DOCSLIB.ORG

P38β - MAPK11 and Its Role in Female Cancers Periklis Katopodis1,2* , Rachel Kerslake1 , Athanasios Zikopoulos3, Nefeli Beri4 and Vladimir Anikin2,5

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
P38β - MAPK11 and Its Role in Female Cancers Periklis Katopodis1,2* , Rachel Kerslake1 , Athanasios Zikopoulos3, Nefeli Beri4 and Vladimir Anikin2,5 Katopodis et al. Journal of Ovarian Research (2021) 14:84 https://doi.org/10.1186/s13048-021-00834-9 RESEARCH Open Access p38β - MAPK11 and its role in female cancers Periklis Katopodis1,2* , Rachel Kerslake1 , Athanasios Zikopoulos3, Nefeli Beri4 and Vladimir Anikin2,5 Abstract Background: The p38MAPK family of Mitogen Activated Protein Kinases are a group of signalling molecules involved in cell growth, survival, proliferation and differentiation. The widely studied p38α isoform is ubiquitously expressed and is implicated in a number of cancer pathologies, as are p38γ and p38δ. However, the mechanistic role of the isoform, p38β, remains fairly elusive. Recent studies suggest a possible role of p38β in both breast and endometrial cancer with research suggesting involvement in bone metastasis and cancer cell survival. Female tissue specific cancers such as breast, endometrial, uterine and ovary account for over 3,000,000 cancer related incidents annually; advancements in therapeutics and treatment however require a deeper understanding of the molecular aetiology associated with these diseases. This study provides an overview of the MAPK signalling molecule p38β (MAPK11) in female cancers using an in-silico approach. Methods: A detailed gene expression and methylation analysis was performed using datasets from cBioportal, CanSar and MEXPRESS. Breast, Uterine Endometrial, Cervical, Ovarian and Uterine Carcinosarcoma TCGA cancer datasets were used and analysed. Results: Data using cBioportal and CanSAR suggest that expression of p38β is lower in cancers: BRCA, UCEC, UCS, CESC and OV compared to normal tissue. Methylation data from SMART and MEXPRESS indicate significant probe level variation of CpG island methylation status of the gene MAPK11. Analysis of the genes’ two CpG islands shows that the gene was hypermethylated in the CpG1 with increased methylation seen in BRCA, CESC and UCEC cancer data sets with a slight increase of expression recorded in cancer samples. CpG2 exhibited hypomethylation with no significant difference between samples and high levels of expression. Further analysis from MEXPRESS revealed no significance between probe methylation and altered levels of expression. In addition, no difference in the expression of BRCA oestrogen/progesterone/HER2 status was seen. Conclusion: This data provides an overview of the expression of p38β in female tissue specific cancers, showing a decrease in expression of the gene in BRCA, UCEC, CESC, UCS and OV, increasing the understanding of p38β MAPK expression and offering insight for future in-vitro investigation and therapeutic application. Keywords: MAPK11, MAPK, Female cancers, Breast cancer, Ovarian cancer, Cervical cancer, Uterine carcinosarcoma, Meexress, Smartapp, Cbioportal, canSar, Methylation, p38β, Pan-cancer * Correspondence: [email protected] 1Biosciences, College of Health and Life Sciences, Brunel University London, Uxbridge, UK 2Division of Thoracic Surgery, The Royal Brompton & Harefield NHS Foundation Trust, Harefield Hospital, London UB9 6JH, UK Full list of author information is available at the end of the article © The Author(s). 2021 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data. Katopodis et al. Journal of Ovarian Research (2021) 14:84 Page 2 of 12 Introduction as signalling molecules such as the Mitogen Activated The establishment of cancer as one of the leading causes Protein Kinase (MAPK) family kinase proteins [11]. of morbidity and mortality globally is widely accepted, yet the complexity of molecular processes that contrib- MAPKs ute to the development and progression of the numer- Mitogen activated protein kinases (MAPKs) play vital ous subsets of cancer continues to plague researchers. roles in signalling transduction pathways