DOCSLIB.ORG

Persistent Transcription-Blocking DNA Lesions Trigger Somatic Growth Attenuation Associated with Longevity

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Persistent Transcription-Blocking DNA Lesions Trigger Somatic Growth Attenuation Associated with Longevity ARTICLES Persistent transcription-blocking DNA lesions trigger somatic growth attenuation associated with longevity George A. Garinis1,2, Lieneke M. Uittenboogaard1, Heike Stachelscheid3,4, Maria Fousteri5, Wilfred van Ijcken6, Timo M. Breit7, Harry van Steeg8, Leon H. F. Mullenders5, Gijsbertus T. J. van der Horst1, Jens C. Brüning4,9, Carien M. Niessen3,9,10, Jan H. J. Hoeijmakers1 and Björn Schumacher1,9,11 The accumulation of stochastic DNA damage throughout an organism’s lifespan is thought to contribute to ageing. Conversely, ageing seems to be phenotypically reproducible and regulated through genetic pathways such as the insulin-like growth factor-1 (IGF-1) and growth hormone (GH) receptors, which are central mediators of the somatic growth axis. Here we report that persistent DNA damage in primary cells from mice elicits changes in global gene expression similar to those occurring in various organs of naturally aged animals. We show that, as in ageing animals, the expression of IGF-1 receptor and GH receptor is attenuated, resulting in cellular resistance to IGF-1. This cell-autonomous attenuation is specifically induced by persistent lesions leading to stalling of RNA polymerase II in proliferating, quiescent and terminally differentiated cells; it is exacerbated and prolonged in cells from progeroid mice and confers resistance to oxidative stress. Our findings suggest that the accumulation of DNA damage in transcribed genes in most if not all tissues contributes to the ageing-associated shift from growth to somatic maintenance that triggers stress resistance and is thought to promote longevity. Ageing represents the progressive functional decline that is exempted levels as a result of pituitary dysfunction (Snell and Ames mice) — have an from evolutionary selection because it largely occurs after reproduc- extended lifespan17–20. Thus, there are two principal components of ageing: tion and beyond the lifespan normally reached in natural habitats1,2. the stochastic accumulation of damage, and genetic pathways that regulate Accumulation of DNA damage is considered not only a key cause of longevity. However, it is unknown how stochastic damage events are linked cancer but also a driving force of ageing3–6. DNA damage invariably to genes that regulate longevity. accumulates during the lifespan of organisms despite sophisticated DNA The effect of DNA damage on organismal ageing becomes appar- repair systems7–9. In accordance with random damage accumulation, a ent when DNA damage accumulates rapidly early in life as a result of clonal population of Caenorhabditis elegans shows chance variation in defects in genome maintenance, leading to segmental progeroid (pre- lifespan distribution under identical environmental conditions, suggest- mature ageing-like) conditions3,6,21–23. Prime examples are nucleotide ing that ageing may have a strong stochastic component10,11. excision repair (NER) defects6. NER removes a wide range of helix- In contrast to models of stochastic damage as an underlying cause of age- distorting lesions, including UV-induced damage, either by global ing, longevity is also regulated genetically12. Some closely related species, for genome (GG)-NER that repairs lesions throughout the genome or by instance, show great diversity of lifespan, indicating that genetic