The NIH Catalyst from the Deputy Director for Intramural Research
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Single Nucleotide Variants in Metastasis-Related Genes Are
View metadata, citation and similar papers at core.ac.uk brought to you by CORE HHS Public Access provided by CDC Stacks Author manuscript Author ManuscriptAuthor Manuscript Author Mol Carcinog Manuscript Author . Author manuscript; Manuscript Author available in PMC 2018 March 01. Published in final edited form as: Mol Carcinog. 2017 March ; 56(3): 1000–1009. doi:10.1002/mc.22565. Single nucleotide variants in metastasis-related genes are associated with breast cancer risk, by lymph node involvement and estrogen receptor status, in women with European and African ancestry Michelle R. Roberts1,2,3, Lara E. Sucheston-Campbell4, Gary R. Zirpoli5, Michael Higgins6, Jo L. Freudenheim3, Elisa V. Bandera7, Christine B. Ambrosone2, and Song Yao2 1Channing Division of Network Medicine, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 2Department of Cancer Prevention and Control, Roswell Park Cancer Institute, Buffalo, NY 3Department of Epidemiology and Environmental Health, University at Buffalo, Buffalo, NY 4Division of Pharmacy Practice and Science, The Ohio State University, Columbus, OH 5Department of Neurology, Massachusetts General Hospital and Harvard Medical School, Boston, MA 6Department of Molecular and Cellular Biology, Roswell Park Cancer Institute, Buffalo, NY 7Rutgers Cancer Institute of New Jersey, New Brunswick, NJ Abstract Background—Single nucleotide polymorphisms (SNPs) in pathways influencing lymph node (LN) metastasis and estrogen receptor (ER) status in breast cancer may partially explain inter- patient variability in prognosis. We examined 154 SNPs in 12 metastasis-related genes for associations with breast cancer risk, stratified by LN and ER status, in European-American (EA) and African-American (AA) women. Methods—2,671 women enrolled in the Women’s Circle of Health Study were genotyped. -
Lineage-Specific Evolution of the Vertebrate Otopetrin Gene Family Revealed by Comparative Genomic Analyses
Hurle et al. BMC Evolutionary Biology 2011, 11:23 http://www.biomedcentral.com/1471-2148/11/23 RESEARCHARTICLE Open Access Lineage-specific evolution of the vertebrate Otopetrin gene family revealed by comparative genomic analyses Belen Hurle1, Tomas Marques-Bonet2,3, Francesca Antonacci3, Inna Hughes4, Joseph F Ryan1, NISC Comparative Sequencing Program1,5, Evan E Eichler3, David M Ornitz6, Eric D Green1,5* Abstract Background: Mutations in the Otopetrin 1 gene (Otop1) in mice and fish produce an unusual bilateral vestibular pathology that involves the absence of otoconia without hearing impairment. The encoded protein, Otop1, is the only functionally characterized member of the Otopetrin Domain Protein (ODP) family; the extended sequence and structural preservation of ODP proteins in metazoans suggest a conserved functional role. Here, we use the tools of sequence- and cytogenetic-based comparative genomics to study the Otop1 and the Otop2-Otop3 genes and to establish their genomic context in 25 vertebrates. We extend our evolutionary study to include the gene mutated in Usher syndrome (USH) subtype 1G (Ush1g), both because of the head-to-tail clustering of Ush1g with Otop2 and because Otop1 and Ush1g mutations result in inner ear phenotypes. Results: We established that OTOP1 is the boundary gene of an inversion polymorphism on human chromosome 4p16 that originated in the common human-chimpanzee lineage more than 6 million years ago. Other lineage- specific evolutionary events included a three-fold expansion of the Otop genes in Xenopus tropicalis and of Ush1g in teleostei fish. The tight physical linkage between Otop2 and Ush1g is conserved in all vertebrates. -
Primepcr™Assay Validation Report