and ability to Of the 18.1 million incidences of cancer worldwide in control intracellular processes such as cell survival, dif- 2018 over 20% of cases are thought to be female repro- ferentiation, proliferation and apoptosis, via the sequen- ductive tissue specific [1]. The most frequently diag- tial phosphorylation of substrate protein Ser/Thr kinase nosed type of female specific cancers is breast cancer protein cascades. The three-tiered activation structure with 2,088,849 cases recorded in 2018, around only 1% consists of the activation of a MAPK Kinase Kinase of which are male [2]. Cervical cancer is the most fre- (MAP 3 K) followed by the phosphorylation of a MAPK quently diagnosed of the gynaecological cancers, with Kinase leading to the dual phosphorylation of MAPK 569,847 cases diagnosed annually followed by endomet- proteins [12]. The conventional subfamilies of MAPK in- rial and uterine with 382,069 cases; ovarian is the least clude: the extracellular signal regulated kinase (ERK) common yet deadliest with 295,414 cases diagnosed glo- proteins, ERK1/2 and ERK5 along with the stress acti- bally each year and over 184,779 deaths [1]. vated Jun amino-terminal kinases (JNK) as well as the Knowledge regarding associated risk factors such as stress activated p38MAPK proteins (Fig. 1)[12, 13]. diet, weight, heritability, and menopausal status along with global health initiatives, routine cervical screening, p38β and breast imaging, have led to earlier detection of both The p38MAPK family is comprised of four homologous cervical and breast cancer [3, 4]. However, recurrence proteins: p38α, p38β, p38δ and p38γ and is involved in and mortality rates are still troublesome. Gynaecological the integration of biochemical signals in response to en- cancers such as uterine and endometrial are also often vironmental stresses as well as reactive oxygen species detected at early to mid-stages with treatment for female (ROS) and inflammatory cytokines [14, 15]. The reproductive tissue cancers often involving surgical pro- p38MAPK family has been implicated in a number of cedures such as complete or partial mastectomy (breast) cancer pathologies. p38α is the most widely studied of or hysterectomy [5]. Ovarian cancer, however, is more the isoforms and is ubiquitously expressed along with frequently diagnosed at an advanced stage owing to the p38β, of which it shares around 75% homology, whereas ambiguous nature of symptoms related to many gynae- p38δ and p38γ are differentially expressed throughout cological disorders [6]. Despite comprising the lowest the tissues [16]. number of gynaecological cases, ovarian cancer is the Over the last few decades, evidence implicating regula- deadliest of gynaecological malignancies with five-year tion of p38 with processes involved in cancer such as survival less than 26% for those diagnosed with advanced epithelial-mesenchymal transition, migration, invasion, serous ovarian cancer [7]. Notwithstanding the contin- and survival has grown. Until recently, investigation of ued advancements in detection and treatments of cancer p38 had primarily focused on the biomarker p38α, how- many of the molecular mechanisms implicated in the de- ever mounting evidence also suggests roles for p38β and velopment, progression and resistance related recurrence the other isoforms [17–20]. of female reproductive tissue specific cancers require p38β is encoded by 12 exons of the gene MAPK11 that further investigation [8]. lie on chromosome 22 at the position 22:55,263,713-50, Of the multitude of risk factors associated with the de- 270,380 (UCSC genome browser/GRCh38/hg38). It is velopment of cancer, hormone dysregulation is substan- comprised of 364 amino acids and contains a kinase do- tial in breast, with the onset of menopause lowering the main comprised of a T-G-Y dual phosphorylation motif risk of breast cancer while prolonged exposure to en- that enables activity [21]. p38β is expressed in the vast dogenous hormones such as oestrogen as and oestrogen majority the organs and cell types with high expression receptor status presenting an increased risk [9]. In in endothelial