alterations transcription-coupled repair (TCR), which removes damage in actively can determine longevity13. Single gene mutations in the IGF-1 pathway transcribed genes. Defects in GG-NER lead to skin-cancer-prone xero- extend lifespan in C. elegans and Drosophila14,15. In mammals, GH-mediated derma pigmentosum (XP), whereas defects in TCR lead to the progeroid GH receptor (GHR) signalling in various cell types induces the secretion conditions Cockayne syndrome (CS), trichothiodystrophy (TTD) and of IGF-1, which regulates somatic growth through the activation of IGF-1 XPF-ERCC1 progeria (XFE), which is additionally linked to interstrand receptor (IGF-1R) signalling; together these comprise the somatotropic crosslink (ICL) repair21,24. Mouse mutants with engineered mutations in axis16. Mice with decreased IGF-1 signalling — whether through IGF-1R both Csb and Xpa or in Ercc1 mimic the repair deficiencies of patients heterozygosity, Ghr knockout, overexpression of Klotho, or decreased GH with CS and those with XFE, respectively. Recently, we showed that 1MGC Department of Cell Biology and Genetics, Center for Biomedical Genetics, Erasmus Medical Center, PO Box 1738, 3000 DR Rotterdam, The Netherlands. 2Institute of Molecular Biology and Biotechnology, FORTH, GR70013 Heraklion, Greece. 3Center for Molecular Medicine Cologne, University of Cologne, 50931 Cologne, Germany. 4Institute for Genetics, University of Cologne, 50674 Cologne, Germany. 5Department of Toxicogenetics, LUMC, 2300RC Leiden, The Netherlands. 6Erasmus Center for Biomics, Erasmus Medical Center, 3000DR Rotterdam, The Netherlands. 7Integrative Bioinformatics Unit, Institute for Informatics, Faculty of Science, University of Amsterdam, 1098SM Amsterdam, The Netherlands. 8National Institute of Public Health and the Environment (RIVM), Laboratory of Toxicology, Pathology and Genetics (TOX), 3720BA Bilthoven, The Netherlands. 9Cologne Excellence Cluster for Cellular Stress Responses in Aging Associated Diseases (CECAD), 50674 Cologne, Germany. 10Department of Dermatology, University of Cologne, 50931 Cologne, Germany. 11Correspondence should be addressed to B.S. (e-mail: [email protected]) Received 17 October 2008; accepted 5 February 2009; published online 12 April 2009; DOI:10.1038/ncb1866 NATURE CELL BIOLOGY ADVANCE ONLINE PUBLICATION 1 © 2009 Macmillan Publishers Limited. All rights reserved. ARTICLES a 10 9 genes involved in IGF-1/GH signalling21,25, which is normally associated 8 26 7 with lifespan extension . It has been hypothesized that somatotropic P 6 attenuation becomes progressively installed with advancing age as a 5 )+( )-( –log 4 result of gradually accumulating damage, and delays the onset of age- 3 related pathology and extends lifespan21,25. It is unknown how suppres- 2 1 sion of the somatotropic axis is triggered and whether somatic growth 0 attenuation is a direct response to specific DNA damage or an indirect consequence of damage-driven tissue degeneration. Here we present DNA repair evidence that the accumulation of transcription-blocking lesions is a Angiogenesis Ubiquitin cycle Mitotic cell cycle DNA metabolism Lipid metabolism Immune response primary cause for attenuation of the somatotropic axis with age and thus Response to stress Signal transduction Protein metabolism Protein metabolism Cell cycle regulation Antigen presentation Response to wounding Regulation of apoptosis links DNA damage to genes that regulate longevity. DNA replication initiation Regulation of metabolism Cellular defence response Response to DNA damage Macromolecule metabolism Amino-acid