DOCSLIB.ORG

TRIM67 Inhibits Tumor Proliferation and Metastasis by Mediating

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
TRIM67 Inhibits Tumor Proliferation and Metastasis by Mediating Journal of Cancer 2020, Vol. 11 6025 Ivyspring International Publisher Journal of Cancer 2020; 11(20): 6025-6037. doi: 10.7150/jca.47538 Research Paper TRIM67 inhibits tumor proliferation and metastasis by mediating MAPK11 in Colorectal Cancer Ying Liu1*, Guiqi Wang1*, Xia Jiang1*, Wei Li1, Congjie Zhai1, Fangjian Shang1, Shihao Chen1, Zengren Zhao1 and Weifang Yu2 1. Department of General Surgery, Hebei Key Laboratory of Colorectal Cancer Precision Diagnosis and Treatment, The First Hospital of Hebei Medical University, Donggang Road No.89, Shijiazhuang, Hebei 050031, P.R. China. 2. Department of Endoscopy Center, The First Hospital of Hebei Medical University, Donggang Road No.89, Shijiazhuang, Hebei 050031, P.R. China. *These authors contributed equally to this work. Corresponding authors: Prof. Zengren Zhao or Weifang Yu, The First Hospital of Hebei Medical University, Donggang Road No.89, Shijiazhuang, Hebei 050031, P.R. China; Tel: +86 0311 85917217; E-mail: [email protected] or [email protected]. © The author(s). This is an open access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/). See http://ivyspring.com/terms for full terms and conditions. Received: 2020.04.28; Accepted: 2020.08.04; Published: 2020.08.18 Abstract Purpose: We recently reported that tripartite motif-containing 67 (TRIM67) activates p53 to suppress colorectal cancer (CRC). However, the function and mechanism of TRIM67 in the inhibition of CRC cell proliferation and metastasis remains to be further elucidated. Methods: We detected the expression of TRIM67 in CRC tissues compared with normal tissues and confirmed its relationship with clinicopathological features. DNA methylation of TRIM67 was analyzed to determine its significantly hypermethylated sites in CRC tissues. CCK-8, colony formation, transwell migration, and Matrigel invasion assays were performed to evaluate the effects of TRIM67 on cell proliferation and metastasis in CRC cells. RNA sequencing of TRIM67 and TRIM67 rescue experiments were performed to reveal its mechanisms in CRC cell proliferation and metastasis. Results: TRIM67 expression was significantly downregulated in CRC tissues and its expression was associated with clinical stage, invasive depth, tumor size, lymph node metastasis, and Dukes’ stage. Three methylation sites were significantly hypermethylated and negatively correlated with TRIM67 expression in CRC tissues. TRIM67 suppressed proliferation, migration, and invasion in CRC cells. RNA sequencing revealed that protein mitogen-activated protein kinase 11 (MAPK11) was a potential downstream negative regulatory gene of TRIM67. Reversing MAPK11 expression could rescue the effects of TRIM67 on the proliferation and metastasis of CRC cells. Conclusion: TRIM67 inhibited cell proliferation and metastasis by mediating MAPK11 in CRC, and may be a potential target to inhibit CRC metastasis. Key words: TRIM67, colorectal cancer, MAPK11, cell proliferation, metastasis Introduction Colorectal cancer (CRC) is a main cause of death of RBCC proteins of which nearly 70 members have worldwide, and its morbidity and mortality have been identified in humans, while fewer than 20 increased in recent years [1]. Multiple genes and members have been identified in invertebrates and signaling pathways have been identified but the none in single-celled organisms. The high number of precise molecular mechanism of CRC is not fully TRIM members in humans indicates that it is a rapidly understood. Therefore, clarifying its pathogenesis and evolving family [3]. Members of the TRIM protein identifying novel molecular biomarkers to improve family are involved in many biological processes the diagnosis and prognosis of patients with CRC are including proliferation, differentiation, development, urgently required [2]. autophagy, and apoptosis of cancer cells [4-8]. In The tripartite motif (TRIM) family is a large class recent years, various studies have associated several http://www.jcancer.org Journal of Cancer 2020, Vol. 11 6026 TRIM