cells yet low in those of hematopoietic ori- addition, age, as well as genome instability and mutation gin such as macrophages and monocytes [22]. p38β is are often implicated in the development and progression activated by MKK6 and expressed at a lower basal level of cancer. Heritable mutation of the DNA repair genes while, p38α is activated by MKK3/6 often leading to the BRCA1 and BRCA2 are not only significantly associated past characterisation of p38β as redundant [23]. p38α with breast cancer but are also biomarkers of ovarian expression is crucial for foetal development and its ab- and endometrial cancer [10]. Other notable genes
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Anti-SEK1 / MKK4 Phospho (Ser80) Antibody (ARG51673)
    Product datasheet [email protected] ARG51673 Package: 100 μl, 50 μl anti-SEK1 / MKK4 phospho (Ser80) antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes SEK1 / MKK4 phospho (Ser80) Tested Reactivity Hu, Ms, Rat Tested Application ICC/IF, IHC-P, WB Host Rabbit Clonality Polyclonal Isotype IgG Target Name SEK1 / MKK4 Antigen Species Human Immunogen Peptide sequence around phosphorylation site of serine 80 (T-H-S(p)-I-E) derived from Human SEK1/MKK4. Conjugation Un-conjugated Alternate Names MEK 4; MAPK/ERK kinase 4; PRKMK4; SAPKK-1; SAPK/ERK kinase 1; SKK1; JNK-activating kinase 1; EC 2.7.12.2; MEK4; MAP kinase kinase 4; c-Jun N-terminal kinase kinase 1; SEK1; SAPKK1; MAPKK4; Stress- activated protein kinase kinase 1; JNKK1; MKK4; SERK1; SAPK kinase 1; Dual specificity mitogen- activated protein kinase kinase 4; JNKK; MAPKK 4 Application Instructions Application table Application Dilution ICC/IF 1:100 - 1:200 IHC-P 1:50 - 1:100 WB 1:500 - 1:1000 Application Note * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Calculated Mw 44 kDa Properties Form Liquid Purification Antibodies were produced by immunizing rabbits with KLH-conjugated synthetic phosphopeptide. Antibodies were purified by affinity-chromatography using epitope-specific phosphopeptide. In addition, non-phospho specific antibodies were removed by chromatogramphy using non- phosphopeptide. Buffer PBS (without Mg2+ and Ca2+, pH 7.4), 150mM NaCl, 0.02% Sodium azide and 50% Glycerol. Preservative 0.02% Sodium azide Stabilizer 50% Glycerol www.arigobio.com 1/3 Concentration 1 mg/ml Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week.
    [Show full text]
  • TRIM67 Inhibits Tumor Proliferation and Metastasis by Mediating
    Journal of Cancer 2020, Vol. 11 6025 Ivyspring International Publisher Journal of Cancer 2020; 11(20): 6025-6037. doi: 10.7150/jca.47538 Research Paper TRIM67 inhibits tumor proliferation and metastasis by mediating MAPK11 in Colorectal Cancer Ying Liu1*, Guiqi Wang1*, Xia Jiang1*, Wei Li1, Congjie Zhai1, Fangjian Shang1, Shihao Chen1, Zengren Zhao1 and Weifang Yu2 1. Department of General Surgery, Hebei Key Laboratory of Colorectal Cancer Precision Diagnosis and Treatment, The First Hospital of Hebei Medical University, Donggang Road No.89, Shijiazhuang, Hebei 050031, P.R. China. 2. Department of Endoscopy Center, The First Hospital of Hebei Medical University, Donggang Road No.89, Shijiazhuang, Hebei 050031, P.R. China. *These authors contributed equally to this work. Corresponding authors: Prof. Zengren Zhao or Weifang Yu, The First Hospital of Hebei Medical University, Donggang Road No.89, Shijiazhuang, Hebei 050031, P.R. China; Tel: +86 0311 85917217; E-mail: [email protected] or [email protected]. © The author(s). This is an open access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/). See http://ivyspring.com/terms for full terms and conditions. Received: 2020.04.28; Accepted: 2020.08.04; Published: 2020.08.18 Abstract Purpose: We recently reported that tripartite motif-containing 67 (TRIM67) activates p53 to suppress colorectal cancer (CRC). However, the function and mechanism of TRIM67 in the inhibition of CRC cell proliferation and metastasis remains to be further elucidated. Methods: We detected the expression of TRIM67 in CRC tissues compared with normal tissues and confirmed its relationship with clinicopathological features.