phosphorylation Intracellular signalling cascade Amino-acid dephosphorylation Growth factor receptor signalling Steroid hormone receptor activity Response to endogenous stimulus RESULTS b Birc5 Apbb2 Ckap2 Prkce DNA damage impinges on pathways associated with longevity Lrdd Erbb2ip Amid Bmpr2 regulation Bnip3l Hbegf Traf4 Plcb4 Moap1 Fyn Inherited defects in NER provide clear-cut links with cancer as well as Topors Snx24 6 Apoptosis Trp53inp1 Morf4l1 premature ageing . We therefore examined whether DNA damage by Pea15 Cova1 Tnfaip3 Ghr Ankrd17 Igf1r ultraviolet (UV) irradiation induces gene-expression responses that nor- Brca1 Rasa2 Chek1 Zfyve9 mally occur in old age. To this end, primary mouse dermal fibroblasts Clspn Pld1 Rad51ap1 Ywhae m/m Fen1 Grb14 (MDFs) from selected NER mouse mutants with severe progeria (Csb / Uhrf1 Gulp1 −/− m/m −/− Rad54l Rasgrp3 Xpa ), mild progeria (Csb ) or no progeria (Xpa ) and wild-type lit- Cdkn1a Socs2 Pcna Somatotropic axis and growth Arhgef12 Mpg Ube2e3 termates at 15 days of age were exposed at early passage (less than six) to Xrcc2 Igfbp4 −2 −2 Csb Rasgrf1 very low (0.6 J m ) and to moderate (4 J m ) UV doses. The sensitivity of Supt16h Kif16b Ptpn11 Ralgps1 −2 Chaf1b Ebpl NER-deficient cells exposed to 0.6 J m UV is equivalent to that of wild- Exo1 Hibadh −2 Rfc5 AF397014 type cells after 4 J m UV (Supplementary Information, Fig. S1). These Topors Mapk14 Response to DNA damage Rad1 Ak5 Rad23a Akap9 UV doses give rise to a maximum of one lesion in 300 or 50 kilobases at Trpc2 Atp11c −2 27 Cxcl1 Hs2st1 0.6 or 4 J m , respectively . Consistent with the presence of randomly Arl6ip2 Arsj Chst4 Atrnl1 Cxcl12 AI317237 distributed lesions in only a small fraction of genes, we did not detect a H2-DMa Cyb5r4 Cmtm7 Maoa Il10rb global transcriptional repression 6 h after UV treatment, because equal Ncf1 Ppa2 Gdf10 Pik3ca numbers of genes were upregulated and downregulated (Supplementary Tap1 Sptlc2 Fcgr1 Gpd2 Nfat5 Oxidative metabolism Pcca Information, Tables S1–S5). A large fraction of UV-induced genes con- Mical2 Immune reponse Lefty1 Tlr4 Dip2c tained relatively long open reading frames, suggesting that the changes Aldh1a3 Tpk1 Nod 4631427C1 Agps Pitpnc1 in expression represent a trans response rather than a cis effect of tran- Lass6 Hecw2 Hmgcs1 C3HC4-1 scriptional blockage. To validate the microarray results, we quantitatively Hmgcs1 Cul3 Plcb4 Tbl1xr1 Tmem23 Cblb confirmed statistically significant changes in gene expression greater than Soat1 Itch Pld1 Phr1 ±1.2-fold by quantitative real-time polymerase chain reaction (qPCR) Lass6 Kcmf1 Ppap2b Znrf3
Load more

Recommended publications
  • Supplemental Figure 1. Vimentin
    Double mutant specific genes Transcript gene_assignment Gene Symbol RefSeq FDR Fold- FDR Fold- FDR Fold- ID (single vs. Change (double Change (double Change wt) (single vs. wt) (double vs. single) (double vs. wt) vs. wt) vs. single) 10485013 BC085239 // 1110051M20Rik // RIKEN cDNA 1110051M20 gene // 2 E1 // 228356 /// NM 1110051M20Ri BC085239 0.164013 -1.38517 0.0345128 -2.24228 0.154535 -1.61877 k 10358717 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 /// BC 1700025G04Rik NM_197990 0.142593 -1.37878 0.0212926 -3.13385 0.093068 -2.27291 10358713 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 1700025G04Rik NM_197990 0.0655213 -1.71563 0.0222468 -2.32498 0.166843 -1.35517 10481312 NM_027283 // 1700026L06Rik // RIKEN cDNA 1700026L06 gene // 2 A3 // 69987 /// EN 1700026L06Rik NM_027283 0.0503754 -1.46385 0.0140999 -2.19537 0.0825609 -1.49972 10351465 BC150846 // 1700084C01Rik // RIKEN cDNA 