Coordinated Changes in DNA Methylation in Antigen-Specific Memory CD4 T Cells Shin-ichi Hashimoto, Katsumi Ogoshi, Atsushi Sasaki, Jun Abe, Wei Qu, Yoichiro Nakatani, Budrul Ahsan, Kenshiro This information is current as Oshima, Francis H. W. Shand, Akio Ametani, Yutaka of September 24, 2021. Suzuki, Shuichi Kaneko, Takashi Wada, Masahira Hattori, Sumio Sugano, Shinichi Morishita and Kouji Matsushima J Immunol published online 18 March 2013
http://www.jimmunol.org/content/early/2013/03/17/jimmun Downloaded from ol.1202267
Supplementary http://www.jimmunol.org/content/suppl/2013/03/18/jimmunol.120226 Material 7.DC1 http://www.jimmunol.org/
Why The JI? Submit online.
• Rapid Reviews! 30 days* from submission to initial decision
• No Triage! Every submission reviewed by practicing scientists
by guest on September 24, 2021 • Fast Publication! 4 weeks from acceptance to publication
*average
Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Author Choice Freely available online through The Journal of Immunology Author Choice option Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published March 18, 2013, doi:10.4049/jimmunol.1202267 The Journal of Immunology
Coordinated Changes in DNA Methylation in Antigen-Specific Memory CD4 T Cells
Shin-ichi Hashimoto,*,†,‡ Katsumi Ogoshi,* Atsushi Sasaki,† Jun Abe,* Wei Qu,† Yoichiro Nakatani,† Budrul Ahsan,x Kenshiro Oshima,† Francis H. W. Shand,* Akio Ametani,* Yutaka Suzuki,{ Shuichi Kaneko,‖ Takashi Wada,‡ Masahira Hattori,† Sumio Sugano,{ Shinichi Morishita,† and Kouji Matsushima*
Memory CD4+ T cells are central regulators of both humoral and cellular immune responses. T cell differentiation results in specific changes in chromatin structure and DNA methylation of cytokine genes. Although the methylation status of a limited number of gene loci in T cells has been examined, the genome-wide DNA methylation status of memory CD4+ T cells remains
unexplored. To further elucidate the molecular signature of memory T cells, we conducted methylome and transcriptome analyses Downloaded from of memory CD4+ T cells generated using T cells from TCR-transgenic mice. The resulting genome-wide DNA methylation profile revealed 1144 differentially methylated regions (DMRs) across the murine genome during the process of T cell differentiation, 552 of which were associated with gene loci. Interestingly, the majority of these DMRs were located in introns. These DMRs included genes such as CXCR6, Tbox21, Chsy1, and Cish, which are associated with cytokine production, homing to bone marrow, and immune responses. Methylation changes in memory T cells exposed to specific Ag appeared to regulate enhancer activity rather
than promoter activity of immunologically relevant genes. In addition, methylation profiles differed between memory T cell http://www.jimmunol.org/ subsets, demonstrating a link between T cell methylation status and T cell differentiation. By comparing DMRs between naive and Ag-specific memory T cells, this study provides new insights into the functional status of memory T cells. The Journal of Immunology, 2013, 190: 000–000.
D4+ T cells are central regulators of both humoral and static proliferation, such that they are able to respond rapidly to cellular immune responses. Activation of naive CD4+ subsequent exposure to the same Ag (1, 2). Recently, it was re- C T cells by Ag induces cell proliferation, resulting in the ported that the first exposure of a naive T cell to Ag and cytokine formation of a large number of effector cells and, subsequently, signals results in specific changes in the cell’s chromatin structure a limited number of memory cells. Memory CD4+ T cell pop- and in DNA methylation of the cell’s cytokine genes (3–5). by guest on September 24, 2021 ulations are maintained by cytokine survival signals and homeo- Chromatin modifications are known to impose epigenetic con- trols on gene expression without changing DNA sequence (6). These modifications determine the level of cell type–specific gene *Department of Molecular Preventive Medicine, Graduate School of Medicine, The University of Tokyo, Tokyo 113-0033, Japan; †Department of Computational Biol- transcription by modulating the accessibility of genes to tran- ogy, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277- scription factors and the basal transcription apparatus. It is well ‡ 8561, Japan; Division of Nephrology, Department of Laboratory Medicine, Kana- known that epigenetic regulation is linked to gene repression of zawa University, Kanazawa 920-8641, Japan; xDepartment of Neurology, Graduate School of Medicine, The University of Tokyo, Tokyo 113-0033 Japan; {Department oncogenes and development-related genes (6, 7). Genes that are of Medical Genome, Graduate School of Frontier Sciences, The University of ‖ active (open) in a particular tissue or cell type have increased Tokyo, Chiba 277-8561, Japan; and Department of Disease Control and Homeostasis, acetylation and methylation of their histones (e.g., H3K4 meth- Faculty of Medicine, Kanazawa University, Kanazawa 920-8641, Japan ylation), whereas genes that are inactive (closed) are characterized Received for publication August 20, 2012. Accepted for publication February 13, 2013. by highly condensed chromatin and decreased acetylation and This work was supported by a Grant-in-Aid for Scientific Research (C) and Core methylation of their histones (e.g., H3K9 and H3K27 methyla- Research for Evolution Science and Technology of the Japan Science and Technol- tion). In addition, DNA methyltransferases establish and maintain ogy Agency. S.-i.H. was supported by the “Genome Information Big Bang” Global the pattern of genomic DNA methylation of cytosines in CpG Center of Excellence project from the Ministry of Education, Culture, Sports, Sci- ence, and Technology of Japan. dinucleotides. DNA methylation status is generally considered to The sequences presented in this article have been submitted to the National Center correlate inversely with transcriptional activity, with transcrip- for Biotechnology Information Sequence Read Archive (http://www.ncbi.nlm.nih. tionally silent genes being highly methylated and transcriptionally gov/sra) under accession number SRP007816. active regions being relatively unmethylated (8, 9). DNA meth- Address correspondence and reprint requests to Dr. Shin-ichi Hashimoto, Department ylation is also associated with epigenetic gene regulation during of Molecular Preventive Medicine, Graduate School of Medicine, The University of Tokyo, Tokyo 113-0033, Japan. E-mail address: [email protected] embryogenesis, genomic imprinting, and X-chromosome inacti- vation (10, 11). The online version of this article contains supplemental material. In the immune system, a lack of methylation at the appropriate Abbreviations used in this article: BM, bone marrow; CGI, CpG island; DMR, differentially methylated region; GO, Gene Ontology Consortium Database; MSCC, loci in T and B lymphocytes is associated with transcription and methyl-sensitive cut counting; P/I, PMA/ionomycin; SAGE, serial analysis of gene rearrangement of Ig and TCR genes, as well as with cell lineage– expression; TAE, Tris–acetate–EDTA; Tg, transgenic; TSS, transcription start site. specific expression of CD4, CD8, and CD21 (12–15). When naive This article is distributed under The American Association of Immunologists, Inc., T cells differentiate to Th1 cells, but not to Th2 cells, DNase Reuse Terms and Conditions for Author Choice articles. hypersensitive sites appear in the IFN-g gene (16). Furthermore, Copyright Ó 2013 by The American Association of Immunologists, Inc. 0022-1767/13/$16.00 the IFN-g gene is methylated to a lesser extent in human and
www.jimmunol.org/cgi/doi/10.4049/jimmunol.1202267 2 METHYLOME AND TRANSCRIPTOME ANALYSES IN MEMORY T CELLS murine Th1 and CD8 effector cells than in naive and Th2 cells. In Adapters A1 (59-TTTCCACTACGCCTCCGCTTTCCTCTCTATGGG- contrast, the IL-4 and IL-5 genes are less methylated in Th2 cells CAGTCGGTGATCCGAC-39)andA2(59-CGGTCGGATCACCGAC- than in Th1 cells. Treatment of T cells in vitro with drugs that in- TGCCCATAGAGAGGAAAGCGGAGGCGTAGTGG-39) contain a 59 MmeI recognition site and a 59-CG overhang; adapters B1 (59-CGC- hibit histone deacetylases or DNA methylation increases IL-4 and CTTGGCCGTACAGCAGAGCTTACCGCAGAGAATGAGGAACCCG- IFN-g expression. Moreover, naive T cells from conditional Dnmt1- GGGCAG-39) and B2 (59-TTTCTGCCCCGGGTTCCTCATTCTCTGCG- knockout mice, which lack DNA (cytosine-5-)-methyltransferase 1, GTAAGCTCTGCTGTACGGCCAAGGCGNN-39) contain a 39-NN over- express substantially more IFN-g and IL-4 after Ag activation, an hang and barcode (more information in Supplemental Table I), as de- scribed in the Applied Biosystems protocol. To construct the MSCC HpaII effect that appears to be mediated, at least in part, by demethylation library, 1 mg genomic DNA isolated from CD4+ T cells was mixed with of the cis-regulatory element (17). Recently, it was demonstrated 8 U HpaII (New England BioLabs) in 13 NEBuffer 1 in a 50-ml reaction that demethylation of the FOXP3 locus is pivotal for differentiation volume and incubated at 37˚C for 12 h. Another 8 U HpaII was added, and of CD4+CD25+ regulatory T cells (18) and that the CpG regions of the mixture was incubated at 37˚C for an additional 3 h. DNA was purified cell type–specific genes (e.g., IL2RA, CTLA4, and CD40LG) in by phenol-chloroform extraction and ethanol precipitation and resus- + pended in 12.5 mldH2O. This 12.5-ml DNA solution was mixed with 1.5 conventional human CD4 T cells and regulatory T cells are dif- ml a mixture containing 5 mM adaptor A1, 5 mM adaptor A2, and 10 U T4 ferentially methylated (19). A limiting DNA methylation affects the DNA ligase (Invitrogen) before incubation at 16˚C for 12 h. DNA was proliferative potential of Ag-specific CD8+ T cells with moder- again purified by phenol-chloroform extraction and ethanol precipitation ate effects on their differentiation to effector and memory CD8+ and resuspended in 8 mldH2O. This DNA was run on a 10% nondenaturing Tris–acetate–EDTA (TAE) polyacrylamide gel, and the 60–80-bp band T cells (20). Additionally, methyl-CpG–binding domain protein was purified. After ethanol precipitation, the DNA pellet was resuspended + 2–deficient mice display reduced memory CD8 T cell differen- in 70 ml a reaction mixture containing 14 U MmeI (New England BioL- tiation following acute viral infection (21). abs), 50 mM S-adenosyl methionine, and 13 NEBuffer 4. This mixture Downloaded from These findings indicate that DNA methylation is crucial for was incubated at 37˚C for 12 h, after which DNA was again purified by memory T cell development and cytokine production. However, in phenol-chloroform extraction and ethanol precipitation and resuspended in 13 mldH2O. This DNA solution was mixed with 1 ml each 5.8 mM adaptor T cells, the DNA methylation status of only a limited number of B1 and B2 and 10 U T4 DNA ligase, and the mixture was incubated at 16˚ genes has been examined. The genome-wide DNA methylation C for 12 h. DNA was again purified and resuspended in 20 mldH2O. This status of memory CD4+ T cells derived from Ag-stimulated naive DNA solution was mixed with 10 U DNA polymerase I (New England BioLabs), 33 mM29-deoxynucleoside 59-triphosphate, and 13 NEBuffer cells remains unexplored. In this study, we investigated the gene- http://www.jimmunol.org/ and incubated at 16˚C for 30 min. DNA was again purified and resus- expression profiles and genome-wide DNA methylation status of pended in 8 mldHO. This DNA was run on a 9% nondenaturing TAE + 2 naive and Ag-specific memory CD4 murine T lymphocytes. polyacrylamide gel, and the 120–140-bp band was purified. The purified DNA was then amplified by PCR using the primers 59-CCACTAC- GCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT-39 and 59-CTGC- Materials and Methods CCCGGGTTCCTCATTCTCT-39. The 20-ml mixture for PCR contained Mice 200 nM of each primer, 200 nM 29-deoxynucleoside 59-triphosphate, 13 PS buffer, and 1.25 U PrimeSTAR HS DNA polymerase (TaKaRa) and was BALB/c mice were purchased from Clea (Tokyo, Japan). OVA-specific run at 98˚C for 30 s; 10 cycles at 98˚C for 5 s, 62˚C for 15 s, 72˚C for 3 2/2 TCR-transgenic (Tg) mice (DO.11.10; OVA-specific TCR Tg RAG2 1 min; and then 72˚C for 10 min. The PCR product was run on a 9% non- mice) were maintained under specific pathogen–free conditions. denaturing TAE polyacrylamide gel, and the 120–130-bp band was puri- by guest on September 24, 2021 fied. The purified libraries were sequenced with the Applied Biosystems Reagents SOLiD4 system, following the manufacturer’s protocol. The integrity of the cDNA was confirmed using an Agilent 2100 Bioanalyzer prior to The anti–CD4-Pacific Blue (RM4-5), anti-CD62L mAb (MEL-14), anti– construction of the MSCC libraries. A 1-ng sample of size-fractionated CD25-PE (7D4), PE-conjugated anti-CD4 mAb (GK1.5-PE), anti–CD44- cDNA was used for sequencing reactions. bio (IM7), anti–CD69-bio (H1.2F3), anti–CD127-bio (A7R34), IFN-g– An MspI control library was constructed in the same manner as the HpaII FITC (XMG1.2), anti–IL-4–Alexa Fluor 647 (11B11), anti–TNF-a–PE/ library, with the following exceptions: in the first step, 100 U MspI (New Cy7 (MP6-XT22), anti-mouse TCR DO11.10-PerCP/Cy5.5 (KJ1-26), and England BioLabs) was used instead of HpaII, and NEBuffer 2 was used streptavidin-allophycocyanin were purchased from BD Pharmingen and instead of NEBuffer 1, and no amplification was performed following gel eBioscience. purification. All HpaII libraries were normalized to 5 million. + SOLiD BioScope software (version 1.3) was used to determine methyl- Generation of effector and memory CD4 T cells sensitive restriction enzyme scores and map MSCC sequence reads (20 bp OVA-specific naive CD4+ T cells were isolated from the spleens of from the MmeI restriction site) to the mouse genome assembly (NCBI37/ DO11.10-Tg mice. To generate effector cells, naive CD4+ T cells were mm9). A DNA-methylation score was defined as the sum of tag sequence hits (a plus-strand tag and a minus-strandtag) for each restriction enzymesite, stimulated with 1 mg/ml an OVA peptide (residues 323–339; ISQAV- 6 HAAHAEINEAGRD; synthesized by Sigma Genosys, Hokkaido, Japan) in the absence of repetitive sites, and normalized to 10 reads by the specific plus allophycocyanin for 5 d in vitro (22). Five million of these cells were enzyme. To avoid inaccurate identification of methylation sites, differen- tially methylated regions (DMRs) were defined as those with a change from transferred i.v. into normal syngeneic BALB/c recipient mice. In most . experiments, 4 wk after effector cell transfer, KJ1+ cells from the spleens 0 tags (high-methylation group) to 10 tags (low-methylation group). of recipient mice were sorted by FACSVantage (BD Pharmingen) and used as memory CD4+ T cells. Generation and sequencing of the 59-serial analysis of gene expression library Assays for cytokine production A newly developed 59-end mRNA collection method (24) has extended the Naive effector and memory KJ-1+CD4+ T cells were restimulated with range of the original 59-end serial analysis of gene expression (SAGE) PMA (20 ng/ml)/ionomycin (1 mg/ml) (P/I) and brefeldin A (10 mg/ml) for technique. This method initially profiles 25-nucleotide 59-SAGE tags using 5 h. Cells were then fixed (Cytofix buffer; BD Pharmingen), per- a novel strategy that incorporates the oligo-capping method. The 59-SAGE meabilized, stained intracellularly with anti–IFN-g Ab, anti–IL-4 Ab, or tags are then ligated directly to a linker for sequencing. The purified li- anti–TNF-a Ab or its isotype control, and analyzed using a Gallios Flow braries were sequenced with a Solexa system, according to the manu- Cytometer (Beckman Coulter). facturer’s protocol (Illumina). The integrity of the cDNA was confirmed using an Agilent 2100 Bioanalyzer prior to construction of 59-SAGE li- Methyl-sensitive cut counting library construction braries. A 1-ng sample of size-fractionated cDNA was used for sequencing reactions with the Illumina GA, performed according to the manufacturer’s The integrity of cDNA was confirmed using an Agilent 2100 Bioanalyzer instructions. We assigned unique tags to RefSeq genes (University of prior to construction of the methyl-sensitive cut counting (MSCC) libraries. California, Santa Cruz, http/hgdownload.cse.ucsc.edu/goldenPath/mm9/ The protocol for MSCC library construction was modified slightly from that database/) when the start position of the tag was within 500 bp upstream described previously (23). of the transcription start site (TSS), based on RefSeq annotation. The Journal of Immunology 3
FIGURE 1. Surface marker and cytokine expres- sion in naive and Ag-specific effector and memory CD4+ T cells. Splenic CD4+ T cells from DO11.10- Tg mice were stimulated with an OVA323–339 peptide plus APC for 5 d in vitro, resulting in Ag- specific effector cells, followed by transfer into nor- mal syngeneic BALB/c recipient mice to generate memory cells. (A) Surface markers on CD4+ Tcells Downloaded from (double positive for KJ1 and CD4, upper left panel) were analyzed by flow cytometry. (B)IFN-g,IL-4, and TNF-a production by naive, effector, and mem- ory CD4 T cells was assessed by intracellular cyto- kine staining. http://www.jimmunol.org/ by guest on September 24, 2021
Real-time PCR EL-4 T cells (5 3 106 cells) were transfected with 2.5 mgeither methylated or unmethylated pCpGL-DMR/EF1 vector or using a control cDNA was prepared from total RNA samples using an Applied Biosystems plasmid with no insert, in triplicate. Synthetic Renilla luciferase reporter (Foster City, CA) cDNA Archive Kit and random primers. The assay was vector (pRL-TK; Promega) was cotransfected (1.5 mg) and served as an run in triplicate for each RNA sample, in accordance with the manu- internal control for efficiency. EL-4 cells were electroporated with a Bio- facturer’s recommendations, with each reaction containing 50 ng total Rad Gene Pulser at 270 V and a capacitance of 975 mF. Twelve hours later, cDNA (as total input RNA) per 20-ml reaction volume. The cycling con- transfected cells were stimulated with PMA (50 ng/ml) and ionomycin 3 ditions for SYBR Green dye I quantitative real-time PCR with 2 Applied (0.5 mg/ml) for 16 h. The cells were harvested, and luciferase activity was Biosystems Universal Master Mix were 2 min at 50˚C, 10 min at 95˚C, measured by the Dual Luciferase Assay system using an Orion L luminometer. followed by 40 rounds of 15 s at 95˚C and 1 min at 60˚C, with analysis by Firefly raw light unit data were normalized to Renilla luciferase activity an Applied Biosystems 7500 PCR system. b-actin was used as the refer- and expressed relative to the control vector with no insert. ence gene. Primer sequences are listed in Supplemental Table I. Data ac- quisition and analysis were performed using SDS 2.1 software in relative Gene ontology quantity mode, with each sample analyzed three times. After PCR, CT values were determined and used to calculate normalized 22DDCT values. Gene ontology was estimated using GOstat software (25). Luciferase reporter assay Fragments of DMRs of the mouse Nr1D1, Ptgir, Tnfsf4, Tbx21, Cish, Chsy1, Sdf4, Hps4, Sema4d, Mtss1, Klf7, Wdfy2, Nr5a1, and MapK1lip1 Table I. Genome-wide methylation sequencing summary for CD4+ T loci were amplified by PCR using genomic DNA as a template and the cell DNA cut with HpaII or MspI restriction nuclease primers shown in Supplemental Table I. To generate a luciferase reporter vector on a CpG-free background, the 500–800-bp PCR product was inserted into the pCpGL-CMV/EF1 vector (a gift from Dr. M. Rehli and Cell Type Nuclease No. of Hits in Genome Unique Tagsa % Dr. M. Klug) using the In-Fusion cloning system (Clontech), replacing the CMV enhancer with the DMR regions (19). Naive HpaII 9,902,632 5,074,880 51 The luciferase reporter vector pCpGL-Cish-DMR/EF1 was methylated MspI 12,994,381 5,499,474 42 in vitro using methylase SssI (New England BioLabs), according to the Effector HpaII 9,349,718 6,039,406 65 manufacturer’s instructions, followed by purification using a QIAquick MspI 9,673,142 6,140,353 63 PCR clean-up kit. In control samples using pCpGL-EF1 and pCpGL-Cish- Memory HpaII 13,582,273 7,055,612 52 DMR/EF1, the methyl-group donor S-adenosylmethionine was omitted. MspI 9,943,128 4,193,004 42 Successful methylation of the reporter plasmid containing the DMR was Total 65,445,274 34,002,729 52 verified by reaction with the methylation-sensitive and methylation- Twenty-base pair MSCC tags were mapped in the genome. resistant enzymes HpaII and MspI, respectively. aNumber of tags in restriction sites for analysis of DNA methylation. 4 METHYLOME AND TRANSCRIPTOME ANALYSES IN MEMORY T CELLS
stimulated effector and memory cell populations were investi- gated. Within effector and memory T cell populations, 24 and 43%, respectively, expressed IFN-g but not IL-4, within which 28 and 50% of cells coexpressed TNF-a (Fig. 1B).
DNA-methylation profiling in memory T cells In this study, we used a recently developed MSCC method (23) that enables high-throughput, genome-wide identification of meth- ylated CpG sites by SOLiD sequencing. Using the HpaII restriction nuclease, which recognizes unmethylated CCGG, most short- sequence tag fragments at HpaII cleavage sites can be uniquely mapped to genome locations. Methylation-sensitive restriction enzymes typically have a recognition site that contains a CpG di- nucleotide, and cleavage is blocked if that site is methylated. Sites FIGURE 2. The relationship between MSCC tag counts and bisulfite sequencing data. To validate the methylation levels determined by MSCC, with many reads are inferred to have low methylation levels, we designed primers targeting 130 profiled locations in bisulfite-treated whereas sites with few or no reads are inferred to have high DNA and performed PCR amplification and Sanger sequencing of the PCR methylation levels. The murine genome contains 1,594,139 CCGG product. Horizontal lines represent median methylation as determined by sites, of which 1,130,065 (71%) can be uniquely mapped. Although bisulfite sequencing, boxes represent the quartiles, and whiskers mark the each restriction enzyme site can generate two library tags, we Downloaded from 5th and 95th percentiles. p , 0.01, Kruskal–Wallis H test. considered the sum of tag sequences for each restriction enzyme site. A total of 619,060 sites (55%) was located within the promoter Bisulfite sequencing and gene body regions of unique genes, and 11% of these were within CpG islands (CGIs). A control library was also constructed Bisulfite sequencing was performed to verify SOLiD data. Bisulfite modification of genomic DNA was performed using the EpiTect Bisulfite by replacing HpaII with MspI, a methylation-insensitive isos-
Kit (QIAGEN). We used Methyl Primer Express software (Applied Bio- chizomer of HpaII. The tags cut with MspI were used for deter- http://www.jimmunol.org/ systems) to design primers. Bisulfite-treated DNA was amplified by PCR. mining zero-tag count or nonhit sites, because no tag from a HpaII The PCR products were cloned into the pCR2.1-TOPO vector and trans- library may correspond to a fully methylated site or false negative. formed into One Shot TOP10 Competent Cells (Invitrogen). At least 24 Using the SOLiD platform, ∼65 million reads of methylation clones were sequenced using an ABI3730 Sequencer. The data were an- + alyzed using QUMA, a quantification tool for methylation analysis (Riken tags from naive, effector, and memory CD4 T cell genomes cut Institute of Physical and Chemical Research, Yokohama, Japan). with HpaII or MspI were aligned to the mouse genome, with at most Statistical analysis two mismatches, to allow for sequencing errors and single nucleo- tide polymorphisms. Thirty-four million (52%) of these tags were Comparisons of each 59-end tag were performed using Z-test statistics (24). aligned to unique sites after repetitive sequences were excluded Accession number (Table I). These MSCC data were analyzed for the methylation by guest on September 24, 2021 59-end and MSCC tags have been deposited in the National Center for levels of individual sites based on bisulfite sequencing. When MSCC Biotechnology Information Sequence Read Archive (http://www.ncbi.nlm. tag counts and DNA methylation for randomly selected HapII sites nih.gov/sra) under accession number SRP007816. were compared, the number of MSCC methylation tags correlated with the methylation levels derived from bisulfite data, consistent Results with results reported previously (23) (Fig. 2). Therefore, we defined + Isolation of Ag-specific memory CD4 T cells three categories of methylation sites: low or hypo (median methyl- To characterize memory T cells using methylome and transcriptome ation ,20%), intermediate (.20 to ,80%), and high or hyper analysis, we generated memory CD4+ T cells from DO11.10 OVA- (.80%). A total of 65 and 64% of unique CpG sites in naive and specific TCR-Tg mice. Splenic CD4+ T cells from the DO11.10-Tg memory CD4+ T cells, respectively, was hypermethylated, whereas mice were stimulated with an OVA323–339 peptide plus allophy- 13% in both naive and memory cells had low methylation. Around cocyanin for 5 d in vitro and then transferred i.v. into normal syn- TSSs, 28 and 31% of sites in naive and memory cells, respectively, geneic BALB/c recipient mice. The transferred DO11.10-Tg T cells were hypermethylated, whereas 45 and 41%, respectively, had low were monitored by staining with a clonotypic KJ1 mAb. At the time methylation. In addition, only 28 and 30% of CGIs in naive and of transfer, cell surface marker expression was CD44high CD127+ memory cells, respectively, were methylated. CD25+ CD69+ and CD62L+, but by 4 wk after cell transfer the activation markers CD25 and CD69 were no longer expressed (Fig. Comparison of CpG methylation between naive and memory 1A). These observations support the development of effector and T cells memory T cell phenotypes, respectively. To confirm the functional To observe changes in DNA methylation during T cell differen- status of these cells, cytokine-production profiles of naive and Ag- tiation, the methylation status of CpG sites in gene-associated
FIGURE 3. DMRs in DNA from naive and memory CD4+ T cells. DMRs were classified based on their location in promoter (up to 500 bp from a TSS, based on RefSeq annotation), exon, intron, and intergenic regions based on their position rel- ative to known genes. The number of sites repre- sents defined HpaII restriction sites. The p values were calculated using the Fisher exact test. The Journal of Immunology 5
Table II. Methylation of the 59-region of naive and memory CD4+ T important for gene expression. Thus, we examined the DNA cell genes with a DMR in an intron methylation status of gene-upstream regions (promoter and first exon) for DMRs. Others investigators reported a correlation be- No. of Tags tween the methylation status of adjacent CpG sites and a high No. of incidence of short-range comethylation (26, 27). Eighty-eight Naive cells Memory cells Genes (%) percent of genes with DMRs showed hypomethylation in their Hypomethylation ($10) Hypomethylation ($10) 273 (87.5) promoter/first exon in naive and memory T cells (Table II). CpG Hypomethylation ($10) Hypermethylation (#2) 0 (0) methylation of the first intron and second exon of Cish and of the Hypermethylation (#2) Hypomethylation ($10) 1 (0.3) first intron of Tbx21, but not of the promoter regions, was different Hypermethylation (#2) Hypermethylation (#2) 29 (9.3) between naive and memory T cells (Fig. 4). The results of MSCC Obscure methylation 9 (2.9) Total 312 (100) analysis of a series of DMRs was consistent with bisulfite se- quencing data. These data suggest that DNA methylation in the gene body (introns and after second exons) may be characteristic regions (the gene body including 500 bp upstream from the TSS) of the memory cell phenotype. To identify the function of genes was compared between naive and memory T cells. When a DMR differentially methylated between naive and memory T cells, was defined as a change from 0 to .10 tags at sites cut by MspI, genes with DMRs were classified using the Gene Ontology 1144 sites were identified as DMRs during T cell differentiation Consortium database (GO) (Table III). Genes associated with cell (Supplemental Table II). Fifty-one percent (552) of these DMRs communication, signal transduction, and intracellular signaling were in gene-associated regions, and 467 sites associated with 437 pathways tended to be hypomethylated in memory T cells. In Downloaded from genes were unmethylated in memory cells. In contrast, 85 sites contrast, genes associated with development processes and bio- associated with 84 genes were methylated in memory cells. The logical regulation tended to be hypomethylated in naive T cells. remaining 49% of the DMRs were in intergenic regions. Fig. 3 shows the DMR positions in the genome. The number of DMRs in DNA methylation and gene expression in memory T cells the 59-region (500 bp upstream from the TSS and first exon) was To investigate the relationship between gene expression and
significantly lower than in other regions. Many DMRs were lo- changes in CpG methylation in DMRs, we analyzed the gene http://www.jimmunol.org/ cated in introns, with a few in CGIs. Our data indicated that DNA expression of naive cells, in vitro–activated effector cells, and methylation in gene-promoter regions did not always correspond memory CD4+ T cells using the Illumina/Solexa sequencing to a repressive epigenetic event in CD4+ T cells. It is well known system. More than 12 million 25-base 59-SAGE tags were ob- that the region upstream of a gene, including the promoter, is tained from the three libraries and matched to sequences in the by guest on September 24, 2021
FIGURE 4. DMRs in the Cish and Tbx21 loci of naive, effector, and memory T cells. Genomic organization of the mouse Cish (A) and Tbx21 (C) loci, showing transcription start sites (arrows), single CGI (boxes), and exons (light blue). MSCC analysis of naive, effector, and memory T cells was across the 59-end of each loci. Each vertical line (brown) represents a mean normalized tag from the MSCC analysis at the genomic location (listed on the x-axis) within the Cish and Tbx21 loci on chromosomes 9 and 11, respectively (University of California, Santa Cruz genome browser). Results of genomic bisulfite sequencing for Cish (B) and Tbx21 (D). Each row of circles represents an individual clone sequenced in the analysis after bisulfite treatment and PCR. Open circles indicate CpG sites at which no DNA methylation was detected. Filled circles indicate CpG sites that were methylated. Stars indicate the position of restriction sites detected by MSCC. Percentage values indicate the DNA methylation ratio of each region, as measured by bisulfite sequencing. 6 METHYLOME AND TRANSCRIPTOME ANALYSES IN MEMORY T CELLS
Table III. Gene ontology of DMR-associated genes
Best GO Category Count Total p Valuea Hypomethylated in memory T cells GO:0007154 Cell communication 119 5560 3.49E218 GO:0007165 Signal transduction 111 5142 2.65E217 GO:0007242 Intracellular signaling pathway 55 1965 4.94E214 GO:0007267 Cell–cell signaling 25 640 5.25E211 GO:0032502 Developmental process 69 3347 1.20E208 GO:0007275 Multicellular organismal development 53 2299 1.20E208 GO:0032501 Multicellular organismal process 75 3822 2.33E208 GO:0048731 System development 39 1605 5.67E207 GO:0065007 Biological regulation 109 6731 7.44E207 GO:0050789 Regulation of biological process 101 6140 1.22E206 GO:0007215 Glutamate signaling pathway 6 21 3.93E206 GO:0048519 Negative regulation of biological process 30 1182 7.67E206 GO:0048856 Anatomical structure development 43 2005 8.94E206 GO:0009966 Regulation of signal transduction 23 800 8.94E206 GO:0048523 Negative regulation of cellular process 29 1137 8.96E206 Hypomethylated in memory T cells GO:0032502 Developmental process 19 3347 4.57E206 GO:0065007 Biological regulation 29 6731 4.57E206 Downloaded from GO:0050789 Regulation of biological process 27 6140 6.68E206 GO:0016070 RNA metabolic process 21 4155 8.43E206 aEach category was based on a p value , 1.0E205. murine genome (Table IV). Seventy-four percent of unique map- EL-4 T cells using unmethylated (CpG) or in vitro SssI-methylated ped tags were associated with RefSeq cDNA sequences, corre- (mCpG) reporter plasmids. The transcriptional activity of the lu- http://www.jimmunol.org/ sponding to ∼12,000–14,000 different protein-coding genes in this ciferase reporter construct containing the DMR of Ptgir, Tnfsf4, cell type (Supplemental Table III). The expression level of 1256 Tbx21, Cish, Chsy1, IL7r, and Acot7 genes was 2-fold greater than genes was significantly different between naive and effector cells, that of the empty control vector (pCpGL-EF1) (Fig. 5). For these whereas 259 genes were expressed significantly differently be- genes, transcriptional activation was reduced following in vitro tween naive and memory cells (p , 0.001, .10-fold difference). methylation of the CpGs in the corresponding DMRs, demon- The 30 genes with the largest relative difference between effector strating a suppressive effect of methylation on enhancer function. and naive cells and between memory and naive cells are listed In contrast, for the luciferase reporter constructs containing the
in Table V. DMR of seven of the eight genes that showed reduced expression by guest on September 24, 2021 When gene-expression levels and DMRs were compared be- in memory cells compared with naive cells, transcriptional activity tween naive and memory CD4 T cells, 24 DMRs were associated was unchanged relative to the empty control vector. Further val- with increased expression of genes (e.g., CXCR6, Tbox21, Chsy1, idation confirmed that MSCC tag counts correlated with bisulfite- and Cish) in memory cells compared with naive cells (.10 tags sequencing data for these genes. For example, DMRs in Klf7 and and .4-fold difference) (Table VI). In contrast, 27 DMRs were Mapk1ip1 had higher MSCC counts in memory cells (indicating associated with decreased expression of other genes (e.g., Maff, less DNA methylation) but higher expression levels in naive cells Ephb6, and Trpm2). Classification using GO revealed that these (Fig. 6). Thus, although these DMRs may possess an alternative genes are related to signal transduction, cell communication, and function, such as inhibition of silencer binding to the gene region, immune responses. These findings indicate that key genes relating they do not influence enhancer activity. to the memory phenotype undergo variable changes in DNA DNA methylation status in T cell subsets methylation during CD4+ T cell differentiation. We next investigated DNA methylation in effector CD4+ T cells. The relationship between DNA methylation and enhancer Effector CD4+ T cells were isolated 5 d after Ag stimulation for activity gene-expression analysis. Interestingly, DMR methylation in To examine the functional implications of these DMRs, we con- effector cells followed different kinetics during differentiation structed a luciferase reporter vector consisting of the EF1 promoter compared with naive and memory cells. DMRs were classified and sequences derived from the DMR in the introns of 15 genes, into six distinct groups by DNA-methylation analysis (Table VII). which positively and negatively correlated with gene expression. Twenty-seven percent of DMRs were hypermethylated in naive Transient transfections were performed in untreated or P/I-treated and effector cells but were hypomethylated in memory cells
Table IV. Summary of CD4+ T cell sequencing
Cell Type Sequenced Tags Unique Tags Mapped Tags (one locus) Tags in RefSeq Gene No. Gene No. (.1 copy) CD4+ naive T cells 12,088,592 7,883,186 4,122,853 3,382,975 14,064 8,715 CD4+ effector T cells 8,660,468 4,547,959 4,449,231 2,790,122 12,877 8,756 CD4+ memory T cells 11,442,151 6,258,543 3,916,175 3,179,174 13,384 8,138 Unique tags were aligned to a position unambiguously. Unique tags in TSSs were the number of unique tags mapped to regions within 500 bases of the representative TSSs of genes in the RefSeq database. Unique tags were categorized into three groups based on the number of mismatches in individual alignments. Effector T cells were generated from CD4+ T cells from DO11.10-Tg mice stimulated with an OVA peptide plus allophycocyanin conditions for 5 d in vitro. Memory CD4 T cells were isolated from spleen and lymph node at 4 wk after cell transfer. 1 copy = 20 tags/3 million tags, because human cells are predicted to contain 300,000 mRNA molecules. The Journal of Immunology 7
Table V. Gene-expression profile of effector and memory CD4+ T cells compared with naive CD4+ T cells
No. of Tags in
Naive T Cells Effector . Naive Effector T Cells Memory T Cells RefSeq Description 0 54,848 4 NM_008630 Metallothionein 2 2 27,314 161 NM_139198 Placenta-specific 8 1 2,483 7 NM_011340 Serine or cysteine proteinase inhibitor clade 0 1,837 66 NM_001111099 Cyclin-dependent kinase inhibitor 1A P21 1 1,620 19 NM_145158 Elastin microfibril interfacer 2 0 1,354 5 NM_013542 Granzyme B 1 1,100 185 NM_008519 Leukotriene B4 receptor 1 5 6,117 7 NM_009375 Thyroglobulin 1 931 5 NM_133662 Immediate early response 3 1 904 1 NM_053095 IL 24 0 895 20 NM_021397 Repressor of GATA 2 1,461 17 NM_007796 CTL-associated protein 2 7 5,661 3819 NM_026820 IFN-induced transmembrane protein 1 11 7,979 94 NM_010370 Granzyme A 0 713 4 NM_001080815 Gastric inhibitory polypeptide receptor
0 543 21 NM_008147 gp49 A Downloaded from 1 448 9 NM_133720 Cysteinyl leukotriene receptor 2 2 879 3 NM_009150 Selenium binding protein 1 50 22,626 82 NM_011401 Solute carrier family 2 facilitated glucose 0 453 2 NM_147776 von Willebrand factor A domain–related protein 3 1,202 81 NM_011498 Basic helix-loop-helix domain containing class 2 724 0 NM_008156 GPI specific 0 348 1 NM_178241 IL-8 receptor a 63 21,938 26 NM_013602 Metallothionein 1 http://www.jimmunol.org/ 39 13,419 53 NM_001077508 TNF receptor superfamily 1 299 38 NM_008337 IFN g 0 326 4 NM_001004174 Hypothetical protein LOC433470 0 325 0 NM_207279 Phosphatidylinositol-specific phospholipase C X 0 322 21 NM_013532 Leukocyte Ig-like receptor 0 319 0 NM_009137 Chemokine C-C motif ligand 22 Effector , Naive 1517 0 159 NM_009777 Complement component 1 q subcomponent, B chain 665 0 93 NM_007574 Complement component 1 q subcomponent, C chain 590 0 39 NM_007572 Complement component 1 q subcomponent, A chain by guest on September 24, 2021 426 0 43 NM_001083955 Hemoglobin a adult chain 2 407 0 384 NM_011703 Vasoactive intestinal peptide receptor 1 3535 10 1,617 NM_008052 Deltex 1 homolog 2037 7 121 NM_001042605 CD74 Ag isoform 1 306 0 4 NM_019577 Chemokine C-C motif ligand 24 289 0 14 NM_007995 Ficolin A 313 1 13 NM_001080934 Solute carrier family 16 monocarboxylic acid 219 0 5 NM_001037859 Colony stimulating factor 1 receptor 178 0 139 NM_033596 Cistone cluster 2 H4 146 1 14 NM_011414 Secretory leukocyte peptidase inhibitor 387 3 302 NM_013832 RAS protein activator like 1 GAP1 like 120 0 19 NM_133209 Paired immunoglobulin-like type 2 receptor b 117 0 9 NM_008220 Hemoglobin b adult major chain 96 1 33 NM_025806 Hypothetical protein LOC66857 78 0 102 NM_145227 29-59 oligoadenylate synthetase 2 78 0 163 NM_178185 Histone cluster 1 H2ao 78 0 283 NM_001033813 Hypothetical protein LOC619310 85 1 7 NM_008076 g-aminobutyric acid GABA-C receptor 74 0 3 NM_177686 C-type lectin domain family 12 member a 79 1 3 NM_016704 Complement component 6 71 1 6 NM_009913 Chemokine C-C motif receptor 9 64 0 11 NM_138673 Stabilin-2 64 0 9 NM_001024932 Paired immunoglobulin-like type 2 receptor b 2 69 1 5 NM_011518 Spleen tyrosine kinase 523 9 28 NM_009525 Wingless-related MMTV integration site 5B 59 0 4 NM_009721 Na+/K+ -ATPase b 1 subunit 1615 28 734 NM_010494 ICAM 2 Memory . Naive 7 5,661 3819 NM_026820 IFN-induced transmembrane protein 1 2 13 931 NM_001099217 Lymphocyte Ag 6 complex locus C2 15 59 3884 NM_010741 Lymphocyte Ag 6 complex locus C 1 1,100 185 NM_008519 Leukotriene B4 receptor 1 2 122 360 NM_015789 Dickkopf-like 1 1 5 163 NM_010553 IL 18 receptor accessory protein 0 309 179 NM_031395 Synaptotagmin-like 3 isoform a 1 2 146 NM_009915 Chemokine C-C motif receptor 2 (Table continues) 8 METHYLOME AND TRANSCRIPTOME ANALYSES IN MEMORY T CELLS
Table V. (Continued)
No. of Tags in
Naive T Cells Effector . Naive Effector T Cells Memory T Cells RefSeq Description 12 641 1,661 NM_011313 S100 calcium binding protein A6 calcyclin 0 73 129 NM_177716 Hypothetical protein LOC239650 23 4,403 2,963 NM_030694 IFN-induced transmembrane protein 2 209 317 22,679 NM_013653 Chemokine C-C motif ligand 5 1 114 88 NM_146064 Acyl-CoA:cholesterol acyltransferase 2 1 3 84 NM_133643 EDAR ectodysplasin-A receptor–associated death 2 27,314 161 NM_139198 Placenta-specific 8 3 16 224 NM_013599 Matrix metallopeptidase 9 1 53 70 NM_030712 Chemokine C-X-C motif receptor 6 4 72 268 NM_011311 S100 calcium binding protein A4 3 140 186 NM_019507 T-box 21 4 1,051 238 NM_024253 NK cell group 7 sequence 0 1,837 66 NM_001111099 Cyclin-dependent kinase inhibitor 1A P21 1 4 59 NM_016685 Cartilage oligomeric matrix protein 12 34 815 NM_009910 Chemokine C-X-C motif receptor 3
1 0 50 NM_016958 Keratin 14 Downloaded from 1 41 44 NM_008967 PG I receptor IP 132 729 5,823 NM_001013384 Podocan-like 1 0 31 43 NM_010177 Fas ligand TNF superfamily member 6 1 299 38 NM_008337 IFN g 1 1 37 NM_010730 Annexin A1 1 4 36 NM_018734 Guanylate nucleotide binding protein 4 Naive . Memory 817 114 8 NM_207231 ADP-ribosylation-like factor 12 protein http://www.jimmunol.org/ 82 37 1 NM_175274 Tweety 3 306 0 4 NM_019577 Chemokine C-C motif ligand 24 75 74 0 NM_010358 Gst m 1 61 52 1 NM_011129 Septin 4 53 63 1 NM_027406 Aldehyde dehydrogenase 1 family member l1 51 1 1 NM_029162 Zinc finger protein 509 51 0 1 NM_008694 Neutrophilic granule protein 51 1 1 NM_153510 Paired immunoglobulin-like type 2 receptor a 51 24 1 NM_007405 Adenylate cyclase 6 48 37 1 NM_011984 Homer homolog 3 by guest on September 24, 2021 148 5 3 NM_009238 SRY-box containing gene 4 46 12 1 NM_013569 Voltage-gated potassium channel subfamily H, 44 10 1 NM_026629 Hypothetical protein LOC68235 43 25 1 NM_011692 Von Hippel-Lindau binding protein 1 219 0 5 NM_001037859 Colony stimulating factor 1 receptor 115 22 3 NM_008538 Myristoylated alanine rich protein kinase C 36 22 1 NM_177758 Zinc finger and SCAN domains 20 36 0 1 NM_013612 Solute carrier family 11 proton-coupled 36 7 1 NM_009223 Stannin 72 18 2 NM_001033929 Threonine synthase-like 2 36 53 0 NM_011232 RAD1 homolog 94 18 3 NM_011639 Thyroid receptor-interacting protein 6 30 4 1 NM_133921 Ovarian zinc finger protein 30 110 1 NM_020006 CDC42 effector protein Rho GTPase binding 4 33 16 0 NM_009372 TG-interacting factor 29 1 1 NM_013667 Solute carrier family 22 member 2 28 14 1 NM_030557 Myoneurin 177 25 6 NM_001081127 A disintegrin-like and metallopeptidase 31 103 0 NM_033612 Elastase 1 pancreatic The 30 genes with the largest relative differences between effector and naive cells and between memory and naive cells are listed. The total number of tags from naive (3,382,975), effector (2,790,122), and memory (3,179,174) cells was normalized to 3,000,000.