    [Show full text]
  • Supplementary Material DNA Methylation in Inflammatory Pathways Modifies the Association Between BMI and Adult-Onset Non- Atopic
    Supplementary Material DNA Methylation in Inflammatory Pathways Modifies the Association between BMI and Adult-Onset Non- Atopic Asthma Ayoung Jeong 1,2, Medea Imboden 1,2, Akram Ghantous 3, Alexei Novoloaca 3, Anne-Elie Carsin 4,5,6, Manolis Kogevinas 4,5,6, Christian Schindler 1,2, Gianfranco Lovison 7, Zdenko Herceg 3, Cyrille Cuenin 3, Roel Vermeulen 8, Deborah Jarvis 9, André F. S. Amaral 9, Florian Kronenberg 10, Paolo Vineis 11,12 and Nicole Probst-Hensch 1,2,* 1 Swiss Tropical and Public Health Institute, 4051 Basel, Switzerland; [email protected] (A.J.); [email protected] (M.I.); [email protected] (C.S.) 2 Department of Public Health, University of Basel, 4001 Basel, Switzerland 3 International Agency for Research on Cancer, 69372 Lyon, France; [email protected] (A.G.); [email protected] (A.N.); [email protected] (Z.H.); [email protected] (C.C.) 4 ISGlobal, Barcelona Institute for Global Health, 08003 Barcelona, Spain; [email protected] (A.-E.C.); [email protected] (M.K.) 5 Universitat Pompeu Fabra (UPF), 08002 Barcelona, Spain 6 CIBER Epidemiología y Salud Pública (CIBERESP), 08005 Barcelona, Spain 7 Department of Economics, Business and Statistics, University of Palermo, 90128 Palermo, Italy; [email protected] 8 Environmental Epidemiology Division, Utrecht University, Institute for Risk Assessment Sciences, 3584CM Utrecht, Netherlands; [email protected] 9 Population Health and Occupational Disease, National Heart and Lung Institute, Imperial College, SW3 6LR London, UK; [email protected] (D.J.); [email protected] (A.F.S.A.) 10 Division of Genetic Epidemiology, Medical University of Innsbruck, 6020 Innsbruck, Austria; [email protected] 11 MRC-PHE Centre for Environment and Health, School of Public Health, Imperial College London, W2 1PG London, UK; [email protected] 12 Italian Institute for Genomic Medicine (IIGM), 10126 Turin, Italy * Correspondence: [email protected]; Tel.: +41-61-284-8378 Int.
    [Show full text]
  • Deep Multiomics Profiling of Brain Tumors Identifies Signaling Networks
    ARTICLE https://doi.org/10.1038/s41467-019-11661-4 OPEN Deep multiomics profiling of brain tumors identifies signaling networks downstream of cancer driver genes Hong Wang 1,2,3, Alexander K. Diaz3,4, Timothy I. Shaw2,5, Yuxin Li1,2,4, Mingming Niu1,4, Ji-Hoon Cho2, Barbara S. Paugh4, Yang Zhang6, Jeffrey Sifford1,4, Bing Bai1,4,10, Zhiping Wu1,4, Haiyan Tan2, Suiping Zhou2, Laura D. Hover4, Heather S. Tillman 7, Abbas Shirinifard8, Suresh Thiagarajan9, Andras Sablauer 8, Vishwajeeth Pagala2, Anthony A. High2, Xusheng Wang 2, Chunliang Li 6, Suzanne J. Baker4 & Junmin Peng 1,2,4 1234567890():,; High throughput omics approaches provide an unprecedented opportunity for dissecting molecular mechanisms in cancer biology. Here we present deep profiling of whole proteome, phosphoproteome and transcriptome in two high-grade glioma (HGG) mouse models driven by mutated RTK oncogenes, PDGFRA and NTRK1, analyzing 13,860 proteins and 30,431 phosphosites by mass spectrometry. Systems biology approaches identify numerous master regulators, including 41 kinases and 23 transcription factors. Pathway activity computation and mouse survival indicate the NTRK1 mutation induces a higher activation of AKT down- stream targets including MYC and JUN, drives a positive feedback loop to up-regulate multiple other RTKs, and confers higher oncogenic potency than the PDGFRA mutation. A mini-gRNA library CRISPR-Cas9 validation screening shows 56% of tested master regulators are important for the viability of NTRK-driven HGG cells, including TFs (Myc and Jun) and metabolic kinases (AMPKa1 and AMPKa2), confirming the validity of the multiomics inte- grative approaches, and providing novel tumor vulnerabilities.
