07 CTRL 03 CTRL 06 CTRL 09 CTRL 08 CTRL 06 CTRL 09 CTRL 01 CTRL 02 CTRL 04 CTRL 01 CTRL 02 CTRL 04 CTRL 08 60-70% support 50-60% support 0-50% support 0% support unrecovered node T2D 06 T2D 04 T2D 03 T2D 05 T2D 01 T2D 02 T2D 07 CAD 03 CAD 05 CAD 01 CAD 02 CAD 04 CAD 06 CTRL 05 CTRL 07 CTRL 03 CTRL 08 CTRL 06 CTRL 09 CTRL 04 CTRL 01 CTRL 02 CTRL 04 CTRL 08 CTRL 02 CTRL 03 CTRL 05 CTRL 07 CTRL 01 CTRL 06 CTRL 09 RA 01 RA 02 RA 03 RA 04 RA 05 RA 06 T2D 06 T2D 05 T2D 04 T2D 01 T2D 02 T2D 08 T2D 03 T2D 07 CAD 03 CAD 05 CAD 01 CAD 02 CAD 04 CAD 06 MetS 02 MetS 04 MetS 03 MetS 05 MetS 01 MetS 06 CTRL 04 CTRL 01 CTRL 06 CTRL 09 CTRL 08 CTRL 02 CTRL 03 CTRL 05 CTRL 07 Figure 1 Unsupervised hierarchical clustering of individual disease cohorts with CTRL. To determine if differential patterns of gene expression could be found among combinations of samples, normalized intensity data points from oligos with an average intensity of X0.20 (average array intensity) were inputted into The Institute for Genomic Research’s Multi-Experiment Viewer. For each comparison, gene intensity averages were calulcated and those X0.20 were selected as input in each comparison. The CTRL vs RA input was 4969 gene and gene splice data points; CTRL vs MetS input was 4225 data points; CTRL vs CAD input contained 4271 data points and the CTRL vs T2D comparison featured an input of 4983 data points.
Load more

Recommended publications
  • Tak1 Polyclonal Antibody Catalog # AP72719
    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 Tak1 Polyclonal Antibody Catalog # AP72719 Specification Tak1 Polyclonal Antibody - Product Information Application IF Primary Accession O43318 Reactivity Human, Mouse, Rat Host Rabbit Clonality Polyclonal Tak1 Polyclonal Antibody - Additional Information Gene ID 6885 Other Names MAP3K7; TAK1; Mitogen-activated protein kinase kinase kinase 7; Transforming growth factor-beta-activated kinase 1; TGF-beta-activated kinase 1 Dilution IF~~IF: 1:50-200 Western Blot: 1/500 - 1/2000. Immunohistochemistry: 1/100 - 1/300. ELISA: 1/40000. Not yet tested in other applications. Format Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. Storage Conditions -20℃ Tak1 Polyclonal Antibody - Protein Information Name MAP3K7 {ECO:0000303|PubMed:28397838, ECO:0000312|HGNC:HGNC:6859} Function Serine/threonine kinase which acts as an essential component of the MAP kinase signal transduction pathway. Plays an important role in the cascades of cellular responses evoked by changes in the environment. Mediates signal transduction of TRAF6, various cytokines including Page 1/3 10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 interleukin-1 (IL-1), transforming growth factor-beta (TGFB), TGFB-related factors like BMP2 and BMP4, toll-like receptors (TLR), tumor necrosis factor receptor CD40 and B-cell receptor (BCR). Ceramides are also able to activate MAP3K7/TAK1. Once activated, acts as an upstream activator of the MKK/JNK signal transduction cascade and the p38 MAPK signal transduction cascade through the phosphorylation and activation of several MAP kinase kinases like MAP2K1/MEK1, MAP2K3/MKK3, MAP2K6/MKK6 and MAP2K7/MKK7.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Human CD64 / FCGR1A Protein (His Tag), Biotinylated
    Human CD64 / FCGR1A Protein (His Tag), Biotinylated Catalog Number: 10256-H08S-B General Information SDS-PAGE: Gene Name Synonym: CD64; Fc gamma RI Protein Construction: A DNA sequence encoding the human FCGR1A (NP_000557.1) (Met1- Pro288) was expressed with a polyhistidine tag at the C-terminus. The purified protein was biotinylated in vitro. Source: Human Expression Host: CHO Stable Cells QC Testing Purity: > 95 % as determined by SDS-PAGE. Bio Activity： Protein Description Measured by its binding ability in a functional ELISA.Immobilized High affinity immunoglobulin gamma Fc receptor I, also known as FCGR1 biotinylated Human CD64 Protein (Cat：10256-H08S-B)at 10 μg/mL can and CD64, is an integral membraneglycoprotein and a member of the bind human IgG1,The EC50 of human IgG1 is 6-14 ng/mL. immunoglobulin superfamily. CD64 is a high affinity receptor for the Fc region of IgG gamma and functions in both innate and adaptive immune Endotoxin: responses. Receptors that recognize the Fc portion of IgG function in the regulation of immune response and are divided into three classes < 1.0 EU per μg protein as determined by the LAL method. designated CD64, CD32, and CD16. CD64 is structurally composed of asignal peptidethat allows its transport to the surface of a cell, Stability: threeextracellularimmunoglobulin domainsof the C2-type that it uses to Samples are stable for up to twelve months from date of receipt at -70 ℃ bind antibody, a hydrophobictransmembrane domain, and a short cytoplasmic tail. CD64 isconstitutivelyfound on only macrophages and Predicted N terminal: Gln 16 monocytes, but treatment of polymorphonuclear leukocyteswith cytokines likeIFNγandG-CSFcan induce CD64 expression on these cells.