(pattern 1). For example, the extent of DNA methylation in the related to cell communication and signal transduction, whereas DMR of CXCR6 was 92% in naive cells, 80% in effector cells, and genes in pattern 3 aligned with GO categories related to negative 6% in memory T cells (Supplemental Fig. 1). Moreover, 43% of regulation of cellular processes (Table VIII). These data indicate DMRs were hypermethylated in the naive phase, intermediately that the timing of methylation changes during T cell differentia- methylated in the effector phase, and hypomethylated in the tion is regulated independently for each gene. memory phase (pattern 2). In Cish, for example, DNA methylation It is well known that central and effector memory T cells are in the DMR in the second exon was 100% in naive cells, 52% in distinct in their differentiation status. Therefore, we also investigated effector cells, and 13% in memory cells. An additional 17% of the DNA methylation status of selected DMRs in subpopulations DMRs were hypermethylated in naive cells, intermediately meth- of central and effector memory CD4+ T cells from an untreated ylated in effector cells, and hypomethylated in memory cells conventional BALB/c mouse. These DMRs were different across (pattern 3). GO classifications for each DMR methylation pattern various T cell subsets, reinforcing the finding that the methylation revealed that genes in pattern 1 mostly fell into GO categories status of T cell subsets reflects T cell differentiation (Fig. 7). Table VI. Correlation between DNA methylation and gene expression in naive, effector, and memory CD4+ T cells Immunology of Journal The
No. of DNA Methylation Scorea Gene Expression Nucleotides Distance from from Naive Naive Effector Effector Memory Memory Restriction Nearest Nearest Cell Cell Cell Cell Cell Cell N4/M4 M4/N4 Naive Effector Memory Site Chr TSS Symbol Description RefSeq Position CGI (bp) HpaII MspI HpaII MspI HpaII MspI Fold Fold CD4 CD4 CD4 123716994 Chr9 1,392 Cxcr6 Chemokine C-X-C NM_030712 Intron1 43,618 0 5 2 7 18 4 0 78 1 53 70 motif receptor 6 96974152 Chr11 2,440 Tbx21 T-box 21 NM_019507 Intron1 21,727 0 2 8 8 30 5 0 69 3 140 186 17493213 Chr7 1,375 Ptgir PG I receptor IP NM_008967 Intron1 2876 0 10 5 6 11 6 0 49 1 41 44 73291652 Chr7 37,252 Chsy1 Carbohydrate NM_001081163 Intron2 237,769 0 10 8 9 48 6 0 20 16 127 326 chondroitin synthase 1 9453075 Chr15 6,536 Il7r IL 7 receptor NM_008372 Intron2 383,054 0 4 6 1 13 5 0 17 29 198 498 precursor 151561336 Chr4 9,094 Acot7 Acyl-CoA NM_133348 Intron1 29,631 0 5 5 6 12 4 0 14 66 289 949 thioesterase 7 107202323 Chr9 3,304 Cish Cytokine inducible NM_009895 Exon_2/3 23,446 0 1 8 9 17 5 0 10 53 5018 528 SH2-containing protein 107201507 Chr9 2,488 Cish Cytokine inducible NM_009895 Intron1 22,630 0 2 0 0 12 1 0 10 53 5018 528 SH2-containing protein 112879061 Chr6 17,427 Srgap3 SLIT-ROBO Rho NM_080448 Intron1 2117,067 0 16 10 10 20 14 0 9 5 241 46 GTPase activating protein 3 41404992 Chr19 54,614 Pik3ap1 Phosphoinositide- NM_031376 Intron3 245,447 0 4 4 2 17 4 0 5 5 14 28 3-kinase adaptor protein 1 41404611 Chr19 54,995 Pik3ap1 Phosphoinositide- NM_031376 Intron3 245,828 0 11 9 15 11 9 0 5 5 14 28 3-kinase adaptor protein 1 43981837 Chr4 11,264 Glipr2 GLI pathogenesis– NM_027450 Intron3 211,607 0 6 1 2 32 2 0 5 59 795 285 related 2 52379040 Chr2 153,059 Cacnb4 Calcium channel NM_001037099 Intron2 99,263 0 7 7 10 34 6 0 4 6 3 26 voltage–dependent, b 4 60189952 Chr2 31,367 Ly75 Lymphocyte Ag 75 NM_013825 Intron11 231,177 0 1 4 2 12 5 0 4 12 56 47 29371127 Chr17 3,606 Cpne5 Copine V NM_153166 Intron1 23,256 0 10 3 11 11 8 0 4 4 37 18 44355013 Chr17 29,493 Clic5 Chloride NM_172621 Intron1 229,555 0 7 10 5 52 9 0 4 4 8 14 intracellular channel 5 28393931 Chr2 25,081 Ralgds Ral guanine NM_009058 Intron1 24,975 0 8 13 15 10 1 0 4 8 81 32 nucleotide dissociation stimulator 155388145 Chr4 342 Tnfrsf4 TNF receptor NM_011659 Intron1 20,771 0 5 21 6 22 3 0 4 394 5522 1455 superfamily 79745901 Chr17 8,528 Cdc42ep3 CDC42 effector NM_026514 Intron1 27,859 0 9 3 14 15 3 0 4 5 2 19 protein Rho GTPase binding 3 27822267 Chr2 80,063 Col5a1 Procollagen NM_015734 Intron16 280,584 0 16 3 9 11 10 0 4 4 1 12 type V, a 1
(Table continues) 9
Downloaded from from Downloaded http://www.jimmunol.org/ by guest on September 24, 2021 24, September on guest by Table VI. (Continued) 10
No. of DNA Methylation Scorea Gene Expression Nucleotides Distance from from Naive Naive Effector Effector Memory Memory Restriction Nearest Nearest Cell Cell Cell Cell Cell Cell N4/M4 M4/N4 Naive Effector Memory Site Chr TSS Symbol Description RefSeq Position CGI (bp) HpaII MspI HpaII MspI HpaII MspI Fold Fold CD4 CD4 CD4 41565822 Chr6 10,256 Ephb6 Eph receptor B6 NM_007680 Intron6 210,660 0 10 7 5 10 11 12 0 207 11 17 77375561 Chr10 54,639 Trpm2 Transient receptor NM_138301 Intron29 10,730 0 5 12 8 10 3 11 0 21 2 2 potential cation channel 58854000 Chr15 59,542 Mtss1 Actin monomer- NM_144800 Intron3 258,831 0 4 15 6 21 3 9 0 179 60 19 binding protein 79178744 Chr15 637 Maff V-maf NM_010755 Intron1 21,005 0 2 0 1 16 1 9 0 25 122 3 musculoaponeurotic fibrosarcoma oncogene 38564748 Chr2 5,312 Nr5a1 Nuclear receptor NM_139051 Intron3 21,049 0 9 1 0 10 2 9 0 17 13 2 subfamily 5 group A, member 1 75013736 Chr12 4,720 Hif1a Hypoxia inducible NM_010431 Intron1 25,274 0 10 11 7 21 4 8 0 59 276 8
factor 1 a subunit CELLS T MEMORY IN ANALYSES TRANSCRIPTOME AND METHYLOME 49653434 Chr2 10,229 2310010M24Rik Hypothetical NM_027990 Intron1 210,474 0 7 2 10 13 7 7 0 51 11 8 protein LOC71897 124129324 Chr5 4,974 Clip1 Restin NM_019765 Intron1 24,195 0 1 8 7 10 2 7 0 289 61 44 124474362 Chr5 7,905 Vps37b Vacuolar protein NM_177876 Intron1 27,571 0 15 0 6 10 10 6 0 2537 1085 394 sorting 37B 63517774 Chr14 61,260 Wdfy2 WD repeat and NM_175546 Intron2 261,692 0 4 35 7 25 2 6 0 30 17 5 FYVE domain containing 2 56872366 Chr18 4,840 Lmnb1 Lamin B1 NM_010721 Intron1 25,420 0 5 1 6 18 2 6 0 73 53 12 3378068 Chr10 179,872 Oprm1 Opioid receptor m 1 NM_001039652 Intron3 243,866 0 7 3 14 14 6 5 0 30 3 6 5574804 Chr10 159,689 Esr1 Estrogen NM_007956 Intron3 258,813 0 16 1 9 11 13 5 0 46 7 9 receptor 1 a 66089658 Chr17 32,361 Rab31 Rab31-like NM_133685 Intron1 231,962 0 3 5 4 23 5 5 0 19 27 4 54300515 Chr13 13,018 Hrh2 Histamine receptor NM_001010973 Intron1 213,119 0 6 1 10 14 0 5 0 32 4 7 H 2 isoform 1 71926521 Chr12 21 Frmd6 FERM domain NM_028127 Exon_1/ 0 0 4 8 0 14 1 4 0 38 31 9 containing 6 14_first exon 58574849 Chr6 28,184 Abcg2 ATP-binding NM_011920 Intron1 15,477 0 6 7 1 10 0 4 0 39 103 9 cassette subfamily G, member 2 88790629 Chr12 5,768 1810035L17Rik Hypothetical NM_026958 Intron3 26,286 0 4 6 2 15 9 4 0 34 130 9 protein LOC380773 64135805 Chr1 32,156 Klf7 Kruppel-like factor NM_033563 Intron1 232,381 0 6 4 11 17 1 4 0 108 48 27 7 ubiquitous 21359913 Chr2 70,720 Gpr158 G protein–coupled NM_001004761 Intron2 269,515 0 8 0 3 13 10 4 0 11 3 3 receptor 158 13609664 Chr8 67,921 Rasa3 RAS p21 protein NM_009025 intron3 267,326 0 8 5 2 14 6 4 0 570 349 157 activator 3 24828918 Chr8 48,754 Zmat4 Zinc finger matrin NM_177086 intron1 248,830 0 10 3 14 11 16 4 0 40 5 11 type 4
(Table continues)
Downloaded from from Downloaded http://www.jimmunol.org/ by guest on September 24, 2021 24, September on guest by Table VI. (Continued) Immunology of Journal The
No. of DNA Methylation Scorea Gene Expression Nucleotides Distance from from Naive Naive Effector Effector Memory Memory Restriction Nearest Nearest Cell Cell Cell Cell Cell Cell N4/M4 M4/N4 Naive Effector Memory Site Chr TSS Symbol Description RefSeq Position CGI (bp) HpaII MspI HpaII MspI HpaII MspI Fold Fold CD4 CD4 CD4 146036806 Chr7 1,142 Mapk1ip1 MAPK-interacting NM_001045483 intron1 2827 0 7 3 5 11 5 4 0 233 152 66 and spindle- stabilizing 96960335 Chr11 16,257 Tbx21 T-box 21 NM_019507 Exon_6/ 215,544 19 1 1 0 0 2 0 69 3 140 186 6_lastExon 94729332 Chr1 1,070 Gpc1 Glypican 1 NM_016696 Intron1 0 16 2 0 0 0 1 0 21 11 22 227 128915487 Chr4 10,198 C77080 Hypothetical NM_001033189 Intron1 2581 12 3 1 1 0 2 0 6 3 3 15 protein LOC97130 148238956 Chr4 60,456 Casz1 Castor homolog NM_027195 Intron2 26,131 10 17 1 16 0 7 0 4 10 13 36 1 zinc finger 120328900 Chr2 39,292 Capn3 Calpain 3 isoform a NM_007601 Exon_21/24 60,309 15 7 2 6 0 13 22 0 61 9 3 35990963 Chr18 1,492 Cxxc5 CXXC finger 5 NM_133687 Intron1 0 28 4 9 2 0 1 13 0 12 22 1 126838794 Chr8 83,501 Galnt2 UDP-N-acetyl-a-D- NM_139272 Intron3 283,718 16 5 0 2 0 1 8 0 128 55 16 galactosamine: polypeptide 63546881 Chr14 90,367 Wdfy2 WD repeat and NM_175546 Intron4 290,799 20 1 1 9 0 6 6 0 30 17 5 FYVE domain containing 2 The category was represented using the criteria of DMRs (changing from 0 to .10 tags at the sites able to be digested by MspI between naive and memory CD4 T cells) and gene expression (memory or naive; .10 tags and .4-fold difference). Each number of gene-expression tags from naive (3,382,975), effector (2,790,122), and memory (3,179,174) cells was normalized to 3,000,000. aDNA methylation score is described in Materials and Methods.
11
Downloaded from from Downloaded http://www.jimmunol.org/ by guest on September 24, 2021 24, September on guest by 12 METHYLOME AND TRANSCRIPTOME ANALYSES IN MEMORY T CELLS
FIGURE 5. Transcriptional activity of a lucif- erase reporter gene in unmethylated and meth- ylated DMR sequences from the introns of 15 genes. Transient transfections were performed with a control plasmid (pCpGL-EF1 promoter) or pCpGL-EF-DMR in P/I-treated EL-4 T cells using unmethylated (CpG) or in vitro SssI methylated (mCpG) reporter plasmids. Firefly raw light unit (RLU) data were normalized to Renilla luciferase activity relative to the control vector with no insert. *p , 0.05, unmethylated versus methylated plasmids, paired Student t test. Downloaded from
Discussion addition, the expression of several other genes [i.e., IFN-induced Following activation with Ag, naive T cells differentiate into short- trans-membrane protein 1 (IFITM1) (29), Dkkl1 (30), and Il18rap lived effector T cells and long-lived memory T cells. However, the (31)], which are related to proliferative capacity and Th1-type molecular mechanisms behind the generation and maintenance of immunological reactions, increased in memory CD4+ T cells + memory CD4 T cells remain unclear. To address this problem, we compared with naive T cells. http://www.jimmunol.org/ studied changes in epigenetic modification and gene expression in It is well known that gene expression involves activation of Ag-specific CD4+ T cells using massive parallel DNA sequencing. transcription factors and/or epigenetic changes in the genome. CpG Phenotypically, both naive and memory T cell subsets are made dinucleotides upstream of genes that are active in a particular tissue up of small resting cells with upregulated IL-7R expression, which or cell type are less methylated, whereas inactive genes are sur- is necessary for their survival in vivo. Effector and memory T cells rounded by highly condensed chromatin and have densely meth- exhibit increased expression of adhesion markers (e.g., CD44 and ylated upstream CpG dinucleotides. A useful technique for gauging LFA-1) and decreased expression of the lymph node homing re- gene accessibility in the chromatin context is to monitor sensitivity ceptor CD62L (28). This expression pattern was confirmed in the of the relevant DNA sequences to digestion with DNaseI in intact current study. Furthermore, our analyses indicated that, compared nuclei (32). In general, genome sites encoding genes located in by guest on September 24, 2021 with naive CD4+ T cells, the genes that were upregulated in active chromatin that are actively transcribed or that have the memory CD4+ T cells (e.g., IL-7R, Bcl2, Bcl2l1, and Cdkn1a and potential to be transcribed upon stimulation are more sensitive the chemokine-related genes CCL5, CCR2, CXCR6, and CXCR3) to DNase I digestion than are sites encoding genes in inactive or were related to cytokine production and development and main- closed chromatin. In this study, we used the recently developed tenance of the memory phase. Expression of the Th1 genes IFN-g, MSCC method that enables cost-effective, high-throughput, Tbox21, and IL18RAP also increased in memory CD4+ T cells. In genome-wide identification of methylated CpG sites. We identi-
FIGURE 6. DMRs in the Mapk1ip1 and Klf7 loci of naive and memory T cells. Genomic organization of the mouse Klf7 (A) and Mapk1ip1 (D) loci showing transcription start sites (→), exons (black boxes), DMRs that were detected by MSCC (↑), and bisulfite sequencing positions (white boxes). (B and E) Results of genomic bisulfite sequencing, where each row of circles represents an individual clone sequenced following bisulfite treatment and PCR. Open circles indicate CpG sites at which no DNA methylation was detected. Stars indicate the position of restriction sites detected by MSCC. Filled circles indicate CpG sites that were methylated. (C and F) Downregulated gene expression in memory CD4 T cells measured by quantitative real-time PCR. RT- PCR was performed as described in Materials and Methods. The Journal of Immunology 13
Table VII. DNA methylation status of DMRs in naive, effector, and scriptional inactivation. Most tissue-specific DNA methylation + memory CD4 T cells seems not to occur within CGI, but rather at CGI shores. However, our data demonstrate that most DMRs in naive and memory CD4+ DNA Methylation Status T cells are not associated with CGI or CGI shores. Furthermore, + Pattern Naive Effector Memory No. of DMR (%) most DMRs in naive and memory CD4 T cells were located in gene bodies, rather than in the promoter regions, as is the case for 1 High High Low 314 (27%) tumor cells. 2 High Int Low 495 (43%) + 3 High Low Low 198 (17%) Of the DMRs identified in naive and memory CD4 T cells, 51 4 Low Low High 25 (2%) were potentially associated with gene expression. Gene body 5 Low Int High 42 (4%) methylation is common in ubiquitously expressed genes and is 6 Low High High 70 (6%) correlated with gene expression (23). Furthermore, intergenic Total 1144 (100%) methylation recently was reported to play a major role in regu- High, High methylation status (#2); Int, intermediate methylation status (3–9 lating cell context–specific alternative promoters in gene bodies tags); Low, low methylation status (.9 tags). (34). In contrast, several groups (19, 35, 36) reported that, in human and mouse regulatory T cells, the majority of DMRs are fied 1,144 regions in the mouse genome that were differentially located at promoter-distal sites and that many of these regions methylated in the process of T cell differentiation. All of these display DNA methylation-dependent enhancer activity in reporter DMRs were in gene body sites without CGIs, highlighting the fact gene assays. Tsuji-Takayama et al. (37) demonstrated that pro- that DNA methylation can occur at sites other than CGIs. Irizarry duction of IL-10 in regulatory T cells was enhanced by IL-2 Downloaded from et al. (33) reported that methylation of CGI shores that exist in through a STAT5-responsive intron enhancer in the IL-10 locus. close proximity (∼2 kb) to CGIs is closely associated with tran- However, Lai et al. (38) reported that DNA methylation in an
Table VIII. GOs classified by methylation state of DMRs in effector cells http://www.jimmunol.org/ GO Hyper(N)-Hyper(E)-Hypo(M) Genes Count Total p Value GO:0007154 Cell communication 25 5560 0.00507 GO:0007165 Signal transduction 23 5142 0.00772 GO:0016477 Cell migration 5 233 0.00772 GO:0006928 Cell motility 6 383 0.00772 GO:0051674 Localization of cell 6 383 0.00772 GO:0022610 Biological adhesion 9 960 0.00772 GO:0007155 Cell adhesion 9 960 0.00772
Hyper(N)-Int(E)-Hypo(M) by guest on September 24, 2021 GO:0007154 Cell communication 74 5560 6.09E212 GO:0007165 Signal transduction 69 5142 2.71E210 GO:0007242 Intracellular signal transduction 33 1965 2.85E207 GO:0007275 Multicellular organismal development 33 2299 6.72E205 GO:0007267 Cell–cell signaling 17 640 8.05E205 GO:0032502 Developmental process 42 3347 0.000126 GO:0051179 Localization 51 4481 0.000243 GO:0007215 Glutamate signaling pathway 4 21 0.00075 GO:0032501 Multicellular organismal process 44 3822 0.000793 GO:0009966 Regulation of signal transduction 17 800 0.000793 GO:0048731 System development 23 1605 0.00236 GO:0051234 Establishment localization 45 4135 0.00298 GO:0006810 Transport 44 4035 0.00327 GO:0050789 Regulation of biological process 60 6140 0.00428 GO:0007268 Synaptic transmission 9 290 0.00434 GO:0048856 Anatomical structure development 26 2005 0.00472 GO:0065007 Biological regulation 64 6731 0.00472 Hyper(N)-Hypo(E)-Hypo(M) GO:0048523 Negative regulation of cellular process 13 1137 0.000127 GO:0048519 Negative regulation of biological process 13 1182 0.000127 GO:0050794 Regulation of cellular process 26 5704 0.000748 GO:0065007 Biological regulation 28 6731 0.00227 GO:0050789 Regulation of biological process 26 6140 0.00289 GO:0018212 Peptidyl-tyrosine modification 3 44 0.0064 GO:0007242 Intracellular signal transduction 13 1965 0.0072 GO:0007165 Signal transduction 22 5142 0.00765 GO:0007154 Cell communication 23 5560 0.00893 Hypo(N)-Int(E)-Hyper(M) GO:0007275 Multicellular organismal development 9 2299 0.00989 GO:0032501 Multicellular organismal process 11 3822 0.00989 Hypo(N)-Hypo(E)-Hyper(M) None Hypo(N)-Hyper(E)-Hyper(M) None GOs with a p value , 0.01 are shown. E, Effector T cells; Hyper, hypermethylation status (more than nine tags); Hypo, hypomethylation status (two or fewer tags); Int, intermediate methylation status (three to nine tags); M, memory T cells; N, naive T cells. 14 METHYLOME AND TRANSCRIPTOME ANALYSES IN MEMORY T CELLS Downloaded from http://www.jimmunol.org/ by guest on September 24, 2021 FIGURE 7. DNA methylation status of selected DMRs in subpopulations of central and effector memory CD4+ T cells. CD62L+ CCR7+ and CD62L2 CCR72 CD4 T cells from BALB/c mice were isolated to represent “central memory” and “effector memory” T cells, respectively. Genomic organization of the mouse Cish, Hrasls3, Tbx21, CXCR6, Bcl2l1, and Ptgir loci, showing transcription start sites (→), exons (black box), DMRs that were detected by MSCC (↑), and bisulfite sequencing position (white box). Graphs show results of genomic bisulfite sequencing, where each row of circles represents an individual clone sequenced in the analysis after bisulfite treatment and PCR. Open circles indicate CpG sites at which no DNA methylation was detected. Filled circles indicate CpG sites that were methylated. Stars indicate the position of restriction sites detected by MSCC. Percentage values indicate the DNA methylation ratio of each region, as measured by bisulfite sequencing. intron can prevent enhancer-blocking transcription factor–medi- results indicate that DNA methylation of the IL-7R gene in CD4+ ated silencing. We used a reporter assay to examine the 51 gene- T cells may be a key mechanism for modifying IL-7–mediated expression–associated DMRs and obtained results consistent with T cell development and survival. In addition, in the current study, earlier reports. When loci containing DMRs were cloned into the expression of Tbx21, as well as of the Th1-related gene Ptgir, was reporter gene plasmid, the DMRs possessed enhancer activity in also correlated with DNA methylation. Lymph node cells from naive T cells in which DNA methylation was suppressed. Like sensitized Ptgir(2/2) mice show reduced IFN-g production and previous studies, our results revealed different enhancer activities a smaller T-bet(+) subset compared with control mice (43). for different DMRs. It was reported that, compared with normal There were also several genes relating to memory CD4+ T cells control cells, the DNA methylation of gene promoter regions homing to bone marrow (BM) that were associated with changes differed in CD4+ T cells in patients with rheumatoid arthritis (39), in DNA methylation. Tokoyada et al. (44) reported that .80% of subacute cutaneous lupus erythematosus (40), and systemic lupus Ly-6ChiCD44hiCD62L2 memory CD4 T lymphocytes reside in erythematosus (41). Together, these results suggest that, in the the BM of adult mice and associate with IL-7–expressing VCAM- normal immune state, these DMRs are associated with enhancer 1 stroma cells. Our results demonstrate that Ly-6C is expressed activity rather than with promoter activity. more highly in memory CD4+ T cells than in naive CD4+ T cells. Genes associated with the 51 gene-expression–associated DMRs Because IL-7 is the main cytokine required for CD4+ T cell sur- in naive and memory CD4+ T cells were functionally categorized vival (45), the BM is predicted to function as a survival niche for as relating to signal transduction, cell communication, and immune memory CD4+ T cells. Thus, in the memory phase of immunity, responses. As predicted, IL-7R, Bcl2l1, Tbox21, and CXCR6 genes memory Th cells are maintained in BM as resting, but highly were associated with changes in DNA methylation. Kim et al. (42) reactive, cells in niches defined by IL-7–expressing stroma cells. reported that DNA methylation is involved in regulating IL-7R In addition, when gene expression between CD44hiCD62L2CD4+ expression in T cells. They found that IL-7Ra high CD8 T cells T cells from the spleen and BM were compared, CD24, CD122, had stronger cell signaling and survival responses to IL-7 compared CXCR6, and CCR2 levels on CD44hiCD62L2CD4+ T cells from with IL-7Ra low CD8 T cells. Together with these findings, our the BM were higher than on the same cells from the spleen (45). The Journal of Immunology 15
Our data also reveal upregulation of gene expression and un- 3. Sawalha, A. H. 2008. Epigenetics and T-cell immunity. Autoimmunity 41: 245– 252. methylation of CXCR6 in the memory phase, suggesting that the 4. Wilson, C. B., E. Rowell, and M. Sekimata. 2009. Epigenetic control of T- unmethylation of DNA in gene body regions may be related to the helper-cell differentiation. Nat. Rev. Immunol. 9: 91–105. homing of CD44hiCD62L2CD4+ T cells to the BM. 5. Cuddapah, S., A. Barski, and K. Zhao. 2010. Epigenomics of T cell activation, + differentiation, and memory. Curr. Opin. Immunol. 22: 341–347. In memory CD4 T cells, the genes Chsy1 and Itgb1 were 6. Portela, A., and M. Esteller. 2010. Epigenetic modifications and human disease. linked to changes in DNA methylation in introns. Chsy1 synthe- Nat. Biotechnol. 28: 1057–1068. sizes chondroitin sulfate and regulates many biological processes, 7. Jaenisch, R., and A. Bird. 2003. Epigenetic regulation of gene expression: how the genome integrates intrinsic and environmental signals. Nat. Genet. 33 including cell proliferation, recognition, and extracellular matrix (Suppl.): 245–254. deposition. Yin (46) showed that Chsy1 is the most prominent 8. Bird, A. 2002. DNA methylation patterns and epigenetic memory. Genes Dev. 16: 6–21. secreted protein in myeloma cell–osteoclast coculture conditioned 9. Jones, P. A., and D. Takai. 2001. The role of DNA methylation in mammalian medium and that Chsy1 activates Notch2 signaling in myeloma epigenetics. Science 293: 1068–1070. cells in the BM microenvironment. Therefore, Chsy1 may play an 10. Li, E. 2002. Chromatin modification and epigenetic reprogramming in mam- malian development. Nat. Rev. Genet. 3: 662–673. important role in cell–cell interactions, such as those between 11. Meehan, R. R. 2003. DNA methylation in animal development. Semin. Cell Dev. T cells and osteoclasts in the BM microenvironment. In contrast, Biol. 14: 53–65. Itgb1 is critical for maintenance of Ag-specific CD4+ T cells in the 12. Lee, P. P., D. R. Fitzpatrick, C. Beard, H. K. Jessup, S. Lehar, K. W. Makar, M. Pe´rez-Melgosa, M. T. Sweetser, M. S. Schlissel, S. Nguyen, et al. 2001. A BM (47). Therefore, DNA methylation in gene body regions is critical role for Dnmt1 and DNA methylation in T cell development, function, likely to play an important role in CD4+ T cell homing to BM. and survival. Immunity 15: 763–774. 13. Carbone, A. M., P. Marrack, and J. W. Kappler. 1988. Demethylated CD8 gene in The expression of Cish was also associated with changes in DNA CD4+ T cells suggests that CD4+ cells develop from CD8+ precursors. Science methylation in gene body regions. Cish is a member of the SOCS 242: 1174–1176. Downloaded from family, which was discovered as a negative regulator of cytokine 14. Wilson, C. B., K. W. Makar, and M. Pe´rez-Melgosa. 2002. Epigenetic regulation of T cell fate and function. J. Infect. Dis. 185(Suppl. 1): S37–S45. signaling. However, inCD4promoter-driven Cish-Tgmice, elevated 15. Schwab, J., and H. Illges. 2001. Regulation of CD21 expression by DNA Cish expression promotes T cell proliferation and survival after TCR methylation and histone deacetylation. Int. Immunol. 13: 705–710. activation relative to T cells in control mice (48). Moreover, 16. Chen, S. C., C. Y. Lin, Y. H. Chen, H. Y. Fang, C. Y. Cheng, C. W. Chang, R. A. Chen, H. L. Tai, C. H. Lee, M. C. Chou, et al. 2006. Aberrant promoter Nakajima et al. (49) showed that expression of both Cish mRNA methylation of EDNRB in lung cancer in Taiwan. Oncol. Rep. 15: 167–172. + and protein is significantly increased in allergen-stimulated CD4 17. Makar, K. W., and C. B. Wilson. 2004. DNA methylation is a nonredundant http://www.jimmunol.org/ repressor of the Th2 effector program. J. Immunol. 173: 4402–4406. T cells from hen egg–allergic patients relative to patients not al- 18. Lindahl Allen, M., C. M. Koch, G. K. Clelland, I. Dunham, and M. Antoniou. lergic to hen eggs. In addition, Khor et al. (50) identified a panel of 2009. DNA methylation-histone modification relationships across the desmin Cish single nucleotide polymorphisms associated with increased locus in human primary cells. BMC Mol. Biol. 10: 51. 19. Schmidl, C., M. Klug, T. J. Boeld, R. Andreesen, P. Hoffmann, M. Edinger, and susceptibility to infectious diseases, such as bacteremia, malaria, M. Rehli. 2009. Lineage-specific DNA methylation in T cells correlates with and tuberculosis. Thus, Cish expression caused by demethylation histone methylation and enhancer activity. Genome Res. 19: 1165–1174. within the Cish locus in memory T cells may play a role in some 20. Chappell, C., C. Beard, J. Altman, R. Jaenisch, and J. Jacob. 2006. DNA methylation by DNA methyltransferase 1 is critical for effector CD8 T cell infectious and allergic diseases. expansion. J. Immunol. 176: 4562–4572. In the current study, differences in methylated regions between 21. Kersh, E. N. 2006. Impaired memory CD8 T cell development in the absence of