    [Show full text]
  • Expression in Stromal Cells Within the Microenvironment of T and NK Cell Lymphomas: Association with Tumor Dormancy and Activation
    pISSN 1598-2998, eISSN 2005-9256 Cancer Res Treat. 2020;52(4):1273-1282 https://doi.org/10.4143/crt.2020.032 Original Article Open Access Forkhead Box C1 (FOXC1) Expression in Stromal Cells within the Microenvironment of T and NK Cell Lymphomas: Association with Tumor Dormancy and Activation Ji Hae Nahm, MD, PhD Purpose Woo Ick Yang, MD, PhD Forkhead box C1 (FOXC1) is critical for maintaining bone marrow microenvironments dur- Sun Och Yoon, MD, PhD ing hematopoiesis, but its role in hematological malignancies remains obscure. Here, we investigated whether FOXC1 regulates tumor dormancy and activation in the microenviron- ments of T and natural killer (NK) cell lymphomas. Materials and Methods One hundred and twenty cases of T and NK cell lymphomas were included; the immu- nohistochemical expression of FOXC1 was investigated in stromal cells, and numbers of FOXC1+ stromal cells were counted. Furthermore, the expression of phosphorylated p38 Department of Pathology, (p-p38) and phosphorylated ERK1/2 (p-ERK1/2) in tumor cells was investigated using Severance Hospital, Yonsei University immunohistochemistry. College of Medicine, Seoul, Korea Results FOXC1 was variably expressed in C-X-C motif chemokine 12–associated reticular stromal cells, histiocytes, (myo)fibroblasts, and endothelial cells. The phenotypes of cases were categorized as dormant (high p-p38/low p-ERK1/2; n=30, 25.0%), active (high p-ERK1/2/ low p-p38; n=25, 20.8%), or intermediate (others; n=65, 54.2%). Lower FOXC1+ stromal cell infiltration was associated with the dormant phenotype, the precursor T lymphoblastic + + + + + + + + + + + + + + + + + + + + + leukemia/lymphoma subtype, and inferior overall survival rates, whereas higher FOXC1 Correspondence: Sun Och Yoon, MD, PhD stromal cell infiltration was associated with the active phenotype and favorable patient + Department + + + + + of + Pathology, + + + + Severance+ + + + +Hospital, + + + + + + + + + + + + + + + + + + + + + + + + prognosis (p < 0.05 for all).
