DOCSLIB.ORG

BGGN 213 Pathway Analysis and the Interpretation of Gene Lists Lecture 15

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
BGGN 213 Pathway Analysis and the Interpretation of Gene Lists Lecture 15 BGGN 213 Pathway Analysis and the Interpretation of Gene Lists Lecture 15 Barry Grant http://thegrantlab.org/bggn213 Inputs Steps Reads R1 Reads R2 [optional] Control FastQ FastQ 1. Quality Reads R1 Reads R2 Control [optional] FastQC FastQ FastQ Treatment 2. Reference Alignment Genome (Mapping) UCSC Fasta TopHat2 Count Last day’s step Table 4. 3. data.frame Annotation Read Differential Counting expression UCSC GTF Count analysis! CuffLinks Table DESeq2 data.frame Volcano Plot Fold change vs P-value Significant (P < 0.01 & log2 > 2) My high-throughput experiment generated a long list of genes/proteins… What do I do now? Pathway analysis! (a.k.a. geneset enrichment) Use bioinformatics methods to help extract biological meaning from such lists… Inputs Steps Reads R1 Reads R2 [optional] Control FastQ FastQ 1. Quality Reads R1 Reads R2 Control [optional] FastQC 5. Gene set FastQ FastQ enrichment Treatment analysis 2. nalysis! Reference KEGG, GO, … Alignment Genome (Mapping) UCSC Fasta TopHat2 Count Table 4. 3. data.frame Annotation Read Differential Counting expression UCSC GTF Count analysis! CuffLinks Table DESeq2 data.frame Basic idea Differentially Expressed Genes (DEGs) Gene-sets (Pathways, annotations, etc...) Annotate... Basic idea Differentially Expressed Genes (DEGs) Gene-sets (Pathways, annotations, etc...) Annotate... Differentially Pathways Expressed Overlap... Genes (DEGs) Pathway analysis (geneset enrichment) Pathway analysis (a.k.a. geneset enrichment) Principle DEGs Pathway Differentially Pathway Expressed (geneset) Genes (DEGs) Enriched Not enriched • DEGs come from your experiment ➢ Critical, needs to be as clean as possible • Pathway genes (“geneset”) come from annotations ➢ Important, but typically not a competitive advantage • Variations of the math: overlap, ranking, networks... ➢ Not critical, different algorithms show similar performances Side-note: Pathway analysis (a.k.a. geneset enrichment) Limitations • Geneset annotation bias: can only discover what is already known • Non-model organisms: no high-quality genesets available • Post-transcriptional regulation is neglected • Tissue-specific variations of pathways are not annotated • e.g. NF-κB regulates metabolism, not inflammation, in adipocytes • Size bias: stats are influenced by the size of the pathway • Many pathways/receptors converge to few regulators e.g. Tens of innate immune receptors activate four TFs: NF-kB, AP-1, IRF3/7, NFAT Starting point for pathway analysis: Your gene list • You have a list of genes/proteins of interest • You have quantitative data for each gene/protein 228018_at F26A1.8NP_000192 C20orf58 • Fold change 226925_atENSG00000090339 F26A1.8 NP_057219 ACPL2 207113_s_atENSG00000010030 3383F53F8.4 NP_055029 TNF • p-value 225078_atENSG00000141401 51513C09H5.2NP_000585 EMP2 221577_x_atENSG00000206439 3613C09H5.2NP_006125 GDF15 1553997_a_atENSG00000204490 7124F22E10.3NP_689495 ASPHD1 • Spectral counts 218433_atENSG00000206328 757F09F7.8NP_001032249 PANK3 204975_atENSG00000142188 92370C34F11.8NP_078870 EMP2 • Presence/absence 202638_s_atENSG00000155893 79646F07F6.5NP_064515 ICAM1 230954_atENSG00000120137 56892F35B3.4NP_733839 C20orf112 228017_s_atENSG00000176907 124540W08E12.3NP_620412 C20orf58 1554018_atENSG00000153944 253982B0222.10NP_859069 GPNMB 203126_atENSG00000174939 140688C03A7.14NP_542183 IMPA2 