    [Show full text]
  • Wo 2010/075007 A2
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date 1 July 2010 (01.07.2010) WO 2010/075007 A2 (51) International Patent Classification: (81) Designated States (unless otherwise indicated, for every C12Q 1/68 (2006.01) G06F 19/00 (2006.01) kind of national protection available): AE, AG, AL, AM, C12N 15/12 (2006.01) AO, AT, AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, (21) International Application Number: DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, PCT/US2009/067757 HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, (22) International Filing Date: KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, 11 December 2009 ( 11.12.2009) ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PE, PG, PH, PL, PT, RO, RS, RU, SC, SD, (25) Filing Language: English SE, SG, SK, SL, SM, ST, SV, SY, TJ, TM, TN, TR, TT, (26) Publication Language: English TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (30) Priority Data: (84) Designated States (unless otherwise indicated, for every 12/3 16,877 16 December 2008 (16.12.2008) US kind of regional protection available): ARIPO (BW, GH, GM, KE, LS, MW, MZ, NA, SD, SL, SZ, TZ, UG, ZM, (71) Applicant (for all designated States except US): DODDS, ZW), Eurasian (AM, AZ, BY, KG, KZ, MD, RU, TJ, W., Jean [US/US]; 938 Stanford Street, Santa Monica, TM), European (AT, BE, BG, CH, CY, CZ, DE, DK, EE, CA 90403 (US).
    [Show full text]
  • Genome-Wide Analysis of Host-Chromosome Binding Sites For
    Lu et al. Virology Journal 2010, 7:262 http://www.virologyj.com/content/7/1/262 RESEARCH Open Access Genome-wide analysis of host-chromosome binding sites for Epstein-Barr Virus Nuclear Antigen 1 (EBNA1) Fang Lu1, Priyankara Wikramasinghe1, Julie Norseen1,2, Kevin Tsai1, Pu Wang1, Louise Showe1, Ramana V Davuluri1, Paul M Lieberman1* Abstract The Epstein-Barr Virus (EBV) Nuclear Antigen 1 (EBNA1) protein is required for the establishment of EBV latent infection in proliferating B-lymphocytes. EBNA1 is a multifunctional DNA-binding protein that stimulates DNA replication at the viral origin of plasmid replication (OriP), regulates transcription of viral and cellular genes, and tethers the viral episome to the cellular chromosome. EBNA1 also provides a survival function to B-lymphocytes, potentially through its ability to alter cellular gene expression. To better understand these various functions of EBNA1, we performed a genome-wide analysis of the viral and cellular DNA sites associated with EBNA1 protein in a latently infected Burkitt lymphoma B-cell line. Chromatin-immunoprecipitation (ChIP) combined with massively parallel deep-sequencing (ChIP-Seq) was used to identify cellular sites bound by EBNA1. Sites identified by ChIP- Seq were validated by conventional real-time PCR, and ChIP-Seq provided quantitative, high-resolution detection of the known EBNA1 binding sites on the EBV genome at OriP and Qp. We identified at least one cluster of unusually high-affinity EBNA1 binding sites on chromosome 11, between the divergent FAM55 D and FAM55B genes. A con- sensus for all cellular EBNA1 binding sites is distinct from those derived from the known viral binding sites, sug- gesting that some of these sites are indirectly bound by EBNA1.