1700084C01 gene // 1 H3 // 78465 /// NM_ 1700084C01Rik BC150846 0.107391 -1.5916 0.0385418 -2.05801 0.295457 -1.29305 10569654 AK007416 // 1810010D01Rik // RIKEN cDNA 1810010D01 gene // 7 F5 // 381935 /// XR 1810010D01Rik AK007416 0.145576 1.69432 0.0476957 2.51662 0.288571 1.48533 10508883 NM_001083916 // 1810019J16Rik // RIKEN cDNA 1810019J16 gene // 4 D2.3 // 69073 / 1810019J16Rik NM_001083916 0.0533206 1.57139 0.0145433 2.56417 0.0836674 1.63179 10585282 ENSMUST00000050829 // 2010007H06Rik // RIKEN cDNA 2010007H06 gene // --- // 6984 2010007H06Rik ENSMUST00000050829 0.129914 -1.71998 0.0434862 -2.51672
    [Show full text]
  • Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-Like Mouse Models: Tracking the Role of the Hairless Gene
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 5-2006 Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene Yutao Liu University of Tennessee - Knoxville Follow this and additional works at: https://trace.tennessee.edu/utk_graddiss Part of the Life Sciences Commons Recommended Citation Liu, Yutao, "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino- like Mouse Models: Tracking the Role of the Hairless Gene. " PhD diss., University of Tennessee, 2006. https://trace.tennessee.edu/utk_graddiss/1824 This Dissertation is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a dissertation written by Yutao Liu entitled "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene." I have examined the final electronic copy of this dissertation for form and content and recommend that it be accepted in partial fulfillment of the requirements for the degree of Doctor of Philosophy, with a major in Life Sciences. Brynn H. Voy, Major Professor We have read this dissertation and recommend its acceptance: Naima Moustaid-Moussa, Yisong Wang, Rogert Hettich Accepted for the Council: Carolyn R.
    [Show full text]
  • Steroid-Dependent Regulation of the Oviduct: a Cross-Species Transcriptomal Analysis
    University of Kentucky UKnowledge Theses and Dissertations--Animal and Food Sciences Animal and Food Sciences 2015 Steroid-dependent regulation of the oviduct: A cross-species transcriptomal analysis Katheryn L. Cerny University of Kentucky, [email protected] Right click to open a feedback form in a new tab to let us know how this document benefits ou.y Recommended Citation Cerny, Katheryn L., "Steroid-dependent regulation of the oviduct: A cross-species transcriptomal analysis" (2015). Theses and Dissertations--Animal and Food Sciences. 49. https://uknowledge.uky.edu/animalsci_etds/49 This Doctoral Dissertation is brought to you for free and open access by the Animal and Food Sciences at UKnowledge. It has been accepted for inclusion in Theses and Dissertations--Animal and Food Sciences by an authorized administrator of UKnowledge. For more information, please contact [email protected]. STUDENT AGREEMENT: I represent that my thesis or dissertation and abstract are my original work. Proper attribution has been given to all outside sources. I understand that I am solely responsible for obtaining any needed copyright permissions. I have obtained needed written permission statement(s) from the owner(s) of each third-party copyrighted matter to be included in my work, allowing electronic distribution (if such use is not permitted by the fair use doctrine) which will be submitted to UKnowledge as Additional File. I hereby grant to The University of Kentucky and its agents the irrevocable, non-exclusive, and royalty-free license to archive and make accessible my work in whole or in part in all forms of media, now or hereafter known.