family members, TRIM15, TRIM27 and pairs of human CRC tissues and adjacent normal TRIM29, with CRC through AKT or JAK2/STAT3 tissues were collected from the First Hospital of Hebei signaling to regulate CRC cell migration and Medical University (Shijiazhuang, Hebei, China). All epithelial–mesenchymal transition [9-11]. patients were without any therapeutic invention and TRIM67, a TRIM family member, is a had signed informed consent prior to surgery. All protein-coding gene located at 1q42.2 consisting of cancer tissues were histologically confirmed as approximately 59 kb DNA bases that encodes TRIM67 colorectal adenocarcinoma or mucinous carcinoma (84 kDa) [12]. To our knowledge, TRIM67 has been and were immediately preserved in liquid nitrogen reported to be involved in neuroprotective effects and within 5 min following resection and then placed at tumor processes. Nicholas P. Boyer et al. [13] found −80°C for long-term preservation. that TRIM67 is necessary for appropriate brain development and behavior. TRIM67 is also associated DNA methylation assay with ubiquitination and interacts with PRG-1 and Genomic DNA (gDNA) was extracted from 10 80K-H to regulate the RAS signaling pathway to pairs of human CRC tissues and adjacent normal inhibit cell proliferation and enhance synapse tissues using the DNeasy Blood and Tissue Kit production in neuroblastoma [14]. Le Duy Do et al. (Qiagen, Valencia, CA, USA) according to the [15] found that autoantibodies against TRIM67 manufacturer's protocol. DNA quality assessment and appeared to be specific biomarkers of paraneoplastic quantification were performed using the NanoDrop cerebellar degeneration and associated with lung 1000 (Thermo Scientific). Bisulphite conversion was carcinoma. A recent study implicated that TRIM67 performed according to the manufacturer’s activates the NF-κB pathway and promotes cell recommendations for the Illumina Infinium Assay apoptosis in GA-13315-treated lung cancer cells [16]. (EZ DNA methylation kit, ZYMO, Orange, CA). The Our previous study found that in The Cancer Genome converted and amplified gDNA fragment was used Atlas (TCGA), TRIM67 is frequently methylated in for hybridization with the 15-mers specific capture CRC compared with adjacent normal tissues, and probe (Table 2) according to the Illumina Infinium HD prevents intestinal tumorigenesis in mice and methylation protocol for genomic facilities improves chemotherapy efficacy by activating the (Novogene, Beijing, China). The nucleotide substrates TRIM67–p53 axis [17]. In the present study, TRIM67 (A/T and C/G) were labeled by different fluorescent expression levels and clinicopathological features dyes and only the probe with complementary binding based on TCGA dataset and our cohort was further of gDNA could be single base extended. Finally, iScan examined. We also investigated the direct functions of software was used to read and output the methylation TRIM67 in CRC cells and studied its potential level results according to the fluorescence. mechanisms as a tumor suppressor in CRC. Cell culture and transfection Materials and Methods Human CRC cell lines HCT116, SW480, LoVo, SW620, SW1116, Caco2, SW1463, and HT29 cell lines TCGA data download and analysis were obtained from Prof. Jun Yu (The Chinese mRNA sequencing data of 647 CRC tissues and University of Hong Kong, Hong Kong, China). 51 normal tissues was downloaded from TCGA HCT116 and HT29 were cultured in McCoy’s 5A (https://tcga-data.nci.nih.gov/), and data for the medium (Gibco, Grand Island, NY, USA) and the mRNA expression of 19,640 genes were obtained. other cells lines were cultured in DMEM medium Immunohistochemistry (IHC) data based on TCGA (Gibco), supplemented with 10% fetal bovine serum was downloaded from The Human Protein Atlas (FBS; Gibco) and 1% penicillin-streptomycin (https://www.proteinatlas.org/). The staining (Invitrogen, Carlsbad, CA, USA) in a 37°C humidified intensity was scored as negative (0), weak (1), incubator with 95% air and 5% CO2. moderate (2), or strong (3). The staining quantity was PLV-TRIM67-shRNA and negative control scored as 1 (≤10%), 2 (11%–50%), 3 (51%–75%), or 4 plasmids were obtained from Prof. Jun Yu. (>75%). The total