    [Show full text]
  • Anti-SEK1 / MKK4 Phospho (Ser80) Antibody (ARG51673)
    Product datasheet [email protected] ARG51673 Package: 100 μl, 50 μl anti-SEK1 / MKK4 phospho (Ser80) antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes SEK1 / MKK4 phospho (Ser80) Tested Reactivity Hu, Ms, Rat Tested Application ICC/IF, IHC-P, WB Host Rabbit Clonality Polyclonal Isotype IgG Target Name SEK1 / MKK4 Antigen Species Human Immunogen Peptide sequence around phosphorylation site of serine 80 (T-H-S(p)-I-E) derived from Human SEK1/MKK4. Conjugation Un-conjugated Alternate Names MEK 4; MAPK/ERK kinase 4; PRKMK4; SAPKK-1; SAPK/ERK kinase 1; SKK1; JNK-activating kinase 1; EC 2.7.12.2; MEK4; MAP kinase kinase 4; c-Jun N-terminal kinase kinase 1; SEK1; SAPKK1; MAPKK4; Stress- activated protein kinase kinase 1; JNKK1; MKK4; SERK1; SAPK kinase 1; Dual specificity mitogen- activated protein kinase kinase 4; JNKK; MAPKK 4 Application Instructions Application table Application Dilution ICC/IF 1:100 - 1:200 IHC-P 1:50 - 1:100 WB 1:500 - 1:1000 Application Note * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Calculated Mw 44 kDa Properties Form Liquid Purification Antibodies were produced by immunizing rabbits with KLH-conjugated synthetic phosphopeptide. Antibodies were purified by affinity-chromatography using epitope-specific phosphopeptide. In addition, non-phospho specific antibodies were removed by chromatogramphy using non- phosphopeptide. Buffer PBS (without Mg2+ and Ca2+, pH 7.4), 150mM NaCl, 0.02% Sodium azide and 50% Glycerol. Preservative 0.02% Sodium azide Stabilizer 50% Glycerol www.arigobio.com 1/3 Concentration 1 mg/ml Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • FCGR1A Recombinant Protein
    FCGR1A Recombinant Protein CATALOG NUMBER: 96-305 The purity of rh CD64 / FCGR1A was determined by DTT-reduced (+) SDS- PAGE and staining overnight with Coomassie Blue. Specifications SPECIES: Human SOURCE SPECIES: HEK293 cells SEQUENCE: Gln 16 - Pro 288 FUSION TAG: His Tag TESTED APPLICATIONS: WB APPLICATIONS: This recombinant protein can be used for WB. For research use only. BIOLOGICAL ACTIVITY: Measured by its ability to bind human IgG1 in the SPR assay (Biacore 2000) with the KD < 5 nM. Measured by its binding ability in a functional ELISA. Immobilized Human IgG4 at 10ug/mL (100 µl/well),can bind Human Fc gamma RI, His Tag (Cat# FCA-H52H2) with a linear of 0.1-2 ng/mL. Properties PURITY: >90% as determined by SDS-PAGE. PREDICTED MOLECULAR 32.5 kDa WEIGHT: PHYSICAL STATE: Lyopholized BUFFER: PBS, pH7.4 STORAGE CONDITIONS: Lyophilized Protein should be stored at -20˚C or lower for long term storage. Upon reconstitution, working aliquots should be stored at -20˚C or -70˚C. Avoid repeated freeze-thaw cycles. Additional Info ALTERNATE NAMES: FCGR1A, FCG1, FCGR1, IGFR1, CD64, CD64A, FCRI ACCESSION NO.: AAH32634 Background Receptors that recognize the Fc portion of IgG are divided into three groups designated Fc gamma RI, RII, and RIII, also known respectively as CD64, CD32, and CD16. Fc gamma RI binds IgG with high affinity and functions during early immune responses. Fc gamma RII and RIII are low affinity receptors that recognize IgG as aggregates surrounding multivalent antigens during late immune responses. High affinity immunoglobulin gamma Fc receptor I is also known as FCGR1A, FCG1, FCGR1, CD64 and IGFR1, is a type of integral membrane glycoprotein that binds monomeric IgG-type antibodies with high affinity, which belongs to the immunoglobulin superfamily or FCGR1 family.