225182_atENSG00000197183 NP_00250110457Y40B10A.6 TMEM50B 225079_atENSG00000136235 NP_0010053409518M176.6 EMP2 NP_004855 243010_atENSG00000130513 2013H04M03.2 MSI2 NP_001415 230668_atENSG00000213853 4050C03A7.4 C20orf58 218541_s_atENSG00000204487 NP_033666C03A7.7 C8orf4 224225_s_atENSG00000206437 NP_002332F44F4.4 ETV7 207339_s_atENSG00000206327 F32A5.2 LTB 202637_s_at W03F8.6 ICAM1 Translating between identifiers • Many different identifiers exist for genes and proteins, e.g. UniProt, Entrez, etc. • Often you will have to translate one set of ids into another • A program might only accept certain types of ids • You might have a list of genes with one type of id and info for genes with another type of id Translating between identifiers • Many different identifiers exist for genes and proteins, e.g. UniProt, Entrez, etc. • Often you will have to translate one set of ids into another • A program might only accept certain types of ids • You might have a list of genes with one type of id and info for genes with another type of id • Various web sites translate ids -> best for small lists • UniProt < www.uniprot.org>; IDConverter < idconverter.bioinfo.cnio.es > Translating between identifiers: UniProt < www.uniprot.org > Translating between identifiers • Many different identifiers exist for genes and proteins, e.g. UniProt, Entrez, etc. • Often you will have to translate one set of ids into another • A program might only accept certain types of ids • You might have a list of genes with one type of id and info for genes with another type of id • Various web sites translate ids -> best for small lists • UniProt < www.uniprot.org>; IDConverter < idconverter.bioinfo.cnio.es > • VLOOKUP in Excel - good if you are an excel whizz - I am not! • Download flat file from Entrez, Uniprot, etc; Open in Excel; Find columns that correspond to the 2 IDs you want to convert between; Sort by ID; Use vlookup to translate your list Translating between identifiers: Excel VLOOKUP VLOOKUP(lookup_value, table_array, col_index_num) Translating between identifiers • Many different identifiers exist for genes and proteins, e.g. UniProt, Entrez, etc. • Often you will have to translate one set of ids into another • A program might only accept certain types of ids • You might have a list of genes with one type of id and info for genes with another type of id • Various web sites translate ids -> best for small lists • UniProt < www.uniprot.org >; IDConverter < idconverter.bioinfo.cnio.es > • VLOOKUP in Excel -> good if you are an excel whizz - I am not! • Download flat file from Entrez, Uniprot, etc; Open in Excel; Find columns that correspond to the two ids you want to convert between; Use vlookup to translate your list • Use the merge() or mapIDs() functions in R - fast, versatile & reproducible! • Also clusterProfiler::bitr() function and many others… [Link to clusterProfiler vignette] Reminder Using the merge() function anno <- read.csv("data/annotables_grch38.csv") This is an annotation file merge(mygenes, anno, by.x="row.names", by.y= "ensgene") Using mapIDs() Thisfunction is our from differential bioconductor expressed genes library("AnnotationDbi") library("org.Hs.eg.db") mygenes$symbol <- mapIds( org.Hs.eg.db, keys=row.names(mygenes), column="SYMBOL", keytype="ENSEMBL" ) Reminder Using the merge() function anno <- read.csv("data/annotables_grch38.csv") merge(mygenes, anno, by.x="row.names", by.y= "ensgene") Using mapIDs() function from bioconductor library("AnnotationDbi") library("org.Hs.eg.db") Load the required Bioconductor packages mygenes$symbol <- mapIds( org.Hs.eg.db, Annotation we want to add column="SYMBOL", keys=row.names(mygenes), keytype="ENSEMBL" ) Our vector of gene names & their format Alternative... See package vignette: https://bioconductor.org/packages/release/bioc/html/clusterProfiler.html What functional set databases do you want? Pathway • Most commonly used: DEGs GO KEGG • Gene Ontology (GO) IPA etc.... • KEGG Pathways (mostly metabolic) • GeneGO MetaBase • Ingenuity Pathway Analysis (IPA) • Many others... • Enzyme Classification, PFAM, Reactome, • Disease Ontology, MSigDB, Chemical Entities of Biological Interest, Network of Cancer Genes etc… • See: Open Biomedical Ontologies ( www.obofoundry.org ) GO < www.geneontology.org > • What function does HSF1 perform? • response to heat; sequence-specific DNA binding; transcription; etc • Ontology => a structured and controlled vocabulary that allows us to annotate gene products consistently, interpret the relationships among annotations, and can easily be handled by a computer • GO database consists of 3 ontologies that describe gene products in terms of their associated biological processes, cellular components and molecular functions GO Annotations • GO is not a stand-alone database of genes/proteins or sequences • Rather gene products get annotated with GO terms by UniProt and other organism specific databases, such as Flybase, Wormbase, MGI, ZFIN, etc. • Annotations are available through AmiGO < amigo.geneontology.org > GO is structured as a “directed graph” Relationships (edges) Parent terms are more general & child terms more specific GO Terms (nodes) GO evidence codes Use and misuse of the gene ontology annotations Seung Yon Rhee, Valerie Wood, Kara Dolinski & Sorin Draghici Nature Reviews Genetics 9, 509-515 (2008) • See AmiGO for details: http://amigo.geneontology.org/amigo/base_statistics Can now do gene list analysis with GeneGO online! Another popular online tool: DAVID at NIAID < david.abcc.ncifcrf.gov > DAVID • Functional Annotation Chart Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources Da Wei Huang, Brad T Sherman & Richard A Lempicki Nature Protocols 4, 44 - 57 (2009) Overlapping functional sets • Many functional sets overlap • In particular those from databases that are hierarchical in nature (e.g. GO) • Hierarchy enables: • Annotation flexibility (e.g. allow different degrees of annotation completeness based on what is known) • Computational methods to “understand” function relationships (e.g. ATPase function is a subset of enzyme function) • Unfortunately, this also makes functional profiling trickier • Clustering of functional sets can be helpful in these cases DAVID
Load more

Recommended publications
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name epithelial membrane protein 2 Gene Symbol Emp2 Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. Not Available UniGene ID Rn.21730 Ensembl Gene ID ENSRNOG00000002664 Entrez Gene ID 360468 Assay Information Unique Assay ID qRnoCIP0024746 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSRNOT00000003615 Amplicon Context Sequence CCTGCTGCCTTCGCTGCCCTGTGAACATGTTGGTGATTCTTGCCTTCATCATCGT CTTCCACATCGTGTCTACGGCACTCTTGTTCATTTCAACCATTGACAATGCCTGG TGGGTAGGAGATGGCTTCTCAGCT Amplicon Length (bp) 104 Chromosome Location 10:4276703-4281842 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 99 R2 0.9989 cDNA Cq 20.98 cDNA Tm (Celsius) 82.5 gDNA Cq Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Emp2, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
    [Show full text]
  • (12) United States Patent (10) Patent No.: US 7.873,482 B2 Stefanon Et Al