+ methyl-CpG-binding domain protein 2. J. Immunol. 177: 3821–3826. by guest on September 24, 2021 naive and memory CD4 T cells did not always correlate with gene 22. Yamashita, M., R. Shinnakasu, Y. Nigo, M. Kimura, A. Hasegawa, M. Taniguchi, expression. The promoter and enhancer regions of differentially and T. Nakayama. 2004. Interleukin (IL)-4-independent maintenance of histone expressed genes were unmethylated, even in naive CD4+ T cells. modification of the IL-4 gene loci in memory Th2 cells. J. Biol. Chem. 279: 39454–39464. Therefore, gene expression in the naive phase is likely to be 23. Ball, M. P., J. B. Li, Y. Gao, J. H. Lee, E. M. LeProust, I. H. Park, B. Xie, regulated primarily by the activation of transcription factors. G. Q. Daley, and G. M. Church. 2009. Targeted and genome-scale strategies However, changes in the DNA methylation of unsynchronized reveal gene-body methylation signatures in human cells. Nat. Biotechnol. 27: 361–368. genes may prepare T cells for rapid responses following secondary 24. Hashimoto, S., W. Qu, B. Ahsan, K. Ogoshi, A. Sasaki, Y. Nakatani, Y. Lee, stimulation via TCR signaling or other stimuli, such as inflam- M. Ogawa, A. Ametani, Y. Suzuki, et al. 2009. High-resolution analysis of the 59-end transcriptome using a next generation DNA sequencer. PLoS ONE 4: matory cytokines, bacteria, and viruses. e4108. Variable DNA methylation of the enhancers of genes related to 25. Beissbarth, T., and T. P. Speed. 2004. GOstat: find statistically overrepresented T cell development and survival represents a novel mechanism Gene Ontologies within a group of genes. Bioinformatics 20: 1464–1465. + 26. Eckhardt, F., J. Lewin, R. Cortese, V. K. Rakyan, J. Attwood, M. Burger, underlying the regulation of gene expression in memory CD4 J. Burton, T. V. Cox, R. Davies, T. A. Down, et al. 2006. DNA methylation T cells. In this study, we demonstrated the important role that profiling of human chromosomes 6, 20 and 22. Nat. Genet. 38: 1378–1385. methylation and demethylation of DNA in exons and introns play in 27. Irizarry, R. A., C. Ladd-Acosta, B. Carvalho, H. Wu, S. A. Brandenburg, + J. A. Jeddeloh, B. Wen, and A. P. Feinberg. 2008. Comprehensive high- regulating gene-expression patterns in Ag-specific memory CD4 throughput arrays for relative methylation (CHARM). Genome Res. 18: 780– T cells. 790. 28. Moulton, V. R., N. D. Bushar, D. B. Leeser, D. S. Patke, and D. L. Farber. 2006. Divergent generation of heterogeneous memory CD4 T cells. J. Immunol. 177: Acknowledgments 869–876. We thank Dr. Yong-Jun Lee and Ryu Takahashi for technical assistance and 29. Yang, G., Y. Xu, X. Chen, and G. Hu. 2007. IFITM1 plays an essential role in the antiproliferative action of interferon-gamma. Oncogene 26: 594–603. Dr. M. Klug (Department of Hematology and Oncology, University Hospi- 30. Gattinoni, L., X. S. Zhong, D. C. Palmer, Y. Ji, C. S. Hinrichs, Z. Yu, tal, Regensburg, Germany), for the plasmid pCpG-basic. C. Wrzesinski, A. Boni, L. Cassard, L. M. Garvin, et al. 2009. Wnt signaling arrests effector T cell differentiation and generates CD8+ memory stem cells. Nat. Med. 15: 808–813. Disclosures 31. Debets, R., J. C. Timans, T. Churakowa, S. Zurawski, R. de Waal Malefyt, The authors have no financial conflicts of interest. K. W. Moore, J. S. Abrams, A. O’Garra, J. F. Bazan, and R. A. Kastelein. 2000. IL-18 receptors, their role in ligand binding and function: anti-IL-1RAcPL an- tibody, a potent antagonist of IL-18. J. Immunol. 165: 4950–4956. 32. Rao, A., and O. Avni. 2000. Molecular aspects of T-cell differentiation. Br. Med. References Bull. 56: 969–984. 1. Seder, R. A., and R. Ahmed. 2003. Similarities and differences in CD4+ and 33. Irizarry, R. A., C. Ladd-Acosta, B. Wen, Z. Wu, C. Montano, P. Onyango, CD8+ effector and memory T cell generation. Nat. Immunol. 4: 835–842. H. Cui, K. Gabo, M. Rongione, M. Webster, et al. 2009. The human colon cancer 2. Moulton, V. R., and D. L. Farber. 2006. Committed to memory: lineage choices methylome shows similar hypo- and hypermethylation at conserved tissue- for activated T cells. Trends Immunol. 27: 261–267. specific CpG island shores. Nat. Genet. 41: 178–186. 16 METHYLOME AND TRANSCRIPTOME ANALYSES IN MEMORY T CELLS
34. Maunakea, A. K., R. P. Nagarajan, M. Bilenky, T. J. Ballinger, C. D’Souza, 42. Kim, H. R., K. A. Hwang, K. C. Kim, and I. Kang. 2007. Down-regulation of IL- S. D. Fouse, B. E. Johnson, C. Hong, C. Nielsen, Y. Zhao, et al. 2010. Conserved 7Ralpha expression in human T cells via DNA methylation. J. Immunol. 178: role of intragenic DNA methylation in regulating alternative promoters. Nature 5473–5479. 466: 253–257. 43. Nakajima, S., T. Honda, D. Sakata, G. Egawa, H. Tanizaki, A. Otsuka, 35. Kim, H. P., and W. J. Leonard. 2007. CREB/ATF-dependent T cell receptor- C. S. Moniaga, T. Watanabe, Y. Miyachi, S. Narumiya, and K. Kabashima. 2010. induced FoxP3 gene expression: a role for DNA methylation. J. Exp. Med. 204: Prostaglandin I2-IP signaling promotes Th1 differentiation in a mouse model of 1543–1551. contact hypersensitivity. J. Immunol. 184: 5595–5603. 36. Baron, U., S. Floess, G. Wieczorek, K. Baumann, A. Gru¨tzkau, J. Dong, 44. Tokoyoda, K., S. Zehentmeier, A. N. Hegazy, I. Albrecht, J. R. Gru¨n, M. Lo¨hning, A. Thiel, T. J. Boeld, P. Hoffmann, M. Edinger, et al. 2007. DNA demethylation and A. Radbruch. 2009. Professional memory CD4+ T lymphocytes preferentially in the human FOXP3 locus discriminates regulatory T cells from activated reside and rest in the bone marrow. Immunity 30: 721–730. FOXP3(+) conventional T cells. Eur. J. Immunol. 37: 2378–2389. 45. Chetoui, N., M. Boisvert, S. Gendron, and F. Aoudjit. 2010. Interleukin-7 promotes 37. Tsuji-Takayama, K., M. Suzuki, M. Yamamoto, A. Harashima, A. Okochi, the survival of human CD4+ effector/memory T cells by up-regulating Bcl-2 pro- T. Otani, T. Inoue, A. Sugimoto, T. Toraya, M. Takeuchi, et al. 2008. The pro- teins and activating the JAK/STAT signalling pathway. Immunology 130: 418–426. duction of IL-10 by human regulatory T cells is enhanced by IL-2 through 46. Yin, L. 2005. Chondroitin synthase 1 is a key molecule in myeloma cell- a STAT5-responsive intronic enhancer in the IL-10 locus. J. Immunol. 181: osteoclast interactions. J. Biol. Chem. 280: 15666–15672. 3897–3905. 47. DeNucci, C. C., and Y. Shimizu. 2011. b1 integrin is critical for the maintenance 38. Lai, A. Y., M. Fatemi, A. Dhasarathy, C. Malone, S. E. Sobol, C. Geigerman, of antigen-specific CD4 T cells in the bone marrow but not long-term immu- D. L. Jaye, D. Mav, R. Shah, L. Li, and P. A. Wade. 2010. DNA methylation nological memory. J. Immunol. 186: 4019–4026. prevents CTCF-mediated silencing of the oncogene BCL6 in B cell lymphomas. 48. Li, S., S. Chen, X. Xu, A. Sundstedt, K. M. Paulsson, P. Anderson, S. Karlsson, J. Exp. Med. 207: 1939–1950. H. O. Sjo¨gren, and P. Wang. 2000. Cytokine-induced Src homology 2 protein 39. Janson, P. C., L. B. Linton, E. A. Bergman, P. Marits, M. Eberhardson, F. Piehl, (CIS) promotes T cell receptor-mediated proliferation and prolongs survival of V. Malmstro¨m, and O. Winqvist. 2011. Profiling of CD4+ T cells with epigenetic activated T cells. J. Exp. Med. 191: 985–994. immune lineage analysis. J. Immunol. 186: 92–102. 49. Nakajima, Y., I. Tsuge, Y. Kondo, R. Komatsubara, N. Hirata, M. Kakami, 40. Luo, Y., X. Zhang, M. Zhao, and Q. Lu. 2009. DNA demethylation of the per- M. Kato, H. Kurahashi, A. Urisu, and Y. Asano. 2008. Up-regulated cytokine- forin promoter in CD4(+) T cells from patients with subacute cutaneous lupus inducible SH2-containing protein expression in allergen-stimulated T cells from erythematosus. J. Dermatol. Sci. 56: 33–36. hen’s egg-allergic patients. Clin. Exp. Allergy 38: 1499–1506. Downloaded from 41. Jeffries, M., M. Dozmorov, Y. Tang, J. T. Merrill, J. D. Wren, and A. H. Sawalha. 50. Khor, C. C., F. O. Vannberg, S. J. Chapman, H. Guo, S. H. Wong, A. J. Walley, 2011. Genome-wide DNA methylation patterns in CD4+ T cells from patients D. Vukcevic, A. Rautanen, T. C. Mills, K. C. Chang, et al. 2010. CISH and with systemic lupus erythematosus. Epigenetics 6: 593–601. susceptibility to infectious diseases. N. Engl. J. Med. 362: 2092–2101. http://www.jimmunol.org/ by guest on September 24, 2021 $ &'(& )#"' ( =: A B CD E F -= <:6 (#,"(
=:
(#&= <:6 (#,"(
=:
!#&0= <:6 (#,"( :6 &@ $ ' "
? ', ('%," "$#' )#"
A B C D E F 98% 40% 92% 100% 95% 100% -=
100% 39% 80% 100% 93% 100% (#&=
!#&0= 42% 5% 6% 75% 96% 63%
,&; &") 0!(0 (& #" "? #,'#" -"!!#&0 '478"#! #&" 1)#"#(!#,' #,''#. "(&"'& $)#"'(&(' ('7&.'83' " $ ' "" /#"'7 ( ,84 " 0' '#" -7(#$83(#&7! 8"!!#&07#+#!8''(>56" #( #,'4-&) "&$&'"('(!""#&! 1(3! " 0' '3(( "#! #)#"#"!#'#!@(( #,'7"#!.'&8' '(#"(// '478 ', ('#"#! ', ('%," ". ( "# & ' " )"" " - , #"'%," " (" 0' '& ', ((&(!"("4 $" & ' " ($' ('(. "# !(0 )#".'((4 & ' " ($' ('. .&!(0 (4&"('#.'( !(0 )#"&)##& #"!',&0 ', ('%," "4(&' " (($#' )#"#&'(& )#" ' ('((.&((0 4 Table S1. Primers and adapter sequences
Gene Adaptation Forward primer Reverse primer
Klf7 Real time PCR ACAAAACAAAAGGGCCACTG GCTGAGAAGTAGCCGGTGTC
MapK1ip1 Real time PCR CCTCTTCCAGTGTCAGGAGC GGGTAAGGATTATTCGGGGA
Actb Real time PCR GCTACAGCTTCACCACCACA AAGGAAGGCTGGAAAAGAGC
Reporter assay
Ptgir ATTAAAAGGAATTCCCACATGTACCGCCAACAGAGA GCTCTTCTCCACTAGCACTCCAAACCGTGTTCCAA
Tnfsf4 ATTAAAAGGAATTCCCCACACCCTGCAAGGAAAAA GCTCTTCTCCACTAGTAACCCTACCACCTCCACAACTG
Tbx21 ATTAAAAGGAATTCCCAAACGGGAGAGAGCAAAAGTG GCTCTTCTCCACTAGCGTTTCATACCCACGAATTCTG
Cish ATTAAAAGGAATTCCGGCGGAACTCTTACTTAGCATGTAC GCTCTTCTCCAAGCTGGAGAACGTCTTGGCTATGCA
Chsy1 ATTAAAAGGAATTCCGGCCTGTCCTCAGACTGCTT GCTCTTCTCCACTAGACAGAATGCTTGTAGAACTGATGGA
IL7r ATTAAAAGGAATTCCCACGCTAGTCCAGCCAATGA GCTCTTCTCCACTAGGGAAGTTTGTTACAGTGGGCAAGA
Acot7 ATTAAAAGGAATTCCTCTATTAGGCTGATCCCAGTTGTG GCTCTTCTCCACTAGCCAGGGCTGTTATACATGGAGAGA
Sdf4 ATTAAAAGGAATTCCCCGATGGTATCAGGCAGACA GCTCTTCTCCACTAGTCTTAACACAGGGCTGGGATGT
RASA3 ATTAAAAGGAATTCCCAGCTGAGGCTTCTGTTAGCAA GCTCTTCTCCACTAGCCCAGTCAACTGCACTGTCATC
Maff ATTAAAAGGAATTCCTGCGTGCACACGGTGTACTT GCTCTTCTCCACTAGACTTTCTGGCCTTGCCTGTTT
Hrh2 ATTAAAAGGAATTCCTGCCTATCAGGGAGCAAGCT GCTCTTCTCCACTAGGCTTTTGCCCAGCCTTCAAA
Mtss1 ATTAAAAGGAATTCCCTGTGCCTGTGGCTCTAAGTCA GCTCTTCTCCACTAGGAATATTGCACCCCCCCTTGT
Klf7 ATTAAAAGGAATTCCATGGCAGGTCACAAGTCAGGAA GCTCTTCTCCACTAGCAGCCCTGAACCGCTTTTCT
Wdfy2 ATTAAAAGGAATTCCTCTCACCCACTACCCGAGAAGT GCTCTTCTCCACTAGAGAGGAGGCAAGTCAGTAAAGAACGT
Nr5a1 ATTAAAAGGAATTCCTCTATAGCTGCCTCTCCCCTTCT GCTCTTCTCCACTAGAGCCAGACTCAACAGGTGCAT
MapK1ip1 ATTAAAAGGAATTCCGATGCTGCTTGTGTAGAGGTGATG GCTCTTCTCCACTAGCCAAAACGTCCTCCCAGAAC B-bar-2NN-R MSCC construct TTTTTAACTGCCCCGGGTTCCTCATTCTCTAGGGAGTGGTCTGCTGTACGGCCAAGGCGNN
B-bar-3NN-R MSCC construct TTTTTAACTGCCCCGGGTTCCTCATTCTCTATAGGTTATACTGCTGTACGGCCAAGGCGNN
B-bar-4NN-R MSCC construct TTTTTAACTGCCCCGGGTTCCTCATTCTCTGGATGCGGTCCTGCTGTACGGCCAAGGCGNN
B-bar-5NN-R MSCC construct TTTTTAACTGCCCCGGGTTCCTCATTCTCTGTGGTGTAAGCTGCTGTACGGCCAAGGCGNN
B-bar-8NN-R MSCC construct TTTTTAACTGCCCCGGGTTCCTCATTCTCTGAGCGAGGATCTGCTGTACGGCCAAGGCGNN
B-bar-9NN-R MSCC construct TTTTTAACTGCCCCGGGTTCCTCATTCTCTAGGTTGCGACCTGCTGTACGGCCAAGGCGNN
B-bar-16NN-R MSCC construct TTTTTAACTGCCCCGGGTTCCTCATTCTCTGGGAGACGTTCTGCTGTACGGCCAAGGCGNN
B-bar-17NN-R MSCC construct TTTTTAACTGCCCCGGGTTCCTCATTCTCTGAGGTGGGAGCTGCTGTACGGCCAAGGCGNN
B-bar-18NN-R MSCC construct TTTTTAACTGCCCCGGGTTCCTCATTCTCTGGTGGGACACCTGCTGTACGGCCAAGGCGNN Table S2. Differentially methylated regions in naive, effector, and memory CD4+ T cells
DNA methylation score* No. of Naive cell Naive cell Effector cell Effector cell Memory cell Memory cell nucleotides Distance from Restriction site Chr Symbol RefSeq Description Position DNA cut DNA cut DNA cut DNA cut DNA cut DNA cut from nearest nearest CGI with HpaII with MspI with HpaII with MspI with HpaII with MspI TSS
6500679 chr1 130325 inter-genic -69398 0 9 2 11 10 7 10384076 chr1 325946 Cpa6 NM_177834 carboxypeptidase B intron8 161853 0 9 8 16 12 11 10761277 chr1 11121 LOC433271 intron1 34103 0 16 2 17 10 9 13633390 chr1 17198 Lactb2 NM_145381 lactamase beta 2 intron3 -16921 0 10 24 5 19 4 20513460 chr1 94676 Pkhd1 NM_153179 polyductin Exon_32/67 -296508 0 11 0 10 10 5 22310111 chr1 112811 Rims1 NM_001012623 regulating synaptic membrane exocytosis 1 intron1 -229904 0 16 3 12 21 5 23036696 chr1 131471 inter-genic 72030 0 22 4 10 12 8 33871022 chr1 248 Zfp451 NM_133817 zinc finger protein 451 intron1 0 0 2 23 0 12 1 35040041 chr1 133238 inter-genic -53162 0 8 1 4 10 16 36314390 chr1 -50208 inter-genic 11686 11 2 3 10 0 2 36825467 chr1 6762 Zap70 NM_009539 zeta-chain TCR associated protein kinase intron1 2186 0 8 2 1 24 5 37022569 chr1 -63591 inter-genic -26883 0 11 5 16 19 15 37310166 chr1 34061 Cnga3 NM_009918 cyclic nucleotide gated channel alpha 3 intron3 46519 0 5 12 2 13 3 42200693 chr1 -553297 inter-genic 347836 0 14 4 11 12 7 46399258 chr1 275676 Dnahc7b intron60 83047 0 18 0 18 12 4 47721050 chr1 -1213758 inter-genic -811509 0 15 3 16 17 13 51274178 chr1 -71791 inter-genic 260825 0 6 9 10 13 4 59538905 chr1 -117 Fzd7 NM_008057 frizzled 7 up500region 0 0 2 8 1 14 5 62552197 chr1 866381 Pard3b NM_001081050 par-3 partitioning defective 3 homolog B intron20 197215 0 10 6 2 12 7 63261612 chr1 49616 inter-genic 33251 0 1 18 5 10 3 64135805 chr1 32156 Klf7 NM_033563 Kruppel-like factor 7 ubiquitous intron1 -32381 0 6 4 11 17 1 67205495 chr1 35856 Cps1 NM_001080809 carbamoyl-phosphate synthetase 1 Exon_11/38 -120401 0 4 2 5 10 3 72049410 chr1 -1413 inter-genic 208913 0 5 0 5 12 5 72164809 chr1 3764 LOC100043255 intron2 -93513 0 4 0 3 11 7 72613450 chr1 -16394 inter-genic -29915 0 7 3 0 11 5 73742402 chr1 -429712 inter-genic 211443 10 7 1 1 0 2 74287828 chr1 4705 Arpc2 NM_029711 actin related protein 2/3 complex subunit 2 intron1 -4674 0 13 7 10 10 9 76136805 chr1 565211 inter-genic -593966 0 5 2 8 12 0 78895554 chr1 78769 inter-genic -241357 0 5 3 1 10 4 79733302 chr1 25003 Wdfy1 NM_001111279 WD repeat and FYVE domain containing 1 isoform intron2 -24523 0 6 14 6 28 6 79856495 chr1 83903 inter-genic -1727 0 7 4 2 12 4 79995468 chr1 41335 inter-genic -140700 10 5 0 2 0 3 80712840 chr1 42286 Dock10 intron1 -41805 0 8 0 4 19 3 80714174 chr1 40952 Dock10 intron1 -40471 0 7 10 9 17 4 84777455 chr1 58422 Trip12 NM_133975 thyroid hormone receptor interactor 12 intron5 -57573 0 4 7 7 29 4 89562447 chr1 45494 Inpp5d NM_001110193 inositol polyphosphate-5-phosphatase D isoform intron3 89994 10 14 1 8 0 3 90879120 chr1 -87916 inter-genic 87891 0 7 9 8 11 5 90916751 chr1 -50285 inter-genic 50260 0 9 0 8 11 1 94076282 chr1 378229 inter-genic 0 10 3 15 6 0 1 94679521 chr1 -48741 inter-genic 48302 0 3 1 2 12 3 94729332 chr1 1070 Gpc1 NM_016696 glypican 1 intron1 0 16 2 0 0 0 1 95575996 chr1 -6274 inter-genic 6035 0 6 1 7 14 3 102250824 chr1 581483 C230078M14Rik NM_172851 contactin associated protein-like 5 intron13 -2259200 0 13 3 21 12 9 107687024 chr1 -17695 inter-genic -126621 0 3 6 3 12 0 108219855 chr1 151410 Phlpp intron4 -151849 0 7 16 7 18 4 120582317 chr1 57796 inter-genic -57919 0 4 12 6 15 5 120686279 chr1 161758 inter-genic 47692 0 7 3 6 12 5 121378038 chr1 23165 Ralb NM_022327 v-ral simian leukemia viral oncogene homolog B intron2 -22960 0 5 3 1 12 5 123010025 chr1 29142 AI848258 intron3 64460 0 8 0 10 10 13 126188588 chr1 -1269024 inter-genic -246560 0 9 6 3 10 8 126322505 chr1 -1135107 inter-genic -380477 0 5 0 2 10 2 133422390 chr1 1546 Srgap2 NM_001081011 SLIT-ROBO Rho GTPase activating protein 2 intron1 0 0 1 29 2 11 0 133867779 chr1 594 Slc45a3 NM_145977 solute carrier family 45 member 3 intron1 -8230 0 3 12 0 11 0 134092631 chr1 -32132 inter-genic -5967 0 4 2 10 10 2 134706509 chr1 -70422 inter-genic 70378 0 2 5 3 12 1 135668824 chr1 -161269 inter-genic -111360 0 4 8 8 12 7 135995015 chr1 -10895 inter-genic -5453 0 5 2 8 10 4 138026205 chr1 -1772 inter-genic 1647 0 12 3 4 12 8 140511932 chr1 4339 Nek7 NM_021605 NIMA never in mitosis gene a-related expressed intron1 -3796 0 11 8 8 12 8 145643446 chr1 18982 Uchl5 NM_019562 ubiquitin carboxyl-terminal esterase L5 intron6 -19602 0 10 13 13 22 8 146148497 chr1 524033 inter-genic -297238 0 9 1 11 12 4 146638059 chr1 1013595 inter-genic -786800 0 7 2 9 12 4 153083708 chr1 26453 inter-genic 107647 0 4 1 10 18 4 153508389 chr1 89726 Niban NM_022018 niban protein intron5 -89946 0 6 3 4 12 7 154413323 chr1 58916 Rgl1 NM_016846 ral guanine nucleotide dissociation intron4 -58714 0 4 12 7 11 3 154668182 chr1 13163 Ncf2 NM_010877 neutrophil cytosolic factor 2 intron3 -55125 0 12 3 12 15 8 162724459 chr1 -98776 inter-genic -2299 0 13 3 7 13 8 165531273 chr1 -22569 inter-genic -289141 0 21 5 8 10 11 166900065 chr1 9012 inter-genic 223977 0 5 3 5 12 6 167751002 chr1 32149 Cd247 NM_001113394 CD247 antigen isoform kappa precursor intron1 24142 0 7 8 9 15 8 168651678 chr1 -279927 inter-genic 279044 0 6 6 9 14 4 170143612 chr1 218775 Pbx1 NM_008783 pre B-cell leukemia transcription factor 1 intron2 283693 0 4 3 2 10 3 171312334 chr1 -273297 inter-genic 149086 0 1 4 3 12 4 173327706 chr1 8564 Arhgap30 NM_001005508 Rho GTPase activating protein 30 Exon_2/12 13634 0 15 7 7 16 4 176558716 chr1 139414 Fmn2 NM_019445 formin 2 intron9 -125274 0 11 3 21 14 16 177373868 chr1 48651 Rgs7 NM_011880 regulator of G protein signaling 7 intron2 -48360 0 3 1 2 11 11 177415526 chr1 6993 Rgs7 NM_011880 regulator of G protein signaling 7 intron2 -6702 0 6 8 14 13 5 179630750 chr1 -29194 inter-genic 95315 0 3 2 1 12 3 179723608 chr1 3030 Adss NM_007422 adenylosuccinate synthetase non muscle intron1 -2456 0 3 9 5 10 1 183142388 chr1 -60775 inter-genic 0 14 0 11 0 0 3 185757933 chr1 -100406 inter-genic 99258 0 1 13 3 10 3 185962833 chr1 104494 inter-genic -105642 0 7 4 2 10 6 187215332 chr1 28359 Eprs NM_029735 glutamyl-prolyl-tRNA synthetase intron12 -28624 10 2 3 7 0 3 187991598 chr1 712872 inter-genic -50650 0 12 2 14 12 10 188379701 chr1 -371139 inter-genic 148458 0 8 7 1 17 5 193887059 chr1 29388 Traf5 NM_011633 Tnf receptor-associated factor 5 intron3 -29088 0 7 2 10 10 5 3638512 chr2 7783 3110001A13Rik NM_025626 hypothetical protein LOC66540 intron1 -7877 0 7 1 8 31 6 9290160 chr2 -490158 inter-genic 506108 0 17 6 20 14 19 12345523 chr2 -500144 inter-genic -5123 0 5 1 4 12 1 16274763 chr2 -3185 inter-genic 3184 0 2 1 1 15 5 21359913 chr2 70720 Gpr158 NM_001004761 G protein-coupled receptor 158 intron2 -69515 0 8 0 3 13 10 24223143 chr2 -17773 inter-genic 0 14 0 0 0 0 2 24632665 chr2 -172656 inter-genic -15079 0 6 15 7 19 0 25151064 chr2 23433 Grin1 NM_008169 glutamate receptor ionotropic, NMDA1 zeta 1 intron18 3390 0 5 3 10 10 1 27109050 chr2 88024 inter-genic -111463 0 6 8 11 14 12 27822267 chr2 80063 Col5a1 NM_015734 procollagen type V, alpha 1 intron16 -80584 0 16 3 9 11 10 28393931 chr2 25081 Ralgds NM_009058 ral guanine nucleotide dissociation stimulator intron1 -4975 0 8 13 15 10 1 28825549 chr2 85035 1700101E01Rik NM_001085514 hypothetical protein LOC329375 intron3 52352 0 9 2 9 12 5 30924452 chr2 73072 Fnbp1 NM_001038700 formin binding protein 1 isoform a intron6 -72017 0 9 2 2 14 5 30992933 chr2 4591 Fnbp1 NM_001038700 formin binding protein 1 isoform a intron1 -3536 0 17 8 26 12 7 32580552 chr2 3961 Sh2d3c NM_013781 SH2 domain containing 3C Exon_2/12 -12857 0 1 3 1 12 1 33035078 chr2 191918 Ralgps1 NM_175211 Ral GEF with PH domain and SH3 binding motif 1 intron8 49356 0 3 17 3 10 3 34816504 chr2 786 Traf1 NM_009421 Tnf receptor-associated factor 1 intron1 47222 0 5 8 5 20 3 35302976 chr2 13870 Ggta1 NM_010283 glycoprotein galactosyltransferase alpha 1 3 intron1 -14784 0 16 11 7 19 6 38564748 chr2 5312 Nr5a1 NM_139051 nuclear receptor subfamily 5 group A, member 1 intron3 -1049 0 9 1 0 10 2 41882751 chr2 626365 Lrp1b NM_053011 low density lipoprotein-related protein 1B intron2 -625620 0 22 3 26 14 22 49653434 chr2 10229 2310010M24Rik NM_027990 hypothetical protein LOC71897 intron1 -10474 0 7 2 10 13 7 52379040 chr2 153059 Cacnb4 NM_001037099 calcium channel voltage-dependent, beta 4 intron2 99263 0 7 7 10 34 6 53675984 chr2 265025 inter-genic 261293 0 4 4 11 14 9 54604891 chr2 316094 Galnt13 NM_173030 UDP-N-acetyl-alpha-D-galactosamine:polypeptide intron4 -316463 0 17 5 19 10 12 60189952 chr2 31367 Ly75 NM_013825 lymphocyte antigen 75 intron11 -31177 0 1 4 2 12 5 65034072 chr2 42609 Cobll1 NM_177025 Cobl-like 1 intron1 -42050 0 10 3 2 18 11 67172603 chr2 -111455 inter-genic 231103 0 12 3 13 12 10 71721510 chr2 10182 Pdk1 NM_172665 pyruvate dehydrogenase kinase isoenzyme 1 Exon_4/11 -10536 0 10 2 10 18 9 73297777 chr2 69688 Wipf1 NM_153138 WAS/WASL interacting protein family member 1 intron1 -69145 0 4 9 3 10 1 75040990 chr2 11727 inter-genic -65510 0 13 7 10 12 5 76052404 chr2 124304 Pde11a NM_001081033 phosphodiesterase 11A intron3 -155563 0 2 15 4 15 4 77784057 chr2 181 BC003993 NM_030560 hypothetical protein LOC80744 intron1 0 12 2 23 5 0 1 80302064 chr2 -140300 inter-genic -14556 0 6 3 7 10 5 83484576 chr2 -158 Zc3h15 NM_026934 erythropoietin 4 immediate early response up500region 0 0 2 3 0 11 2 92610262 chr2 -144995 inter-genic 144883 0 6 5 0 10 4 92610406 chr2 -144851 inter-genic 144739 0 9 14 6 33 9 92947257 chr2 -80483 inter-genic -61712 0 5 11 7 12 3 92952655 chr2 -75085 inter-genic -67110 0 1 0 2 10 3 94338372 chr2 855782 inter-genic -60763 0 13 7 7 17 7 102784236 chr2 -129595 inter-genic 129299 13 4 1 4 0 8 102840578 chr2 -73253 inter-genic 72957 0 14 2 9 11 18 103114082 chr2 29269 Ehf NM_007914 ets homologous factor Exon_6/9 200548 0 8 4 5 10 7 103197209 chr2 -67024 inter-genic 127710 0 9 3 11 12 9 106751927 chr2 93713 inter-genic 62417 0 6 4 7 12 5 112923309 chr2 -202579 inter-genic 133813 0 17 4 9 10 7 114698306 chr2 68100 LOC100043222 intron3 217906 0 9 2 3 12 10 114933407 chr2 -474104 inter-genic -453006 0 17 5 13 12 11 118728589 chr2 1239 Bahd1 NM_001045523 bromo adjacent homology domain containing 1 intron1 0 15 6 9 3 0 4 120328900 chr2 39292 Capn3 NM_007601 calpain 3 isoform a Exon_21/24 60309 15 7 2 6 0 13 122174299 chr2 32861 inter-genic 0 0 3 11 5 10 1 123832143 chr2 -603888 inter-genic 83494 0 11 1 11 11 7 124311362 chr2 -124669 inter-genic 124214 0 8 1 6 10 6 130121565 chr2 -109 Ebf4 NM_001110513 early B-cell factor 4 up500region 0 13 5 0 1 0 1 136273405 chr2 -54350 inter-genic -60100 0 8 3 1 10 2 137643074 chr2 -439245 inter-genic 439198 0 8 11 11 13 11 137879815 chr2 -202504 inter-genic 202457 0 5 3 5 11 3 143836425 chr2 572 Rrbp1 NM_024281 ribosome binding protein 1 isoform a intron1 0 0 2 9 6 11 0 148509067 chr2 2168 Gzf1 NM_028986 GDNF-inducible zinc finger protein 1 intron1 -2392 0 7 5 3 12 6 150732853 chr2 -2468 inter-genic -2926 0 18 7 7 18 13 152653986 chr2 3430 Bcl2l1 NM_009743 Bcl2-like 1 intron2 -2606 0 7 1 6 10 6 161878079 chr2 608802 Ptprt NM_021464 protein tyrosine phosphatase receptor type, T intron7 -608085 0 20 3 9 14 6 164346527 chr2 23503 inter-genic -13643 0 1 3 3 12 1 165469882 chr2 -10915 inter-genic -49470 0 6 17 15 21 7 168399503 chr2 343382 inter-genic -3254 0 9 2 9 13 5 168907037 chr2 -536171 inter-genic -126648 0 10 3 1 11 7 180674501 chr2 14896 C030019F02Rik intron4 -14610 0 14 4 8 15 6 5498448 chr3 -74644 inter-genic 77347 0 7 6 6 12 5 24787930 chr3 556216 inter-genic 254668 10 14 0 2 0 3 26412275 chr3 -124277 inter-genic 88683 0 25 1 13 14 6 27179035 chr3 -36963 inter-genic 91654 0 1 9 3 10 1 29055227 chr3 73729 6130401L20Rik intron4 -73916 0 14 2 15 10 11 29971215 chr3 -529793 inter-genic 435334 0 7 3 4 16 6 35228703 chr3 -424356 inter-genic -370596 0 2 1 7 11 7 37072185 chr3 109595 inter-genic -109763 0 1 14 6 14 0 50481934 chr3 -546434 inter-genic 546442 0 6 3 1 14 4 50959825 chr3 -68543 inter-genic 68551 0 7 3 17 16 5 52507567 chr3 -60954 inter-genic 313226 0 8 3 6 17 5 52776167 chr3 -69301 inter-genic 44626 15 1 0 8 0 1 55555468 chr3 -30978 inter-genic 28660 10 18 0 19 0 16 57952826 chr3 31972 LOC100040216 intron1 265717 0 14 3 15 12 11 59917601 chr3 31809 inter-genic 387267 0 9 2 8 11 4 60350279 chr3 45106 Mbnl1 NM_020007 muscleblind-like 1 intron2 -45411 0 5 3 2 10 9 60351906 chr3 46733 Mbnl1 NM_020007 muscleblind-like 1 intron2 -47038 0 5 1 4 13 5 60616072 chr3 -190644 inter-genic 190433 0 5 3 4 10 3 64737124 chr3 -176181 inter-genic 459073 0 7 2 5 12 9 67459892 chr3 73203 inter-genic -73365 0 7 3 5 19 9 67462618 chr3 75929 inter-genic -76091 0 16 3 16 14 7 68588733 chr3 -61267 inter-genic 84346 0 7 2 7 19 7 68931233 chr3 -221 Kpna4 NM_008467 karyopherin alpha 4 up500region 0 17 3 7 0 0 2 69314845 chr3 194006 Ppm1l NM_178726 protein phosphatase 1 formerly 2C-like intron2 87427 0 14 9 11 16 8 85519890 chr3 6538 9930021J17Rik NM_172682 hypothetical protein LOC229488 intron2 -171160 0 9 1 0 17 3 88336047 chr3 -3922 inter-genic 0 21 2 8 3 0 1 91056413 chr3 181045 inter-genic -743301 0 6 8 11 15 7 93004254 chr3 3060 EG229574 Exon_2/8 243281 0 26 4 10 11 16 96685790 chr3 23429 Gpr89 NM_026229 G protein-coupled receptor 89 intron8 -22905 0 6 15 8 24 6 101642455 chr3 -171622 inter-genic 85552 0 5 5 0 37 8 103668086 chr3 3872 Ptpn22 NM_008979 protein tyrosine phosphatase non-receptor type intron1 49994 0 4 0 20 11 5 107471904 chr3 27560 Ahcyl1 NM_145542 S-adenosylhomocysteine hydrolase-like 1 intron10 -26911 0 3 1 0 10 4 107638253 chr3 -41894 inter-genic 60430 0 10 1 8 11 4 108922908 chr3 -3158 inter-genic 3121 0 9 3 4 11 4 118110407 chr3 -154688 inter-genic -538726 0 7 2 9 14 4 121948686 chr3 177 Gclm NM_008129 glutamate-cysteine ligase modifier subunit Exon_1/7_1stExon 0 13 1 8 1 0 1 122123410 chr3 666 Bcar3 NM_013867 breast cancer anti-estrogen resistance 3 intron1 -638 13 0 1 1 0 1 125442150 chr3 301553 inter-genic 198593 0 9 3 9 16 6 129974058 chr3 90263 Col25a1 NM_198711 collagen type XXV, alpha 1 isoform 2 intron2 -90434 0 12 2 10 11 9 133288074 chr3 314995 inter-genic -80932 0 3 15 5 11 6 136604671 chr3 -6874 inter-genic -272236 0 3 5 9 13 5 137737915 chr3 10148 inter-genic 68286 13 18 0 15 0 13 138089459 chr3 10999 Adh4 NM_011996 alcohol dehydrogenase 4 class II pi intron6 16163 0 9 8 5 10 7 145517328 chr3 95638 Ddah1 NM_026993 dimethylarginine dimethylaminohydrolase 1 intron4 69637 0 12 18 16 11 4 145673260 chr3 22298 Syde2 intron4 -22651 0 3 3 11 17 5 156766094 chr3 541337 Negr1 NM_001039094 neuronal growth regulator 1 isoform a intron4 430910 0 6 1 6 10 11 157184112 chr3 -13248 inter-genic 12892 0 2 1 0 12 4 12937582 chr4 103578 inter-genic -103597 0 10 4 5 12 4 20050722 chr4 81524 inter-genic -81773 0 17 1 14 14 8 24423869 chr4 -8439 inter-genic 0 11 3 3 2 0 1 27225935 chr4 -1514366 inter-genic -952379 0 2 5 3 10 2 31232670 chr4 -36442 inter-genic 791857 0 13 3 14 11 3 31733995 chr4 -317101 inter-genic 290532 0 13 1 6 14 8 32338128 chr4 12204 Bach2 NM_007521 BTB and CNC homology 2 isoform 2 intron1 -12747 0 5 10 2 19 7 33236413 chr4 16883 Gabrr1 NM_008075 gamma-aminobutyric acid GABA receptor rho 1 intron3 39418 0 11 6 12 10 2 35514576 chr4 415273 inter-genic -341974 0 20 4 4 12 20 41026025 chr4 -57028 inter-genic 19036 0 11 9 9 20 8 43303789 chr4 23759 4930417M19Rik NM_177195 testis flippase intron2 80815 0 20 2 6 17 15 43981837 chr4 11264 Glipr2 NM_027450 GLI pathogenesis-related 2 intron3 -11607 0 6 1 2 32 2 47647810 chr4 160278 inter-genic -161009 0 6 3 6 12 2 47794031 chr4 -270088 inter-genic 261713 0 6 2 12 13 12 48064627 chr4 508 Nr4a3 NM_015743 nuclear receptor subfamily 4 group A, member 3 Exon_1/6_1stExon 0 12 8 8 1 0 2 52003492 chr4 -250282 inter-genic 448278 0 8 2 8 19 9 53459078 chr4 5550 Slc44a1 NM_133891 solute carrier family 44 member 1 intron1 -6203 0 17 36 16 35 11 59465600 chr4 -128862 inter-genic -14782 0 6 7 8 10 2 61557956 chr4 198082 inter-genic 311397 0 10 0 2 11 1 62296318 chr4 109916 inter-genic -51897 0 8 8 1 40 9 62438156 chr4 -188451 inter-genic -193735 0 12 2 14 10 5 63504563 chr4 17753 Tnfsf8 NM_009403 tumor necrosis factor ligand superfamily intron2 -173999 0 8 2 9 10 10 63532427 chr4 311038 inter-genic 146136 0 8 3 3 12 3 64443059 chr4 -342148 inter-genic 342421 0 14 0 7 12 11 72314037 chr4 879221 inter-genic -453358 0 5 2 9 10 3 76096522 chr4 143679 Ptprd NM_011211 protein tyrosine phosphatase receptor type, D intron1 1276 15 1 3 3 0 1 86967769 chr4 447402 inter-genic -91718 0 4 2 8 10 3 87690709 chr4 -49824 inter-genic -13206 0 8 0 17 21 9 88826214 chr4 42885 Mtap NM_024433 methylthioadenosine phosphorylase Exon_8/8_lastExon -42951 0 8 3 8 14 8 96413532 chr4 38317 LOC620779 NM_001081284 hypothetical LOC620779 intron7 779826 0 9 4 7 12 10 101632385 chr4 19374 inter-genic 127756 0 4 4 5 12 9 105677882 chr4 -310460 inter-genic 310439 0 8 2 7 12 6 107392975 chr4 14748 inter-genic -36826 0 18 20 11 43 22 109828974 chr4 178345 inter-genic -105340 0 14 4 11 11 7 109844414 chr4 193785 inter-genic -120780 0 15 4 12 12 9 111129276 chr4 41666 2310026E23Rik intron5 -41912 0 12 0 12 10 5 114560513 chr4 -21064 inter-genic 14145 0 10 12 9 11 6 115219204 chr4 -17117 inter-genic 190963 0 15 9 7 17 9 116494192 chr4 -81 Hpdl NM_146256 4-hydroxyphenylpyruvate dioxygenase-like up500region 635 0 2 0 0 12 0 116678085 chr4 10133 inter-genic -10126 0 8 15 12 17 2 116961592 chr4 207926 4931406I20Rik NM_025739 hypothetical protein LOC66743 intron6 0 0 9 12 2 12 8 119735109 chr4 247827 Hivep3 NM_010657 human immunodeficiency virus type I enhancer intron2 -29659 0 6 8 16 19 3 119822959 chr4 -11069 inter-genic -1619 0 17 9 13 13 5 124605591 chr4 8554 Cdca8 NM_026560 cell division cycle associated 8 intron3 -8152 0 15 30 10 37 14 125042972 chr4 47 LOC100039298 Exon_1/7_1stExon 124222 0 1 18 14 10 1 125815045 chr4 33804 Stk40 NM_028800 serine/threonine kinase 40 Exon_10/11 10696 0 17 6 9 10 7 125815129 chr4 33888 Stk40 NM_028800 serine/threonine kinase 40 intron10 10612 0 6 8 4 14 2 125912321 chr4 21203 Mtap7d1 NM_144941 microtubule-associated protein 7 domain Exon_9/17 1137 11 6 7 7 0 3 127230449 chr4 309422 inter-genic -227014 0 12 5 8 10 4 127604237 chr4 -334050 inter-genic 44546 0 1 3 1 11 4 127657123 chr4 -281164 inter-genic 7875 0 13 3 4 11 9 128694542 chr4 -40652 inter-genic -24252 0 6 15 7 14 4 128721982 chr4 -13212 inter-genic 3897 0 6 5 11 10 4 128915487 chr4 10198 C77080 NM_001033189 hypothetical protein LOC97130 intron1 -581 12 3 1 1 0 2 129737631 chr4 12500 Col16a1 NM_028266 collagen type XVI, alpha 1 intron21 -12839 0 5 7 9 10 1 129913250 chr4 -72771 inter-genic 38884 0 5 1 3 11 6 130461444 chr4 -5735 inter-genic -43834 0 4 3 5 11 2 130684764 chr4 134216 inter-genic 45144 0 1 5 2 12 3 131393023 chr4 1168 Ptpru NM_001083119 protein tyrosine phosphatase receptor type, U intron1 0 0 3 3 0 12 0 131478307 chr4 622 EG623230 Exon_1(only) -2193 10 0 15 8 0 1 131735069 chr4 -95258 inter-genic 32060 0 11 0 13 10 6 131965801 chr4 12519 Phactr4 NM_175306 phosphatase and actin regulator 4 intron2 -12116 0 3 1 1 10 3 132288461 chr4 -2 Xkr8 NM_201368 X Kell blood group precursor related family up500region -35774 0 1 1 0 10 1 132585412 chr4 17992 Ahdc1 NM_146155 AT hook DNA binding motif, containing 1 intron2 9001 11 6 0 1 0 2 133430205 chr4 13492 Rps6ka1 NM_009097 ribosomal protein S6 kinase polypeptide 1 intron2 -13281 15 3 13 4 0 1 135308312 chr4 -7323 inter-genic 103194 10 4 2 4 0 2 135898409 chr4 31523 inter-genic -32025 0 11 12 10 12 10 137156231 chr4 6128 Usp48 NM_130879 ubiquitin specific protease 48 intron1 -6650 0 4 1 1 10 1 138052462 chr4 41362 inter-genic -42548 0 2 9 10 12 0 139481445 chr4 15043 inter-genic 40035 0 1 3 0 10 5 139744801 chr4 57896 Igsf21 NM_198610 immunoglobin superfamily member 21 intron1 -55526 0 1 18 9 17 1 141438683 chr4 89157 inter-genic -8136 0 4 0 2 13 5 142926414 chr4 -13237 inter-genic 13484 0 6 7 14 10 4 143494003 chr4 57604 inter-genic -509794 0 3 13 5 12 2 144263690 chr4 12579 Gm436 NM_001085504 hypothetical protein LOC230890 Exon_3/4 -218467 0 4 3 5 12 11 145458684 chr4 31563 inter-genic -32140 0 20 15 33 13 15 148238956 chr4 60456 Casz1 NM_027195 castor homolog 1 zinc finger intron2 26131 10 17 1 16 0 7 148892412 chr4 61 Ctnnbip1 NM_023465 catenin beta interacting protein 1 Exon_1/5_1stExon 0 0 2 3 1 13 2 149722999 chr4 -57449 inter-genic 22885 17 12 2 6 0 7 150298830 chr4 4567 Tnfrsf9 NM_001077508 tumor necrosis factor receptor superfamily intron1 -10473 0 3 3 2 20 1 151561336 chr4 9094 Acot7 NM_133348 acyl-CoA thioesterase 7 intron1 -9631 0 5 5 6 12 4 151890749 chr4 38499 Nphp4 NM_153424 nephrocystin 4 intron9 -39301 0 5 4 4 14 1 153948143 chr4 62837 Prdm16 NM_027504 transcription factor MEL1 intron1 -60747 0 8 1 1 10 1 153957157 chr4 53823 Prdm16 NM_027504 transcription factor MEL1 intron1 -51733 0 12 7 9 15 3 154411499 chr4 -29639 inter-genic 5394 0 4 2 5 14 3 154593171 chr4 3471 Ski NM_011385 Sloan-Kettering viral oncogene homolog intron1 -2475 0 1 8 5 11 0 154735961 chr4 -463 Prkcz NM_008860 protein kinase C zeta isoform a up500region 0 0 1 36 6 16 1 155241784 chr4 1763 BC002216 intron1 -1610 0 5 3 6 19 5 155383008 chr4 15986 Sdf4 NM_011341 stromal cell derived factor 4 Exon_5/7 -17077 0 11 11 6 45 6 155388145 chr4 342 Tnfrsf4 NM_011659 tumor necrosis factor receptor superfamily intron1 20771 0 5 21 6 22 3 7990966 chr5 30495 inter-genic 65424 0 18 2 6 11 25 10089183 chr5 -409933 inter-genic -823060 0 6 6 11 12 3 13066565 chr5 -14759 inter-genic -683203 0 13 6 15 10 14 23858633 chr5 -12003 inter-genic -1591 0 2 19 2 11 2 25388937 chr5 123094 inter-genic -123208 0 11 2 4 15 5 26690429 chr5 106173 inter-genic -293219 0 5 3 8 11 5 31932518 chr5 67463 Rbks NM_153196 ribokinase intron7 16216 0 7 8 10 19 8 33345602 chr5 -9946 inter-genic 15462 0 6 13 8 13 6 34830346 chr5 -38148 inter-genic 25786 0 4 7 7 10 6 36677260 chr5 63526 Sorcs2 NM_030889 VPS10 domain receptor protein SORCS 2 intron1 -62806 0 10 2 9 12 1 38564869 chr5 13808 LOC100040397 intron1 -14620 0 11 9 18 12 17 38719229 chr5 8482 inter-genic -8750 0 7 7 7 10 1 39284457 chr5 548830 inter-genic -209005 0 11 3 12 12 14 40216044 chr5 26705 inter-genic -180403 0 15 2 10 11 13 43715998 chr5 90801 inter-genic -92095 0 10 5 11 11 10 46630496 chr5 599876 inter-genic -382887 0 5 10 16 10 8 49644866 chr5 -171296 inter-genic 270905 0 6 14 10 14 0 52222984 chr5 -532058 inter-genic 281233 0 5 8 5 12 6 53785099 chr5 38720 inter-genic -126880 0 4 39 10 28 2 53937010 chr5 -10007 inter-genic 43224 0 7 7 6 10 3 56107643 chr5 1717835 inter-genic -1380401 0 14 0 9 10 3 60611183 chr5 899703 inter-genic -2502705 0 11 8 14 13 18 61584574 chr5 64489 LOC666597 intron1 -1572510 0 23 4 13 13 20 62769689 chr5 569567 inter-genic 387396 0 4 1 4 12 5 64328169 chr5 31965 AA536743 intron2 -31421 0 8 9 13 25 11 64328296 chr5 31838 AA536743 intron2 -31294 0 2 2 2 12 3 65326857 chr5 -34493 inter-genic 34319 0 3 3 5 17 7 65434972 chr5 73622 inter-genic 63620 0 6 4 5 13 3 67147417 chr5 10339 3732412D22Rik intron1 -10592 0 16 5 11 11 5 67189187 chr5 52109 3732412D22Rik intron1 -52362 0 12 2 9 11 10 73602116 chr5 45739 Fryl NM_028194 furry homolog-like isoform 1 intron2 -44526 0 1 5 4 15 0 75971564 chr5 516 Kit NM_021099 c-kit intron1 0 0 2 27 2 18 4 80117445 chr5 1159007 inter-genic 1331163 0 2 1 3 10 2 82346720 chr5 896103 inter-genic -123218 10 4 13 8 0 5 83689014 chr5 -863223 inter-genic 1156174 0 10 2 11 24 16 92386991 chr5 5101 Rchy1 NM_026557 androgen receptor N-terminal-interacting Exon_2/9 -4622 0 4 5 8 13 5 92404988 chr5 -11510 inter-genic -13374 0 18 5 14 11 5 105954393 chr5 5904 Lrrc8c NM_133897 AD158 intron1 -5996 0 10 1 6 14 3 106695997 chr5 51368 inter-genic -85093 0 1 6 2 12 8 107204562 chr5 187089 inter-genic -79623 0 5 9 5 19 3 108207277 chr5 96847 Evi5 NM_007964 ecotropic viral integration site 5 intron16 53573 0 11 6 12 14 7 109145344 chr5 21824 inter-genic -22381 0 10 7 17 13 11 111923251 chr5 76066 inter-genic -77692 0 11 3 8 12 4 112798190 chr5 24391 Hps4 NM_138646 Hermansky-Pudlak syndrome 4 homolog intron8 25407 13 3 4 1 0 3 114099499 chr5 898 Cmklr1 NM_008153 chemokine-like receptor 1 intron1 35299 10 9 4 10 0 4 115876767 chr5 -2926 inter-genic 2537 0 1 3 4 10 5 117608706 chr5 25103 Taok3 NM_001081308 TAO kinase 3 intron1 -38942 0 4 18 8 23 7 119616235 chr5 -504442 inter-genic -160194 0 16 3 9 13 8 120889196 chr5 7287 Lhx5 NM_008499 LIM homeobox protein 5 intron4 663 0 1 0 3 10 2 121871665 chr5 23675 C330023M02Rik NM_172722 hypothetical protein LOC231713 intron11 -23797 0 13 7 14 25 4 124129324 chr5 4974 Clip1 NM_019765 restin intron1 -4195 0 1 8 7 10 2 124474362 chr5 7905 Vps37b NM_177876 vacuolar protein sorting 37B intron1 -7571 0 15 0 6 10 10 129112189 chr5 5209 inter-genic -6365 0 8 11 7 12 8 131463114 chr5 320276 Wbscr17 NM_145218 UDP-GalNAc:polypeptide intron5 -319087 0 12 5 7 10 9 134652178 chr5 457 Wbscr16 NM_033572 Williams-Beuren syndrome chromosome region 16 intron1 0 20 7 1 1 0 2 135399172 chr5 -9070 inter-genic 9011 0 5 3 9 10 8 137492009 chr5 -14155 inter-genic 13886 0 6 6 2 14 8 140024811 chr5 4949 inter-genic 0 0 2 2 1 22 3 140134633 chr5 114771 inter-genic -39311 0 7 8 13 10 5 145322709 chr5 15938 inter-genic -16446 0 6 8 12 10 4 145522089 chr5 356 Tmem130 NM_177735 transmembrane protein 130 intron1 -239 0 2 34 6 11 0 147682481 chr5 25835 inter-genic -25958 0 1 3 14 12 4 147746988 chr5 -13298 inter-genic 13080 0 1 11 3 10 3 147833491 chr5 54612 Lnx2 NM_080795 PDZ domain containing ring finger 1 intron8 -7304 0 5 4 10 13 7 148111424 chr5 29723 inter-genic 4642 13 4 13 7 0 3 152135756 chr5 -34538 inter-genic 35241 0 4 21 8 14 5 5431916 chr6 98531 inter-genic 14099 0 11 1 7 12 13 16648714 chr6 -366434 inter-genic 366286 0 4 8 14 13 5 17018255 chr6 3107 Tes NM_011570 testis derived transcript isoform 1 intron1 -3255 0 13 4 14 20 8 21559784 chr6 393676 Kcnd2 NM_019697 potassium voltage-gated channel Shal-related intron1 241797 0 4 1 3 10 11 24347300 chr6 -130843 inter-genic 129763 0 8 3 4 10 4 28431041 chr6 694 Snd1 NM_019776 staphylococcal nuclease domain containing 1 intron1 -1226 0 3 9 2 16 2 28986697 chr6 -23523 inter-genic 23257 0 2 10 6 13 2 31784157 chr6 12372 LOC620104 intron3 270781 10 5 4 9 0 4 35490571 chr6 209771 inter-genic -1394 0 8 5 11 10 4 36459478 chr6 -13731 inter-genic -120952 0 8 0 8 13 15 37005274 chr6 244700 Dgki NM_001081206 diacylglycerol kinase iota intron10 -244525 0 16 6 8 12 6 37005342 chr6 244632 Dgki NM_001081206 diacylglycerol kinase iota intron10 -244457 0 8 4 6 22 3 37673496 chr6 -82474 inter-genic 82481 0 11 3 16 21 10 38331728 chr6 205 Ttc26 NM_153600 tetratricopeptide repeat domain 26 intron1 -27896 0 1 14 6 11 4 41152708 chr6 -40754 inter-genic 402454 0 7 3 4 24 10 41152868 chr6 -40594 inter-genic 402294 0 2 3 1 13 2 41565822 chr6 10256 Ephb6 NM_007680 Eph receptor B6 intron6 -10660 0 10 7 5 10 11 42238043 chr6 1360 Clcn1 NM_013491 chloride channel 1 intron1 -23214 0 7 21 6 22 4 42274473 chr6 116 6330503C03Rik NM_001113327 hypothetical protein LOC76156 isoform b intron1 0 0 14 16 1 22 3 45070988 chr6 60902 Cntnap2 NM_001004357 contactin associated protein-like 2 isoform a intron1 -1855703 0 14 0 8 12 11 48595073 chr6 -2159 inter-genic -15828 0 6 1 8 11 0 48751121 chr6 -40399 inter-genic -58420 0 5 3 4 11 1 48979520 chr6 -7103 inter-genic 44236 0 3 0 2 11 3 50343930 chr6 134553 inter-genic 61555 0 7 1 6 10 5 50350440 chr6 141063 inter-genic 55045 0 10 6 7 14 11 51748990 chr6 254469 inter-genic -186392 0 13 3 18 11 18 53612148 chr6 88781 Creb5 NM_172728 cAMP responsive element binding protein 5 intron3 155710 0 11 1 14 10 10 53917926 chr6 10739 Cpvl intron2 -71500 0 16 4 9 10 3 54744096 chr6 -22813 inter-genic 22382 0 8 16 8 12 6 55688922 chr6 54446 inter-genic -61937 0 10 4 8 10 6 56524802 chr6 77704 EG666688 intron3 6191 0 4 13 6 16 3 58574849 chr6 28184 Abcg2 NM_011920 ATP-binding cassette sub-family G, member 2 intron1 15477 0 6 7 1 10 0 63385891 chr6 179041 Grid2 NM_008167 glutamate receptor ionotropic, delta 2 intron1 -179900 0 8 3 15 13 12 65140547 chr6 39729 inter-genic -148017 0 11 14 8 36 15 67333346 chr6 116374 inter-genic -7368 0 4 3 0 21 3 67980846 chr6 763874 inter-genic -495989 0 9 14 7 16 8 69074697 chr6 -1719823 inter-genic -1589840 0 12 1 3 14 5 71843443 chr6 15311 Ptcd3 NM_027275 Pentatricopeptide repeat domain 3 Exon_13/24 -15197 0 7 5 11 25 8 79540953 chr6 -428088 inter-genic -1375095 0 5 4 6 14 4 81993747 chr6 2081 Tmem166 NM_145570 transmembrane protein 166 intron1 -2027 0 5 3 3 11 7 82837210 chr6 -69192 inter-genic 52244 0 10 3 0 15 8 83679435 chr6 18178 Vax2 NM_011912 ventral anterior homeobox containing gene 2 intron1 -18339 0 3 19 8 14 3 84190189 chr6 208622 inter-genic -104714 0 19 6 24 11 14 85120971 chr6 -16953 inter-genic -15953 0 3 0 5 10 5 86565492 chr6 -12675 inter-genic 53194 0 6 6 16 13 10 87107033 chr6 178734 Antxr1 NM_054041 anthrax toxin receptor 1 intron17 114778 0 22 5 17 15 9 87285646 chr6 121 Antxr1 NM_054041 anthrax toxin receptor 1 Exon_1/18_1stExon 0 0 2 6 3 15 1 88513670 chr6 98254 inter-genic 14207 0 8 8 20 15 10 92134010 chr6 5 Mrps25 NM_025578 mitochondrial ribosomal protein S25 Exon_1/4_1stExon 0 0 2 2 1 11 1 92718926 chr6 -47545 inter-genic -62990 0 21 2 10 10 7 93016458 chr6 249987 inter-genic -123398 0 3 0 0 14 2 94097611 chr6 136285 Magi1 NM_001029850 membrane associated guanylate kinase WW and PDZ intron1 -135207 0 4 0 10 11 4 94610399 chr6 39738 Lrig1 NM_008377 leucine-rich repeats and immunoglobulin-like intron2 -38843 0 7 7 4 11 9 95020705 chr6 -47809 inter-genic 46931 0 19 6 17 11 13 97255363 chr6 312210 Frmd4b NM_145148 GRP1-binding protein GRSP1 Exon_18/24 94690 0 8 1 4 11 6 101203974 chr6 123915 Pdzrn3 NM_018884 PDZ domain containing RING finger 3 intron3 -123189 0 7 1 3 11 2 103902053 chr6 441184 inter-genic -439859 0 5 6 6 10 10 108276002 chr6 112891 Itpr1 NM_010585 inositol 14,5-triphosphate receptor 1 intron4 -140772 0 6 14 14 21 11 108395115 chr6 232004 Itpr1 NM_010585 inositol 14,5-triphosphate receptor 1 intron44 214244 0 13 1 16 14 14 108460754 chr6 297643 Itpr1 NM_010585 inositol 14,5-triphosphate receptor 1 Exon_55/62 148605 0 8 0 5 15 9 108622278 chr6 11656 inter-genic -3848 0 7 13 2 35 5 112879061 chr6 17427 Srgap3 NM_080448 SLIT-ROBO Rho GTPase activating protein 3 intron1 -117067 0 16 10 10 20 14 113610475 chr6 21979 Irak2 NM_172161 interleukin-1 receptor-associated kinase 2 intron2 -22098 0 15 5 13 20 5 116719363 chr6 118647 inter-genic -95344 0 11 2 11 13 4 117294522 chr6 55586 EG640142 intron1 -176112 0 20 1 15 11 21 125383703 chr6 83931 inter-genic -53399 0 14 3 9 19 6 127053147 chr6 6405 9630033F20Rik NM_177003 RIKEN cDNA 9630033F20 gene intron1 -6049 0 4 3 17 27 2 127053216 chr6 6336 9630033F20Rik NM_177003 RIKEN cDNA 9630033F20 gene intron1 -5980 0 2 1 0 15 3 129135894 chr6 5255 Clec2d NM_053109 C-type lectin domain family 2 member d Exon_5/5_lastExon -342991 0 2 18 17 11 0 135690627 chr6 432900 Grin2b NM_008171 glutamate receptor ionotropic, NMDA2B epsilon intron12 7638 0 4 5 4 11 5 137159562 chr6 -41423 inter-genic 41293 0 12 1 3 11 8 140575489 chr6 202870 inter-genic -3584 0 7 1 4 12 5 141250358 chr6 52569 Pde3a NM_018779 phosphodiesterase 3A cGMP inhibited intron1 -52336 0 13 5 9 11 13 142797213 chr6 115757 St8sia1 NM_011374 ST8 alpha-N-acetyl-neuraminide intron4 92075 0 3 4 4 26 3 142911578 chr6 1392 St8sia1 NM_011374 ST8 alpha-N-acetyl-neuraminide intron1 -972 0 6 5 11 11 3 146561577 chr6 21535 Tm7sf3 NM_026281 transmembrane 7 superfamily member 3 intron7 -21204 0 12 0 8 11 9 148398510 chr6 95305 inter-genic -6015 0 11 0 14 14 11 4428898 chr7 12555 Eps8l1 NM_026146 epidermal growth factor receptor pathway intron14 23778 0 7 6 7 10 5 4713059 chr7 9843 4930401F20Rik NM_172895 hypothetical protein LOC243822 intron3 -15432 0 9 3 6 10 7 6045888 chr7 28572 Nlrp4c NM_031389 NLR family pyrin domain containing 4C intron5 37776 0 8 1 11 11 9 13565504 chr7 2308 Zfp446 NM_175558 zinc finger protein 446 intron4 -2314 0 9 14 5 24 7 16807375 chr7 -35 Dhx34 NM_027883 DEAH Asp-Glu-Ala-His box polypeptide 34 up500region 0 0 5 2 3 21 4 17493213 chr7 1375 Ptgir NM_008967 prostaglandin I receptor IP intron1 -876 0 10 5 6 11 6 17510362 chr7 18524 inter-genic -1273 0 3 19 8 16 5 19496304 chr7 -14393 inter-genic -775 0 3 1 0 11 3 20058552 chr7 -15852 inter-genic 753 0 6 16 5 15 2 25894630 chr7 22847 Pou2f2 NM_011138 POU domain class 2, transcription factor 2 intron5 -23617 0 5 11 3 37 8 25894654 chr7 22823 Pou2f2 NM_011138 POU domain class 2, transcription factor 2 intron5 -23593 0 4 3 8 22 10 26565381 chr7 8177 Axl NM_009465 AXL receptor tyrosine kinase intron4 26098 0 5 3 3 21 5 31186472 chr7 -12334 inter-genic 20179 0 9 0 10 11 11 31935591 chr7 476 Gramd1a NM_027898 GRAM domain containing 1A intron1 0 13 2 0 0 0 2 34388754 chr7 76360 inter-genic 528647 0 16 7 16 13 10 50568659 chr7 -30 Zfp715 NM_027264 zinc finger protein 715 up500region 625 11 2 3 0 0 1 50758436 chr7 2870 4931406B18Rik NM_028737 hypothetical protein LOC74054 intron2 36652 0 9 6 13 17 14 51934194 chr7 -29918 inter-genic -8058 0 4 0 3 11 6 52257995 chr7 4966 Irf3 NM_016849 interferon regulatory factor 3 Exon_8/8_lastExon 4565 0 3 11 5 25 1 56565731 chr7 -54359 inter-genic -64591 0 2 3 0 11 0 58976723 chr7 99287 inter-genic 140104 0 6 1 4 10 12 60188167 chr7 177392 inter-genic -927118 0 15 0 2 10 8 63562829 chr7 67689 p intron9 -257493 0 21 2 17 14 20 66405178 chr7 -482815 inter-genic 78791 0 5 3 6 11 6 68316932 chr7 49878 D0Kist2 intron5 -1176206 0 9 2 2 10 8 71643420 chr7 -3171 inter-genic 2993 10 6 1 16 0 4 72750644 chr7 38857 EG665234 intron3 -38976 0 2 4 11 14 4 73291652 chr7 37252 Chsy1 NM_001081163 carbohydrate chondroitin synthase 1 intron2 -37769 0 10 8 9 48 6 73721056 chr7 -131933 inter-genic 113552 0 11 1 6 14 10 80271567 chr7 -183848 inter-genic 248566 0 4 1 6 11 3 80352115 chr7 -103300 inter-genic 168018 0 10 1 11 11 3 82544138 chr7 33198 inter-genic 56252 0 5 19 10 14 1 85231288 chr7 -89567 inter-genic 491521 0 4 2 3 11 3 86481588 chr7 63437 Abhd2 NM_018811 abhydrolase domain containing 2 intron5 55330 0 8 10 1 13 5 86938508 chr7 -18 Mesp1 NM_008588 mesoderm posterior 1 up500region 980 10 1 6 0 0 6 87443709 chr7 4307 Prc1 NM_145150 protein regulator of cytokinesis 1 intron1 -4567 0 7 2 7 12 5 87539750 chr7 10565 Furin NM_001081454 furin paired basic amino acid cleaving enzyme intron8 -7040 0 7 8 10 11 8 87547229 chr7 3086 Furin NM_001081454 furin paired basic amino acid cleaving enzyme intron1 0 0 2 8 0 19 7 87561857 chr7 73835 inter-genic -14005 0 7 4 2 11 1 87903867 chr7 44311 Iqgap1 NM_016721 IQ motif containing GTPase activating protein 1 intron8 -43943 0 7 8 11 12 4 90747719 chr7 14279 Tmc3 NM_177695 transmembrane channel-like gene family 3 intron7 32646 0 8 3 10 12 4 90809146 chr7 74852 Il16 NM_010551 interleukin 16 intron12 28782 0 3 0 1 13 2 91509888 chr7 288 Arnt2 NM_007488 aryl hydrocarbon receptor nuclear translocator intron1 -48165 10 4 1 1 0 7 95130215 chr7 379265 Grm5 NM_001081414 glutamate receptor metabotropic 5 intron3 148482 0 4 1 8 11 2 95169544 chr7 418594 Grm5 NM_001081414 glutamate receptor metabotropic 5 intron3 109153 0 8 1 3 11 5 99228218 chr7 988923 Dlg2 NM_011807 chapsyn-110 intron11 481363 0 7 0 11 11 7 103694949 chr7 335803 Odz4 NM_011858 odd Oz/ten-m homolog 4 intron3 -334762 0 5 3 11 10 10 105688260 chr7 45529 inter-genic -50057 0 5 3 9 14 5 106739073 chr7 55078 Arrb1 NM_177231 arrestin beta 1 isoform A intron7 34958 0 10 7 14 15 9 108043475 chr7 37198 Arhgef17 NM_001081116 Rho guanine nucleotide exchange factor GEF 17 intron1 508 12 1 2 0 0 1 108446134 chr7 4629 Atg16l2 NM_001111111 autophagy related 16 like 2 intron3 856 0 1 3 4 14 1 108588955 chr7 18744 Pde2a NM_001008548 phosphodiesterase 2A cGMP-stimulated intron1 10426 0 9 0 2 13 6 116830222 chr7 -12822 inter-genic 16750 0 8 3 4 12 5 120512796 chr7 55 Btbd10 NM_133700 K+ channel tetramerization protein Exon_1/11_1stExon 0 0 4 11 0 10 2 121559483 chr7 716 Pde3b NM_011055 phosphodiesterase 3B cGMP-inhibited Exon_1/16_1stExon 0 0 1 7 0 13 1 123339021 chr7 102128 inter-genic 41778 0 6 0 5 10 7 124428547 chr7 -95945 inter-genic 95923 0 4 1 4 10 9 127017680 chr7 21235 Dcun1d3 NM_173408 DCN1 defective in cullin neddylation 1, domain intron1 -21938 0 3 5 2 17 3 127017680 chr7 2110 LOC100043399 Exon_2/2_lastExon 21939 0 3 5 2 17 3 127660511 chr7 95297 Abca16 NM_207130 ATP-binding cassette transporter sub-family A intron18 -12582 13 9 1 4 0 8 129230856 chr7 20145 inter-genic 14256 0 3 3 3 10 6 129621483 chr7 188845 Prkcb1 NM_008855 protein kinase C beta 1 intron5 -189108 0 3 5 3 14 8 