    [Show full text]
  • Cep57, a NEDD1-Binding Pericentriolar Material Component, Is Essential for Spindle Pole Integrity
    Cell Research (2012) :1-12. © 2012 IBCB, SIBS, CAS All rights reserved 1001-0602/12 $ 32.00 npg ORIGINAL ARTICLE www.nature.com/cr Cep57, a NEDD1-binding pericentriolar material component, is essential for spindle pole integrity Qixi Wu1, *, Runsheng He1, *, Haining Zhou1, Albert CH Yu2, Bo Zhang1, Junlin Teng1, Jianguo Chen1, 3 1The State Key Laboratory of Biomembrane and Membrane Bioengineering and The Key Laboratory of Cell Proliferation and Dif- ferentiation of Ministry of Education, College of Life Sciences, Peking University, Beijing 100871, China; 2Department of Neurobi- ology, Neuroscience Research Institute, School of Basic Medical Sciences, Peking University, Beijing 100191, China; 3The Center for Theoretical Biology, Peking University, Beijing 100871, China Formation of a bipolar spindle is indispensable for faithful chromosome segregation and cell division. Spindle in- tegrity is largely dependent on the centrosome and the microtubule network. Centrosome protein Cep57 can bundle microtubules in mammalian cells. Its related protein (Cep57R) in Xenopus was characterized as a stabilization factor for microtubule-kinetochore attachment. Here we show that Cep57 is a pericentriolar material (PCM) component. Its interaction with NEDD1 is necessary for the centrosome localization of Cep57. Depletion of Cep57 leads to unaligned chromosomes and a multipolar spindle, which is induced by PCM fragmentation. In the absence of Cep57, cen- trosome microtubule array assembly activity is weakened, and the spindle length and microtubule density decrease. As a spindle microtubule-binding protein, Cep57 is also responsible for the proper organization of the spindle micro- tubule and localization of spindle pole focusing proteins. Collectively, these results suggest that Cep57, as a NEDD1- binding centrosome component, could function as a spindle pole- and microtubule-stabilizing factor for establishing robust spindle architecture.
    [Show full text]
  • Cytotoxic Effects and Changes in Gene Expression Profile
    Toxicology in Vitro 34 (2016) 309–320 Contents lists available at ScienceDirect Toxicology in Vitro journal homepage: www.elsevier.com/locate/toxinvit Fusarium mycotoxin enniatin B: Cytotoxic effects and changes in gene expression profile Martina Jonsson a,⁎,MarikaJestoib, Minna Anthoni a, Annikki Welling a, Iida Loivamaa a, Ville Hallikainen c, Matti Kankainen d, Erik Lysøe e, Pertti Koivisto a, Kimmo Peltonen a,f a Chemistry and Toxicology Research Unit, Finnish Food Safety Authority (Evira), Mustialankatu 3, FI-00790 Helsinki, Finland b Product Safety Unit, Finnish Food Safety Authority (Evira), Mustialankatu 3, FI-00790 Helsinki, c The Finnish Forest Research Institute, Rovaniemi Unit, P.O. Box 16, FI-96301 Rovaniemi, Finland d Institute for Molecular Medicine Finland (FIMM), University of Helsinki, P.O. Box 20, FI-00014, Finland e Plant Health and Biotechnology, Norwegian Institute of Bioeconomy, Høyskoleveien 7, NO -1430 Ås, Norway f Finnish Safety and Chemicals Agency (Tukes), Opastinsilta 12 B, FI-00521 Helsinki, Finland article info abstract Article history: The mycotoxin enniatin B, a cyclic hexadepsipeptide produced by the plant pathogen Fusarium,isprevalentin Received 3 December 2015 grains and grain-based products in different geographical areas. Although enniatins have not been associated Received in revised form 5 April 2016 with toxic outbreaks, they have caused toxicity in vitro in several cell lines. In this study, the cytotoxic effects Accepted 28 April 2016 of enniatin B were assessed in relation to cellular energy metabolism, cell proliferation, and the induction of ap- Available online 6 May 2016 optosis in Balb 3T3 and HepG2 cells. The mechanism of toxicity was examined by means of whole genome ex- fi Keywords: pression pro ling of exposed rat primary hepatocytes.