immunostaining score was M98-TRIM67, M98-MAPK11, siMAPK11, and negative calculated by multiplying the staining intensity score control plasmids were purchased from GeneCopoeia with the quantity and ranged from 0 to 12 [18]. (Guangzhou, China). The plasmids were transfected into CRC cells using Lipofectamine 2000 (Invitrogen) Patients and tissue specimens according to the manufacturer’s protocol. The present study was approved by the Ethics Committee of The First Hospital of Hebei Medical University (No. 2016004) and was in accordance with the principles of Declaration of Helsinki. A total of 60 http://www.jcancer.org Journal of Cancer 2020, Vol. 11 6027 Reverse transcription-quantitative polymerase colony formation assay, transfected cells were seeded chain reaction (RT-qPCR analysis) into 10-cm plates. The visible colonies were fixed with Total RNA was extracted from frozen tissues and 4% formaldehyde and stained with crystal violet after cells using TRIzol® reagent (Invitrogen) according to 12 days. Colonies containing more than 50 cells were the manufacturer’s protocol. cDNA was produced counted and each condition was performed in from the RNA by performing reverse transcription triplicate. using a PrimeScript™ RT Reagent Kit (Perfect Real
Load more

Recommended publications
  • Integrative Genomic and Epigenomic Analyses Identified IRAK1 As a Novel Target for Chronic Inflammation-Driven Prostate Tumorigenesis
    bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.447920; this version posted June 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Integrative genomic and epigenomic analyses identified IRAK1 as a novel target for chronic inflammation-driven prostate tumorigenesis Saheed Oluwasina Oseni1,*, Olayinka Adebayo2, Adeyinka Adebayo3, Alexander Kwakye4, Mirjana Pavlovic5, Waseem Asghar5, James Hartmann1, Gregg B. Fields6, and James Kumi-Diaka1 Affiliations 1 Department of Biological Sciences, Florida Atlantic University, Florida, USA 2 Morehouse School of Medicine, Atlanta, Georgia, USA 3 Georgia Institute of Technology, Atlanta, Georgia, USA 4 College of Medicine, Florida Atlantic University, Florida, USA 5 Department of Computer and Electrical Engineering, Florida Atlantic University, Florida, USA 6 Department of Chemistry & Biochemistry and I-HEALTH, Florida Atlantic University, Florida, USA Corresponding Author: [email protected] (S.O.O) Running Title: Chronic inflammation signaling in prostate tumorigenesis bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.447920; this version posted June 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract The impacts of many inflammatory genes in prostate tumorigenesis remain understudied despite the increasing evidence that associates chronic inflammation with prostate cancer (PCa) initiation, progression, and therapy resistance.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Anti-SEK1 / MKK4 Phospho (Ser80) Antibody (ARG51673)
    Product datasheet [email protected] ARG51673 Package: 100 μl, 50 μl anti-SEK1 / MKK4 phospho (Ser80) antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes SEK1 / MKK4 phospho (Ser80) Tested Reactivity Hu, Ms, Rat Tested Application ICC/IF, IHC-P, WB Host Rabbit Clonality Polyclonal Isotype IgG Target Name SEK1 / MKK4 Antigen Species Human Immunogen Peptide sequence around phosphorylation site of serine 80 (T-H-S(p)-I-E) derived from Human SEK1/MKK4. Conjugation Un-conjugated Alternate Names MEK 4; MAPK/ERK kinase 4; PRKMK4; SAPKK-1; SAPK/ERK kinase 1; SKK1; JNK-activating kinase 1; EC 2.7.12.2; MEK4; MAP kinase kinase 4; c-Jun N-terminal kinase kinase 1; SEK1; SAPKK1; MAPKK4; Stress- activated protein kinase kinase 1; JNKK1; MKK4; SERK1; SAPK kinase 1; Dual specificity mitogen- activated protein kinase kinase 4; JNKK; MAPKK 4 Application Instructions Application table Application Dilution ICC/IF 1:100 - 1:200 IHC-P 1:50 - 1:100 WB 1:500 - 1:1000 Application Note * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Calculated Mw 44 kDa Properties Form Liquid Purification Antibodies were produced by immunizing rabbits with KLH-conjugated synthetic phosphopeptide. Antibodies were purified by affinity-chromatography using epitope-specific phosphopeptide. In addition, non-phospho specific antibodies were removed by chromatogramphy using non- phosphopeptide. Buffer PBS (without Mg2+ and Ca2+, pH 7.4), 150mM NaCl, 0.02% Sodium azide and 50% Glycerol. Preservative 0.02% Sodium azide Stabilizer 50% Glycerol www.arigobio.com 1/3 Concentration 1 mg/ml Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Supplementary Material DNA Methylation in Inflammatory Pathways Modifies the Association Between BMI and Adult-Onset Non- Atopic