130661932 chr7 56107 inter-genic -18130 0 13 9 2 16 24 132856721 chr7 5332 D430042O09Rik NM_001081022 hypothetical protein LOC233865 intron1 -5886 0 6 3 3 10 6 133110700 chr7 115223 Gsg1l NM_001101488 GSG1-like intron2 -114376 0 9 17 3 18 3 139555976 chr7 49382 inter-genic -48689 0 5 8 7 11 4 141978944 chr7 116575 Dock1 NM_001033420 dedicator of cytokinesis 1 intron21 -116773 0 11 0 15 12 9 144498126 chr7 8000 Ebf3 NM_010096 early B-cell factor 3 isoform 3 intron6 -2743 11 2 9 6 0 1 146036806 chr7 1142 Mapk1ip1 NM_001045483 MAPK-interacting and spindle-stabilizing intron1 -827 0 7 3 5 11 5 148129413 chr7 1934 Athl1 NM_145387 ATH1 acid trehalase-like 1 Exon_4/14 -21125 0 5 4 4 14 6 6203891 chr8 564386 inter-genic -1424602 0 8 2 6 10 11 7130693 chr8 111528 inter-genic 1529130 0 4 1 4 12 14 7851612 chr8 832447 inter-genic 808211 0 7 3 12 14 5 8952119 chr8 -1025597 inter-genic 255575 0 6 5 3 14 7 9559571 chr8 211450 Tmem28 NM_173446 transmembrane protein 28 intron1 -210762 0 8 2 8 14 5 11555432 chr8 257 Cars2 Exon_2/17 0 28 11 13 6 0 3 13609664 chr8 67921 Rasa3 NM_009025 RAS p21 protein activator 3 intron3 -67326 0 8 5 2 14 6 14440852 chr8 344978 Dlgap2 NM_172910 SAP90/PSD-95 associated protein 2 intron3 -345263 11 8 4 22 0 5 24094261 chr8 -74485 inter-genic -9357 0 15 4 13 10 14 24828918 chr8 48754 Zmat4 NM_177086 zinc finger matrin type 4 intron1 -48830 0 10 3 14 11 16 25302999 chr8 522835 inter-genic -522911 0 2 3 8 13 5 34842822 chr8 309 Gtf2e2 NM_026584 general transcription factor II E polypeptide 2 intron1 0 0 1 3 1 13 0 35654479 chr8 89865 inter-genic 215170 0 18 5 9 11 7 40708398 chr8 19632 Msr1 NM_001113326 macrophage scavenger receptor 1 isoform b intron4 639565 0 13 5 7 11 10 45626124 chr8 -180018 inter-genic 394013 0 8 13 9 11 4 47351648 chr8 37310 inter-genic 25875 0 5 0 6 11 6 47733511 chr8 30709 inter-genic -31093 0 6 35 14 38 10 51250632 chr8 -232359 inter-genic 750621 0 11 12 14 11 14 52074656 chr8 591665 inter-genic -73403 0 6 7 16 11 7 55773098 chr8 30931 Wdr17 NM_028220 WD repeat domain 17 intron5 158249 0 7 5 17 11 8 58920581 chr8 -109349 inter-genic 108936 0 7 9 8 11 8 59804435 chr8 3735 inter-genic -4257 0 4 9 4 11 1 63345216 chr8 -23971 inter-genic 23806 0 11 0 8 14 7 63393938 chr8 68157 Clcn3 NM_007711 chloride channel 3 isoform a intron11 24917 0 5 8 6 21 6 69010233 chr8 171 1810029B16Rik NM_025465 hypothetical protein LOC66282 intron1 0 0 6 18 0 13 1 71552573 chr8 -60110 inter-genic 59857 10 4 1 15 0 10 73030957 chr8 -321 2810428I15Rik NM_025577 hypothetical protein LOC66462 up500region 570 0 14 8 15 12 8 78014782 chr8 42190 1700007B14Rik intron1 -278095 0 9 1 2 12 5 82091456 chr8 -72118 inter-genic 71448 0 10 6 7 10 9 83435902 chr8 32402 inter-genic -32628 0 13 4 11 11 10 86716044 chr8 43987 inter-genic 504 0 5 21 7 11 1 87231599 chr8 92638 Nfix NM_001081982 nuclear factor I/X isoform 1 Exon_10/10_lastExon 981 14 2 14 3 0 1 87508711 chr8 -5806 inter-genic 1133 0 7 3 6 19 2 92523969 chr8 -736440 inter-genic 347638 0 8 2 5 14 3 92723055 chr8 -537354 inter-genic 148552 0 13 6 22 10 9 92872242 chr8 -93 Tox3 NM_172913 TOX high mobility group box family member 3 up500region 636 16 0 1 0 0 2 95214991 chr8 16691 inter-genic -16756 0 7 2 5 10 5 98560768 chr8 200319 inter-genic -84927 0 8 3 8 10 9 102158241 chr8 219115 inter-genic -218846 0 7 5 5 13 6 102585215 chr8 30832 inter-genic -645820 0 7 6 12 10 4 106264224 chr8 -330824 inter-genic 263556 0 10 3 7 14 5 106517974 chr8 18554 LOC100041397 intron3 -9805 0 9 2 1 10 12 107258275 chr8 368 Ces6 NM_133960 carboxylesterase 6 intron1 -92935 0 4 8 6 10 7 112107499 chr8 17595 inter-genic -18184 0 8 2 7 10 3 113007577 chr8 216701 Hydin NM_172916 hydrocephalus inducing intron24 -118240 0 11 7 4 10 6 114150476 chr8 3744 Ldhd NM_027570 D-lactate dehydrogenase Exon_11/11_lastExon -16794 0 6 0 2 10 2 114483691 chr8 19070 inter-genic -19197 0 5 0 1 40 7 117501805 chr8 538210 Wwox NM_019573 WW-domain oxidoreductase intron8 -456064 0 14 34 4 12 10 117798377 chr8 834782 Wwox NM_019573 WW-domain oxidoreductase intron8 431261 0 8 14 5 14 8 119429823 chr8 15511 2310061C15Rik NM_026844 hypothetical protein LOC66531 intron2 -15200 0 6 0 8 12 5 119741747 chr8 -39245 inter-genic -60227 0 8 4 16 14 5 122643574 chr8 -25554 inter-genic -6031 0 1 2 4 10 3 122855454 chr8 -157311 inter-genic 68036 11 3 0 3 0 5 123251785 chr8 -8490 inter-genic 8115 0 6 3 5 11 3 123505011 chr8 -103362 inter-genic 92432 0 7 18 13 18 4 123652345 chr8 761 Foxl1 NM_008024 forkhead box L1 Exon_1(only) 0 0 2 4 0 12 2 123763979 chr8 112395 inter-genic 32958 0 3 3 7 16 3 123810623 chr8 159039 inter-genic -13686 0 15 2 9 10 9 125054489 chr8 -37425 inter-genic 20144 0 6 3 5 11 0 125109283 chr8 25956 Galns NM_016722 galactosamine N-acetyl-6-sulfate sulfatase intron11 8906 0 17 5 18 25 5 126838794 chr8 83501 Galnt2 NM_139272 UDP-N-acetyl-alpha-D-galactosamine:polypeptide intron3 -83718 16 5 0 2 0 1 127558496 chr8 -19598 inter-genic -18751 0 2 10 3 12 3 128161138 chr8 -32627 inter-genic 32527 0 1 3 7 14 8 128662954 chr8 143885 inter-genic 0 0 3 0 0 10 0 129139734 chr8 193307 inter-genic -23466 0 2 3 3 12 3 129184887 chr8 238460 inter-genic -68619 0 9 19 4 19 8 129209512 chr8 263085 inter-genic -93244 0 7 3 10 10 7 129573998 chr8 -14146 inter-genic 13460 0 2 5 9 11 6 131213447 chr8 3767 Itgb1 NM_010578 integrin beta 1 fibronectin receptor beta intron1 -4227 0 5 1 7 12 4 7640103 chr9 11873 Mmp20 NM_013903 matrix metalloproteinase 20 enamelysin intron3 123684 0 5 7 8 12 5 13269385 chr9 -145835 inter-genic 284164 0 3 5 5 14 2 18508897 chr9 17341 Muc16 intron1 230910 0 7 2 7 15 9 20988602 chr9 -81140 inter-genic 0 0 2 0 2 14 0 26020696 chr9 -538450 inter-genic 520375 0 7 8 5 10 5 27365383 chr9 -84759 inter-genic -258787 0 7 6 2 17 7 27828369 chr9 229516 Opcml NM_177906 opioid binding protein/cell adhesion intron1 382458 10 4 3 6 0 2 28297960 chr9 699107 Opcml NM_177906 opioid binding protein/cell adhesion intron2 -87133 0 4 0 6 10 7 29844368 chr9 -390545 inter-genic 390163 0 10 5 13 11 6 30894877 chr9 15691 inter-genic 43994 0 14 0 10 11 11 34546818 chr9 250503 Kirrel3 NM_026324 membrane protein mKirre intron1 -250364 0 7 10 5 12 5 35475345 chr9 -1878 inter-genic -93298 0 10 14 21 11 5 35968370 chr9 252363 inter-genic 565487 0 9 8 4 17 8 41776786 chr9 155584 Sorl1 NM_011436 sortilin-related receptor LDLR class A intron47 78347 0 5 4 3 14 11 42615424 chr9 137028 Grik4 NM_175481 glutamate receptor KA1 precursor intron3 -90063 0 8 0 4 11 9 42994979 chr9 18857 Pou2f3 NM_011139 POU domain class 2, transcription factor 3 intron2 -18591 0 15 3 13 11 10 44412820 chr9 -68500 inter-genic 0 13 0 0 0 0 1 45037258 chr9 -89924 inter-genic 39783 0 10 12 6 12 11 49156554 chr9 7823 Drd2 NM_010077 dopamine receptor 2 intron1 -8137 0 4 2 10 14 14 52860062 chr9 -249712 inter-genic 195788 10 8 1 6 0 11 54246207 chr9 103677 Dmxl2 intron25 -102624 0 16 1 15 13 17 55393332 chr9 4319 Isl2 NM_027397 insulin related protein 2 islet 2 Exon_6/6_lastExon 0 19 0 9 0 0 2 57612279 chr9 1386 Clk3 NM_007713 CDC-like kinase 3 intron1 0 13 3 10 0 0 3 57757968 chr9 -824 inter-genic 29771 0 6 0 4 13 13 59504568 chr9 154 Pkm2 NM_011099 pyruvate kinase muscle intron1 0 0 1 29 5 13 4 62220223 chr9 30989 Anp32a NM_009672 acidic leucine-rich nuclear phosphoprotein 32 intron3 -8708 0 2 3 4 18 0 62992590 chr9 2195 Lbxcor1 NM_172446 transcriptional corepressor Corl1 Exon_2/9 0 28 7 29 3 0 3 63035326 chr9 190331 Map2k5 NM_011840 mitogen-activated protein kinase kinase 5 intron21 38851 0 7 2 2 12 6 64494360 chr9 260864 Megf11 NM_172522 MEGF11 protein intron6 -8281 0 15 7 15 11 7 64686533 chr9 27716 AI115600 intron4 -27610 10 4 1 8 0 11 66349883 chr9 151553 Herc1 Exon_76/78 9433 0 9 1 9 12 16 66454193 chr9 -107355 inter-genic -14454 0 5 2 7 12 6 66743069 chr9 24423 Rab8b NM_173413 RAB8B member RAS oncogene family intron1 -23947 0 3 10 10 31 4 67560003 chr9 12010 inter-genic 47488 0 10 7 13 21 2 73719936 chr9 61436 Unc13c NM_001081153 unc13 homolog 3 intron1 758725 0 9 6 10 11 8 75248720 chr9 9099 Mapk6 NM_015806 mitogen-activated protein kinase 6 intron1 -8276 0 11 0 2 11 11 76564176 chr9 -380648 inter-genic -149241 0 2 3 2 12 3 76825899 chr9 67632 Tinag NM_012033 tubulointerstitial nephritis antigen intron9 410965 0 7 3 8 11 7 78234971 chr9 -8612 inter-genic 8436 0 3 3 6 10 3 84758308 chr9 440754 inter-genic 461727 0 4 5 1 11 6 87850818 chr9 -371659 inter-genic -216850 0 9 7 6 18 5 87873692 chr9 -348785 inter-genic -239724 0 12 1 5 11 6 90955554 chr9 -36330 inter-genic 294928 0 1 1 0 16 8 92140910 chr9 -13270 inter-genic 4296 0 8 13 7 21 7 94085493 chr9 -484843 inter-genic 352014 0 2 1 3 12 10 95516238 chr9 -21808 inter-genic 21739 0 5 8 9 11 7 96264133 chr9 583 Atp1b3 NM_007502 Na+/K+ -ATPase beta 3 subunit intron1 0 0 6 3 0 10 0 96528351 chr9 3569 Rasa2 NM_053268 RAS p21 protein activator 2 intron1 -2777 0 4 2 2 10 5 96596690 chr9 35402 Zbtb38 NM_175537 zinc finger and BTB domain containing 38 intron2 -23232 0 6 3 2 19 1 96614486 chr9 17606 Zbtb38 NM_175537 zinc finger and BTB domain containing 38 intron2 -5436 0 5 3 1 16 3 98756861 chr9 -148 EG623186 up500region 26 10 7 1 2 0 1 102620833 chr9 700 Amotl2 NM_019764 angiomotin like 2 intron1 0 0 8 8 2 37 2 102639534 chr9 -2443 inter-genic -19607 0 5 6 10 14 3 103693639 chr9 -211294 inter-genic -30076 0 8 3 11 10 8 107201507 chr9 2488 Cish NM_009895 cytokine inducible SH2-containing protein intron1 -2630 0 2 0 0 12 1 107202323 chr9 3304 Cish NM_009895 cytokine inducible SH2-containing protein Exon_2/3 -3446 0 1 8 9 17 5 107437509 chr9 1234 Tmem115 NM_019704 transmembrane protein 115 Exon_1/2_1stExon 0 0 5 0 0 19 2 108960104 chr9 -24966 inter-genic 16175 0 4 8 6 14 8 109827242 chr9 -6719 inter-genic 6719 0 9 12 10 43 9 111913403 chr9 -176725 inter-genic 224248 0 5 6 4 10 9 112081101 chr9 -9027 inter-genic 56550 0 13 4 8 11 3 113089390 chr9 9541 LOC100043801 intron2 -527609 0 3 10 1 12 5 113819422 chr9 97719 Clasp2 NM_001081960 CLIP-associating protein CLASP2 isoform b intron31 78381 10 14 0 10 0 17 114355388 chr9 45152 Glb1 NM_009752 galactosidase beta 1 intron10 -45211 0 9 2 11 14 7 114377504 chr9 67268 Glb1 NM_009752 galactosidase beta 1 intron15 -67327 0 4 8 2 34 1 119932262 chr9 -68988 inter-genic -12104 0 4 8 15 24 2 120480967 chr9 334 Rpl14 NM_025974 ribosomal protein L14 intron1 -469 0 3 3 0 11 0 122481673 chr9 989 9530059O14Rik Exon_2/3 0 14 3 5 0 0 2 123716994 chr9 1392 Cxcr6 NM_030712 chemokine C-X-C motif receptor 6 intron1 43618 0 5 2 7 18 4 123716994 chr9 43691 Fyco1 NM_001110253 FYVE and coiled-coil domain containing 1 intron15 -43617 0 5 2 7 18 4 3378068 chr10 54713 A130090K04Rik NM_001033391 hypothetical protein LOC320495 intron2 -243865 0 7 3 14 14 6 3378068 chr10 179872 Oprm1 NM_001039652 opioid receptor mu 1 intron3 243866 0 7 3 14 14 6 5574804 chr10 159689 Esr1 NM_007956 estrogen receptor 1 alpha intron3 -58813 0 16 1 9 11 13 8735534 chr10 -178894 inter-genic -129999 0 11 3 14 12 14 12696492 chr10 -31767 inter-genic -12678 0 8 2 1 11 8 13144579 chr10 -76254 inter-genic 48972 0 13 6 6 15 9 13716966 chr10 30782 Hivep2 NM_010437 human immunodeficiency virus type I enhancer intron1 -32595 0 4 12 9 12 0 18370909 chr10 92653 D10Bwg1379e NM_001033258 hypothetical protein LOC215821 intron10 119638 0 6 3 2 10 7 21407283 chr10 -3367 inter-genic 194772 0 8 2 5 25 5 32531190 chr10 -195496 inter-genic 78471 11 12 0 4 0 5 34201194 chr10 -2010 inter-genic -63174 0 12 0 10 11 9 34920208 chr10 302181 inter-genic -782188 0 19 6 11 12 21 37813702 chr10 -871769 inter-genic -957784 0 7 1 7 11 11 40382998 chr10 -20089 inter-genic 19961 0 5 3 15 13 3 41630026 chr10 22772 inter-genic -22931 10 3 3 3 0 3 43858088 chr10 -32164 inter-genic 10239 10 3 2 3 0 5 44120773 chr10 132610 inter-genic 57583 0 6 13 3 22 6 44469533 chr10 -102854 inter-genic -220299 0 3 0 4 10 8 44540649 chr10 -31738 inter-genic 246059 0 5 3 6 27 6 51662589 chr10 -79902 inter-genic 79617 0 10 1 16 11 6 55049923 chr10 -220863 inter-genic 785027 0 8 1 4 11 3 59478986 chr10 13400 Ascc1 NM_026937 activating signal cointegrator 1 complex subunit intron5 -13458 0 4 8 4 11 5 60297697 chr10 -254409 inter-genic -4403 0 1 8 7 11 2 63594527 chr10 701682 Ctnna3 NM_177612 catenin cadherin associated protein alpha 3 intron7 -548165 0 11 3 7 12 9 63917413 chr10 1024568 Ctnna3 NM_177612 catenin cadherin associated protein alpha 3 intron10 -871051 0 6 2 9 11 6 67073753 chr10 35120 inter-genic -62965 0 4 1 7 12 2 69583745 chr10 23877 Ccdc6 NM_001111121 coiled-coil domain containing 6 intron1 -24328 0 3 8 4 15 1 71335368 chr10 168333 inter-genic -491194 0 10 3 4 12 6 73251376 chr10 -33254 inter-genic -689500 0 4 7 8 13 3 76025644 chr10 628 1700027D21Rik NM_029661 hypothetical protein LOC76573 intron1 -31570 0 8 3 10 11 5 77046945 chr10 2434 Pttg1ip NM_145925 pituitary tumor-transforming gene 1 intron1 -2623 0 3 2 2 10 1 77375561 chr10 54639 Trpm2 NM_138301 transient receptor potential cation channel intron29 10730 0 5 12 8 10 3 79751120 chr10 -4081 inter-genic 3935 0 15 1 8 14 7 81043305 chr10 5029 Tle2 NM_019725 transducin-like enhancer protein 2 Exon_7/21 -5388 0 5 6 0 18 3 82454556 chr10 6315 Chst11 NM_021439 carbohydrate sulfotransferase 11 intron1 -6647 0 5 4 8 12 5 83845800 chr10 57414 Nuak1 NM_001004363 NUAK family SNF1-like kinase, 1 intron4 -57167 0 4 5 0 11 7 85859338 chr10 102244 Syn3 NM_013722 synapsin III intron4 96330 0 18 7 16 16 21 86699598 chr10 10954 inter-genic -178470 0 4 3 5 10 6 87471721 chr10 42306 inter-genic 137642 0 7 7 1 23 1 92806363 chr10 33378 LOC100041854 intron3 -33506 0 11 4 9 35 11 94234460 chr10 82926 4921537D05Rik intron13 -83419 0 17 1 3 14 9 95367575 chr10 -35721 inter-genic 35619 0 8 2 5 10 8 98728308 chr10 2444 Dusp6 NM_026268 dual specificity phosphatase 6 intron2 -4178 0 2 3 1 10 1 99950332 chr10 -353 Tmtc3 NM_001110013 transmembrane and tetratricopeptide repeat up500region 0 0 4 0 1 14 2 103031180 chr10 200704 inter-genic -200978 0 2 6 13 11 6 107602856 chr10 3401 Ppp1r12a NM_027892 protein phosphatase 1 regulatory inhibitor intron1 -4218 0 7 3 10 20 6 109512515 chr10 -525190 inter-genic 380149 0 5 0 10 13 14 110516397 chr10 -46494 inter-genic -69886 0 3 2 4 12 1 110981161 chr10 37820 inter-genic -37968 0 2 3 2 11 0 111021020 chr10 77679 inter-genic -77827 0 3 8 3 10 4 111221280 chr10 -188559 inter-genic 188406 0 8 3 6 13 2 114568144 chr10 53932 Tph2 NM_173391 tryptophan hydroxylase 2 intron7 -119969 0 6 0 8 11 5 116395201 chr10 -8128 inter-genic -8407 0 3 4 3 11 2 117326003 chr10 -252884 inter-genic -43145 10 8 6 5 0 5 117376290 chr10 -202597 inter-genic -93432 0 7 0 4 14 3 119219335 chr10 327966 Grip1 NM_133442 glutamate receptor interacting protein 1 isoform intron1 307343 0 12 1 8 12 14 119726607 chr10 62492 inter-genic -62553 0 9 2 1 11 6 119866125 chr10 47864 Hmga2 NM_010441 high mobility group AT-hook 2 intron3 14419 0 6 26 6 14 1 122899873 chr10 198742 AI851790 NM_182807 TAFA2 protein intron2 -198377 0 5 5 12 11 11 126526004 chr10 10042 Centg1 NM_001033263 centaurin gamma 1 intron12 2012 0 10 2 2 14 7 126604835 chr10 2555 B4galnt1 NM_008080 beta-14-N-acetylgalactosaminyltransferase Exon_6/11 -2799 0 3 4 4 10 2 3995177 chr11 255 1700020C11Rik NM_026443 mitochondrial protein 18 kDa intron1 -1379 0 6 0 1 11 0 4137440 chr11 1018 Osm NM_001013365 oncostatin M intron1 -19314 0 4 13 6 10 12 4397394 chr11 97399 Mtmr3 NM_028860 myotubularin-related protein 3 Exon_11/18 -96820 0 10 5 14 12 12 5296358 chr11 48490 Znrf3 NM_001080924 zinc and ring finger 3 intron1 -47604 0 4 1 0 16 6 5473957 chr11 4271 Ankrd36 NM_023816 ankyrin repeat domain 36 intron3 -32211 0 15 1 8 10 8 7848090 chr11 750308 inter-genic 676213 0 16 4 5 10 11 8099505 chr11 -684662 inter-genic 424798 0 2 3 2 10 5 11618236 chr11 32021 Ikzf1 NM_001025597 zinc finger protein subfamily 1A 1 isoform a intron3 -32929 0 8 9 11 24 6 16761974 chr11 109769 Egfr NM_207655 epidermal growth factor receptor isoform 1 intron3 89105 0 5 1 7 10 6 18785963 chr11 132718 Meis1 NM_010789 Meis homeobox 1 intron9 14502 0 8 6 1 16 2 21051057 chr11 59731 inter-genic -59817 0 6 2 6 12 6 23686499 chr11 120826 inter-genic -15979 0 6 12 9 11 7 29073253 chr11 258 Smek2 NM_134034 SMEK homolog 2 suppressor of mek1 Exon_1/16_1stExon 0 14 1 0 0 0 2 29073253 chr11 -435 A630052C17Rik up500region 0 14 1 0 0 0 2 33933841 chr11 -13359 inter-genic -190412 0 7 8 11 17 7 34589652 chr11 7671 Dock2 NM_033374 dedicator of cyto-kinesis 2 intron1 -57211 0 4 6 9 16 1 35090254 chr11 155297 Slit3 NM_011412 slit homolog 3 intron4 -155756 0 5 0 7 10 8 42271663 chr11 38405 Gabrb2 NM_008070 gamma-aminobutyric acid GABA-A receptor intron4 975521 0 10 4 5 14 11 43190884 chr11 -56348 inter-genic 56300 0 2 8 4 11 4 48466939 chr11 -146922 inter-genic 100236 10 8 8 17 0 3 48611242 chr11 -2619 inter-genic 2573 0 8 10 2 14 4 48947982 chr11 83748 Olfr56 NM_010999 olfactory receptor 56 Exon_6/6_lastExon 34638 0 15 2 6 13 9 55522158 chr11 238905 inter-genic -239019 10 12 0 3 0 7 56929447 chr11 103990 Gria1 NM_008165 glutamate receptor ionotropic, AMPA1 alpha 1 intron2 402290 0 7 3 9 11 7 57458471 chr11 -472 Galnt10 NM_134189 UDP-N-acetyl-alpha-D-galactosamine:polypeptide up500region 0 0 2 1 3 10 2 57772384 chr11 -33873 inter-genic 49733 0 3 3 2 13 8 57939831 chr11 42142 Gemin5 NM_172558 gem nuclear organelle associated protein 5 intron25 22551 0 14 0 17 14 8 57999706 chr11 2362 Irgb10 intron1 -14375 0 6 1 7 35 2 58036060 chr11 23003 inter-genic 16901 0 4 2 8 17 7 61541794 chr11 43883 inter-genic 33549 0 2 3 9 28 3 62031433 chr11 140835 Specc1 NM_001029936 sperm antigen with calponin homology and intron12 30566 0 8 6 4 15 0 62958872 chr11 13861 Pmp22 NM_008885 peripheral myelin protein intron3 -12956 0 11 11 12 14 12 63737901 chr11 -155148 inter-genic 0 0 4 13 5 14 6 64403772 chr11 154939 inter-genic -70006 0 22 12 17 16 15 65604418 chr11 -16327 inter-genic -3300 0 11 2 12 14 5 65626043 chr11 5298 Zkscan6 NM_026107 zinc finger with KRAB and SCAN domains 6 intron2 -5360 0 8 15 8 16 5 67292721 chr11 -123885 inter-genic -24262 0 6 2 13 11 7 68137509 chr11 62817 Ntn1 NM_008744 netrin 1 intron2 -60920 0 8 3 6 10 3 69229556 chr11 20264 inter-genic 1930 0 2 4 0 10 0 69497524 chr11 11973 Tnfsf12-tnfsf13 NM_001034097 tumor necrosis factor ligand superfamily intron11 2622 0 8 9 6 11 6 69697297 chr11 11742 Centb1 NM_153788 centaurin beta 1 intron17 2786 0 5 8 12 10 3 72469414 chr11 48652 Ube2g1 NM_025985 ubiquitin-conjugating enzyme E2G 1 intron1 33890 11 11 2 17 0 9 72767000 chr11 -7756 inter-genic 7577 0 4 17 6 16 0 78326249 chr11 452 Poldip2 NM_026389 polymerase delta interacting protein 38 intron1 -881 0 6 3 1 23 6 80291493 chr11 946 Cdk5r1 NM_009871 cyclin-dependent kinase 5 regulatory subunit Exon_1(only) 0 0 6 8 6 10 7 81710207 chr11 71689 Accn1 NM_001034013 amiloride-sensitive cation channel 1 neuronal intron1 -71833 0 9 2 0 10 4 83713980 chr11 49610 Tcf2 intron8 41449 0 1 1 3 10 6 92744324 chr11 -216438 inter-genic 215289 0 11 4 3 11 10 95259012 chr11 12777 inter-genic -13276 0 8 2 4 16 2 95457345 chr11 -70958 inter-genic -9737 0 1 1 1 11 1 95926506 chr11 170 Ube2z NM_172300 ubiquitin-conjugating enzyme E2Z Exon_1/7_1stExon 0 0 6 1 1 13 2 96891232 chr11 -75 Scrn2 NM_146027 secernin 2 up500region -8468 11 4 10 3 0 1 96960335 chr11 16257 Tbx21 NM_019507 T-box 21 Exon_6/6_lastExon -15544 19 1 1 0 0 2 96974152 chr11 2440 Tbx21 NM_019507 T-box 21 intron1 -1727 0 2 8 8 30 5 96990171 chr11 78038 inter-genic 9787 0 1 9 3 16 5 98300289 chr11 11 1810046J19Rik NM_025559 hypothetical protein LOC103742 Exon_1/4_1stExon 0 0 1 10 0 10 1 98634312 chr11 2242 Nr1d1 NM_145434 nuclear receptor subfamily 1 group D, member 1 intron1 -806 0 2 2 0 16 4 99000481 chr11 97908 inter-genic 91005 10 5 0 4 0 7 99023041 chr11 120468 inter-genic 68445 0 1 13 8 13 4 101630176 chr11 35907 inter-genic 15647 0 8 3 6 19 17 102583209 chr11 -39710 inter-genic -24320 0 9 1 7 12 2 102853129 chr11 -36746 inter-genic -1771 0 1 0 1 10 0 103224394 chr11 302 5730442P18Rik NM_183288 hypothetical protein LOC70559 intron1 -56 10 1 3 0 0 1 105829154 chr11 -121 Ace NM_207624 angiotensin I converting enzyme up500region 0 20 2 18 6 0 3 106018544 chr11 2910 Limd2 NM_172397 LIM domain containing 2 Exon_5/5_lastExon -2557 0 7 1 4 16 3 106649768 chr11 38 Ddx5 NM_007840 DEAD Asp-Glu-Ala-Asp box polypeptide 5 Exon_1/13_1stExon 0 13 6 0 0 0 1 106965033 chr11 28201 Bptf NM_176850 bromodomain PHD finger transcription factor intron2 -27907 0 12 14 16 13 10 108075364 chr11 129876 Prkca NM_011101 protein kinase C alpha intron2 -128906 0 3 9 7 14 7 108078573 chr11 126667 Prkca NM_011101 protein kinase C alpha intron2 -125697 0 4 18 4 19 7 108533218 chr11 246639 Ccdc46 NM_029606 coiled-coil domain containing 46 isoform 2 intron22 -246910 10 3 0 8 0 2 111903407 chr11 -65344 inter-genic 739265 0 8 2 1 11 5 113800598 chr11 126665 Sdk2 NM_172800 sidekick 2 intron2 -125628 0 9 3 3 14 14 115743325 chr11 -18166 inter-genic -23584 0 4 4 7 12 4 116537263 chr11 4281 1810032O08Rik Exon_5/5_lastExon 18289 0 24 3 3 10 5 117100028 chr11 -93005 inter-genic 27365 0 8 3 4 16 7 117102404 chr11 -90629 inter-genic 24989 0 3 3 9 11 2 117111398 chr11 -81635 inter-genic 15995 0 2 0 5 16 5 117642703 chr11 -1660 inter-genic -1489 0 3 0 0 13 5 121421079 chr11 107764 Tbcd NM_029878 tubulin-specific chaperone d intron16 -107887 0 3 1 0 14 3 121639070 chr11 -52490 inter-genic 52419 0 4 13 9 19 5 11157487 chr12 -310 Kcns3 NM_173417 potassium voltage-gated channel up500region 550 0 2 6 1 10 0 12407979 chr12 124831 inter-genic -8755 0 1 1 1 13 2 14898749 chr12 -37886 inter-genic -740136 0 10 5 5 10 6 15724338 chr12 -99476 inter-genic 97329 0 4 11 7 14 6 25986171 chr12 326375 inter-genic -200784 0 3 0 6 11 0 26050805 chr12 391009 inter-genic -265418 0 3 1 2 14 7 28109854 chr12 -171779 inter-genic -83803 0 9 3 6 12 6 29090152 chr12 -244352 inter-genic 146744 0 6 4 8 12 6 32969370 chr12 -94281 inter-genic 94229 0 19 8 17 12 9 33064291 chr12 640 2010109K11Rik Exon_1(only) 0 12 0 17 5 0 2 46390363 chr12 960393 inter-genic -215374 0 10 13 8 13 5 47666241 chr12 2236271 inter-genic 254185 0 8 1 10 10 13 51544234 chr12 205849 Prkcm NM_008858 protein kinase C mu intron2 -205718 0 12 1 15 14 13 52105923 chr12 -82075 inter-genic 343055 0 3 3 0 10 2 53605157 chr12 -11906 inter-genic 0 10 2 7 3 0 1 55663102 chr12 -60472 inter-genic 94041 0 7 3 9 14 7 58029158 chr12 269299 Slc25a21 NM_172577 solute carrier family 25 mitochondrial intron2 231678 0 6 4 8 14 4 65926259 chr12 -92638 inter-genic 92514 0 10 2 6 13 6 71926521 chr12 21 Frmd6 NM_028127 FERM domain containing 6 Exon_1/14_1stExon 0 0 4 8 0 14 1 73851165 chr12 -33503 inter-genic 10300 0 13 3 8 11 9 74429894 chr12 42035 Slc38a6 intron5 -42427 0 5 10 6 15 2 74843169 chr12 157142 Prkch NM_008856 protein kinase C eta intron10 -157731 0 6 37 11 51 11 74847314 chr12 161287 Prkch NM_008856 protein kinase C eta intron10 161148 0 13 18 18 12 13 75013736 chr12 4720 Hif1a NM_010431 hypoxia inducible factor 1 alpha subunit intron1 -5274 0 10 11 7 21 4 78004895 chr12 66442 Fntb NM_145927 farnesyltransferase CAAX box, beta intron7 57794 0 3 8 4 19 2 80701394 chr12 303126 Rad51l1 NM_009014 RAD51-like 1 intron7 -428307 0 4 8 9 19 7 80746751 chr12 348483 Rad51l1 NM_009014 RAD51-like 1 intron7 464190 0 13 15 4 21 9 82111292 chr12 -16525 inter-genic 16399 0 4 7 5 10 4 85961304 chr12 -22541 inter-genic -3112 0 1 22 6 11 3 87881071 chr12 -138578 inter-genic -70091 0 9 15 11 12 0 88790629 chr12 5768 1810035L17Rik NM_026958 hypothetical protein LOC380773 intron3 -6286 0 4 6 2 15 9 88833736 chr12 -1700 inter-genic -20914 0 21 1 17 10 7 92659801 chr12 20311 Tshr NM_011648 thyroid stimulating hormone receptor isoform 1 intron1 166875 0 6 5 5 13 5 100421825 chr12 136467 inter-genic 208401 0 8 13 8 20 4 101615004 chr12 144036 Ttc7b NM_001033213 tetratricopeptide repeat domain 7B intron14 -143516 0 7 24 17 13 9 109566281 chr12 21802 1600002O04Rik Exon_9/9_lastExon 0 13 7 4 2 0 1 110677133 chr12 -14299 inter-genic 14062 11 1 3 5 0 3 112711598 chr12 28426 inter-genic 11763 10 4 3 21 0 5 114180551 chr12 -224 Nudt14 NM_025399 nudix nucleoside diphosphate linked moiety up500region 505 0 4 2 0 14 2 117501351 chr12 145 Wdr60 NM_146039 WD repeat domain 60 Exon_1/22_1stExon 0 12 1 8 1 0 3 10990129 chr13 -624189 inter-genic -630681 0 6 12 6 11 7 11882918 chr13 316292 Ryr2 NM_023868 ryanodine receptor 2 cardiac intron22 -315282 10 18 0 16 0 15 14046908 chr13 -32 B3galnt2 NM_178640 UDP-GalNAc:betaGlcNAc beta up500region 0 17 0 1 0 0 2 51850119 chr13 38892 Sema4d NM_013660 semaphorin 4D intron2 -38009 13 0 0 0 0 0 99124482 chr13 273 Foxd1 NM_008242 forkhead box D1 Exon_1(only) 0 12 1 1 0 0 0 55565900 chr13 232 Prr7 NM_001030296 proline rich 7 synaptic intron1 0 11 2 11 2 0 0 40375293 chr13 -352942 LOC100039048 inter-genic 424025 10 70705 41345387 chr13 175 BC024659 XM_001472442 Exon_1/2_1stExon 0 10 1 0 0 0 0