    [Show full text]
  • Activation of Diverse Signalling Pathways by Oncogenic PIK3CA Mutations
    ARTICLE Received 14 Feb 2014 | Accepted 12 Aug 2014 | Published 23 Sep 2014 DOI: 10.1038/ncomms5961 Activation of diverse signalling pathways by oncogenic PIK3CA mutations Xinyan Wu1, Santosh Renuse2,3, Nandini A. Sahasrabuddhe2,4, Muhammad Saddiq Zahari1, Raghothama Chaerkady1, Min-Sik Kim1, Raja S. Nirujogi2, Morassa Mohseni1, Praveen Kumar2,4, Rajesh Raju2, Jun Zhong1, Jian Yang5, Johnathan Neiswinger6, Jun-Seop Jeong6, Robert Newman6, Maureen A. Powers7, Babu Lal Somani2, Edward Gabrielson8, Saraswati Sukumar9, Vered Stearns9, Jiang Qian10, Heng Zhu6, Bert Vogelstein5, Ben Ho Park9 & Akhilesh Pandey1,8,9 The PIK3CA gene is frequently mutated in human cancers. Here we carry out a SILAC-based quantitative phosphoproteomic analysis using isogenic knockin cell lines containing ‘driver’ oncogenic mutations of PIK3CA to dissect the signalling mechanisms responsible for oncogenic phenotypes induced by mutant PIK3CA. From 8,075 unique phosphopeptides identified, we observe that aberrant activation of PI3K pathway leads to increased phosphorylation of a surprisingly wide variety of kinases and downstream signalling networks. Here, by integrating phosphoproteomic data with human protein microarray-based AKT1 kinase assays, we discover and validate six novel AKT1 substrates, including cortactin. Through mutagenesis studies, we demonstrate that phosphorylation of cortactin by AKT1 is important for mutant PI3K-enhanced cell migration and invasion. Our study describes a quantitative and global approach for identifying mutation-specific signalling events and for discovering novel signalling molecules as readouts of pathway activation or potential therapeutic targets. 1 McKusick-Nathans Institute of Genetic Medicine and Department of Biological Chemistry, Johns Hopkins University School of Medicine, 733 North Broadway, BRB 527, Baltimore, Maryland 21205, USA.
    [Show full text]
  • Supplementary Data
    Journal of Alzheimer’s Disease 28 (2012) 1–3 1 IOS Press Supplementary Data Neuroinflammation, Hyperphosphorylated Tau, Diffuse Amyloid Plaques, and Down-Regulation of the Cellular Prion Protein in Air Pollution Exposed Children and Young Adults Lilian Calderon-Garcidue´ nas˜ a,b,∗, Michael Kavanaughb, Michelle Blockc, Amedeo D’Angiullid, Ricardo Delgado-Chavez´ e, Ricardo Torres-Jardon´ f , Angelica Gonzalez-Maciel´ a, Rafael Reynoso-Roblesa, Norma Osnayaa, Rodolfo Villarreal-Calderong, Ruixin Guoh, Zhaowei Huah, Hongtu Zhuh, George Perryi and Philippe Diazj aInstituto Nacional de Pediatr´ıa, Mexico City, Mexico bThe Center for Structural and Functional Neurosciences, The University of Montana, Missoula, MT, USA cVirginia Commonwealth University Medical Campus, Richmond, VA, USA dDepartment of Neuroscience, Carleton University, Ottawa, Ontario, Canada ePathology Department, Instituto Nacional de Cancerologia, Mexico City, Mexico f Centro de Ciencias de la Atm´osfera, Universidad Nacional Aut´onoma de Me´xico, Mexico City, Mexico gDavidson Honors College, The University of Montana, Missoula, MT, USA hDepartment of Biostatistics, Gillings School of Global Public Health, University of North Carolina, Chapel Hill, NC, USA iCollege of Sciences, University of Texas at San Antonio, San Antonio, TX, USA jCore Laboratory for Neuromolecular Production, The University of Montana, Missoula, MT, USA Handling Editor: Massimo Tabaton Accepted 17 August 2011 ∗Correspondence to: Lilian Calderon-Garcidue´ nas,˜ MD Ph.D., The Center for Structural and Functional Neuro- sciences, The University of Montana, 32 Campus Drive, 287 Skaggs Building, Missoula, MT 59812, USA. E-mail: [email protected]. ISSN 1387-2877/12/$27.50 © 2012 – IOS Press and the authors. All rights reserved 2 L.