    [Show full text]
  • 1 Original Article Scleraxis and E47 Cooperatively Regulate the Sox9
    Original article Scleraxis and E47 cooperatively regulate the Sox9-dependent transcription Takayuki Furumatsu a, *, Chisa Shukunami b, Michiyo Amemiya-Kudo c, Hitoshi Shimano d, Toshifumi Ozaki a a Department of Orthopaedic Surgery, Science of Functional Recovery and Reconstruction, Okayama University Graduate School of Medicine, Dentistry, and Pharmaceutical Sciences 2-5-1 Shikatacho, kitaku, Okayama 700-8558, Japan b Department of Cellular Differentiation, Institute for Frontier Medical Sciences, Kyoto University 53 Shogoin-Kawaharacho, Sakyoku, Kyoto 606-8507, Japan c Okinaka Memorial Institute for Medical Research, Toranomon Hospital 2-2-2 Toranomon, Minatoku, Tokyo 105-8470, Japan d Department of Internal Medicine, Endocrinology and Metabolism, Advanced Biomedical Applications, Graduate School of Comprehensive Human Sciences Center for Tsukuba Advanced Research Alliance, University of Tsukuba 1-1-1 Tennodai, Tsukuba-city, Ibaraki 305-8575, Japan * Corresponding author at: Department of Orthopaedic Surgery, Science of Functional Recovery and Reconstruction, Okayama University Graduate School of Medicine, Dentistry, and Pharmaceutical Sciences, 2-5-1 Shikatacho, Kitaku, Okayama 700-8558, Japan. Tel: +81-86-235-7273; fax: +81-86-223-9727. E-mail address: [email protected] (T. Furumatsu). 1 Abstract During musculoskeletal development, Sry-type HMG box 9 (Sox9) has a crucial role in mesenchymal condensation and chondrogenesis. On the other hand, a tissue-specific basic helix-loop-helix (bHLH) transcription factor Scleraxis (Scx) regulates the differentiation of tendon and ligament progenitors. Whereas these two transcription factors cooperatively participate in the determination of cellular lineages, the precise interaction between Sox9 and Scx remains unclear. We have previously demonstrated that the Sox9-dependent transcription is synergistically activated by several Sox9- associating molecules, such as p300 and Smad3, on chromatin.
    [Show full text]
  • Supplemental Information
    Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.
    [Show full text]
  • Role of Amylase in Ovarian Cancer Mai Mohamed University of South Florida, [email protected]
    University of South Florida Scholar Commons Graduate Theses and Dissertations Graduate School July 2017 Role of Amylase in Ovarian Cancer Mai Mohamed University of South Florida, [email protected] Follow this and additional works at: http://scholarcommons.usf.edu/etd Part of the Pathology Commons Scholar Commons Citation Mohamed, Mai, "Role of Amylase in Ovarian Cancer" (2017). Graduate Theses and Dissertations. http://scholarcommons.usf.edu/etd/6907 This Dissertation is brought to you for free and open access by the Graduate School at Scholar Commons. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Scholar Commons. For more information, please contact [email protected]. Role of Amylase in Ovarian Cancer by Mai Mohamed A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Pathology and Cell Biology Morsani College of Medicine University of South Florida Major Professor: Patricia Kruk, Ph.D. Paula C. Bickford, Ph.D. Meera Nanjundan, Ph.D. Marzenna Wiranowska, Ph.D. Lauri Wright, Ph.D. Date of Approval: June 29, 2017 Keywords: ovarian cancer, amylase, computational analyses, glycocalyx, cellular invasion Copyright © 2017, Mai Mohamed Dedication This dissertation is dedicated to my parents, Ahmed and Fatma, who have always stressed the importance of education, and, throughout my education, have been my strongest source of encouragement and support. They always believed in me and I am eternally grateful to them. I would also like to thank my brothers, Mohamed and Hussien, and my sister, Mariam. I would also like to thank my husband, Ahmed.