14046908 chr13 -305 LOC100040205 up500region 0 17 0 1 0 0 2 15560446 chr13 4891 Gli3 NM_008130 GLI-Kruppel family member GLI3 intron1 -5780 10 15 0 5 0 10 17929686 chr13 -111820 inter-genic -34510 0 7 2 4 18 6 20325824 chr13 -514504 inter-genic -143576 0 9 0 7 10 4 22076321 chr13 39359 inter-genic -3263 0 11 6 11 11 9 23684697 chr13 28294 Hist1h2be NM_178194 histone cluster 1 H2be intron1 7212 0 11 3 13 14 4 24188622 chr13 184040 Lrrc16 NM_026825 leucine rich repeat containing 16 intron21 -183666 0 10 3 8 14 5 26519282 chr13 -65086 inter-genic -1371539 0 2 4 15 14 3 29023772 chr13 95062 inter-genic 19843 0 5 1 5 20 7 30699320 chr13 -52644 inter-genic 52381 0 6 7 14 10 3 30856419 chr13 15293 Irf4 NM_013674 interferon regulatory factor 4 Exon_9/9_lastExon -13981 0 4 5 7 12 3 30874343 chr13 33217 inter-genic -31905 0 5 7 9 14 3 34387343 chr13 49706 3110004L20Rik intron3 -48654 0 9 4 14 12 16 35833591 chr13 81843 Cdyl NM_009881 chromodomain protein Y chromosome-like intron3 0 10 6 1 1 0 1 35908934 chr13 157186 Cdyl NM_009881 chromodomain protein Y chromosome-like intron5 -76380 0 5 8 8 14 5 36614364 chr13 405085 Fars2 NM_001039189 phenylalanine-tRNA synthetase 2 mitochondrial intron5 56137 0 5 3 12 21 8 40375293 chr13 -352942 inter-genic 424025 10 7 0 7 0 5 44416789 chr13 200254 inter-genic 408240 0 2 6 6 10 0 47077891 chr13 -61047 inter-genic 28331 0 6 5 5 16 0 49397243 chr13 7332 Fgd3 NM_015759 FYVE RhoGEF and PH domain containing 3 intron1 -39220 0 10 1 11 11 10 51420909 chr13 -83223 inter-genic 83028 0 13 3 2 11 7 52099154 chr13 157093 inter-genic -155761 0 6 2 8 10 5 52894346 chr13 202096 inter-genic 130330 0 5 5 6 12 9 52956004 chr13 69040 Auh NM_016709 AU RNA-binding enoyl-coenzyme A hydratase intron6 -68671 0 3 19 5 18 11 54300515 chr13 13018 Hrh2 NM_001010973 histamine receptor H 2 isoform 1 intron1 -13119 0 6 1 10 14 0 54989686 chr13 -61106 inter-genic 60365 0 4 10 2 13 2 55988187 chr13 102248 inter-genic -50807 0 14 8 14 13 11 57683851 chr13 325783 Spock1 NM_009262 sparc/osteonectin cwcv and kazal-like domains intron5 -324990 0 10 4 11 11 5 58545339 chr13 41711 inter-genic -42734 0 2 5 0 13 1 60920381 chr13 217074 inter-genic -217259 0 7 4 9 10 11 63246906 chr13 130613 2010111I01Rik NM_028079 aminopeptidase O intron4 94430 0 9 5 9 14 10 74754893 chr13 -22426 inter-genic 22379 0 2 2 0 10 3 79272393 chr13 758960 inter-genic -929994 0 9 5 17 10 15 91320037 chr13 43553 Atg10 NM_025770 autophagy-related 10-like intron2 -43360 0 5 13 3 17 6 91346246 chr13 17344 Atg10 NM_025770 autophagy-related 10-like intron2 -17151 0 8 3 11 12 3 94837641 chr13 9891 Lhfpl2 NM_172589 lipoma HMGIC fusion partner-like 2 intron1 -10236 0 5 8 8 11 3 99638602 chr13 57735 Tnpo1 NM_178716 transportin 1 isoform 1 intron7 -22190 0 9 3 7 22 6 113958761 chr13 32471 inter-genic 124559 0 1 13 13 20 4 115267752 chr13 -340741 inter-genic -18986 0 4 2 5 13 2 115669507 chr13 52740 Itga2 NM_008396 integrin alpha 2 intron6 61146 0 6 10 2 10 2 12270871 chr14 -115654 inter-genic 115008 0 4 5 4 11 5 17084258 chr14 2431 Ngly1 NM_021504 N-glycanase 1 intron1 -2466 0 1 8 3 11 5 22316212 chr14 -2863 inter-genic 2440 0 2 5 3 11 6 22649234 chr14 -1548 inter-genic 1190 0 4 7 3 11 3 22846496 chr14 7563 1700112E06Rik NM_028275 Exon_2/7 -7679 0 23 2 35 14 16 23529160 chr14 690227 1700112E06Rik NM_028275 intron5 -690343 0 9 12 16 16 11 25073878 chr14 -38707 inter-genic -9631 0 3 7 1 11 0 27352392 chr14 832 Slmap NM_032008 sarcolemma associated protein intron1 -1007 0 4 10 6 10 1 28189628 chr14 138404 Arhgef3 NM_027871 Rho guanine nucleotide exchange factor GEF 3 intron3 -40533 0 1 5 2 16 2 29692806 chr14 -138633 inter-genic -361340 0 6 8 12 13 3 31639867 chr14 1066 Tmem110 NM_028839 transmembrane protein 110 intron1 -1154 0 1 20 4 11 3 34659830 chr14 -76942 inter-genic 76626 0 7 1 6 11 1 39577276 chr14 709098 Nrg3 NM_008734 neuregulin 3 intron2 -708127 0 15 0 10 15 12 41809663 chr14 17399 5730469M10Rik NM_027464 hypothetical protein LOC70564 intron5 -17155 0 6 3 1 16 5 41959585 chr14 -5159 inter-genic -73467 10 9 2 13 0 4 48508315 chr14 -10214 inter-genic 232196 0 11 2 8 13 5 49041308 chr14 17425 inter-genic 24606 0 2 20 8 12 1 50505039 chr14 -241214 inter-genic 177046 0 18 4 14 11 15 52723997 chr14 -342 Hnrpc up500region 0 14 2 0 0 0 1 54695941 chr14 -183030 inter-genic 177434 0 21 1 13 11 19 56077199 chr14 -20434 inter-genic 32481 0 1 12 3 14 1 56740157 chr14 -52430 inter-genic -221173 0 15 6 14 14 7 62267701 chr14 34319 LOC668253 intron2 0 19 2 18 3 0 1 63426049 chr14 -5743 inter-genic 30033 0 2 16 12 11 3 63517774 chr14 61260 Wdfy2 NM_175546 WD repeat and FYVE domain containing 2 intron2 -61692 0 4 35 7 25 2 63546881 chr14 90367 Wdfy2 NM_175546 WD repeat and FYVE domain containing 2 intron4 -90799 20 1 1 9 0 6 64375240 chr14 -38615 inter-genic 103841 0 3 3 0 11 3 65710339 chr14 141458 inter-genic 6194 0 5 6 2 13 4 65716822 chr14 147941 inter-genic 0 10 0 1 0 0 1 68192242 chr14 -142099 inter-genic 140931 10 9 0 2 0 5 68692685 chr14 -9255 inter-genic 9053 0 7 1 0 11 5 70428390 chr14 -48861 inter-genic 45965 0 3 2 4 14 2 70479167 chr14 1916 Egr3 NM_018781 early growth response 3 Exon_2/2_lastExon 0 16 4 6 1 0 3 80508636 chr14 108528 inter-genic -334919 0 14 2 3 11 7 80616001 chr14 215893 inter-genic -442284 10 1 3 5 0 4 81412793 chr14 1012685 inter-genic -1239076 0 8 8 13 15 8 84843398 chr14 -2082 inter-genic 0 0 1 14 5 12 0 87614690 chr14 -201798 inter-genic -73927 0 7 2 3 14 3 105544646 chr14 31896 Rbm26 NM_134077 RNA binding motif protein 26 intron9 -31240 11 19 2 20 0 5 115178264 chr14 -313209 inter-genic 261287 0 8 5 3 10 3 116921024 chr14 1429551 Gpc5 NM_175500 glypican 5 intron7 403575 0 10 1 6 12 3 117325768 chr14 1232 Gpc6 NM_001079844 glypican 6 isoform 1 intron1 0 0 1 1 1 14 3 119073594 chr14 31831 Abcc4 NM_001033336 ATP-binding cassette sub-family C CFTR/MRP, intron1 -31408 0 4 3 6 11 4 119312054 chr14 10333 Dzip1 NM_025943 DAZ interacting protein 1 intron3 -9750 0 9 8 10 10 10 120799533 chr14 124643 Mbnl2 NM_175341 muscleblind-like 2 isoform 1 intron7 77399 0 9 3 6 10 1 121721902 chr14 56548 Stk24 NM_145465 serine/threonine protein kinase 24 intron2 -55677 0 10 3 5 11 2 124394362 chr14 681985 Fgf14 NM_207667 fibroblast growth factor 14 isoform b intron3 368415 0 9 2 11 12 11 8583698 chr15 -280750 inter-genic 2430 0 11 1 12 11 6 9453075 chr15 6536 Il7r NM_008372 interleukin 7 receptor precursor intron2 383054 0 4 6 1 13 5 10235182 chr15 127773 Prlr NM_011169 prolactin receptor intron2 164357 0 10 10 6 11 6 10689857 chr15 -192253 inter-genic -46054 0 4 4 5 21 1 12251784 chr15 534 Golph3 NM_025673 golgi phosphoprotein 3 intron1 0 0 1 1 0 10 0 21737815 chr15 -87196 inter-genic 3556115 13 22 3 13 0 10 27184898 chr15 -211533 inter-genic 211104 0 7 7 8 10 14 27228766 chr15 -167665 inter-genic 167236 0 9 4 6 18 5 30579952 chr15 477605 Ctnnd2 NM_008729 catenin cadherin associated protein delta 2 intron7 -3660 0 3 3 3 11 4 31279018 chr15 18300 5730557B15Rik NM_027496 hypothetical protein LOC67434 isoform 2 intron1 -17764 0 17 8 9 36 12 36213087 chr15 -187 Rnf19 up500region 0 11 0 3 1 0 2 36325550 chr15 216428 inter-genic 100470 0 1 14 5 24 1 36421380 chr15 5124 Ankrd46 NM_175134 ankyrin repeat domain 46 intron2 -4639 0 5 5 2 10 1 36692032 chr15 -470969 inter-genic 30108 0 3 8 5 11 3 38059297 chr15 -89658 inter-genic -51598 0 1 23 9 23 2 39566459 chr15 -11018 inter-genic 122205 0 18 3 8 11 10 40665639 chr15 179052 Zfpm2 NM_011766 zinc finger protein multitype 2 intron3 -179220 0 22 3 13 16 21 41736682 chr15 -16900 inter-genic -116321 0 9 3 4 10 6 41746078 chr15 -7504 inter-genic -125717 0 7 1 0 13 8 50478702 chr15 -236955 inter-genic 222326 0 11 8 11 11 12 53126071 chr15 51665 Ext1 NM_010162 exostosin 1 intron1 -50431 0 3 9 6 16 4 55387986 chr15 879 Mrpl13 NM_026759 mitochondrial ribosomal protein L13 intron1 -778 0 5 7 3 11 8 58854000 chr15 59542 Mtss1 NM_144800 actin monomer-binding protein intron3 -58831 0 4 15 6 21 3 59372637 chr15 166836 Nsmce2 NM_026746 non-SMC element 2 MMS21 homolog intron4 106440 0 14 15 8 38 18 59557505 chr15 77297 inter-genic -78428 0 6 7 6 11 9 63935293 chr15 279186 Ddef1 NM_010026 development and differentiation enhancing intron26 43739 0 7 19 9 11 7 66693730 chr15 -29224 inter-genic 106416 0 5 13 5 13 4 71881200 chr15 343219 inter-genic 495155 0 2 11 2 11 5 72490774 chr15 400858 1810044A24Rik NM_180662 NIK and IKKbeta binding protein isoform 2 intron20 114420 0 4 0 3 11 3 74419337 chr15 72712 Bai1 NM_174991 brain-specific angiogenesis inhibitor 1 Exon_31/31_lastExon -25000 0 4 0 0 11 4 76090639 chr15 -7879 inter-genic -13441 12 12 2 11 0 8 79178744 chr15 637 Maff NM_010755 v-maf musculoaponeurotic fibrosarcoma oncogene intron1 -1005 0 2 0 1 16 1 79358675 chr15 18494 Ddx17 NM_001040187 DEAD box polypeptide 17 isoform 4 Exon_13/13_lastExon 11969 0 10 3 9 10 12 82099226 chr15 -6138 inter-genic 6147 0 3 5 2 11 6 83175464 chr15 5211 Arfgap3 NM_025445 ADP-ribosylation factor GTPase activating intron1 -4915 0 9 8 6 19 5 84282054 chr15 126905 inter-genic -5607 11 1 1 1 0 5 86643098 chr15 -126438 inter-genic -598784 0 5 1 7 11 8 87033956 chr15 264420 inter-genic 340488 0 8 6 9 13 5 87454959 chr15 -700 inter-genic 0 10 0 12 1 0 2 90367755 chr15 142062 Cpne8 NM_025815 copine VIII isoform 1 intron13 -141760 0 7 2 12 10 2 92586408 chr15 359168 Pdzrn4 intron9 -359055 0 10 3 9 21 8 93431483 chr15 188585 inter-genic -5750 0 4 0 4 12 4 96298524 chr15 111319 inter-genic -8140 0 4 13 6 14 7 96539498 chr15 352293 inter-genic 407 0 12 4 18 11 7 98239111 chr15 10260 1700031M16Rik intron5 28810 0 5 2 1 10 3 101802475 chr15 -56180 inter-genic 5330 0 6 3 5 12 3 102913133 chr15 48308 inter-genic 3221 0 6 1 6 11 4 5029894 chr16 20107 3930401K13Rik NM_001079814 cytokine-like nuclear factor n-pac isoform 1 intron7 16590 0 13 0 24 10 13 6162259 chr16 277169 A2bp1 NM_021477 ataxin 2 binding protein 1 isoform gamma intron1 186779 0 5 4 2 11 1 10026267 chr16 -144053 inter-genic -31507 0 15 5 24 13 11 14993918 chr16 94765 LOC100042737 intron3 -91108 0 14 3 16 14 12 20804822 chr16 71623 inter-genic -71963 0 5 10 2 14 3 28846975 chr16 82807 1600021P15Rik NM_177718 hypothetical protein LOC239796 intron1 -81925 0 14 1 2 11 11 30512665 chr16 37997 Tmem44 NM_172614 transmembrane protein 44 Exon_10/10_lastExon 1922 11 3 4 4 0 2 31149056 chr16 52266 Centb2 NM_030138 centaurin beta 2 intron4 -51282 0 9 8 9 28 7 35813611 chr16 43140 Hspbap1 NM_175111 Hspb associated protein 1 intron3 -43362 0 6 8 8 11 5 35870467 chr16 1117 Parp14 NM_001039530 poly ADP-ribose polymerase family member 14 intron1 -642 0 5 17 5 11 6 38359212 chr16 9835 inter-genic -12228 0 15 3 11 16 11 38460932 chr16 1920 Cd80 NM_009855 CD80 antigen precursor intron1 -8385 0 5 2 9 16 5 43640467 chr16 -121887 inter-genic -21957 0 3 2 6 14 1 55070530 chr16 865748 inter-genic 751206 0 6 1 20 10 6 75150480 chr16 -442655 inter-genic 442540 0 6 1 0 10 8 75593503 chr16 368 Rbm11 NM_198302 RNA binding motif protein 11 intron1 -483 14 4 2 0 0 5 79615901 chr16 -383725 inter-genic -1039404 0 6 2 6 11 10 82789715 chr16 995721 inter-genic 1913540 0 5 0 1 11 9 83740535 chr16 -1034142 inter-genic 962720 0 5 1 7 10 6 84105282 chr16 -669395 inter-genic 597973 0 7 11 17 11 12 87727021 chr16 27823 Bach1 NM_007520 BTB and CNC homology 1 intron4 -28058 18 11 8 11 0 2 89557029 chr16 249798 inter-genic 310678 0 3 1 0 11 4 94725932 chr16 22116 Dscr3 NM_007834 Down syndrome critical region protein 3 Exon_5/8 -21927 10 4 7 6 0 3 95519098 chr16 39841 Kcnj15 NM_001039056 potassium inwardly-rectifying channel J15 Exon_4/4_lastExon 287919 0 6 1 0 10 3 96609508 chr16 26108 Jam4 intron4 -107117 0 2 1 5 11 5 97128018 chr16 264322 Dscam NM_031174 Down syndrome cell adhesion molecule intron3 -264092 0 5 0 8 10 5 3647000 chr17 49259 Nox3 NM_198958 NADPH oxidase 3 intron11 89610 0 6 1 3 11 2 3951424 chr17 393601 inter-genic -394033 0 6 2 13 12 6 5255594 chr17 260521 Arid1b NM_001085355 AT rich interactive domain 1B Swi1 like intron5 -65786 0 11 14 10 36 14 5830303 chr17 -11060 inter-genic 10629 11 6 16 2 0 4 8427436 chr17 -7954 inter-genic 48878 0 5 8 7 11 6 14699619 chr17 -138397 inter-genic -282143 0 5 13 13 16 10 25881861 chr17 8877 BC052484 NM_177822 hypothetical protein LOC328783 intron11 -27522 0 5 7 2 14 4 27095462 chr17 17021 Syngap1 intron10 -9849 12 7 4 5 0 1 29371127 chr17 3606 Cpne5 NM_153166 copine V intron1 -3256 0 10 3 11 11 8 31619767 chr17 -37292 inter-genic 29136 0 11 5 11 19 1 31619942 chr17 -37117 inter-genic 28961 0 12 8 13 15 6 31662050 chr17 4991 1500032D16Rik NM_001083891 NADH-ubiquinone oxidoreductase flavoprotein 3 intron2 -5135 0 11 2 0 10 6 31966442 chr17 151553 inter-genic 20440 0 8 1 6 19 6 34162584 chr17 -6212 inter-genic -1288 0 10 0 0 11 5 34253886 chr17 4804 Brd2 NM_010238 bromodomain containing 2 isoform a Exon_3/13 -1454 0 4 6 1 13 3 34843948 chr17 36469 Tnxb NM_031176 tenascin XB intron21 -27122 0 1 7 6 12 7 36866379 chr17 -43475 inter-genic 107492 0 6 5 6 16 6 37364097 chr17 2026 inter-genic -30152 0 10 15 15 10 7 43815815 chr17 11442 Cyp39a1 NM_018887 cytochrome P450 family 39, subfamily a, intron2 -12016 0 11 0 17 10 11 44355013 chr17 29493 Clic5 NM_172621 chloride intracellular channel 5 intron1 -29555 0 7 10 5 52 9 44612985 chr17 287465 inter-genic 258414 0 1 13 13 19 2 44648373 chr17 -265746 inter-genic 223026 0 5 3 8 11 4 45671919 chr17 11537 Tcte1 NM_013688 t-complex-associated testis expressed 1 Exon_3/5 0 0 8 8 6 11 9 45747362 chr17 46262 inter-genic -15103 0 7 0 6 11 4 46835917 chr17 5977 Ppp2r5d NM_009358 delta isoform of regulatory subunit B56 protein intron2 -5717 10 6 1 2 0 2 46849021 chr17 610 Pex6 NM_145488 peroxisomal biogenesis factor 6 Exon_1/17_1stExon 0 0 3 21 1 13 3 47874577 chr17 10787 inter-genic 0 11 0 2 0 0 1 50795851 chr17 147110 Plcl2 NM_013880 phospholipase C-like 2 intron4 -147839 0 4 8 12 13 7 51318113 chr17 545 Tbc1d5 NM_028162 TBC1 domain family member 5 intron1 0 10 2 15 4 0 1 52429398 chr17 -14493 inter-genic 312266 11 2 1 2 0 1 54439633 chr17 305618 inter-genic -1789 0 3 4 2 10 1 57897141 chr17 -11851 inter-genic -482561 0 14 1 7 10 7 59400473 chr17 249628 inter-genic -247931 0 29 3 15 10 21 64488228 chr17 242858 Fert2 NM_001037997 fer fms/fps related protein kinase testis Exon_18/18_lastExon 192486 0 8 0 4 10 11 66089658 chr17 32361 Rab31 NM_133685 Rab31-like intron1 -31962 0 3 5 4 23 5 69365495 chr17 -140654 inter-genic 59428 0 7 5 6 11 4 69657240 chr17 -76077 inter-genic 74585 0 6 3 5 14 7 69666957 chr17 -66360 inter-genic 64868 0 10 0 4 11 14 69789278 chr17 613 A330050F15Rik intron1 0 0 1 10 8 11 0 73457795 chr17 462 Lycat NM_001081071 lysocardiolipin acyltransferase intron1 0 0 4 0 0 13 2 75864683 chr17 -269 Rasgrp3 NM_207246 RAS guanyl releasing protein 3 up500region 86151 0 2 3 1 11 0 77786347 chr17 -810060 inter-genic 812710 0 2 3 10 12 5 79745901 chr17 8528 Cdc42ep3 NM_026514 CDC42 effector protein Rho GTPase binding 3 intron1 -7859 0 9 3 14 15 3 83436167 chr17 -178474 inter-genic 177869 0 10 7 12 11 6 83759071 chr17 8750 Eml4 NM_199466 echinoderm microtubule associated protein like 4 intron1 -8934 0 8 6 2 13 5 86091638 chr17 71465 inter-genic 0 0 1 5 0 12 5 87252409 chr17 -61390 inter-genic -99950 0 7 7 5 23 7 87509265 chr17 2247 Socs5 NM_019654 suppressor of cytokine signaling 5 intron1 -2829 0 2 1 5 11 5 88140943 chr17 69047 inter-genic 4384 0 6 9 9 10 5 88463864 chr17 759 Fbxo11 NM_001081034 F-box protein 11 intron1 0 0 6 19 3 14 1 4248997 chr18 83168 inter-genic 103895 0 9 1 14 11 14 9101298 chr18 -111619 inter-genic 110847 0 3 11 10 11 2 13645590 chr18 480092 inter-genic 483058 0 2 6 7 11 8 20412223 chr18 6383 Dsg1c NM_181680 desmoglein 1 gamma intron1 -194765 0 6 1 8 11 8 23833259 chr18 -129225 inter-genic 77500 0 8 8 6 11 9 23941752 chr18 -20732 inter-genic 20508 0 7 5 9 22 3 24275345 chr18 4973 D030070L09Rik NM_172625 hypothetical protein LOC225280 intron1 -4712 0 1 9 13 11 7 24293830 chr18 -70111 inter-genic -13772 0 13 3 6 11 5 24478837 chr18 63014 inter-genic -115067 0 13 3 1 11 8 31498770 chr18 -295266 inter-genic 270226 0 10 3 8 13 8 35713408 chr18 -3275 inter-genic 8250 13 3 7 3 0 5 35990963 chr18 1492 Cxxc5 NM_133687 CXXC finger 5 intron1 0 28 4 9 2 0 1 36177610 chr18 179202 LOC100042150 Exon_11/11_lastExon 0 0 6 3 0 12 2 36627323 chr18 -60482 inter-genic 47535 0 2 3 2 13 0 38575718 chr18 -2910 inter-genic 2836 0 5 3 6 13 2 39301384 chr18 148586 Arhgap26 NM_175164 Rho GTPase activating protein 26 intron10 -148821 0 5 3 7 27 12 41727481 chr18 -169799 inter-genic 383040 0 18 1 7 14 7 42822189 chr18 151049 inter-genic -151475 0 5 8 2 10 1 42917974 chr18 246834 inter-genic -247260 0 13 5 19 11 8 43310396 chr18 -56954 inter-genic 56712 0 6 3 7 10 12 43647782 chr18 43019 inter-genic -10539 0 10 7 14 12 16 44821760 chr18 3551 LOC100042883 Exon_1/2_1stExon 0 17 5 0 1 0 5 47881403 chr18 183172 inter-genic 324907 0 5 1 6 11 4 53745464 chr18 121265 inter-genic -33470 0 2 6 5 12 4 55078126 chr18 71439 Zfp608 NM_175751 zinc finger protein 608 intron3 -69367 0 21 23 10 13 8 56872366 chr18 4840 Lmnb1 NM_010721 lamin B1 intron1 -5420 0 5 1 6 18 2 58388473 chr18 -327420 inter-genic -19447 0 8 0 5 12 9 64500196 chr18 179 Onecut2 NM_194268 one cut domain family member 2 Exon_1/2_1stExon 0 22 2 9 2 0 2 64542347 chr18 42330 Onecut2 NM_194268 one cut domain family member 2 intron1 -39968 11 2 3 2 0 1 66347787 chr18 103703 Ccbe1 NM_178793 collagen and calcium binding EGF domains 1 intron2 -103110 0 6 6 4 10 11 67461429 chr18 12553 Impa2 NM_053261 inositol myo-1(or 4)-monophosphatase 2 intron1 -12584 0 25 59 26 29 9 67957609 chr18 23080 inter-genic 1952 0 4 5 1 12 6 67974948 chr18 40419 inter-genic -15387 0 6 1 2 10 8 69804485 chr18 300311 Tcf4 NM_013685 transcription factor 4 isoform a intron11 -298804 0 18 26 12 51 14 70747828 chr18 19987 Mbd2 NM_010773 methyl-CpG binding domain protein 2 intron2 -20105 0 16 28 20 29 4 73103227 chr18 -629847 inter-genic 628439 0 17 3 26 11 16 74242654 chr18 -133211 inter-genic -19168 0 3 2 9 10 2 76838190 chr18 -35592 inter-genic 244815 15 6 4 5 0 4 77070883 chr18 -24057 inter-genic 12122 0 10 3 4 11 10 77517427 chr18 -3269 inter-genic -24301 0 9 14 8 21 4 79455466 chr18 -675452 inter-genic -149793 0 8 11 7 10 2 80789907 chr18 97352 inter-genic 104812 0 12 4 12 10 10 81595980 chr18 903425 inter-genic 111124 11 1 1 2 0 4 85021062 chr18 257 Cyb5 NM_025797 cytochrome b-5 intron1 100256 0 3 1 0 10 0 88088450 chr18 -394538 inter-genic 950941 0 11 20 47 16 14 5425248 chr19 -334 Drap1 NM_024176 Dr1 associated protein 1 negative cofactor 2 up500region 0 20 9 5 3 0 3 5425248 chr19 92 AI837181 NM_134149 basophilic leukemia expressed protein Exon_1/2_1stExon 0 20 9 5 3 0 3 7026622 chr19 10278 inter-genic 0 13 0 0 0 0 1 7500212 chr19 5174 2700081O15Rik NM_175381 hypothetical protein LOC108899 Exon_4/4_lastExon -3626 0 2 10 3 14 7 7634598 chr19 2650 Hrasls3 NM_139269 Hrasls like suppressor 3 intron2 52236 0 1 3 2 10 1 10198348 chr19 -59114 inter-genic -22636 0 7 2 12 14 11 11602483 chr19 9435 Ms4a6b NM_027209 membrane-spanning 4-domains subfamily A, member intron5 290533 0 11 3 2 18 6 18334028 chr19 -321887 inter-genic 371754 0 13 2 5 11 9 26118861 chr19 428064 1700048O14Rik intron3 370991 0 8 0 0 11 13 29480705 chr19 -4742 inter-genic -44479 0 4 32 6 21 5 36529686 chr19 76130 Pcgf5 NM_029508 polycomb group ring finger 5 intron8 -45664 0 8 8 3 14 12 41404611 chr19 54995 Pik3ap1 NM_031376 phosphoinositide-3-kinase adaptor protein 1 intron3 -45828 0 11 9 15 11 9 41720616 chr19 97728 Slit1 NM_015748 slit homolog 1 Exon_13/37 -96959 0 8 2 14 11 8 42593752 chr19 458 D19Ertd386e NM_177464 growth inhibition and differentiation related intron1 0 10 2 42 4 0 1 43592934 chr19 6063 Got1 NM_010324 glutamate oxaloacetate transaminase 1 soluble intron1 -5898 0 9 7 12 10 9 44058670 chr19 2338 Cpn1 NM_030703 carboxypeptidase N polypeptide 1 intron1 44314 0 1 1 0 11 2 44593851 chr19 26485 Sec31b NM_001033343 SEC31-like 2 Exon_21/26 7857 0 5 2 1 12 4 44621198 chr19 -16145 inter-genic -1238 10 13 1 10 0 5 48524080 chr19 243566 Sorcs3 NM_025696 sortilin-related VPS10 domain containing intron2 -244410 0 13 3 3 13 2 51069486 chr19 -628063 inter-genic -316989 0 3 0 3 10 0 53614759 chr19 11161 Dusp5 NM_001085390 dual specificity phosphatase 5 intron3 -10450 0 6 0 3 19 3 53640808 chr19 -34128 inter-genic 33688 0 1 3 3 11 5 54139192 chr19 19470 inter-genic -19647 0 8 4 7 11 2 56754553 chr19 -42308 inter-genic 41814 0 3 7 4 12 5 57473546 chr19 38377 inter-genic -38434 0 3 18 7 11 1 57497488 chr19 -29929 inter-genic -62376 0 10 3 15 10 5 9048327 chrX 120603 inter-genic -143177 0 7 1 4 10 6 20953914 chrX 15924 inter-genic -15973 0 7 10 10 11 9 22446341 chrX 407584 inter-genic 495423 0 19 1 11 13 13 34618012 chrX 29173 inter-genic 7074 0 17 5 5 10 8 45506481 chrX 6778 1200013B08Rik NM_028773 hypothetical protein LOC74131 intron1 103296 0 4 5 5 10 2 45675814 chrX -18720 inter-genic -7969 0 11 7 9 18 4 47766421 chrX -428191 inter-genic -39550 0 4 1 2 18 6 48280929 chrX -70676 inter-genic -86444 0 23 14 23 11 11 53769431 chrX 61378 inter-genic -60865 12 2 3 4 0 4 55644725 chrX 360921 inter-genic -353451 0 11 2 8 12 6 71517712 chrX -118 Snora70 up500region -1672 0 1 5 15 11 3 78099892 chrX 188241 inter-genic 215890 0 5 3 4 11 3 80059944 chrX -134297 inter-genic -1744162 16 1 8 1 0 1 81474769 chrX 1280528 Dmd NM_007868 dystrophin muscular dystrophy intron44 1344228 0 3 2 5 10 2 91059309 chrX 18123 Pdk3 NM_145630 pyruvate dehydrogenase kinase isoenzyme 3 Exon_2/12 -17906 10 13 0 6 0 8 93295364 chrX 3981 Msn NM_010833 moesin intron1 -4067 0 11 8 7 11 6 95909783 chrX 176539 Ophn1 NM_052976 oligophrenin 1 intron7 -175959 10 4 4 4 0 4 98279239 chrX 1450 Slc7a3 NM_007515 solute carrier family 7 cationic amino acid Exon_3/13 24310 0 2 6 5 11 6 99284224 chrX 19844 LOC331476 intron3 17935 0 5 8 9 15 6 108736742 chrX 73944 D030011N01Rik intron4 -73825 0 23 5 12 11 10 108744913 chrX 65773 D030011N01Rik intron4 -65654 0 5 3 0 10 0 112372103 chrX 269353 inter-genic -2658007 0 2 3 5 10 3 117772574 chrX 368639 Pcdh11x NM_001081385 protocadherin 11 X-linked intron10 -366098 0 13 3 11 15 12 127410727 chrX 371019 inter-genic -1126600 0 6 24 8 23 2 130642588 chrX 3657 Nox1 NM_172203 NADPH oxidase 1 intron1 48953 0 26 3 24 12 11 130699740 chrX -22299 inter-genic -106104 0 10 0 8 11 6 130939695 chrX 320 Drp2 NM_010078 dystrophin related protein 2 intron1 69839 0 12 9 17 18 7 139964028 chrX -163801 inter-genic -563701 0 9 1 2 10 8 141706439 chrX 582990 inter-genic -583029 0 14 4 19 10 16 143749500 chrX 352445 inter-genic 238608 0 5 18 10 14 1 152026607 chrX 31261 Ptchd1 NM_001093750 patched domain containing 1 intron1 -30594 0 8 3 11 11 12 158073753 chrX -81805 inter-genic 81286 0 9 4 2 10 3 158529072 chrX 68648 Nhs NM_001081052 Nance-Horan syndrome intron1 -67675 0 12 3 10 14 4 MCSS tags cut with HpaII were normalized. DMRs (differentially methylated regions) were defined as a change from 0 to more than 10 tags at sites digested by MspI between naive and memory CD4 T cells. * Methylation score is described in Materials and Methods. Table S3. Transcript profile in murine naive CD4+ T cells Tag No. RefSeq Description Naive cells Effector cells Memory cells 93158 32737 59802 NM_013487 CD3 antigen delta polypeptide 84433 13492 104831 NM_010686 lysosomal-associated protein transmembrane 5 70431 34467 152751 NM_009095 ribosomal protein S5 47693 6870 63858 NM_133796 Rho GDP dissociation inhibitor GDI alpha 46525 33589 50044 NM_013706 CD52 antigen 41141 4153 46023 NM_010261 Rab acceptor 1 27588 3285 31638 NM_029803 interferon alpha-inducible protein 27 24888 20752 36979 NM_012053 ribosomal protein L8 23591 8951 9203 NM_007393 actin beta, cytoplasmic 19399 1632 13120 NM_016933 protein tyrosine phosphatase receptor type, C 17679 1646 15815 NM_010129 epithelial membrane protein 3 17499 15450 13004 NM_009008 RAS-related C3 botulinum substrate 2 17405 27954 23063 NM_009382 thymus cell antigen 1 theta 15950 3136 17119 NM_007806 cytochrome b-245 alpha polypeptide 15908 96951 19273 NM_011029 ribosomal protein SA 15714 45950 31585 NM_013647 ribosomal protein S16 15547 1281 5671 NM_175092 ras homolog gene family member f 14857 1898 9997 NM_009151 selectin P ligand 13579 6359 16229 NM_013535 C10 protein 13028 5102 283717 NM_008495 lectin galactose binding, soluble 1 12845 4399 17516 NM_009983 cathepsin D 12068 3241 10670 NM_009898 coronin actin binding protein 1A 11666 6333 8688 NM_009775 peripheral benzodiazepine receptor 11311 2224 1912 NM_007719 chemokine C-C motif receptor 7 11239 7135 13817 NM_008761 FXYD domain-containing ion transport regulator 10998 458 18628 NM_026938 transmembrane protein 160 10587 736 9419 NM_011117 plectin 1 isoform 1 10174 1110 11552 NM_133916 eukaryotic translation initiation factor 3 9868 5108 4664 NM_025858 scotin isoform 1 9809 27919 11808 NM_001048057 ribosomal protein L38 9796 367 4153 NM_001082536 megakaryoblastic leukemia translocation 1 9656 2826 10274 NM_016665 stimulated by retinoic acid 13 9541 6150 6471 NM_010239 ferritin heavy chain 1 9498 209 2539 NM_144913 bin3 bicoid-interacting 3, homolog 9253 6776 13815 NM_009438 ribosomal protein L13a 9199 1427 8932 NM_011354 small EDRK-rich factor 