    [Show full text]
  • Establishment of a Temperature-Sensitive Model of Oncogene-Induced Senescence in Angiosarcoma Cells
    cancers Article Establishment of a Temperature-Sensitive Model of Oncogene-Induced Senescence in Angiosarcoma Cells Adilson da Costa 1,2, Michael Y. Bonner 3, Shikha Rao 1, Linda Gilbert 1,4, Maiko Sasaki 4 , Justin Elsey 1, Jamie MacKelfresh 1,5 and Jack L. Arbiser 1,4,6,* 1 Department of Dermatology, Emory University School of Medicine, Atlanta, GA 30322, USA; [email protected] (A.d.C.); [email protected] (S.R.); [email protected] (L.G.); [email protected] (J.E.); [email protected] (J.M.) 2 Department of Post-Graduate Studies, Instituto de Assistência Médica ao Servidor Público Estadual, Sao Paulo 04029-000, SP, Brazil 3 Department of Medical Biochemistry & Biophysics, Karolinska Institutet, 17177 Solna, Sweden; [email protected] 4 Atlanta Veterans Affairs Medical Center, Decatur, GA 30033, USA; [email protected] 5 Department of Pathology, Emory University School of Medicine, Atlanta, GA 30322, USA 6 Winship Cancer Institute of Emory University, Atlanta, GA 30322, USA * Correspondence: [email protected]; Tel.: +1-(404)-727-5063; Fax: +1-(404)-727-0923 Received: 11 December 2019; Accepted: 1 February 2020; Published: 8 February 2020 Abstract: Lesions with driver mutations, including atypical nevi and seborrheic keratoses, are very common in dermatology, and are prone to senescence. The molecular events that prevent senescent lesions from becoming malignant are not well understood. We have developed a model of vascular proliferation using a temperature-sensitive, large T antigen and oncogenic HRas. By elevating the temperature to 39 ◦C, we can turn off large T antigen and study the molecular events in cells with the Ras driver mutation.
    [Show full text]
  • MAPK14 (T106M) [GST-Tagged] Kinase
    MAPK14 (T106M) [GST-tagged] Kinase Alternate Names: Cytokine-Suppressive Anti-inflammatory Drug-Binding Protein 1, CSBP1, SAPK2A, p38-Alpha Cat. No. 66-0035-050 Quantity: 50 µg Lot. No. 30314 Storage: -70˚C FOR RESEARCH USE ONLY NOT FOR USE IN HUMANS CERTIFICATE OF ANALYSIS Page 1 of 2 Background Physical Characteristics Protein ubiquitylation and protein Species: human Protein Sequence: Please see page 2 phosphorylation are the two major mechanisms that regulate the func- Source: E. coli tions of proteins in eukaryotic cells. Quantity: 50 μg However, these different posttrans- lational modifications do not operate Concentration: 3.55 mg/ml independently of one another, but are frequently interlinked to enable bio- Formulation: 50 mM Tris/HCl pH7.5, 0.1 mM EGTA, 150 mM NaCl, 0.1% ß-Mercap- logical processes to be controlled in a toethanol, 270 mM sucrose, 0.03% Brij-35, more complex and sophisticated man- 1 mM Benzamidine, 0.2 mM PMSF ner. Studying how protein phosphory- lation events control the ubiquitin sys- Molecular Weight: ~67.6 kDa tem and how ubiquitylation regulates Purity: >85% by InstantBlue™ SDS-PAGE protein phosphorylation has become a focal point of the study of cell regula- Stability/Storage: 12 months at -70˚C; tion and human disease. MAP kinas- aliquot as required es are serine, threonine, and tyrosine specific protein kinases that regulate proliferation, gene expression, differ- entiation, mitosis, cell survival, and Quality Assurance apoptosis in response to stimuli, such Purity: Protein Identification: as mitogens, osmotic stress, heat 4-12% gradient SDS-PAGE Confirmed by mass spectrometry. shock and pro-inflammatory cytok- InstantBlue™ staining ines.