    US007873482B2 (12) United States Patent (10) Patent No.: US 7.873,482 B2 Stefanon et al. (45) Date of Patent: Jan. 18, 2011 (54) DIAGNOSTIC SYSTEM FOR SELECTING 6,358,546 B1 3/2002 Bebiak et al. NUTRITION AND PHARMACOLOGICAL 6,493,641 B1 12/2002 Singh et al. PRODUCTS FOR ANIMALS 6,537,213 B2 3/2003 Dodds (76) Inventors: Bruno Stefanon, via Zilli, 51/A/3, Martignacco (IT) 33035: W. Jean Dodds, 938 Stanford St., Santa Monica, (Continued) CA (US) 90403 FOREIGN PATENT DOCUMENTS (*) Notice: Subject to any disclaimer, the term of this patent is extended or adjusted under 35 WO WO99-67642 A2 12/1999 U.S.C. 154(b) by 158 days. (21)21) Appl. NoNo.: 12/316,8249 (Continued) (65) Prior Publication Data Swanson, et al., “Nutritional Genomics: Implication for Companion Animals'. The American Society for Nutritional Sciences, (2003).J. US 2010/O15301.6 A1 Jun. 17, 2010 Nutr. 133:3033-3040 (18 pages). (51) Int. Cl. (Continued) G06F 9/00 (2006.01) (52) U.S. Cl. ........................................................ 702/19 Primary Examiner—Edward Raymond (58) Field of Classification Search ................... 702/19 (74) Attorney, Agent, or Firm Greenberg Traurig, LLP 702/23, 182–185 See application file for complete search history. (57) ABSTRACT (56) References Cited An analysis of the profile of a non-human animal comprises: U.S. PATENT DOCUMENTS a) providing a genotypic database to the species of the non 3,995,019 A 1 1/1976 Jerome human animal Subject or a selected group of the species; b) 5,691,157 A 1 1/1997 Gong et al.
    [Show full text]
  • Loss of Epithelial Membrane Protein-2 Expression Confers an Independent Prognosticator in Nasopharyngeal Carcinoma: a Cohort Study
    Open Access Research BMJ Open: first published as 10.1136/bmjopen-2012-000900 on 5 April 2012. Downloaded from Loss of epithelial membrane protein-2 expression confers an independent prognosticator in nasopharyngeal carcinoma: a cohort study Yi-Hsien Chen,1 Li-Ching Wu,2 Wen-Ren Wu,3 Hung-Jung Lin,1 Sung-Wei Lee,4 Ching-Yih Lin,5 Shih-Lun Chang,6 Nan-Haw Chow,7,8 Hsuan-Ying Huang,9 Chien-Feng Li,2,3,10,11 Han-Ping Hsu,12 Yow-Ling Shiue3 To cite: Chen Y-H, Wu L-C, ABSTRACT ARTICLE SUMMARY Wu W-R, et al. Loss of Objective: To evaluate the expression of epithelial epithelial membrane membrane protein-2 (EMP2) protein and its Article focus protein-2 expression confers clinicopathological associations in patients with - an independent Recent studies have suggested that EMP2 plays nasopharyngeal carcinoma. prognosticator in a tumour suppressor role in B cell lymphomas. nasopharyngeal carcinoma: Design: Retrospective population-based cohort study. - Immunoexpression of EMP2 was retrospectively a cohort study. BMJ Open Setting: This study was based on a biobank in Chi-Mei assessed in biopsies of 124 consecutive patients 2012;2:e000900. Medical Center (Tainan, Taiwan) from 1993 to 2002. with nasopharyngeal carcinoma. doi:10.1136/ Participants: Biopsies of 124 consecutive bmjopen-2012-000900 nasopharyngeal carcinoma patients without initial Key messages - Loss of EMP2 expression significantly correlates distant metastasis and treated with consistent < Prepublication history for with advanced primary tumour, nodal status and guidelines were assessed. Immunoexpressions of this paper is available online. AJCC stage. To view these files please EMP2 were analysed and the outcomes were correlated - In multivariate analyses, loss of EMP2 expres- visit the journal online (http:// with clinicopathological features and patient survivals.