    Supplementary Material DNA Methylation in Inflammatory Pathways Modifies the Association between BMI and Adult-Onset Non- Atopic Asthma Ayoung Jeong 1,2, Medea Imboden 1,2, Akram Ghantous 3, Alexei Novoloaca 3, Anne-Elie Carsin 4,5,6, Manolis Kogevinas 4,5,6, Christian Schindler 1,2, Gianfranco Lovison 7, Zdenko Herceg 3, Cyrille Cuenin 3, Roel Vermeulen 8, Deborah Jarvis 9, André F. S. Amaral 9, Florian Kronenberg 10, Paolo Vineis 11,12 and Nicole Probst-Hensch 1,2,* 1 Swiss Tropical and Public Health Institute, 4051 Basel, Switzerland; [email protected] (A.J.); [email protected] (M.I.); [email protected] (C.S.) 2 Department of Public Health, University of Basel, 4001 Basel, Switzerland 3 International Agency for Research on Cancer, 69372 Lyon, France; [email protected] (A.G.); [email protected] (A.N.); [email protected] (Z.H.); [email protected] (C.C.) 4 ISGlobal, Barcelona Institute for Global Health, 08003 Barcelona, Spain; [email protected] (A.-E.C.); [email protected] (M.K.) 5 Universitat Pompeu Fabra (UPF), 08002 Barcelona, Spain 6 CIBER Epidemiología y Salud Pública (CIBERESP), 08005 Barcelona, Spain 7 Department of Economics, Business and Statistics, University of Palermo, 90128 Palermo, Italy; [email protected] 8 Environmental Epidemiology Division, Utrecht University, Institute for Risk Assessment Sciences, 3584CM Utrecht, Netherlands; [email protected] 9 Population Health and Occupational Disease, National Heart and Lung Institute, Imperial College, SW3 6LR London, UK; [email protected] (D.J.); [email protected] (A.F.S.A.) 10 Division of Genetic Epidemiology, Medical University of Innsbruck, 6020 Innsbruck, Austria; [email protected] 11 MRC-PHE Centre for Environment and Health, School of Public Health, Imperial College London, W2 1PG London, UK; [email protected] 12 Italian Institute for Genomic Medicine (IIGM), 10126 Turin, Italy * Correspondence: [email protected]; Tel.: +41-61-284-8378 Int.
    [Show full text]
  • Deep Multiomics Profiling of Brain Tumors Identifies Signaling Networks
    ARTICLE https://doi.org/10.1038/s41467-019-11661-4 OPEN Deep multiomics profiling of brain tumors identifies signaling networks downstream of cancer driver genes Hong Wang 1,2,3, Alexander K. Diaz3,4, Timothy I. Shaw2,5, Yuxin Li1,2,4, Mingming Niu1,4, Ji-Hoon Cho2, Barbara S. Paugh4, Yang Zhang6, Jeffrey Sifford1,4, Bing Bai1,4,10, Zhiping Wu1,4, Haiyan Tan2, Suiping Zhou2, Laura D. Hover4, Heather S. Tillman 7, Abbas Shirinifard8, Suresh Thiagarajan9, Andras Sablauer 8, Vishwajeeth Pagala2, Anthony A. High2, Xusheng Wang 2, Chunliang Li 6, Suzanne J. Baker4 & Junmin Peng 1,2,4 1234567890():,; High throughput omics approaches provide an unprecedented opportunity for dissecting molecular mechanisms in cancer biology. Here we present deep profiling of whole proteome, phosphoproteome and transcriptome in two high-grade glioma (HGG) mouse models driven by mutated RTK oncogenes, PDGFRA and NTRK1, analyzing 13,860 proteins and 30,431 phosphosites by mass spectrometry. Systems biology approaches identify numerous master regulators, including 41 kinases and 23 transcription factors. Pathway activity computation and mouse survival indicate the NTRK1 mutation induces a higher activation of AKT down- stream targets including MYC and JUN, drives a positive feedback loop to up-regulate multiple other RTKs, and confers higher oncogenic potency than the PDGFRA mutation. A mini-gRNA library CRISPR-Cas9 validation screening shows 56% of tested master regulators are important for the viability of NTRK-driven HGG cells, including TFs (Myc and Jun) and metabolic kinases (AMPKa1 and AMPKa2), confirming the validity of the multiomics inte- grative approaches, and providing novel tumor vulnerabilities.