    [Show full text]
  • SNM1A (DCLRE1A) (NM 001271816) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC235137 SNM1A (DCLRE1A) (NM_001271816) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: SNM1A (DCLRE1A) (NM_001271816) Human Tagged ORF Clone Tag: Myc-DDK Symbol: DCLRE1A Synonyms: PSO2; SNM1; SNM1A Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC235137 representing NM_001271816 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTTAGAAGACATTTCCGAAGAAGACATTTGGGAATACAAATCTAAAAGAAAACCAAAACGAGTTGATC CAAATAATGGCTCTAAAAATATTCTAAAATCTGTTGAAAAAGCAACAGATGGAAAATACCAGTCAAAACG GAGTAGAAACAGAAAAAGAGCCGCAGAAGCTAAAGAGGTGAAGGACCATGAAGTGCCCCTTGGAAATGCA GGTTGTCAGACTTCTGTTGCTTCTAGTCAGAATTCAAGTTGTGGAGATGGTATTCAGCAGACCCAAGACA AGGAAACTACTCCAGGAAAACTCTGTAGAACTCAAAAAAGCCAACACGTGTCCCCAAAGATACGTCCAGT TTATGATGGATACTGTCCAAATTGCCAGATGCCTTTTTCCTCATTGATAGGGCAGACACCTCGATGGCAT GTTTTTGAATGTTTGGATTCTCCACCACGCTCTGAAACAGAGTGTCCTGATGGTCTTCTGTGTACCTCAA CCATTCCTTTTCATTACAAGAGATACACTCACTTCCTGCTAGCTCAAAGCAGGGCTGGTGATCATCCTTT TAGCAGCCCATCACCTGCGTCAGGTGGCAGTTTCAGTGAGACTAAGTCAGGCGTCCTTTGTAGCCTTGAG GAAAGATGGTCTTCGTATCAGAACCAAACTGATAACTCGGTTTCAAATGATCCCTTATTGATGACACAGT ATTTTAAAAAGTCTCCGTCTCTGACTGAAGCCAGTGAAAAGATTTCTACTCATATCCAAACATCCCAACA AGCTCTACAATTTACAGATTTTGTTGAGAATGACAAACTAGTGGGAGTTGCTTTGCGTCTTGCAAACAAC
    [Show full text]
  • Antigen-Specific Memory CD4 T Cells Coordinated Changes in DNA
    Downloaded from http://www.jimmunol.org/ by guest on September 24, 2021 is online at: average * The Journal of Immunology The Journal of Immunology published online 18 March 2013 from submission to initial decision 4 weeks from acceptance to publication http://www.jimmunol.org/content/early/2013/03/17/jimmun ol.1202267 Coordinated Changes in DNA Methylation in Antigen-Specific Memory CD4 T Cells Shin-ichi Hashimoto, Katsumi Ogoshi, Atsushi Sasaki, Jun Abe, Wei Qu, Yoichiro Nakatani, Budrul Ahsan, Kenshiro Oshima, Francis H. W. Shand, Akio Ametani, Yutaka Suzuki, Shuichi Kaneko, Takashi Wada, Masahira Hattori, Sumio Sugano, Shinichi Morishita and Kouji Matsushima J Immunol Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Author Choice option Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Freely available online through http://www.jimmunol.org/content/suppl/2013/03/18/jimmunol.120226 7.DC1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material Permissions Email Alerts Subscription Author Choice Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 24, 2021. Published March 18, 2013, doi:10.4049/jimmunol.1202267 The Journal of Immunology Coordinated Changes in DNA Methylation in Antigen-Specific Memory CD4 T Cells Shin-ichi Hashimoto,*,†,‡ Katsumi Ogoshi,* Atsushi Sasaki,† Jun Abe,* Wei Qu,† Yoichiro Nakatani,† Budrul Ahsan,x Kenshiro Oshima,† Francis H.