2 8683 2237 7399 NM_008518 lymphotoxin B 8213 1798 4365 NM_027898 GRAM domain containing 1A 7950 1924 2669 NM_027521 minor histocompatibility antigen HA-1 7595 17277 11347 NM_007750 cytochrome c oxidase subunit VIIIa 7589 640 7652 NM_029272 NADH dehydrogenase ubiquinone Fe-S protein 7 7284 1230 4904 NM_172397 LIM domain containing 2 7274 892 11520 NM_008080 beta-14-N-acetylgalactosaminyltransferase 7084 1206 512 NM_176807 folate receptor 4 delta isoform 2 7015 19054 11378 NM_026020 ribosomal protein large P2 7015 1563 14560 NM_025983 ATP synthase H+ transporting, mitochondrial F1 6934 1030 2368 NM_010689 linker for activation of T cells 6796 1715 4938 NM_001033186 src family associated phosphoprotein 1 6793 3695 8854 NM_010724 proteosome prosome macropain subunit, beta 6759 1208 6796 NM_011577 transforming growth factor beta 1 6596 1406 9098 NM_144869 hypothetical protein LOC225884 6546 2420 1952 NM_001024458 adducin 1 alpha isoform 1 6318 1787 2944 NM_134116 G-protein signalling modulator 3 AGS3-like C. 6186 2240 10022 NM_001110211 annexin A6 isoform b 6173 1821 6469 NM_177343 calcium/calmodulin-dependent protein kinase 1D 6118 4208 4482 NM_153788 centaurin beta 1 6110 934 3259 NM_013895 translocase of inner mitochondrial membrane 9 6083 766 1738 NM_026145 potassium channel tetramerization 6037 3498 3209 NM_009156 selenoprotein W 1 5778 636 3498 NM_010227 filamin alpha 5723 562 2604 NM_145439 transmembrane channel-like gene family 6 isoform 5640 1792 6700 NM_198613 adaptor-related protein complex 2 sigma 1 5638 373 3929 NM_181405 arginyl aminopeptidase aminopeptidase B-like 5602 1845 4874 NM_025562 tetratricopeptide repeat domain 11 5571 997 8437 NM_025843 NADH dehydrogenase ubiquinone 1 beta 5503 6085 5943 NM_028659 eukaryotic translation initiation factor 3 5405 863 1887 NM_008488 Rho guanine nucleotide exchange factor GEF 1 5392 1372 4762 NM_026948 divalent cation tolerant protein CUTA isoform 2 5342 1511 5843 NM_027206 tumor necrosis factor alpha-induced protein 5269 8608 11609 NM_172086 ribosomal protein L32 5229 5575 6375 NM_001081108 hypothetical protein LOC66096 5178 981 6397 NM_016794 vesicle-associated membrane protein 8 5094 6792 9522 NM_181821 host cell factor C1 regulator 1 5049 10760 4551 NM_009941 cytochrome c oxidase subunit IV isoform 1 5038 3110 2973 NM_007648 CD3 antigen epsilon polypeptide 4979 11403 1752 NM_020582 ATP synthase H+ transporting, mitochondrial F0 4963 247 3294 NM_026398 processing of precursor 5 ribonuclease P/MRP 4952 5740 5946 NM_026545 proteasome 26S non-ATPase subunit 8 4949 1527 5923 NM_016876 eukaryotic translation initiation factor 3 4889 508 5474 NM_029748 hypothetical protein LOC76799 4825 8338 7087 NM_012052 ribosomal protein S3 4825 3819 2856 NM_011072 profilin 1 4744 458 4705 NM_019719 STIP1 homology and U-box containing protein 1 4721 2912 5513 NM_007645 CD37 antigen 4654 423 1221 NM_023900 guanine nucleotide releasing protein x 4649 4996 2349 NM_007486 Rho GDP dissociation inhibitor GDI beta 4641 891 3034 NM_008433 intermediate conductance calcium-activated 4495 106 4142 NM_026257 UBX domain containing 5 4472 3875 9983 NM_026851 mitochondrial ribosomal protein L52 4450 2314 2840 NM_001077698 formin-like 1 isoform 2 4330 3533 5117 NM_010885 NADH dehydrogenase ubiquinone 1 alpha 4260 116 2923 NM_198001 hypothetical protein LOC73737 4126 404 6162 NM_010347 amino-terminal enhancer of split 4116 4036 1643 NM_011508 eukaryotic translation initiation factor 1 4062 718 13533 NM_011827 hematopoietic cell signal transducer 4036 4701 2543 NM_001113358 defender against cell death 1 4009 1016 11347 NM_025396 6-phosphogluconolactonase 4004 5932 5414 NM_025344 eukaryotic translation initiation factor 3 3974 504 2923 NM_026388 synaptic vesicle associated protein of 30 kD 3963 594 807 NM_175185 hydroxysteroid dehydrogenase like 1 3949 3798 6623 NM_008529 lymphocyte antigen 6 complex locus E 3918 171 1015 NM_134009 nicalin homolog 3880 2754 2530 NM_023684 Lck interacting transmembrane adaptor 1 3870 1242 4043 NM_021519 endothelial differentiation-related factor 1 3847 1229 3886 NM_197991 RIKEN cDNA 2310044H10 3835 2372 4666 NM_009698 adenine phosphoribosyl transferase 3757 4364 2451 NM_013488 CD4 antigen 3753 2981 4597 NM_026552 actin related protein 2/3 complex subunit 4 3707 2524 2317 NM_031868 protein phosphatase 1 catalytic subunit, alpha 3637 837 3478 NM_023374 succinate dehydrogenase complex subunit B, iron 3554 283 2608 NM_001081379 ankyrin repeat domain 11 3535 10 1617 NM_008052 deltex 1 homolog 3523 1321 5985 NM_025917 unconventional SNARE in the ER 1 homolog isoform 3490 620 2862 NM_010579 eukaryotic translation initiation factor 6 3454 3317 2803 NM_009735 beta-2-microglobulin 3420 652 2308 NM_011408 schlafen 2 3411 990 1095 NM_027445 ring finger protein 167 3405 303 2300 NM_011063 phosphoprotein enriched in astrocytes 15 isoform 3393 431 6381 NM_177688 H2A histone family member J 3374 236 268 NM_001080746 general transcription factor II I isoform 1 3344 2789 6345 NM_026943 small nuclear ribonucleoprotein D2 3313 200 2414 NM_026748 integrator complex subunit 1 3295 413 1456 NM_008975 protein tyrosine phosphatase 4a3 3282 1359 1672 NM_018815 nucleoporin 210 3273 1985 1412 NM_019693 HLA-B-associated transcript 1A 3199 1130 3579 NM_001039175 elongation of very long chain fatty acids-like 1 3178 6088 1658 NM_008138 guanine nucleotide binding protein G protein 3172 6659 5396 NM_029751 ribosomal protein L18A 3167 420 4979 NM_029632 protein phosphatase 1 regulatory inhibitor 3156 1244 1314 NM_010312 guanine nucleotide-binding protein beta-2 3135 661 943 NM_138306 diacylglycerol kinase zeta 3102 2823 2422 NM_007725 calponin 2 3082 689 1794 NM_134118 glycoprotein synaptic 2 3074 2277 3143 NM_031247 GTPase IMAP family member 3 3069 3338 4047 NM_025963 ribosomal protein S10 3067 1974 6460 NM_018860 ribosomal protein L41 3053 591 1125 NM_009447 tubulin alpha 4 3047 1795 2337 NM_001025208 hypothetical protein LOC547349 3030 2732 1147 NM_008672 nucleosome assembly protein 1-like 4 3027 300 2002 NM_138630 Rho GTPase activating protein 4 3014 2681 1402 NM_019925 G protein-coupled receptor 132 3014 589 1810 NM_026888 phosphorylase kinase gamma 2 testis 2996 357 539 NM_019547 seb4 2938 5005 3477 NM_010422 hexosaminidase B 2916 1525 2888 NM_173742 ribonuclease RNase K 2910 238 1838 NM_011625 apoptosis-stimulating protein of p53 1 2908 401 2968 NM_026080 mitochondrial ribosomal protein S24 2906 1338 2924 NM_016742 cell division cycle 37 homolog 2877 1453 1153 NM_010693 lymphocyte protein tyrosine kinase 2843 1501 1595 NM_019829 syntaxin 5 2833 1200 2577 NM_177611 pleckstrin and Sec7 domain containing 4 2832 2352 3451 NM_008925 protein kinase C substrate 80K-H 2832 1949 857 NM_016811 diacylglycerol kinase alpha 2819 328 3174 NM_025368 Josephin domain containing 2 2799 219 2905 NM_013543 estradiol 17 beta-dehydrogenase 8 2784 2340 2307 NM_009457 ubiquitin-activating enzyme E1 2778 291 2062 NM_153056 sirtuin 7 silent mating type information 2777 951 1175 NM_028152 MMS19 MET18 S. cerevisiae 2769 1203 4361 NM_025577 hypothetical protein LOC66462 2745 2123 1761 NM_007748 cytochrome c oxidase subunit VI a, polypeptide 2695 299 2756 NM_134150 otubain 1 2680 638 1165 NM_178878 mitochondrial trifunctional protein alpha 2679 14567 2986 NM_008143 guanine nucleotide binding protein G protein 2678 19506 900 NM_023409 epididymal secretory protein E1 2668 7214 2671 NM_011287 ribosomal protein L10A 2655 1037 3731 NM_144870 NADH dehydrogenase ubiquinone Fe-S protein 8 2644 3185 1676 NM_138597 ATP synthase H+ transporting, mitochondrial F1 2636 853 2096 NM_015807 5'3'-nucleotidase, cytosolic 2635 867 1637 NM_026373 DOC-1 related protein 2610 141 827 NM_009325 thromboxane A2 receptor 2602 231 1146 NM_145580 transmembrane protein 149 2593 1851 920 NM_001113394 CD247 antigen isoform kappa precursor 2583 443 2187 NM_001025365 D4Wsu114e protein 2577 584 2631 NM_025407 ubiquinol-cytochrome c reductase core protein 1 2563 280 452 NM_007460 adaptor-related protein complex 3 delta 1 2558 3322 2771 NM_011671 uncoupling protein 2 mitochondrial proton 2546 2514 2710 NM_008577 solute carrier family 3 activators of dibasic 2537 1085 394 NM_177876 vacuolar protein sorting 37B 2519 426 736 NM_027410 hypothetical protein LOC70381 2395 19616 1877 NM_001077184 basigin isoform 2 2365 247 3481 NM_012015 H2A histone family member Y 2352 297 831 NM_016703 prolactin regulatory element binding protein 2342 87 85 NM_010145 epoxide hydrolase 1 microsomal 2327 1143 2132 NM_026776 vacuolar protein sorting 25 2326 188 1210 NM_016849 interferon regulatory factor 3 2325 2411 3778 NM_029478 transmembrane protein 49 2311 316 567 NM_011237 RAD9 homolog 2297 1190 1333 NM_007783 c-src tyrosine kinase 2276 2125 1391 NM_009122 special AT-rich sequence binding protein 1 2260 245 608 NM_178707 zinc finger protein 592 2239 552 2011 NM_013640 proteasome prosome macropain subunit, beta 2223 1161 5021 NM_080559 SH3 domain binding glutamic acid-rich 2222 112 3227 NM_026964 coiled-coil domain containing 124 2195 2677 2364 NM_011319 seryl-aminoacyl-tRNA synthetase 2181 706 3276 NM_020003 kidney predominant protein NCU-G1 2180 912 323 NM_009858 CD8 antigen beta chain 1 2174 1516 1813 NM_010376 histocompatibility 13 2172 1010 1852 NM_145353 Yip1 domain family member 3 2138 942 2455 NM_178600 vitamin K epoxide reductase complex subunit 1 2135 563 778 NM_010102 endothelial differentiation G-protein-coupled 2105 667 422 NM_021462 MAP kinase-interacting serine/threonine kinase 2099 220 2037 NM_146084 hypothetical protein LOC225358 2098 1018 1579 NM_011116 phospholipase D family member 3 2096 1304 2692 NM_011193 proline-serine-threonine phosphatase-interacting 2095 215 850 NM_029097 ATPase type 13A2 2092 947 1847 NM_029887 Yip1 interacting factor homolog B isoform 1 2091 522 1068 NM_022410 myosin heavy polypeptide 9, non-muscle isoform 2086 397 2386 NM_009720 antioxidant protein 1 2069 1416 2746 NM_010299 GM2 ganglioside activator protein 2067 52 191 NM_001042613 selenoprotein P precursor 2048 2646 1382 NM_001113486 septin 9 isoform a 2037 7 121 NM_001042605 CD74 antigen isoform 1 2025 785 227 NM_016894 receptor-activity modifying protein 1 isoform 1 2014 36002 2982 NM_021278 thymosin beta 4, X chromosome 1998 230 2035 NM_026269 hypothetical protein LOC67604 1994 287 796 NM_017476 A kinase PRKA anchor protein 8-like 1988 479 1891 NM_016666 aryl-hydrocarbon receptor-interacting protein 1975 1645 1615 NM_001017968 zinc finger DHHC domain containing 18 1959 193 1945 NM_026877 alveolar soft part sarcoma chromosome region 1958 838 1857 NM_007988 fatty acid synthase 1957 379 428 NM_133206 zinc and ring finger 1 1941 815 3464 NM_028617 hypothetical protein LOC73711 1937 2057 1671 NM_013541 glutathione S-transferase pi 1 1917 785 1672 NM_011189 proteasome prosome macropain 28 subunit, 1916 73 652 NM_146019 chromodomain helicase DNA binding protein 3 1904 196 667 NM_175362 caspase recruitment domain family member 11 1898 359 2965 NM_010331 GPI anchor attachment protein 1 1897 15951 2154 NM_011341 stromal cell derived factor 4 1885 1303 1081 NM_015805 ATPas class II, type 9B 1885 237 1427 NM_001110231 CUG triplet repeat RNA binding protein 2 1884 468 1364 NM_016671 interleukin 27 receptor alpha 1881 1699 1767 NM_018853 ribosomal protein large, P1 1874 3589 2460 NM_011296 ribosomal protein S18 1869 608 2089 NM_012002 COP9 signalosome subunit 6 1867 410 1161 NM_178939 p53 and DNA damage regulated 1 1866 756 2539 NM_019870 N-acetyltransferase ARD1 1864 727 2382 NM_001111066 FK506 binding protein 8 isoform a 1857 353 1226 NM_133224 ATPase type 13A1 1850 967 1540 NM_017461 septin 1 1850 122 1467 NM_172952 gephyrin 1846 5354 2285 NM_008155 glucose phosphate isomerase 1 1834 346 1014 NM_001042655 TBC1 domain family member 17 1827 4997 3274 NM_009084 ribosomal protein L37a 1814 859 1850 NM_177262 protein kinase N1 1805 275 860 NM_029679 hypothetical protein LOC193385 isoform 1 1792 1666 1061 NM_015742 myosin IXb 1791 674 1209 NM_028071 coactosin-like 1 1784 1489 2107 NM_025352 ubiquinol-cytochrome c reductase complex III 1780 3098 1647 NM_009798 capping protein actin filament muscle Z-line 1774 428 922 NM_001048060 gluconokinase-like protein isoform b 1764 394 1927 NM_175399 exosome component 4 1751 712 458 NM_001042491 anaphase-promoting complex subunit 5 isoform b 1749 612 763 NM_001038018 G protein-coupled receptor kinase 6 isoform a 1741 319 953 NM_019777 inhibitor of kappaB kinase epsilon 1740 1454 624 NM_130863 adrenergic receptor kinase beta 1 1736 465 989 NM_001038846 RCSD domain containing 1 isoform b 1729 3549 917 NM_019749 gamma-aminobutyric acid receptor associated 1717 265 446 NM_009059 ral guanine nucleotide dissociation 1711 1335 1965 NM_008258 hematological and neurological expressed 1710 544 1061 NM_011602 talin 1 1707 1108 1977 NM_021538 epsilon subunit of coatomer protein complex 1707 940 1017 NM_007517 ancient ubiquitous protein 1698 1177 3685 NM_153152 hypothetical protein LOC224904 1694 1034 1069 NM_009225 small nuclear ribonucleoprotein B 1690 2221 374 NM_001093754 DENN/MADD domain containing 2D isoform 2 1690 349 1886 NM_019391 lymphocyte specific 1 1690 1024 1163 NM_013566 integrin beta 7 1686 770 1004 NM_009703 v-raf murine sarcoma 3611 viral oncogene 1685 566 579 NM_023229 Fas-activated serine/threonine kinase 1680 766 562 NM_145554 low density lipoprotein receptor adaptor protein 1679 3846 1979 NM_008705 nucleoside-diphosphate kinase 2 1678 216 964 NM_212473 hypothetical protein LOC77938 1674 146 436 NM_025852 transcription elongation factor B polypeptide 3 1673 811 1108 NM_016745 ATPase Ca++ transporting, ubiquitous 1673 76 1812 NM_015786 histone cluster 1 H1c 1672 412 2201 NM_011843 membrane bound C2 domain containing protein 1666 1944 657 NM_025498 presenilin enhancer 2 homolog 1659 823 5630 NM_011777 zyxin 1657 1562 1474 NM_008160 glutathione peroxidase 1 1653 582 1560 NM_025842 vacuolar protein sorting 28 1648 674 1113 NM_007965 Ena-vasodilator stimulated phosphoprotein 1646 524 1546 NM_016921 T-cell immune regulator 1 1646 363 1000 NM_032543 ring finger protein 123 1644 6027 2218 NM_007438 aldolase 1 A isoform 1636 470 478 NM_001033126 tumor necrosis factor receptor superfamily 1628 572 1842 NM_025348 NADH-ubiquinone oxidoreductase B9 subunit 1626 228 2549 NM_026530 MPN domain containing 1624 541 1337 NM_011900 mannose-P-dolichol utilization defect 1 1624 318 1120 NM_001039520 dynamin 2 1615 52 1434 NM_008452 Kruppel-like factor 2 lung 1615 28 734 NM_010494 intercellular adhesion molecule 2 1597 504 1031 NM_153557 hypothetical protein LOC227622 1583 5043 1675 NM_033444 chloride intracellular channel 1 1567 216 528 NM_013630 polycystin 1 1565 2547 1661 NM_020600 ribosomal protein S14 1558 208 1056 NM_177568 phospholipase C beta 2 1555 284 1388 NM_026909 THAP domain containing 7 1553 176 1283 NM_007835 dynactin 1 1543 20051 1603 NM_025587 ribosomal protein S21 1543 549 1884 NM_178408 arrestin domain containing 1 1541 245 205 NM_011256 phosphatidylinositol transfer protein 1538 328 2756 NM_011290 ribosomal protein L6 1531 584 1245 NM_009923 2'3'-cyclic nucleotide 3' phosphodiesterase 1522 788 1023 NM_001077705 protein tyrosine phosphatase non-receptor type 1522 48 1059 NM_007828 death-associated kinase 3 1520 1462 1116 NM_019566 ras homolog gene family member G 1517 0 159 NM_009777 complement component 1 q subcomponent, B chain 1512 490 1013 NM_029391 RAB4B member RAS oncogene family 1504 529 913 NM_010764 mannosidase 2 alpha B1 1502 1172 1953 NM_007874 receptor accessory protein 5 1502 809 1966 NM_026790 hypothetical protein LOC52668 isoform 1 1501 295 1070 NM_133693 hypothetical protein LOC68035 1500 740 576 NM_146014 cerebral cavernous malformation 2 homolog 1497 1540 749 NM_008859 protein kinase C theta 1476 1202 815 NM_011886 secretory carrier membrane protein 3 1476 508 551 NM_026859 repressor of RNA polymerase III transcription 1473 1802 1358 NM_145410 hypothetical protein LOC214917 1472 4149 606 NM_016774 ATP synthase H+ transporting mitochondrial F1 1462 183 1588 NM_021319 peptidoglycan recognition protein 2 1461 374 1101 NM_011925 CD97 antigen 1459 880 1466 NM_029576 RAB1B member RAS oncogene family 1459 181 977 NM_013664 SH3-domain GRB2-like 1 1455 689 562 NM_001040403 flotillin 2 isoform 1 1447 397 1255 NM_021280 phospholipase C gamma 1 1439 1466 2131 NM_133831 glioma tumor suppressor candidate region gene 2 1439 699 902 NM_025898 N-ethylmaleimide sensitive fusion protein 1435 3510 2032 NM_013725 ribosomal protein S11 1434 304 736 NM_011306 retinoid X receptor beta 1424 31 677 NM_019420 UDP-Gal:betaGalNAc beta 1422 596 674 NM_011528 transaldolase 1 1421 2147 1159 NM_009976 cystatin C 1419 432 1200 NM_178650 TBC1 domain family member 10c 1410 11687 2183 NM_007907 eukaryotic translation elongation factor 2 1407 2568 1928 NM_001083891 NADH-ubiquinone oxidoreductase flavoprotein 3 1407 1834 1094 NM_146093 2B28 1407 147 937 NM_181452 mammary tumor virus receptor 2 isoform 1 1399 376 1561 NM_023547 zinc finger HIT type 4 1398 988 527 NM_029999 limb-bud and heart 1387 2397 1780 NM_007475 acidic ribosomal phosphoprotein P0 1385 433 739 NM_011201 protein tyrosine phosphatase non-receptor type 1384 248 1229 NM_027278 hypothetical protein LOC69961 1383 313 438 NM_010551 interleukin 16 1373 1051 611 NM_146011 Rho GTPase activating protein 9 1369 198 1278 NM_153088 CTD carboxy-terminal domain RNA polymerase II, 1356 334 1286 NM_146226 acylpeptide hydrolase 1354 517 836 NM_009737 branched chain aminotransferase 2 1349 746 2166 NM_001033175 ceroid-lipofuscinosis neuronal 6 1347 74 108 NM_138956 Ras association RalGDS/AF-6 domain family 3 1344 333 1284 NM_020007 muscleblind-like 1 1343 623 1064 NM_026638 CDP-diacylglycerol--inositol 1343 529 882 NM_178785 hypothetical protein LOC320484 1342 508 1723 NM_025795 non-SMC condensin II complex subunit H2 1339 929 500 NM_144937 ubiquitin specific peptidase 3 1332 2023 973 NM_008162 glutathione peroxidase 4 isoform 2 precursor 1329 663 1258 NM_145156 solute carrier family 25 member 28 1324 116 527 NM_011906 G protein-coupled receptor 175 1323 1866 1269 NM_009279 signal sequence receptor delta 1320 127 2659 NM_025599 hypothetical protein LOC66497 1320 1804 755 NM_033617 ATPase H+ transporting, lysosomal V0 subunit B 1319 1170 1125 NM_023312 NADH dehydrogenase ubiquinone 1 alpha 1317 785 595 NM_009284 signal transducer and activator of transcription 1315 169 552 NM_178900 protein kinase D2 1313 2629 1137 NM_029711 actin related protein 2/3 complex subunit 2 1313 332 1260 NM_028427 transmembrane protein 192 1310 47 1264 NM_013481 block of proliferation 1 1308 1051 853 NM_010173 fatty acid amide hydrolase 1305 126 701 NM_009207 solute carrier family 4 anion exchanger 1302 186 164 NM_013811 dynein axonemal, heavy chain 8 1299 254 592 NM_026391 protein phosphatase 2A regulatory subunit B, 1298 23 210 NM_011662 TYRO protein tyrosine kinase binding protein 1297 205 1698 NM_153599 cyclin-dependent kinase 8 1294 376 749 NM_013850 ATP-binding cassette sub-family A, member 7 1292 237 1072 NM_025650 ubiquinol-cytochrome c reductase subunit 1289 780 1853 NM_138748 protein phosphatase 2A regulatory subunit B PR 1273 43 1551 NM_026871 histidine triad nucleotide binding protein 2 1258 725 977 NM_028312 coiled-coil domain containing 12 1251 913 793 NM_026325 transmembrane protein 179B 1243 4031 2120 NM_023168 glutamate receptor ionotropic, N-methyl 1242 55 1708 NM_029763 polymerase RNA III (DNA directed) polypeptide 1240 277 813 NM_008279 mitogen-activated protein kinase kinase kinase 1239 1849 1664 NM_178598 transgelin 2 1239 1501 614 NM_001113560 glyoxalase 1 1236 1513 1342 NM_009539 zeta-chain TCR associated protein kinase 1235 630 552 NM_197980 COX19 cytochrome c oxidase assembly homolog 1232 237 804 NM_001025608 putative MAPK activating protein PM20PM21 1231 776 549 NM_011951 mitogen-activated protein kinase 14 1229 570 195 NM_017367 cyclin I 1228 692 1325 NM_001007571 hypothetical protein LOC101966 1227 362 498 NM_033072 methyl-CpG binding domain protein 6 1226 780 858 NM_018742 golgi SNARE 15 kD 1226 602 531 NM_178690 RAB3 GTPase activating protein subunit 1 1222 254 306 NM_013595 methyl-CpG binding domain protein 3 1218 904 327 NM_008014 protein phosphatase 1G formerly 2C 1217 6490 1143 NM_025628 cytochrome c oxidase subunit VIb polypeptide 1 1217 511 1291 NM_147151 euchromatic histone lysine N-methyltransferase 2 1217 527 599 NM_019828 transient receptor potential cation channel 1210 303 895 NM_025567 cytochrome c-1 1205 79 548 NM_012030 solute carrier family 9 sodium/hydrogen 1201 591 1338 NM_027231 DNA directed RNA polymerase II polypeptide F 1200 308 1025 NM_198020 TRM1 tRNA methyltransferase 1 homolog 1196 401 1205 NM_013604 metaxin 1 1195 94 204 NM_001033320 RGD motif leucine rich repeats, tropomodulin 1194 191 1343 NM_025337 aldo-keto reductase family 7 member A5 1192 299 375 NM_001003949 membralin 1179 458 747 NM_016860 ARP1 actin-related protein 1 homolog A 1178 1052 902 NM_009499 vasodilator-stimulated phosphoprotein 1177 247 902 NM_172281 ring finger protein 40 1173 200 177 NM_026988 parathymosin 1172 103 1571 NM_153168 leucyl-tRNA synthetase mitochondrial 1170 1977 1299 NM_030207 Sfi1 homolog spindle assembly associated 1166 1457 483 NM_013785 inositol hexaphosphate kinase 1 1164 3812 1067 NM_010589 Janus kinase 3 1164 1640 1105 NM_028715 FCH domain only 1 1155 1910 575 NM_011588 tripartite motif protein 28 1155 1306 434 NM_145422 hypothetical protein LOC28088 1152 706 749 NM_009045 v-rel reticuloendotheliosis viral oncogene 1150 241 1097 NM_139302 SH3-domain GRB2-like endophilin B2 1148 401 627 NM_001039086 Rap guanine nucleotide exchange factor GEF 1 1148 569 1068 NM_013520 FMS-like tyrosine kinase 3 ligand 1148 142 570 NM_001079883 B-cell leukemia/lymphoma 11B isoform a 1143 624 981 NM_199306 WD and tetratricopeptide repeats 1 1142 445 596 NM_133691 poly-U binding splicing factor 60 isoform b 1142 144 644 NM_027318 zinc finger HIT domain containing 1 1141 1049 914 NM_015735 damage specific DNA binding protein 1 1141 561 456 NM_007840 DEAD Asp-Glu-Ala-Asp box polypeptide 5 1140 2273 601 NM_025618 sorcin isoform 2 1137 973 752 NM_153505 NCK associated protein 1 like 1134 2155 838 NM_026669 testis enhanced gene transcript 1131 205 728 NM_145488 peroxisomal biogenesis factor 6 1123 700 661 NM_030205 coronin 7 1120 3574 981 NM_001037877 nuclear localized protein 1 isoform a 1119 1840 505 NM_022656 nischarin 1119 359 798 NM_011637 three prime repair exonuclease 1 1117 4904 277 NM_011179 prosaposin 1117 471 1084 NM_021327 TNFAIP3 interacting protein 1 1114 1235 764 NM_024460 hypothetical protein LOC67695 1113 97 1452 NM_138586 exosome component 5 1113 914 612 NM_057171 HLA-B-associated transcript 3 1106 317 919 NM_134002 casein kinase 1 gamma 2 1101 384 521 NM_010517 insulin-like growth factor binding protein 4 1099 875 1031 NM_011503 syntaxin binding protein 2 1099 970 880 NM_023126 cell line NK14 derived transforming oncogene 1098 186 1058 NM_026828 hypothetical protein LOC52838 1092 1291 1374 NM_023260 mitochondrial ribosomal protein S34 1091 183 1326 NM_145396 transducin beta-like 3 1080 429 1013 NM_145760 ADP-ribosylation factor GTPase activating 1079 1067 766 NM_025299 thioredoxin-like 4 isoform a 1078 391 1075 NM_019705 RanBP-type and C3HC4-type zinc finger containing 1077 570 1115 NM_017366 acyl-Coenzyme A dehydrogenase very long chain 1076 33 1035 NM_153775 hypothetical protein LOC66965 1073 101 563 NM_027323 SRR1 domain containing 1070 16349 1568 NM_011297 ribosomal protein S24 isoform 1 1070 329 730 NM_010772 MYC-associated zinc finger protein 1065 436 995 NM_008595 O-fucosylpeptide 1063 801 668 NM_015816 LSM4 homolog U6 small nuclear RNA associated 1061 1042 906 NM_013585 proteosome prosome macropain subunit, beta 1061 263 428 NM_153585 CCR4-NOT transcription complex subunit 10 1053 556 365 NM_010240 ferritin light chain 1 1052 771 440 NM_026780 SYF2 homolog RNA splicing factor 1048 445 479 NM_001037801 CD6 antigen isoform 1 1044 1058 279 NM_011715 WD repeat domain 1 1039 227 790 NM_026156 XPA binding protein 2 1038 348 787 NM_019757 Fzr1 protein 1038 118 1237 NM_146131 pre-B-cell leukemia transcription factor 1035 263 769 NM_010238 bromodomain containing 2 isoform a 1025 418 1681 NM_019722 ADP-ribosylation factor-like 2 1024 1154 830 NM_174990 GTPase IMAP family member 4 isoform a 1022 150 217 NM_010122 eukaryotic translation initiation factor 2B 1021 285 2982 NM_009829 cyclin D2 1020 171 274 NM_011682 utrophin 1019 452 562 NM_011829 inosine 5'-phosphate dehydrogenase 1 1018 132 851 NM_022419 abhydrolase domain containing 8 1014 532 743 NM_019519 Rab geranylgeranyl transferase a subunit 1011 336 723 NM_134044 hypothetical protein LOC104799 1008 1051 1098 NM_133708 GDP-mannose pyrophosphorylase A 1007 312 407 NM_011710 tryptophanyl-tRNA synthetase 1004 520 724 NM_026308 ribonuclease P 21kDa subunit 1003 2400 391 NM_001008700 interleukin 4 receptor