    [Show full text]
  • Visnagin—A New Protectant Against Doxorubicin Cardiotoxicity? Inhibition of Mitochondrial Malate Dehydrogenase 2 (MDH2) and Beyond
    Editorial Page 1 of 5 Visnagin—a new protectant against doxorubicin cardiotoxicity? Inhibition of mitochondrial malate dehydrogenase 2 (MDH2) and beyond Lei Xi Pauley Heart Center, Division of Cardiology, Virginia Commonwealth University, Richmond, VA 23298-0204, USA Correspondence to: Lei Xi, MD, FAHA. Associate Professor, Division of Cardiology, Box 980204, Virginia Commonwealth University, 1101 East Marshall Street, Room 7-020C, Richmond, VA 23298-0204, USA. Email: [email protected]. Submitted Oct 08, 2015. Accepted for publication Oct 13, 2015. doi: 10.3978/j.issn.2305-5839.2015.10.43 View this article at: http://dx.doi.org/10.3978/j.issn.2305-5839.2015.10.43 Doxorubicin (DOX) is a broad-spectrum and potent with excessive ROS generation in mitochondria (12,13). anthracycline antibiotic that has been widely used since Due to the complex multi-factorial cellular and 1960s as a chemotherapeutic agent to treat a variety of molecular drivers underlying DOX cardiotoxicity, the human cancers (1). Despite its superior anti-cancer efficacy, optimal therapeutic approaches for protection against the clinical use of DOX is often limited by dose-dependent DOX cardiotoxicity have not yet been identified, despite cardiotoxicity, which may lead to irreversible dilated over 40 years of extensive research. Notably Herman et al. cardiomyopathy and congestive heart failure (2,3). Currently in 1972 first introduced bisdioxopiperazine compound as predominant theories for explaining DOX cardiotoxicity a cardioprotective agent against DOX cardiotoxicity (14). include the DOX-induced increase of oxidative stress in The subsequent research in this area led to identification cardiomyocytes (4), alteration of mitochondrial energetics of dexrazoxane, the only drug currently approved by the (5,6), and direct effect on DNA.
    [Show full text]
  • Identification of Differentially Expressed Genes in Human Bladder Cancer Through Genome-Wide Gene Expression Profiling
    521-531 24/7/06 18:28 Page 521 ONCOLOGY REPORTS 16: 521-531, 2006 521 Identification of differentially expressed genes in human bladder cancer through genome-wide gene expression profiling KAZUMORI KAWAKAMI1,3, HIDEKI ENOKIDA1, TOKUSHI TACHIWADA1, TAKENARI GOTANDA1, KENGO TSUNEYOSHI1, HIROYUKI KUBO1, KENRYU NISHIYAMA1, MASAKI TAKIGUCHI2, MASAYUKI NAKAGAWA1 and NAOHIKO SEKI3 1Department of Urology, Graduate School of Medical and Dental Sciences, Kagoshima University, 8-35-1 Sakuragaoka, Kagoshima 890-8520; Departments of 2Biochemistry and Genetics, and 3Functional Genomics, Graduate School of Medicine, Chiba University, 1-8-1 Inohana, Chuo-ku, Chiba 260-8670, Japan Received February 15, 2006; Accepted April 27, 2006 Abstract. Large-scale gene expression profiling is an effective CKS2 gene not only as a potential biomarker for diagnosing, strategy for understanding the progression of bladder cancer but also for staging human BC. This is the first report (BC). The aim of this study was to identify genes that are demonstrating that CKS2 expression is strongly correlated expressed differently in the course of BC progression and to with the progression of human BC. establish new biomarkers for BC. Specimens from 21 patients with pathologically confirmed superficial (n=10) or Introduction invasive (n=11) BC and 4 normal bladder samples were studied; samples from 14 of the 21 BC samples were subjected Bladder cancer (BC) is among the 5 most common to microarray analysis. The validity of the microarray results malignancies worldwide, and the 2nd most common tumor of was verified by real-time RT-PCR. Of the 136 up-regulated the genitourinary tract and the 2nd most common cause of genes we detected, 21 were present in all 14 BCs examined death in patients with cancer of the urinary tract (1-7).