    [Show full text]
  • (NM 001142939) Mouse Untagged Clone – MC215669
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MC215669 Gm20604 (NM_001142939) Mouse Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Gm20604 (NM_001142939) Mouse Untagged Clone Tag: Tag Free Symbol: Gm20604 Synonyms: AK010878-Moap1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >MC215669 representing NM_001142939 Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGCTTTCGGGCGAGTACGTCGGTTGTGACGGGGAGCCGCAGCGGCTACGAGTGTCCTGTGAGGCGT CGGGAGACGCGGACCCTCTCCAGAGCCTGTCGGCGGGCGTGGTCCGGATGAAGGAGTTGGTAGCGGAGTT CTTCGGGACCCTAGTGGAGCAGGACGCGCAAGGCTTGGCGGAAGATCCGGACGACGCTTTGGATGGCTCC CGGACCTCTGCGTGTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA Restriction Sites: SgfI-MluI ACCN: NM_001142939 Insert Size: 228 bp OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). RefSeq: NM_001142939.1, NP_001136411.1 RefSeq Size: 3835 bp RefSeq ORF: 228 bp This product is to be used for
    [Show full text]
  • Protein Phosphorylation Sites Notes References Transcription Factors
    Protein Phosphorylation Notes References sites Transcription AML1 Ser249, Ser266 Phosphorylation of the acute myelogenous leukemia 1 (AML1) potentially regulates its (Tanaka et al., 1996) Factors (RUNX1) transactivation potential and thereby modifies myeloid hematopoietic differentiation. Androgen Ser514 Phosphorylation of androgen receptor by ERKs is controversial. May play a role in survival (Yeh et al., 1999) receptor and proliferation of prostate cells. Arix/Phox2a Ser36, Ser71 Phosphorylation of Arix by ERK1/2 inhibits its ability to interact with target genes. (Hsieh et al., 2005) ATF2 Thr71 This phosphorylation together with the phosphorylation of Thr69 by p38MAPK induces (Ouwens et al., 2002) activation of ATF2. Beta2 (Neuro Ser274 Phosphorylation of this HLH transcription factor induces its glucose-sensitive transactivation (Khoo et al. 2003) D1) and enhances its capability to heterodimerize with E47/12 and bind to DNA. BCL-6 Ser333, Ser343 Phosphorylation of BCL-6 induces its degradation that is important for B-cell differentiation (Niu et al., 1998) and antibody response. BMAL1 Ser527, Thr534, Phosphorylation of this helix-loop-helix-PAS transcription factor inhibits its activity as a clock (Sanada et al., 2002) Ser599 (chicken) oscillator. CBP Thr188 Phosphorylation of the C-terminal region of the CREB binding protein (CBP, and also its (Janknecht and homolog p300) enhances its transactivation potential. Nordheim, 1996) C/EBPb Thr188 (rat) Phosphorylation of the CCAAT/enhancer-binding protein-b (C/EBPb) by ERK2 (not ERK1) (Hanlon et al., 2001) enhances its interaction with SRF and its transactivation activity. CRY1/2 Ser265, Ser557 Phosphorylation of the Cryptochromes proteins CRY1 and 2 results in attenuation of their (Sanada et al., 2004) (CRY1, mouse) ability to inhibit BMAL1:CLOCK-mediated transcription.
    [Show full text]
  • Genome-Wide Sirna Screen for Mediators of NF-Κb Activation
    Genome-wide siRNA screen for mediators SEE COMMENTARY of NF-κB activation Benjamin E. Gewurza, Fadi Towficb,c,1, Jessica C. Marb,d,1, Nicholas P. Shinnersa,1, Kaoru Takasakia, Bo Zhaoa, Ellen D. Cahir-McFarlanda, John Quackenbushe, Ramnik J. Xavierb,c, and Elliott Kieffa,2 aDepartment of Medicine and Microbiology and Molecular Genetics, Channing Laboratory, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115; bCenter for Computational and Integrative Biology, Massachusetts General Hospital, Harvard Medical School, Boston, MA 02114; cProgram in Medical and Population Genetics, The Broad Institute of Massachusetts Institute of Technology and Harvard, Cambridge, MA 02142; dDepartment of Biostatistics, Harvard School of Public Health, Boston, MA 02115; and eDepartment of Biostatistics and Computational Biology and Department of Cancer Biology, Dana-Farber Cancer Institute, Boston, MA 02115 Contributed by Elliott Kieff, December 16, 2011 (sent for review October 2, 2011) Although canonical NFκB is frequently critical for cell proliferation, (RIPK1). TRADD engages TNFR-associated factor 2 (TRAF2), survival, or differentiation, NFκB hyperactivation can cause malig- which recruits the ubiquitin (Ub) E2 ligase UBC5 and the E3 nant, inflammatory, or autoimmune disorders. Despite intensive ligases cIAP1 and cIAP2. CIAP1/2 polyubiquitinate RIPK1 and study, mammalian NFκB pathway loss-of-function RNAi analyses TRAF2, which recruit and activate the K63-Ub binding proteins have been limited to specific protein classes. We therefore under- TAB1, TAB2, and TAB3, as well as their associated kinase took a human genome-wide siRNA screen for novel NFκB activa- MAP3K7 (TAK1). TAK1 in turn phosphorylates IKKβ activa- tion pathway components. Using an Epstein Barr virus latent tion loop serines to promote IKK activity (4).
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]