PrimePCR™Assay Validation Report Gene Information Gene Name epithelial membrane protein 2 Gene Symbol Emp2 Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. Not Available UniGene ID Rn.21730 Ensembl Gene ID ENSRNOG00000002664 Entrez Gene ID 360468 Assay Information Unique Assay ID qRnoCIP0024746 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSRNOT00000003615 Amplicon Context Sequence CCTGCTGCCTTCGCTGCCCTGTGAACATGTTGGTGATTCTTGCCTTCATCATCGT CTTCCACATCGTGTCTACGGCACTCTTGTTCATTTCAACCATTGACAATGCCTGG TGGGTAGGAGATGGCTTCTCAGCT Amplicon Length (bp) 104 Chromosome Location 10:4276703-4281842 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 99 R2 0.9989 cDNA Cq 20.98 cDNA Tm (Celsius) 82.5 gDNA Cq Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Emp2, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. -
Steroid-Dependent Regulation of the Oviduct: a Cross-Species Transcriptomal Analysis
University of Kentucky UKnowledge Theses and Dissertations--Animal and Food Sciences Animal and Food Sciences 2015 Steroid-dependent regulation of the oviduct: A cross-species transcriptomal analysis Katheryn L. Cerny University of Kentucky, [email protected] Right click to open a feedback form in a new tab to let us know how this document benefits ou.y Recommended Citation Cerny, Katheryn L., "Steroid-dependent regulation of the oviduct: A cross-species transcriptomal analysis" (2015). Theses and Dissertations--Animal and Food Sciences. 49. https://uknowledge.uky.edu/animalsci_etds/49 This Doctoral Dissertation is brought to you for free and open access by the Animal and Food Sciences at UKnowledge. It has been accepted for inclusion in Theses and Dissertations--Animal and Food Sciences by an authorized administrator of UKnowledge. For more information, please contact [email protected]. STUDENT AGREEMENT: I represent that my thesis or dissertation and abstract are my original work. Proper attribution has been given to all outside sources. I understand that I am solely responsible for obtaining any needed copyright permissions. I have obtained needed written permission statement(s) from the owner(s) of each third-party copyrighted matter to be included in my work, allowing electronic distribution (if such use is not permitted by the fair use doctrine) which will be submitted to UKnowledge as Additional File. I hereby grant to The University of Kentucky and its agents the irrevocable, non-exclusive, and royalty-free license to archive and make accessible my work in whole or in part in all forms of media, now or hereafter known. -
1 Original Article Scleraxis and E47 Cooperatively Regulate the Sox9
Original article Scleraxis and E47 cooperatively regulate the Sox9-dependent transcription Takayuki Furumatsu a, *, Chisa Shukunami b, Michiyo Amemiya-Kudo c, Hitoshi Shimano d, Toshifumi Ozaki a a Department of Orthopaedic Surgery, Science of Functional Recovery and Reconstruction, Okayama University Graduate School of Medicine, Dentistry, and Pharmaceutical Sciences 2-5-1 Shikatacho, kitaku, Okayama 700-8558, Japan b Department of Cellular Differentiation, Institute for Frontier Medical Sciences, Kyoto University 53 Shogoin-Kawaharacho, Sakyoku, Kyoto 606-8507, Japan c Okinaka Memorial Institute for Medical Research, Toranomon Hospital 2-2-2 Toranomon, Minatoku, Tokyo 105-8470, Japan d Department of Internal Medicine, Endocrinology and Metabolism, Advanced Biomedical Applications, Graduate School of Comprehensive Human Sciences Center for Tsukuba Advanced Research Alliance, University of Tsukuba 1-1-1 Tennodai, Tsukuba-city, Ibaraki 305-8575, Japan * Corresponding author at: Department of Orthopaedic Surgery, Science of Functional Recovery and Reconstruction, Okayama University Graduate School of Medicine, Dentistry, and Pharmaceutical Sciences, 2-5-1 Shikatacho, Kitaku, Okayama 700-8558, Japan. Tel: +81-86-235-7273; fax: +81-86-223-9727. E-mail address: [email protected] (T. Furumatsu). 1 Abstract During musculoskeletal development, Sry-type HMG box 9 (Sox9) has a crucial role in mesenchymal condensation and chondrogenesis. On the other hand, a tissue-specific basic helix-loop-helix (bHLH) transcription factor Scleraxis (Scx) regulates the differentiation of tendon and ligament progenitors. Whereas these two transcription factors cooperatively participate in the determination of cellular lineages, the precise interaction between Sox9 and Scx remains unclear. We have previously demonstrated that the Sox9-dependent transcription is synergistically activated by several Sox9- associating molecules, such as p300 and Smad3, on chromatin. -