    [Show full text]
  • Role of MDH2 Pathogenic Variant in Pheochromocytoma and Paraganglioma Patients
    ARTICLE © American College of Medical Genetics and Genomics Role of MDH2 pathogenic variant in pheochromocytoma and paraganglioma patients Bruna Calsina, MSc, Mercedes Robledo, PhD et al.# Purpose: MDH2 (malate dehydrogenase 2) has recently been variant (c.429+1G>T). All were germline and those with available proposed as a novel potential pheochromocytoma/paraganglioma biochemical data, corresponded to noradrenergic PPGL. (PPGL) susceptibility gene, but its role in the disease has not been MDH2 MDH2 Conclusion: This study suggests that pathogenic variants addressed. This study aimed to determine the prevalence of may play a role in PPGL susceptibility and that they might be pathogenic variants among PPGL patients and determine the responsible for less than 1% of PPGLs in patients without associated phenotype. pathogenic variants in other major PPGL driver genes, a prevalence Methods: Eight hundred thirty patients with PPGLs, negative for similar to the one recently described for other PPGL genes. the main PPGL driver genes, were included in the study. However, more epidemiological data are needed to recommend Interpretation of variants of unknown significance (VUS) was MDH2 testing in patients negative for other major PPGL genes. performed using an algorithm based on 20 computational predictions, by implementing cell-based enzymatic and immuno- Genetics in Medicine (2018) 20:1652–1662; https://doi.org/10.1038/ fluorescence assays, and/or by using a molecular dynamics s41436-018-0068-7 simulation approach. Results: Five variants with potential
    [Show full text]
  • Gene Number in Species of Astereae That Have Different Chromosome Numbers (Plant Evolution/Isozymes/Aneuploidy/Compositae) L
    Proc. Nati. Acad. Sci. USA Vol. 78, No. 6, pp. 3726-3729, June 1981 Evolution Gene number in species of Astereae that have different chromosome numbers (plant evolution/isozymes/aneuploidy/Compositae) L. D. GOTTLIEB Department of Genetics, University of California, Davis, California 95616 Communicated by P. H. Raven, February 18, 1981 ABSTRACT Differencesin the gameticchromosome numbers MATERIALS AND METHODS (n = 4, 5, 9) ofspecies.in the Astereae tribe ofthe Compositae have Seven species were examined: Machaeranthera tenuis, n = 4 been variously .interpreted. One hypothesis proposes that n = 9 (Jackson 7607, Ft. Davis, TX); M. mexicana, n = 4 (Jackson was the original base number ofthe group and that the lower num- bers resulted from aneuploid reduction. The alternative hypoth- 7547, 57 miles west of Durango, Mexico); M. boltoniae, n = 4 esis asserts that the ancestral base number was n = 4 or n = 5 and (Jackson 7551, 27 miles north of Durango, Mexico); M. turneri that species in which n = 9 are allotetraploids derived by hybrid- n = 5 (Jackson 7564, Meoqui, Chihauhua, Mexico); M. brevi- ization between taxa with the lower numbers. Electrophoretic lingulata, n = 9 (Jackson 7526, Aguascalientes, Mexico); Aster analysis of 17 enzyme systems' in.five species of Machaeranthera, riparius, n = 5 Jackson 'Lordsburg, NM, and Jackson 7550, 27 in which n = 4, 5, and 9, and two species of Aster in which n = miles north of Durango, Mexico); Aster hydrophilus, n = 9 5 and 9,-demonstrates that all of these species have the same num- (Jackson 7640, Beatty NV). The seeds were generously provided ber of gene loci specifying the tested enzymes.