    [Show full text]
  • Supplementary Data
    Supplemental figures Supplemental figure 1: Tumor sample selection. A total of 98 thymic tumor specimens were stored in Memorial Sloan-Kettering Cancer Center tumor banks during the study period. 64 cases corresponded to previously untreated tumors, which were resected upfront after diagnosis. Adjuvant treatment was delivered in 7 patients (radiotherapy in 4 cases, cyclophosphamide- doxorubicin-vincristine (CAV) chemotherapy in 3 cases). 34 tumors were resected after induction treatment, consisting of chemotherapy in 16 patients (cyclophosphamide-doxorubicin- cisplatin (CAP) in 11 cases, cisplatin-etoposide (PE) in 3 cases, cisplatin-etoposide-ifosfamide (VIP) in 1 case, and cisplatin-docetaxel in 1 case), in radiotherapy (45 Gy) in 1 patient, and in sequential chemoradiation (CAP followed by a 45 Gy-radiotherapy) in 1 patient. Among these 34 patients, 6 received adjuvant radiotherapy. 1 Supplemental Figure 2: Amino acid alignments of KIT H697 in the human protein and related orthologs, using (A) the Homologene database (exons 14 and 15), and (B) the UCSC Genome Browser database (exon 14). Residue H697 is highlighted with red boxes. Both alignments indicate that residue H697 is highly conserved. 2 Supplemental Figure 3: Direct comparison of the genomic profiles of thymic squamous cell carcinomas (n=7) and lung primary squamous cell carcinomas (n=6). (A) Unsupervised clustering analysis. Gains are indicated in red, and losses in green, by genomic position along the 22 chromosomes. (B) Genomic profiles and recurrent copy number alterations in thymic carcinomas and lung squamous cell carcinomas. Gains are indicated in red, and losses in blue. 3 Supplemental Methods Mutational profiling The exonic regions of interest (NCBI Human Genome Build 36.1) were broken into amplicons of 500 bp or less, and specific primers were designed using Primer 3 (on the World Wide Web for general users and for biologist programmers (see Supplemental Table 2) [1].
    [Show full text]
  • The NIH Catalyst from the Deputy Director for Intramural Research
    — Fostering Communication and Collaboration The nihCatalyst A Publication for NIH Intramural Scientists National Institutes of Health Office of the Director Volume 15 Issue 6 November-Dece.mber i , 2007 Research Festival Research Festival of Age: Getting to the Bottom Coming Tissue Engineering and Regenerative Medicine Of the Beta Cell by Fran Pollner by Julie Wallace or some, the quest is to increase the progenitor pool of pancre- anel chair Rocky F atic beta cells, to derive stem Tuan noted that cells that can be controlled in cul- P this was the NIH ture and serve as replacements for Research Festival’s damaged or lost beta cells; for oth- first dedicated sympo- ers, the quest is for new treatments. sium on tissue engi- neering and regenera- Stem Cell Studies tive medicine, a re- Typically, cul- flection that the field tured human beta is steadily approach- cells do not prolif- ing the threshold of erate well or retain clinical application. the mature pheno- Indeed, applying type, noted Marvin biological and engi- neering principles to Gershengorn, chief Fran Pollner The Re-Generation: (left to right): Pamela Robey, N1DCR; of the Clinical En- Marvin repairing and replac- Cynthia Dunbar, NHLB1; Catherine Kuo, NIAMS; and panel docrinology Branch Gershengorn ing damaged and de- chair Rocky Tuan, NIAMS and scientific director, NIDDK, who stroyed tissues has at- has been exploring the optimization tracted researchers across NIH; scientists adipocytes, and chondrocytes derived of hIPCs (human islet cell-derived from three institutes described their on- from MSCs could indeed be made to precursor cells) for about five years.