E Proteins and ID Proteins: Helix-Loop-Helix Partners in Development and Disease
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Developmental Cell Review E Proteins and ID Proteins: Helix-Loop-Helix Partners in Development and Disease Lan-Hsin Wang1 and Nicholas E. Baker1,2,3,* 1Department of Genetics, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10461, USA 2Department of Developmental and Molecular Biology, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10461, USA 3Department of Ophthalmology and Visual Sciences, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10461, USA *Correspondence: [email protected] http://dx.doi.org/10.1016/j.devcel.2015.10.019 The basic Helix-Loop-Helix (bHLH) proteins represent a well-known class of transcriptional regulators. Many bHLH proteins act as heterodimers with members of a class of ubiquitous partners, the E proteins. A widely expressed class of inhibitory heterodimer partners—the Inhibitor of DNA-binding (ID) proteins—also exists. Genetic and molecular analyses in humans and in knockout mice implicate E proteins and ID proteins in a wide variety of diseases, belying the notion that they are non-specific partner proteins. Here, we explore relationships of E proteins and ID proteins to a variety of disease processes and highlight gaps in knowledge of disease mechanisms. E proteins and Inhibitor of DNA-binding (ID) proteins are widely conferring DNA-binding specificity and transcriptional activation expressed transcriptional regulators with very general functions. on heterodimers with the ubiquitous E proteins (Figure 1). They are implicated in diseases by evidence ranging from Another class of pervasive HLH proteins acts in opposition to confirmed Mendelian inheritance, association studies, and E proteins. -
SIPA1 Is a Modulator of HGF/MET Induced Tumour Metastasis Via the Regulation of Tight Junction-Based Cell to Cell Barrier Function
cancers Article SIPA1 Is a Modulator of HGF/MET Induced Tumour Metastasis via the Regulation of Tight Junction-Based Cell to Cell Barrier Function Chang Liu 1, Wenguo Jiang 1 , Lijian Zhang 2, Rachel Hargest 1,* and Tracey A. Martin 1,* 1 Division of Cancer and Genetics, School of Medicine, Cardiff University, Heath Park, Cardiff CF14 4XN, UK; [email protected] (C.L.); [email protected] (W.J.) 2 Peking University School of Oncology and Peking University Cancer Hospital, Fucheng Road, Beijing 100142, China; [email protected] * Correspondence: [email protected] (R.H.); [email protected] (T.A.M.); Tel.: +44-29-2068-7130 (R.H.) Simple Summary: The role of Signal Induced Proliferation Associated 1 (SIPA1) in lung cancer remains largely unknown. This study aimed to evaluate the importance of SIPA1 in the development and progression of lung cancer, to demonstrate the cellular functions of SIPA1 and the molecular mechanisms involved. Abstract: Background: Lung cancer is the leading cause of cancer death. SIPA1 is a mitogen induced GTPase activating protein (GAP) and may hamper cell cycle progression. SIPA1 has been shown to be involved in MET signaling and may contribute to tight junction (TJ) function and cancer metastasis. Methods: Human lung tumour cohorts were analyzed. In vitro cell function assays were performed after knock down of SIPA1 in lung cancer cells with/without treatment. Quantitative Citation: Liu, C.; Jiang, W.G.; Zhang, polymerase chain reaction (qPCR) and western blotting were performed to analyze expression of L.; Hargest, R.; Martin, T.A. SIPA1 Is a HGF (hepatocyte growth factor), MET, and their downstream markers. -
A Genome-Wide Library of MADM Mice for Single-Cell Genetic Mosaic Analysis