    [Show full text]
  • Views of Distant-Acting G, Gudbjartsson DF, Magnusson KP, Andersen K, Levey AI, Backman Enhancers
    BASIC RESEARCH www.jasn.org A 4.1-Mb Congenic Region of Rf-4 Contributes to Glomerular Permeability † ‡ † Caitlin C. O’Meara,* Michelle M. Lutz, Allison B. Sarkis,* Haiyan Xu,* Rajendra K. Kothinti,§ † † | Matthew Hoffman,* Carol Moreno,* Niloofar M. Tabatabai,§ Jozef Lazar,* † Richard J. Roman,¶ and Howard J. Jacob* ** *Human and Molecular Genetics Center and Departments of †Physiology, ‡Anesthesiology, §Medicine, |Dermatology, and **Pediatrics, Medical College of Wisconsin, Milwaukee, Wisconsin; and ¶Department of Pharmacology and Toxicology, University of Mississippi Medical Center, Jackson, Mississippi ABSTRACT The combined transfer of two renal function quantitative trait loci (QTLs), Rf-1 (rat chromosome 1) and Rf-4 (rat chromosome 14), from the Fawn-hooded hypertensive rat onto the August Copenhagen Irish genetic background significantly increases proteinuria and demonstrates an interaction between these QTLs. Because the original Rf-4 congenic region is 61.9 Mbp, it is necessary to reduce this interval to feasibly search for variants responsible for renal susceptibility in this region. Here, we generated a minimal con- genic line (Rf-1a+4_a) to identify a 4.1-Mb region of the Rf-4 QTL that significantly contributes to the severity of proteinuria in the Fawn-hooded hypertensive rat. Rf-1a+4_a animals have an increased glo- merular permeability to albumin without significant changes in BP, indicating that at least one genetic element in this refined region directly affects renal function. Sequence analysis revealed no variants pre- dicted to damage protein function, implying that regulatory elements are responsible for the Rf-4 phe- notype. Multiple human studies, including recent genome-wide association studies, link the homologous human region with susceptibility to renal disease, suggesting that this congenic line is an important model for studying pathways that contribute to the progression of kidney disease.
    [Show full text]
  • Whole Exome Sequencing in Families at High Risk for Hodgkin Lymphoma: Identification of a Predisposing Mutation in the KDR Gene
    Hodgkin Lymphoma SUPPLEMENTARY APPENDIX Whole exome sequencing in families at high risk for Hodgkin lymphoma: identification of a predisposing mutation in the KDR gene Melissa Rotunno, 1 Mary L. McMaster, 1 Joseph Boland, 2 Sara Bass, 2 Xijun Zhang, 2 Laurie Burdett, 2 Belynda Hicks, 2 Sarangan Ravichandran, 3 Brian T. Luke, 3 Meredith Yeager, 2 Laura Fontaine, 4 Paula L. Hyland, 1 Alisa M. Goldstein, 1 NCI DCEG Cancer Sequencing Working Group, NCI DCEG Cancer Genomics Research Laboratory, Stephen J. Chanock, 5 Neil E. Caporaso, 1 Margaret A. Tucker, 6 and Lynn R. Goldin 1 1Genetic Epidemiology Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 2Cancer Genomics Research Laboratory, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 3Ad - vanced Biomedical Computing Center, Leidos Biomedical Research Inc.; Frederick National Laboratory for Cancer Research, Frederick, MD; 4Westat, Inc., Rockville MD; 5Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; and 6Human Genetics Program, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD, USA ©2016 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol.2015.135475 Received: August 19, 2015. Accepted: January 7, 2016. Pre-published: June 13, 2016. Correspondence: [email protected] Supplemental Author Information: NCI DCEG Cancer Sequencing Working Group: Mark H. Greene, Allan Hildesheim, Nan Hu, Maria Theresa Landi, Jennifer Loud, Phuong Mai, Lisa Mirabello, Lindsay Morton, Dilys Parry, Anand Pathak, Douglas R. Stewart, Philip R. Taylor, Geoffrey S. Tobias, Xiaohong R. Yang, Guoqin Yu NCI DCEG Cancer Genomics Research Laboratory: Salma Chowdhury, Michael Cullen, Casey Dagnall, Herbert Higson, Amy A.
    [Show full text]