    [Show full text]
  • PRODUCTS and SERVICES Target List
    PRODUCTS AND SERVICES Target list Kinase Products P.1-11 Kinase Products Biochemical Assays P.12 "QuickScout Screening Assist™ Kits" Kinase Protein Assay Kits P.13 "QuickScout Custom Profiling & Panel Profiling Series" Targets P.14 "QuickScout Custom Profiling Series" Preincubation Targets Cell-Based Assays P.15 NanoBRET™ TE Intracellular Kinase Cell-Based Assay Service Targets P.16 Tyrosine Kinase Ba/F3 Cell-Based Assay Service Targets P.17 Kinase HEK293 Cell-Based Assay Service ～ClariCELL™ ～ Targets P.18 Detection of Protein-Protein Interactions ～ProbeX™～ Stable Cell Lines Crystallization Services P.19 FastLane™ Structures ～Premium～ P.20-21 FastLane™ Structures ～Standard～ Kinase Products For details of products, please see "PRODUCTS AND SERVICES" on page 1～3. Tyrosine Kinases Note: Please contact us for availability or further information. Information may be changed without notice. Expression Protein Kinase Tag Carna Product Name Catalog No. Construct Sequence Accession Number Tag Location System HIS ABL(ABL1) 08-001 Full-length 2-1130 NP_005148.2 N-terminal His Insect (sf21) ABL(ABL1) BTN BTN-ABL(ABL1) 08-401-20N Full-length 2-1130 NP_005148.2 N-terminal DYKDDDDK Insect (sf21) ABL(ABL1) [E255K] HIS ABL(ABL1)[E255K] 08-094 Full-length 2-1130 NP_005148.2 N-terminal His Insect (sf21) HIS ABL(ABL1)[T315I] 08-093 Full-length 2-1130 NP_005148.2 N-terminal His Insect (sf21) ABL(ABL1) [T315I] BTN BTN-ABL(ABL1)[T315I] 08-493-20N Full-length 2-1130 NP_005148.2 N-terminal DYKDDDDK Insect (sf21) ACK(TNK2) GST ACK(TNK2) 08-196 Catalytic domain
    [Show full text]
  • Proteome Profiler™ Human Phospho-MAPK Array
    Proteome Profiler™ Array Human Phospho-MAPK Array Kit Catalog Number ARY002 For the parallel determination of the relative levels of phosphorylation of Mitogen-Activated Protein Kinases (MAPKs) and other serine/threonine kinases. This package insert must be read in its entirety before using this product. FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. TABLE OF CONTENTS Contents Page INTRODUCTION 2 PRINCIPLE OF THE ASSAY . 2 TECHNICAL HINTS AND LIMITATIONS 2 MATERIALS PROVIDED . 3 OTHER MATERIALS REQUIRED 3 SAMPLE PREPARATION . 4 REAGENT PREPARATION 4 ARRAY PROTOCOL. .5 DATA ANALYSIS 6 PROFILING KINASE PHOSPHORYLATION . 7 SPECIFICITY - COMPETITION 9 SPECIFICITY - PATHWAY INHIBITION . 10 APPENDIX 11 MANUFACTURED AND DISTRIBUTED BY: R&D Systems, Inc. TELEPHONE: (800) 343-7475 614 McKinley Place NE (612) 379-2956 Minneapolis, MN 55413 FAX: (612) 656-4400 United States of America E-MAIL: [email protected] DISTRIBUTED BY: R&D Systems Europe, Ltd. 19 Barton Lane TELEPHONE: +44 (0)1235 529449 Abingdon Science Park FAX: +44 (0)1235 533420 Abingdon, OX14 3NB E-MAIL: [email protected] United Kingdom R&D Systems China Co. Ltd. 24A1 Hua Min Empire Plaza TELEPHONE: +86 (21) 52380373 726 West Yan An Road FAX: +86 (21) 52371001 Shanghai PRC 200050 E-MAIL: [email protected] INTRODUCTION Analyzing the phosphorylation status of all three major families of mitogen-activated protein kinases (MAPKs), the extracellular signal-regulated kinases (ERK1/2), c-Jun N-terminal kinases (JNK1 - 3), and different p38 isoforms (a/b/d/g), is essential in understanding the roles these signaling molecules play in mechanisms underlying cell function and disease.
    [Show full text]