bioRxiv preprint doi: https://doi.org/10.1101/2020.06.05.136192; this version posted June 6, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Contreras et al., A Genome-wide Library of MADM Mice for Single-Cell Genetic Mosaic Analysis Ximena Contreras1, Amarbayasgalan Davaatseren1, Nicole Amberg1, Andi H. Hansen1, Johanna Sonntag1, Lill Andersen2, Tina Bernthaler2, Anna Heger1, Randy Johnson3, Lindsay A. Schwarz4,5, Liqun Luo4, Thomas Rülicke2 & Simon Hippenmeyer1,6,# 1 Institute of Science and Technology Austria, Am Campus 1, 3400 Klosterneuburg, Austria 2 Institute of Laboratory Animal Science, University of Veterinary Medicine Vienna, Vienna, Austria 3 Department of Biochemistry and Molecular Biology, University of Texas, Houston, TX 77030, USA 4 HHMI and Department of Biology, Stanford University, Stanford, CA 94305, USA 5 Present address: St. Jude Children’s Research Hospital, Memphis, TN 38105, USA 6 Lead contact #Correspondence and requests for materials should be addressed to S.H. ([email protected]) 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.06.05.136192; this version posted June 6, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Contreras et al., SUMMARY Mosaic Analysis with Double Markers (MADM) offers a unique approach to visualize and concomitantly manipulate genetically-defined cells in mice with single-cell resolution. -
Single-Cell Analysis Uncovers Fibroblast Heterogeneity
ARTICLE https://doi.org/10.1038/s41467-020-17740-1 OPEN Single-cell analysis uncovers fibroblast heterogeneity and criteria for fibroblast and mural cell identification and discrimination ✉ Lars Muhl 1,2 , Guillem Genové 1,2, Stefanos Leptidis 1,2, Jianping Liu 1,2, Liqun He3,4, Giuseppe Mocci1,2, Ying Sun4, Sonja Gustafsson1,2, Byambajav Buyandelger1,2, Indira V. Chivukula1,2, Åsa Segerstolpe1,2,5, Elisabeth Raschperger1,2, Emil M. Hansson1,2, Johan L. M. Björkegren 1,2,6, Xiao-Rong Peng7, ✉ Michael Vanlandewijck1,2,4, Urban Lendahl1,8 & Christer Betsholtz 1,2,4 1234567890():,; Many important cell types in adult vertebrates have a mesenchymal origin, including fibro- blasts and vascular mural cells. Although their biological importance is undisputed, the level of mesenchymal cell heterogeneity within and between organs, while appreciated, has not been analyzed in detail. Here, we compare single-cell transcriptional profiles of fibroblasts and vascular mural cells across four murine muscular organs: heart, skeletal muscle, intestine and bladder. We reveal gene expression signatures that demarcate fibroblasts from mural cells and provide molecular signatures for cell subtype identification. We observe striking inter- and intra-organ heterogeneity amongst the fibroblasts, primarily reflecting differences in the expression of extracellular matrix components. Fibroblast subtypes localize to discrete anatomical positions offering novel predictions about physiological function(s) and regulatory signaling circuits. Our data shed new light on the diversity of poorly defined classes of cells and provide a foundation for improved understanding of their roles in physiological and pathological processes. 1 Karolinska Institutet/AstraZeneca Integrated Cardio Metabolic Centre, Blickagången 6, SE-14157 Huddinge, Sweden. -
(12) United States Patent (10) Patent No.: US 7.873,482 B2 Stefanon Et Al
US007873482B2 (12) United States Patent (10) Patent No.: US 7.873,482 B2 Stefanon et al. (45) Date of Patent: Jan. 18, 2011 (54) DIAGNOSTIC SYSTEM FOR SELECTING 6,358,546 B1 3/2002 Bebiak et al. NUTRITION AND PHARMACOLOGICAL 6,493,641 B1 12/2002 Singh et al. PRODUCTS FOR ANIMALS 6,537,213 B2 3/2003 Dodds (76) Inventors: Bruno Stefanon, via Zilli, 51/A/3, Martignacco (IT) 33035: W. Jean Dodds, 938 Stanford St., Santa Monica, (Continued) CA (US) 90403 FOREIGN PATENT DOCUMENTS (*) Notice: Subject to any disclaimer, the term of this patent is extended or adjusted under 35 WO WO99-67642 A2 12/1999 U.S.C. 154(b) by 158 days. (21)21) Appl. NoNo.: 12/316,8249 (Continued) (65) Prior Publication Data Swanson, et al., “Nutritional Genomics: Implication for Companion Animals'. The American Society for Nutritional Sciences, (2003).J. US 2010/O15301.6 A1 Jun. 17, 2010 Nutr. 133:3033-3040 (18 pages). (51) Int. Cl. (Continued) G06F 9/00 (2006.01) (52) U.S. Cl. ........................................................ 702/19 Primary Examiner—Edward Raymond (58) Field of Classification Search ................... 702/19 (74) Attorney, Agent, or Firm Greenberg Traurig, LLP 702/23, 182–185 See application file for complete search history. (57) ABSTRACT (56) References Cited An analysis of the profile of a non-human animal comprises: U.S. PATENT DOCUMENTS a) providing a genotypic database to the species of the non 3,995,019 A 1 1/1976 Jerome human animal Subject or a selected group of the species; b) 5,691,157 A 1 1/1997 Gong et al. -