    [Show full text]
  • Yale Computational Biology and Bioinformatics Rotation Guide 2020-2021
    Yale Computational Biology and Bioinformatics Rotation Guide 2020-2021 Julien Berro ............................................................................................................................................................3 Cynthia Brandt .......................................................................................................................................................3 Kei-Hoi Cheung .....................................................................................................................................................4 Chris Cotsapas ........................................................................................................................................................4 Richard Flavell .......................................................................................................................................................4 Joel Gelernter .........................................................................................................................................................5 Mark Gerstein .........................................................................................................................................................6 Antonio Giraldez ....................................................................................................................................................7 Jeffrey Gruen ..........................................................................................................................................................8
    [Show full text]
  • Content Based Search in Gene Expression Databases and a Meta-Analysis of Host Responses to Infection
    Content Based Search in Gene Expression Databases and a Meta-analysis of Host Responses to Infection A Thesis Submitted to the Faculty of Drexel University by Francis X. Bell in partial fulfillment of the requirements for the degree of Doctor of Philosophy November 2015 c Copyright 2015 Francis X. Bell. All Rights Reserved. ii Acknowledgments I would like to acknowledge and thank my advisor, Dr. Ahmet Sacan. Without his advice, support, and patience I would not have been able to accomplish all that I have. I would also like to thank my committee members and the Biomed Faculty that have guided me. I would like to give a special thanks for the members of the bioinformatics lab, in particular the members of the Sacan lab: Rehman Qureshi, Daisy Heng Yang, April Chunyu Zhao, and Yiqian Zhou. Thank you for creating a pleasant and friendly environment in the lab. I give the members of my family my sincerest gratitude for all that they have done for me. I cannot begin to repay my parents for their sacrifices. I am eternally grateful for everything they have done. The support of my sisters and their encouragement gave me the strength to persevere to the end. iii Table of Contents LIST OF TABLES.......................................................................... vii LIST OF FIGURES ........................................................................ xiv ABSTRACT ................................................................................ xvii 1. A BRIEF INTRODUCTION TO GENE EXPRESSION............................. 1 1.1 Central Dogma of Molecular Biology........................................... 1 1.1.1 Basic Transfers .......................................................... 1 1.1.2 Uncommon Transfers ................................................... 3 1.2 Gene Expression ................................................................. 4 1.2.1 Estimating Gene Expression ............................................ 4 1.2.2 DNA Microarrays ......................................................
    [Show full text]
  • Table S3: Analysis of Genes Induced in BAHD1 Knockdown HEK213 Cells