    [Show full text]
  • P38β - MAPK11 and Its Role in Female Cancers Periklis Katopodis1,2* , Rachel Kerslake1 , Athanasios Zikopoulos3, Nefeli Beri4 and Vladimir Anikin2,5
    Katopodis et al. Journal of Ovarian Research (2021) 14:84 https://doi.org/10.1186/s13048-021-00834-9 RESEARCH Open Access p38β - MAPK11 and its role in female cancers Periklis Katopodis1,2* , Rachel Kerslake1 , Athanasios Zikopoulos3, Nefeli Beri4 and Vladimir Anikin2,5 Abstract Background: The p38MAPK family of Mitogen Activated Protein Kinases are a group of signalling molecules involved in cell growth, survival, proliferation and differentiation. The widely studied p38α isoform is ubiquitously expressed and is implicated in a number of cancer pathologies, as are p38γ and p38δ. However, the mechanistic role of the isoform, p38β, remains fairly elusive. Recent studies suggest a possible role of p38β in both breast and endometrial cancer with research suggesting involvement in bone metastasis and cancer cell survival. Female tissue specific cancers such as breast, endometrial, uterine and ovary account for over 3,000,000 cancer related incidents annually; advancements in therapeutics and treatment however require a deeper understanding of the molecular aetiology associated with these diseases. This study provides an overview of the MAPK signalling molecule p38β (MAPK11) in female cancers using an in-silico approach. Methods: A detailed gene expression and methylation analysis was performed using datasets from cBioportal, CanSar and MEXPRESS. Breast, Uterine Endometrial, Cervical, Ovarian and Uterine Carcinosarcoma TCGA cancer datasets were used and analysed. Results: Data using cBioportal and CanSAR suggest that expression of p38β is lower in cancers: BRCA, UCEC, UCS, CESC and OV compared to normal tissue. Methylation data from SMART and MEXPRESS indicate significant probe level variation of CpG island methylation status of the gene MAPK11.
    [Show full text]
  • Expression in Stromal Cells Within the Microenvironment of T and NK Cell Lymphomas: Association with Tumor Dormancy and Activation
    pISSN 1598-2998, eISSN 2005-9256 Cancer Res Treat. 2020;52(4):1273-1282 https://doi.org/10.4143/crt.2020.032 Original Article Open Access Forkhead Box C1 (FOXC1) Expression in Stromal Cells within the Microenvironment of T and NK Cell Lymphomas: Association with Tumor Dormancy and Activation Ji Hae Nahm, MD, PhD Purpose Woo Ick Yang, MD, PhD Forkhead box C1 (FOXC1) is critical for maintaining bone marrow microenvironments dur- Sun Och Yoon, MD, PhD ing hematopoiesis, but its role in hematological malignancies remains obscure. Here, we investigated whether FOXC1 regulates tumor dormancy and activation in the microenviron- ments of T and natural killer (NK) cell lymphomas. Materials and Methods One hundred and twenty cases of T and NK cell lymphomas were included; the immu- nohistochemical expression of FOXC1 was investigated in stromal cells, and numbers of FOXC1+ stromal cells were counted. Furthermore, the expression of phosphorylated p38 Department of Pathology, (p-p38) and phosphorylated ERK1/2 (p-ERK1/2) in tumor cells was investigated using Severance Hospital, Yonsei University immunohistochemistry. College of Medicine, Seoul, Korea Results FOXC1 was variably expressed in C-X-C motif chemokine 12–associated reticular stromal cells, histiocytes, (myo)fibroblasts, and endothelial cells. The phenotypes of cases were categorized as dormant (high p-p38/low p-ERK1/2; n=30, 25.0%), active (high p-ERK1/2/ low p-p38; n=25, 20.8%), or intermediate (others; n=65, 54.2%). Lower FOXC1+ stromal cell infiltration was associated with the dormant phenotype, the precursor T lymphoblastic + + + + + + + + + + + + + + + + + + + + + leukemia/lymphoma subtype, and inferior overall survival rates, whereas higher FOXC1 Correspondence: Sun Och Yoon, MD, PhD stromal cell infiltration was associated with the active phenotype and favorable patient + Department + + + + + of + Pathology, + + + + Severance+ + + + +Hospital, + + + + + + + + + + + + + + + + + + + + + + + + prognosis (p < 0.05 for all).
    [Show full text]