Transcriptional Regulation of Ski and Scleraxis in Primary Cardiac Myofibroblasts
Transcriptional Regulation of Ski and Scleraxis in Primary Cardiac Myofibroblasts by Matthew R. Zeglinski A Thesis submitted to the Faculty of Graduate Studies of The University of Manitoba in partial fulfilment of the requirements of the degree of DOCTOR OF PHILOSOPHY Department of Physiology and Pathophysiology University of Manitoba Winnipeg Copyright © 2016 by Matthew R. Zeglinski Abstract Transforming growth factor-β1 (TGFβ1) is a mediator of the fibrotic response through activation of quiescent cardiac fibroblasts to hypersynthetic myofibroblasts. Scleraxis (Scx) is a pro-fibrotic transcription factor that is induced by TGFβ1-3 and works synergistically with Smads to promote collagen expression. Ski is a negative regulator of TGFβ/Smad signaling through its interactions with Smad proteins at the promoter region of TGFβ regulated genes. To date, no studies have examined the direct DNA:protein transcriptional mechanisms that regulate Scx expression by TGFβ1-3 or Ski, nor the mechanisms that govern Ski expression by Scx. We hypothesize that Ski and Scx regulate one another, and form a negative feedback loop that represses gene expression and is a central regulator of the fibrotic response in cardiac myofibroblasts. Primary adult rat cardiac myofibroblasts were isolated via retrograde Langendorff perfusion. First passage (P1) cells were infected with adenovirus encoding HA-Ski, HA-Scx, or LacZ at the time of plating. Twenty-four hours later, cells were harvested for Western blot, quantitative real-time PCR (qPCR), and electrophoretic gel shift assays (EMSA). NIH-3T3 or Cos7 cells were transfected with equal quantities of plasmid DNA for 24 hours prior to harvesting for luciferase, qPCR, and EMSA analysis. -
MUTED Antibody - C-Terminal Region (ARP63301 P050) Data Sheet
MUTED antibody - C-terminal region (ARP63301_P050) Data Sheet Product Number ARP63301_P050 Product Name MUTED antibody - C-terminal region (ARP63301_P050) Size 50ug Gene Symbol BLOC1S5 Alias Symbols DKFZp686E2287; MU; MUTED Nucleotide Accession# NM_201280 Protein Size (# AA) 187 amino acids Molecular Weight 21kDa Product Format Lyophilized powder NCBI Gene Id 63915 Host Rabbit Clonality Polyclonal Official Gene Full Name Muted homolog (mouse) Gene Family BLOC1S This is a rabbit polyclonal antibody against MUTED. It was validated on Western Blot by Aviva Systems Biology. At Aviva Systems Biology we manufacture rabbit polyclonal antibodies on a large scale (200-1000 Description products/month) of high throughput manner. Our antibodies are peptide based and protein family oriented. We usually provide antibodies covering each member of a whole protein family of your interest. We also use our best efforts to provide you antibodies recognize various epitopes of a target protein. For availability of antibody needed for your experiment, please inquire (). Partner Proteins BLOC1S2,DTNBP1,BLOC1S1,BLOC1S2,CNO,DTNBP1,SNAPIN,BLOC1S2,BLOC1S3,DTNBP1,PLDN,SQS TM1,YOD1 This gene encodes a component of BLOC-1 (biogenesis of lysosome-related organelles complex 1). Components of this complex are involved in the biogenesis of organelles such as melanosomes and platelet- Description of Target dense granules. A mouse model for Hermansky-Pudlak Syndrome is mutated in the murine version of this gene. Alternative splicing results in multiple transcript variants. Read-through transcription exists between this gene and the upstream EEF1E1 (eukaryotic translation elongation factor 1 epsilon 1) gene, as well as with the downstream TXNDC5 (thioredoxin domain containing 5) gene.