    Table S3: Analysis of genes induced in BAHD1 knockdown HEK213 cells. Top networks associated to genes induced in BAHD1 KD cells (Ingenuity Pathways Analysis). Associated Network Functions Molecules in Network Score Focus (Molecules in BAHD1-KD transcriptome in upper case) Molecules Cancer, Cell Cycle, Cellular Growth and Proliferation ALCAM, BCL2L11, Caspase, CDKN1C, CLEC11A, CTH, Cyclin 54 27 A, Cyclin E, DACH1, DSP, ERK, GAL, IGF2, Igfbp, IGFBP7, IL6R, KISS1R, LGALS3, Mmp, NEFM, PDGF BB, PHLDA1, Rb, RBL1, RET, RUNX2, SCARA3, SEPP1, SLC6A6, SOX8, SULF1, TAC1, TACSTD1, VCAN, WWP1 Immune Response, Respiratory Disease, Organismal Injury and ADCYAP1R1, ALOX5, Ap1, ATF1, CaMKII, COL13A1, Creb, 39 21 Abnormalities F12, F2R, FSH, hCG, IL1, INDO, ITCH, LDL, MEOX1, NFkB, NID1, NR2F2, P38 MAPK, Pka, Pkc(s), PLA2G7, PLAU, PLC, PLCD3, PRKAR1A, RAP2B, RIPK2, S1PR3, SUMO1, TANK, Tgf beta, TIMP2, Vegf Top Molecular and Cellular Functions associated to genes induced in BAHD1 KD cells (Ingenuity Pathways Analysis). Category Molecules p-value # Molecules Cell Death SAT1, IL6R, PRKAR1A, PHLDA2, RASL10A, PHLDA1, S1PR3, 1,56E-04 - 1,90E-02 43 DSP, IGF2, ADCYAP1R1, ALOX5, QKI, LGALS3, RIPK2, IGFBP7, RUNX2, CDKN1C, PLA2G7, STEAP3, F2R, PLAU, SULF1, KAT2B, RET, BCL2L11, CTH, ATF1, RBL1, DACH1, RTN1, GAL, VCAN, PACS2, TAC1, SUMO1, HLF, EMP2, CLEC11A, TANK, ACSL4, TIMP2, INDO Cellular Growth and Proliferation F12, SAT1, IL6R, PRKAR1A, SEC14L2, PHLDA2, RASL10A, 2,35E-04 - 1,90E-02 46 PHLDA1, DSP, S1PR3, IGF2, CRLF1, ADCYAP1R1, ALOX5, LAMB1, LGALS3, RIPK2, IGFBP7,
    [Show full text]
  • A Network Inference Approach to Understanding Musculoskeletal
    A NETWORK INFERENCE APPROACH TO UNDERSTANDING MUSCULOSKELETAL DISORDERS by NIL TURAN A thesis submitted to The University of Birmingham for the degree of Doctor of Philosophy College of Life and Environmental Sciences School of Biosciences The University of Birmingham June 2013 University of Birmingham Research Archive e-theses repository This unpublished thesis/dissertation is copyright of the author and/or third parties. The intellectual property rights of the author or third parties in respect of this work are as defined by The Copyright Designs and Patents Act 1988 or as modified by any successor legislation. Any use made of information contained in this thesis/dissertation must be in accordance with that legislation and must be properly acknowledged. Further distribution or reproduction in any format is prohibited without the permission of the copyright holder. ABSTRACT Musculoskeletal disorders are among the most important health problem affecting the quality of life and contributing to a high burden on healthcare systems worldwide. Understanding the molecular mechanisms underlying these disorders is crucial for the development of efficient treatments. In this thesis, musculoskeletal disorders including muscle wasting, bone loss and cartilage deformation have been studied using systems biology approaches. Muscle wasting occurring as a systemic effect in COPD patients has been investigated with an integrative network inference approach. This work has lead to a model describing the relationship between muscle molecular and physiological response to training and systemic inflammatory mediators. This model has shown for the first time that oxygen dependent changes in the expression of epigenetic modifiers and not chronic inflammation may be causally linked to muscle dysfunction.
    [Show full text]
  • BGGN 213 Pathway Analysis and the Interpretation of Gene Lists
    BGGN 213 Pathway Analysis and the Interpretation of Gene Lists Barry Grant http://thegrantlab.org/bggn213 My high-throughput experiment generated a long list of genes/proteins… What do I do now? Pathway analysis! (a.k.a. geneset enrichment) Use bioinformatics methods to help extract biological meaning from such lists… Pathway analysis (a.k.a. geneset enrichment) Principle DEGs Pathway Differentially Pathway Expressed (geneset) Genes (DEGs) Enriched Not enriched • Variations of the math: overlap, ranking, networks... ➢ Not critical, different algorithms show similar performances • DEGs come from your experiment ➢ Critical, needs to be as clean as possible • Pathway genes (“geneset”) come from annotations ➢ Important, but typically not a competitive advantage Pathway analysis (a.k.a. geneset enrichment) Limitations • Post-transcriptional regulation is neglected • Directionality is hard to capture sensibly • e.g. IκBα/NF-κB • Tissue-specific variations of pathways are not annotated • e.g. NF-κB regulates metabolism, not inflammation, in adipocytes • Size bias: stats are influenced by the size of the pathway • Geneset annotation bias: can only discover what is already known • Non-model organisms: no high-quality genesets available • Many pathways/receptors converge to few regulators • e.g. tens of innate immune receptors activate 4 TFs: NF-kB, AP-1, IRF3/7, NFAT Starting point for pathway analysis: Your gene list • You have a list of genes/proteins of interest • You have quantitative data for each gene/protein • Fold change 228018_at F26A1.8NP_000192
    [Show full text]
  • A Mechanogenetic Model of Exercise-Induced Pulmonary Haemorrhage in the Thoroughbred Horse
    G C A T T A C G G C A T genes Article A Mechanogenetic Model of Exercise-Induced Pulmonary Haemorrhage in the Thoroughbred Horse Sarah Blott 1,* , Hannah Cunningham 1, Laurène Malkowski 1 , Alexandra Brown 2 and Cyril Rauch 1,* 1 School of Veterinary Medicine and Science, University of Nottingham, Sutton Bonington LE12 5RD, UK; [email protected] (H.C.); [email protected] (L.M.) 2 Animal Health Trust, Lanwades Park, Kentford, Newmarket, Suffolk CB8 7UU, UK; [email protected] * Correspondence: [email protected] (S.B.); [email protected] (C.R.) Received: 30 September 2019; Accepted: 30 October 2019; Published: 1 November 2019 Abstract: Exercise-induced pulmonary haemorrhage (EIPH) occurs in horses performing high-intensity athletic activity. The application of physics principles to derive a ‘physical model’, which is coherent with existing physiology and cell biology data, shows that critical parameters for capillary rupture are cell–cell adhesion and cell stiffness (cytoskeleton organisation). Specifically, length of fracture in the capillary is a ratio between the energy involved in cell–cell adhesion and the stiffness of cells suggesting that if the adhesion diminishes and/or that the stiffness of cells increases EIPH is more likely to occur. To identify genes associated with relevant cellular or physiological phenotypes, the physical model was used in a post-genome-wide association study (GWAS) to define gene sets associated with the model parameters. The primary study was a GWAS of EIPH where the phenotype was based on weekly tracheal wash samples collected over a two-year period from 72 horses in a flat race training yard.
    [Show full text]
  • A Systems Approach to Mapping Transcriptional Networks Controlling
    Xu et al. BMC Genomics 2010, 11:451 http://www.biomedcentral.com/1471-2164/11/451 RESEARCH ARTICLE Open Access A systems approach to mapping transcriptional networks controlling surfactant homeostasis Yan Xu1,2*, Minlu Zhang2,3, Yanhua Wang1, Pooja Kadambi4, Vrushank Dave1, Long J Lu2,3, Jeffrey A Whitsett1 Abstract Background: Pulmonary surfactant is required for lung function at birth and throughout life. Lung lipid and surfactant homeostasis requires regulation among multi-tiered processes, coordinating the synthesis of surfactant proteins and lipids, their assembly, trafficking, and storage in type II cells of the lung. The mechanisms regulating these interrelated processes are largely unknown. Results: We integrated mRNA microarray data with array independent knowledge using Gene Ontology (GO) similarity analysis, promoter motif searching, protein interaction and literature mining to elucidate genetic networks regulating lipid related biological processes in lung. A Transcription factor (TF) - target gene (TG) similarity matrix was generated by integrating data from different analytic methods. A scoring function was built to rank the likely TF-TG pairs. Using this strategy, we identified and verified critical components of a transcriptional network directing lipogenesis, lipid trafficking and surfactant homeostasis in the mouse lung. Conclusions: Within the transcriptional network, SREBP, CEBPA, FOXA2, ETSF, GATA6 and IRF1 were identified as regulatory hubs displaying high connectivity. SREBP, FOXA2 and CEBPA together form a common core regulatory module that controls surfactant lipid homeostasis. The core module cooperates with other factors to regulate lipid metabolism and transport, cell growth and development, cell death and cell mediated immune response. Coordinated interactions of the TFs influence surfactant homeostasis and regulate lung function at birth.
    [Show full text]