alpha 1003 662 1248 NM_001081635 cyclin D3 1001 1283 2769 NM_007599 gelsolin-like capping protein 999 255 755 NM_145416 KRI1 homolog 996 102 289 NM_001077359 G protein-coupled receptor kinase-interactor 2 995 276 652 NM_026757 hypothetical protein LOC104457 995 157 194 NM_009213 sphingomyelin phosphodiesterase 2 neutral 994 71 2009 NM_009272 spermidine synthase 991 182 282 NM_144551 tribbles homolog 2 988 569 478 NM_172395 CDC42 small effector 1 986 377 1166 NM_198027 alkB alkylation repair homolog 6 984 159 468 NM_178246 Est1p-like protein B 983 26 172 NM_026856 zinc finger motif enhancer binding protein 2 979 771 440 NM_177994 hypothetical protein LOC109284 976 256 800 NM_194346 ring finger protein 31 975 102 1663 NM_011633 Tnf receptor-associated factor 5 974 677 1901 NM_009091 ribosomal protein S15 974 858 320 NM_017462 polymerase DNA directed gamma 974 139 455 NM_001025589 regulatory factor X-associated 970 4299 1603 NM_025974 ribosomal protein L14 970 571 571 NM_001013811 hypothetical protein LOC434197 969 374 189 NM_020286 tetraspanin 32 966 247 508 NM_053193 cleavage and polyadenylation specific factor 1 964 214 752 NM_194348 ATG2 autophagy related 2 homolog A 962 139 258 NM_024457 RAS related protein 1b 959 10608 1238 NM_009112 S100 calcium binding protein A10 959 615 991 NM_010598 potassium voltage-gated channel shaker-related 959 723 727 NM_178440 myosin IG 956 44 35 NM_028469 hypothetical protein LOC73212 953 18219 937 NM_026147 ribosomal protein S20 949 665 1530 NM_008842 proviral integration site 1 948 641 585 NM_198899 UDP-glucose ceramide glucosyltransferase-like 1 944 212 555 NM_026664 vacuolar protein sorting 53 940 1813 628 NM_009057 recombination activating gene 1 activating 940 199 361 NM_027889 vacuolar protein sorting 11 937 10821 1080 NM_025327 keratinocyte associated protein 2 935 555 1449 NM_026767 dolichyl-phosphate mannosyltransferase 932 337 863 NM_013818 GTP binding protein 1 927 989 511 NM_012060 B-cell receptor-associated protein 31 926 144 815 NM_134149 basophilic leukemia expressed protein 924 954 495 NM_144897 apolipoprotein A-I binding protein 921 4659 664 NM_008019 FK506 binding protein 1a 920 8923 453 NM_011655 tubulin beta 5 916 117 369 NM_053202 forkhead box P1 914 312 384 NM_172457 MOB1 Mps One Binder kinase activator-like 2A 913 406 760 NM_033374 dedicator of cyto-kinesis 2 913 237 408 NM_025659 ABI gene family member 3 911 325 774 NM_025317 mitochondrial ribosomal protein L54 911 161 827 NM_148934 hypothetical protein LOC110012 905 379 530 NM_130882 cytochrome P450 family 4, subfamily f, 903 1383 844 NM_008323 isocitrate dehydrogenase 3 NAD+ gamma 901 1088 838 NM_019913 thioredoxin 2 900 440 420 NM_172619 a disintegrin-like and metalloprotease 899 136 622 NM_145939 alpha-13-mannosyltransferase ALG3 897 342 354 NM_174960 GTPase IMAP family member 9 896 760 366 NM_001102405 acid phosphatase 5 tartrate resistant 896 316 646 NM_013852 ATP-binding cassette sub-family F GCN20, 895 4235 409 NM_133668 solute carrier family 25 mitochondrial carrier 892 346 679 NM_019575 secretory carrier membrane protein 4 892 267 245 NM_001112701 pleckstrin homology Sec7 and coiled/coil 891 96 670 NM_178698 phosphatidylinositol glycan class V 890 630 1423 NM_008144 seipin 886 1253 574 NM_007879 developmentally regulated GTP binding protein 1 886 605 844 NM_001037913 hypothetical protein LOC622404 886 167 423 NM_139154 Rab40c member RAS oncogene family 876 389 1540 NM_007931 endonuclease G 875 174 557 NM_133952 smooth muscle cell associated protein-1 874 134 360 NM_199299 PHD finger protein 15 869 368 457 NM_172132 jumonji domain containing 2B 866 1510 1449 NM_010386 histocompatibility 2 class II, locus DMa 865 1284 975 NM_009388 transketolase 865 385 315 NM_029098 limb region 1 like 861 351 1142 NM_133978 CKLF-like MARVEL transmembrane domain containing 859 341 617 NM_028754 hypothetical protein LOC74098 858 338 682 NM_153551 DENN/MADD domain containing 1C 858 2074 580 NM_007505 ATP synthase H+ transporting, mitochondrial F1 858 326 255 NM_007668 cyclin-dependent kinase 5 857 749 402 NM_001042634 CDC-like kinase 1 isoform 1 854 974 1684 NM_009795 calpain small subunit 1 853 4181 1159 NM_029767 ribosomal protein S9-like 853 534 825 NM_025575 SYS1 Golgi-localized integral membrane protein 853 334 304 NM_175836 spectrin beta 2 isoform 1 849 944 722 NM_153795 UNC-112 related protein 2 839 342 962 NM_001113345 p66 alpha isoform b 838 277 1031 NM_144893 solute carrier family 35 member C2 837 217 613 NM_017393 caseinolytic protease ATP-dependent, 836 2799 997 NM_013563 interleukin 2 receptor gamma chain 836 296 773 NM_153680 sorting nexin 17 836 395 610 NM_021713 melanocyte proliferating gene 1 836 322 472 NM_007570 B-cell translocation gene 2 anti-proliferative 835 3130 1240 NM_018851 SAM domain- and HD domain-containing protein 1 835 2648 736 NM_001001892 histocompatibility 2 K1, K region isoform 1 835 244 445 NM_016813 nuclear RNA export factor 1 835 1091 427 NM_152808 solute carrier family 44 member 2 835 322 143 NM_001109909 arsenate resistance protein 2 isoform 2 831 201 354 NM_145557 hypothetical protein LOC230996 827 159 263 NM_198602 cut-like homeobox 1 isoform b 826 801 389 NM_172257 SID1 transmembrane family member 2 826 537 471 NM_015731 ATPase class II, type 9A 825 252 626 NM_172620 vacuolar protein sorting 52 822 537 445 NM_009510 villin 2 822 211 490 NM_001081654 testis expressed gene 264 821 1654 542 NM_019817 coatomer protein complex subunit zeta 1 820 171 347 NM_001113408 LIM domain binding 1 isoform 1 819 240 662 NM_177333 exocyst complex component 3 819 381 312 NM_026160 microtubule-associated protein 1 light chain 3 817 76 771 NM_019436 SHP2-interacting transmembrane adaptor protein 817 114 8 NM_207231 ADP-ribosylation-like factor 12 protein 816 1558 367 NM_028292 protein phosphatase methylesterase 1 815 442 594 NM_025830 WW domain containing E3 ubiquitin protein ligase 814 143 253 NM_145361 BTB POZ domain containing 2 812 763 506 NM_001038642 E26 avian leukemia oncogene 1 5' domain isoform 812 239 846 NM_031201 tissue specific transplantation antigen P35B 811 410 1753 NM_031393 synaptotagmin-like 1 811 88 516 NM_019763 SPEN homolog transcriptional regulator 811 733 421 NM_028308 ovary-specific MOB-like protein 805 538 485 NM_207677 death effector domain-containing DNA binding 803 112 468 NM_021344 tescalcin 800 62 229 NM_011242 RAS guanyl releasing protein 2 795 237 585 NM_146211 glycosyltransferase 25 domain containing 1 794 767 613 NM_023719 thioredoxin interacting protein isoform 2 792 906 435 NM_026609 leptin receptor overlapping transcript-like 1 789 229 286 NM_010925 novel nuclear protein 1 789 84 409 NM_001033337 hypothetical protein LOC239570 789 30 65 NM_010752 mitotic arrest deficient 1-like 1 788 654 522 NM_025559 hypothetical protein LOC103742 787 1251 540 NM_007651 CD53 antigen 786 312 1294 NM_177081 protein tyrosine phosphatase non-receptor type 786 829 256 NM_008562 myeloid cell leukemia sequence 1 786 23 429 NM_133962 rho/rac guanine nucleotide exchange factor GEF 785 465 447 NM_025667 hypothetical protein LOC52174 783 459 294 NM_175102 splicing factor 3b subunit 5 782 526 303 NM_153137 TRAF3-interacting JNK-activating modulator 781 1282 854 NM_016906 Sec61 alpha subunit homolog 780 1633 562 NM_001008705 maternal G10 transcript 780 59 649 NM_146216 Vac14 homolog 779 1052 491 NM_170755 hypothetical protein LOC227298 779 76 324 NM_022418 transmembrane and ubiquitin-like domain 775 354 1032 NM_011815 FYN binding protein 772 1025 679 NM_001025571 SH2 domain protein 2A isoform 2 772 384 277 NM_026861 phosphoglycerate dehydrogenase like 1 768 247 622 NM_028291 PABP-dependent polyA nuclease 3 766 563 991 NM_019762 plakophilin 3 766 579 597 NM_001005331 eukaryotic translation initiation factor 4 766 714 415 NM_027911 Raver1 765 1051 435 NM_028773 hypothetical protein LOC74131 764 1934 1310 NM_011206 protein tyrosine phosphatase non-receptor type 764 290 446 NM_033526 ubiquilin 4 763 2842 1022 NM_146167 GTPase IMAP family member 7 762 486 377 NM_080289 glyoxylate reductase/hydroxypyruvate reductase 761 3856 615 NM_010860 myosin light polypeptide 6, alkali, smooth 761 243 369 NM_028993 hypothetical protein LOC74549 761 109 455 NM_001079694 splicing factor arginine/serine-rich 5 758 420 205 NM_178622 RIKEN cDNA 2400003N08 757 299 430 NM_001013414 hypothetical protein LOC216860 756 988 1002 NM_025313 ATP synthase H+ transporting, mitochondrial F1 753 145 1672 NM_013658 sema domain immunoglobulin domain Ig, 753 262 315 NM_001083334 bridging integrator 1 isoform 2 751 83 546 NM_026526 N-6 adenine-specific DNA methyltransferase 2 750 393 886 NM_025529 nudix-type motif 8 750 210 806 NM_026538 nucleolar RNA helicase homolog 748 681 579 NM_010908 nuclear factor of kappa light chain gene 746 675 691 NM_145537 putative alpha-mannosidase 745 1428 442 NM_133937 hypothetical protein LOC101314 744 2253 211 NM_007798 cathepsin B preproprotein 744 470 1004 NM_172261 protein phosphatase 1 regulatory subunit 9B 742 308 574 NM_013673 nuclear antigen Sp100 742 80 364 NM_001081962 mSin3A-binding protein 737 143 134 NM_001025599 tripartite motif protein 26 isoform a 736 970 545 NM_022305 UDP-Gal:betaGlcNAc beta 14- 733 388 517 NM_008850 phosphatidylinositol transfer protein alpha 732 343 452 NM_023464 Sjogren's syndrome nuclear autoantigen 1 731 314 615 NM_007383 acyl-Coenzyme A dehydrogenase short chain 729 1624 612 NM_022993 low-density lipoprotein receptor-related protein 729 398 536 NM_008948 proteasome prosome macropain 26S subunit, 728 212 617 NM_153820 Rho GTPase activating protein 15 isoform 1 725 4236 744 NM_011291 ribosomal protein L7 725 1405 192 NM_025347 yippee-like 3 725 82 677 NM_024210 hypothetical protein LOC67862 723 258 464 NM_016881 phosphomannomutase 2 720 300 377 NM_001080388 MAP/microtubule affinity-regulating kinase 2 717 285 830 NM_080469 prion protein interacting protein 1 716 311 804 NM_015740 biogenesis of lysosome-related organelles 716 147 541 NM_019652 arsA bacterial arsenite transporter 715 558 853 NM_028601 zinc finger MIZ-type containing 2 isoform 1 715 117 298 NM_025604 proteasome prosome macropain assembly 714 163 831 NM_197979 ubiquinol-cytochrome c reductase complex 713 197 859 NM_025340 SHANK-associated RH domain interacting protein 710 173 377 NM_027320 interferon-induced protein 35 709 41 949 NM_008929 DnaJ Hsp40 homolog subfamily C, member 3B 708 75 281 NM_001032378 platelet/endothelial cell adhesion molecule 1 707 173 372 NM_026015 zinc finger matrin type 5 706 194 779 NM_001110795 adaptor protein complex AP-1 gamma 2 subunit 703 359 481 NM_133973 component of oligomeric golgi complex 4 702 1168 365 NM_013536 EMG1 nucleolar protein homolog 702 156 371 NM_145421 hypothetical protein LOC216169 702 351 370 NM_015782 small nuclear ribonucleoprotein polypeptide A 701 4183 573 NM_007899 extracellular matrix protein 1 701 122 199 NM_027901 general transcription factor IIIC polypeptide 699 105 529 NM_029865 occludin/ELL domain containing 1 698 169 550 NM_022012 mitogen-activated protein kinase kinase kinase 697 119 632 NM_172624 dipeptidylpeptidase 9 697 37 451 NM_133879 GLI-Kruppel family member HKR3 696 300 821 NM_026844 hypothetical protein LOC66531 696 341 649 NM_021549 polynucleotide kinase 3'- phosphatase 695 4260 435 NM_022024 glia maturation factor gamma isoform 1 695 356 376 NM_026124 RAB5-interacting protein 694 161 779 NM_145122 peroxisome biogenesis factor 16 694 611 153 NM_013502 C-terminal binding protein 1 694 147 270 NM_172293 hypothetical protein LOC239647 694 1200 463 NM_026686 hypothetical protein LOC68347 694 589 601 NM_001110193 inositol polyphosphate-5-phosphatase D isoform 694 119 622 NM_027129 hypothetical protein LOC69596 692 536 460 NM_011706 transient receptor potential cation channel 692 236 141 NM_013559 heat shock protein 105 691 349 485 NM_027829 hypothetical protein LOC71564 689 1472 227 NM_139200 pleckstrin homology Sec7 and coiled-coil 689 181 335 NM_007948 excision repair cross-complementing rodent 686 338 856 NM_001102565 alkB alkylation repair homolog 1 686 73 515 NM_021304 abhydrolase domain containing 1 685 730 609 NM_008494 lunatic fringe gene homolog 685 126 477 NM_175356 phosphatidylinositol 4-kinase catalytic, beta 685 77 116 NM_178751 transmembrane protein 142B 684 154 533 NM_024227 mitochondrial ribosomal protein L28 683 32 49 NM_134156 actinin alpha 1 680 94 753 NM_027980 Fanconi anemia core complex 100 kDa subunit 680 273 301 NM_025844 cysteine and histidine-rich domain 679 165 159 NM_175511 hypothetical protein LOC241303 678 124 299 NM_029929 vacuolar sorting protein 33a 676 313 747 NM_010071 docking protein 2 676 360 165 NM_023343 integrin-linked kinase-associated 674 314 496 NM_011971 proteasome beta 3 subunit 672 2148 175 NM_011157 serglycin 670 302 307 NM_011543 S-phase kinase-associated protein 1A 670 152 415 NM_015747 solute carrier family 20 member 1 669 398 118 NM_027308 hypothetical protein LOC70080 667 203 489 NM_029377 lin-37 homolog 667 103 215 NM_019639 ubiquitin C 666 142 399 NM_028636 mannosidase alpha, class 2C, member 1 665 148 347 NM_198305 actinfilin 665 197 126 NM_011424 nuclear receptor co-repressor 2 665 0 93 NM_007574 complement component 1 q subcomponent, C chain 664 379 251 NM_001033405 triggering receptor expressed on myeloid 664 159 378 NM_153583 APG4-D protein 663 369 252 NM_028816 exportin 6 662 373 831 NM_019824 actin related protein 2/3 complex subunit 3 662 152 447 NM_030238 dynein cytoplasmic, heavy chain 1 660 761 387 NM_010499 immediate early response 2 660 412 292 NM_133998 hypothetical protein LOC108707 659 1100 366 NM_025284 thymosin beta 10 659 116 389 NM_133986 T-cell leukemia translocation altered 658 789 446 NM_009443 trans-golgi network protein 658 243 195 NM_013508 ELK3 member of ETS oncogene family isoform a 657 414 412 NM_029012 signal peptide peptidase 3 656 770 670 NM_011570 testis derived transcript isoform 1 656 334 624 NM_001002895 hypothetical protein LOC106672 655 56 661 NM_008296 heat shock factor 1 654 313 281 NM_176850 bromodomain PHD finger transcription factor 653 156 558 NM_133768 argininosuccinate lyase 653 36 53 NM_010382 histocompatibility 2 class II antigen E beta 652 87 216 NM_001037755 brain-specific angiogenesis inhibitor 650 209 233 NM_015749 transcobalamin 2 649 3488 402 NM_008410 integral membrane protein 2B 648 176 621 NM_009797 F-actin capping protein alpha-1 subunit 647 29 875 NM_016850 interferon regulatory factor 7 647 810 537 NM_027352 golgi reassembly stacking protein 2 647 814 217 NM_053014 1-acylglycerol-3-phosphate O-acyltransferase 3 645 128 562 NM_013651 splicing factor 3a subunit 2 644 93 786 NM_134147 LRP16 protein 644 360 280 NM_028868 CXXC finger 1 PHD domain 643 322 350 NM_010219 FK506 binding protein 4 640 380 549 NM_021548 cAMP-regulated phosphoprotein 19 640 111 136 NM_078477 Kruppel-like factor 16 639 120 473 NM_133779 phosphatidylinositol glycan class T 639 786 666 NM_025542 hypothetical protein LOC66404 639 213 463 NM_025305 mitchondrial ribosomal protein S7 639 139 143 NM_024454 RAB21 member RAS oncogene family 638 344 347 NM_008390 interferon regulatory factor 1 637 685 2995 NM_011690 valyl-tRNA synthetase 637 442 219 NM_013477 ATPase H+ transporting, V0 subunit D isoform 1 636 923 370 NM_025533 nitric oxide synthase interacting protein 636 166 178 NM_027840 selectin ligand interactor cytoplasmic-1 633 531 429 NM_011752 zinc finger protein 259 632 1748 440 NM_130884 isocitrate dehydrogenase 3 beta subunit 632 952 606 NM_001035854 adaptor-related protein complex 2 beta 1 631 113 285 NM_009459 ubiquitin-conjugating enzyme E2H 629 186 847 NM_207220 G protein-coupled receptor 137 628 377 316 NM_146145 Janus kinase 1 628 97 520 NM_013859 zinc finger HIT domain containing 2 626 468 1092 NM_024281 ribosome binding protein 1 isoform a 626 28 1080 NM_153419 glutamate-rich WD repeat containing 1 626 175 102 NM_030037 motile sperm domain containing 3 622 201 796 NM_177041 FAD-synthetase 622 411 483 NM_011586 myosin XVIIIa 622 317 264 NM_173048 golgi associated gamma adaptin ear containing, 621 217 422 NM_028864 zinc finger CCCH type antiviral 1 620 200 334 NM_016658 galactose-1-phosphate uridyl transferase 618 220 378 NM_001077364 glucocorticoid-induced leucine zipper isoform 1 617 298 607 NM_146164 leucine rich repeat protein 4 neuronal 617 277 306 NM_007521 BTB and CNC homology 2 isoform 2 615 216 780 NM_013610 ninjurin 1 615 296 352 NM_145482 SET domain containing 4 615 251 277 NM_001013378 ubiquitin specific peptidase like 1 615 211 210 NM_170760 U2 small nuclear RNA auxiliary factor 1-like 4 615 163 647 NM_001081291 coiled-coil domain containing 88B 614 284 257 NM_008916 putative phosphatase 613 17 876 NM_009854 CD7 antigen 613 84 629 NM_008992 ATP-binding cassette sub-family D, member 4 609 254 425 NM_001081043 protein tyrosine phosphatase non-receptor type 609 88 79 NM_172726 hypothetical protein LOC231868 608 299 975 NM_198095 DAMP-1 protein 608 138 828 NM_198026 IQ motif containing C 608 145 276 NM_001110826 DEAD Asp-Glu-Ala-Asp box polypeptide 6 608 85 171 NM_025695 SMC6 protein 608 95 595 NM_011876 twinfilin-like protein 607 809 349 NM_178688 actin-binding LIM protein 1 isoform 1 607 636 400 NM_001083807 RUN and SH3 domain containing 1 isoform 2 606 402 324 NM_011678 ubiquitin specific protease 4 proto-oncogene 605 356 185 NM_028661 hypothetical protein LOC73833 604 851 419 NM_025448 signal sequence receptor beta 604 290 501 NM_172584 inositol 13,4-triphosphate 5/6 kinase 604 362 334 NM_145527 MAP-kinase activating death domain 603 357 396 NM_027185 differentially expressed in FDCP 6 603 341 322 NM_144522 TBC1 domain family member 10b 602 161 237 NM_145828 xylosyltransferase II 601 1256 493 NM_007531 B-cell receptor-associated protein 37 600 77 234 NM_010703 lymphoid enhancer binding factor 1 600 1277 466 NM_018799 eukaryotic translation initiation factor 3 600 216 422 NM_146152 importin 13 599 899 272 NM_001080384 clathrin light polypeptide Lca isoform a 599 240 457 NM_147201 nuclear receptor binding protein 598 3247 678 NM_011149 peptidylprolyl isomerase B 598 545 646 NM_025814 SERPINE1 mRNA binding protein 1 isoform 1 596 106 232 NM_008845 phosphatidylinositol-4-phosphate 5-kinase type 596 85 182 NM_028194 furry homolog-like isoform 1 596 82 167 NM_023712 spinster 595 230 746 NM_009907 ceroid-lipofuscinosis neuronal 3 595 485 392 NM_025411 thioredoxin family Trp26 592 1123 921 NM_009304 synaptogyrin 2 592 288 546 NM_010398 histocompatibility 2 T region locus 23 592 375 282 NM_023799 meningioma expressed antigen 5 hyaluronidase 592 239 539 NM_213733 aminopeptidase-like 1 591 324 415 NM_032465 CD96 antigen 591 57 489 NM_023060 eukaryotic elongation factor 590 251 355 NM_001110329 Flt3 interacting zinc finger protein 1 590 0 39 NM_007572 complement component 1 q subcomponent, A chain 589 1185 545 NM_026353 hypothetical protein LOC67739 588 1043 531 NM_025417 COMM domain containing 4 588 228 1085 NM_028195 cytohesin 4 587 683 614 NM_177158 hypothetical protein LOC320435 587 353 221 NM_145382 hypothetical protein LOC212483 585 923 347 NM_030109 splicing factor 3b subunit 2 585 458 267 NM_001040187 DEAD box polypeptide 17 isoform 4 585 305 250 NM_028070 alkB alkylation repair homolog 4 584 231 53 NM_011346 selectin lymphocyte 584 403 630 NM_016721 IQ motif containing GTPase activating protein 1 584 285 149 NM_009331 transcription factor 7 T-cell specific 584 116 66 NM_172990 pantothenate kinase 4 583 688 408 NM_008112 guanosine diphosphate GDP dissociation 583 97 421 NM_027877 MUS81 endonuclease 583 139 243 NM_009565 zinc finger and BTB domain containing 7B 582 287 297 NM_011418 SWI/SNF related matrix associated, actin 581 216 520 NM_011304 RuvB-like protein 2 580 412 467 NM_146129 phosphorylated CTD interacting factor PCIF1 580 70 304 NM_201256 eukaryotic translation initiation factor 4E 580 25 167 NM_172551 mitochondrial DNA-directed RNA polymerase 579 183 356 NM_177294 RNA polymerase II associated protein 1 578 505 542 NM_019880 mitochondrial carrier homolog 1 578 162 387 NM_008136 guanine nucleotide binding protein related 577 148 333 NM_144894 zinc finger CCCH-type with G patch domain 576 472 442 NM_172502 hypothetical protein LOC212123 575 215 670 NM_177185 hypothetical protein LOC320538 574 951 291 NM_021789 trafficking protein particle complex 4 572 108 136 NM_145853 two pore channel 1 571 239 414 NM_009297 suppressor of Ty 6 homolog 571 128 149 NM_172664 tousled-like kinase 1 570 285 535 NM_029832 hypothetical protein LOC77006 570 349 157 NM_009025 RAS p21 protein activator 3 569 411 350 NM_172116 Parkinson disease 7 domain containing 1 569 314 218 NM_008394 interferon regulatory factor 9 568 606 669 NM_013765 ribosomal protein S26 568 925 307 NM_153781 brain glycogen phosphorylase 568 297 334 NM_025554 polymerase RNA II (DNA directed) polypeptide 568 160 197 NM_025514 hypothetical protein LOC52717 568 544 788 NM_026305 transcription elongation factor B SIII 568 47 136 NM_033541 2'-5' oligoadenylate synthetase 1C 567 284 513 NM_009024 retinoic acid receptor alpha 566 55 414 NM_001001738 hypothetical protein LOC414801 562 44 507 NM_170759 zinc finger protein 628 560 119 384 NM_178764 hypothetical protein LOC319604 559 2094 205 NM_019572 histone deacetylase 7A 559 854 103 NM_027514 poliovirus receptor 559 253 391 NM_007896 microtubule-associated protein RP/EB family, 556 1984 409 NM_010583 IL2-inducible T-cell kinase 556 554 405 NM_007523 BCL2-antagonist/killer 1 556 557 217 NM_010684 lysosomal membrane glycoprotein 1 556 63 127 NM_001083912 common-site lymphoma/leukemia guanine nucleotide 555 660 310 NM_024456 RAB5C member RAS oncogene family 555 44 585 NM_080793 SET domain-containing protein 7 553 711 614 NM_013721 ribosomal protein L7a 553 152 113 NM_028862 ring finger protein 145 551 199 414 NM_033568 EAP30 subunit of ELL complex 550 215 646 NM_025701 trafficking protein particle complex 5 549 502 489 NM_021608 dynactin 5 546 546 223 NM_126165 vacuolar protein sorting 4a 546 239 276 NM_010817 proteasome prosome macropain 26S subunit, 545 254 566 NM_145404 protein arginine N-methyltransferase 7 545 442 258 NM_026977 hypothetical protein LOC69171 545 106 475 NM_173013 microtubule-associated protein 1S 545 226 427 NM_016781 AMP-activated protein kinase noncatalytic 545 228 405 NM_029983 modulator of antigen receptor signaling MARS 544 250 232 NM_001076554 spectrin alpha 2 544 202 209 NM_145465 serine/threonine protein kinase 24 543 2202 355 NM_008302 heat shock protein 1 beta 543 692 191 NM_009006 mitogen-activated protein kinase kinase kinase 543 283 248 NM_178627 DNA polymerase delta interacting protein 3 542 1037 410 NM_023172 NADH dehydrogenase ubiquinone 1 beta 542 223 274 NM_027815 hypothetical protein LOC71517 541 182 374 NM_026824 PP3111 protein 541 200 348 NM_153129 phosphofurin acidic cluster sorting protein 1 540 710 294 NM_008054 protein-tyrosine kinase fyn 539 225 507 NM_021502 hematopoietic stem/progenitor cells 176 539 172 367 NM_010586 inositol 14,5-triphosphate receptor 2 isoform 538 3344 421 NM_008551 MAP kinase-activated protein kinase 2 538 118 655 NM_026240 GRAM domain containing 3 537 370 249 NM_007661 cell division cycle 2-like 1 537 156 359 NM_145975 DEAD box polypeptide 46 537 127 156 NM_001005525 arginine/serine-rich coiled-coil 2 isoform 1 537 283 344 NM_008679 nuclear receptor coactivator 3 537 229 318 NM_175112 RAE1 RNA export 1 homolog 536 329 691 NM_134100 hypothetical protein LOC106073 536 404 467 NM_009097 ribosomal protein S6 kinase polypeptide 1 536 74 109 NM_013490 choline kinase alpha isoform 1 535 544 537 NM_010956 oxoglutarate dehydrogenase lipoamide 533 531 780 NM_177305 ADP-ribosylation factor-like 7 533 352 421 NM_021438 FGF intracellular binding protein 533 265 211 NM_026718 ankyrin repeat domain 13a 532 1117 285 NM_016795 serine/arginine-rich protein specific kinase 1 532 903 350 NM_024211 solute carrier family 25 mitochondrial carrier 532 145 283 NM_008740 N-ethylmaleimide sensitive fusion protein 532 139 199 NM_021420 serine/threonine kinase 4 531 230 236 NM_133945 vaccinia related kinase 3 530 959 288 NM_177301 heterogeneous nuclear ribonucleoprotein L 529 1419 588 NM_025289 transforming growth factor beta regulated gene 529 918 313 NM_153560 early estrogen-induced gene 1 protein 529 381 445 NM_010073 dolichol-phosphate beta-D mannosyltransferase 529 479 240 NM_019674 protein phosphatase 4 catalytic subunit 528 2091 610 NM_007591 calreticulin 528 976 777 NM_023258 PYD and CARD domain containing 528 153 421 NM_001024616 hypothetical protein LOC227624 527 91 366 NM_001083925 2'-5' oligoadenylate synthetase 1B 526 460 382 NM_026542 solute carrier family 25 member 39 525 152 458 NM_001081049 myeloid/lymphoid or mixed-lineage leukemia 1 523 543 165 NM_001039472 kinesin family member 21B 523 9 28 NM_009525 wingless-related MMTV integration site 5B 522 260 491 NM_019396 cysteine and histidine rich 1 isoform 1 522 54 113 NM_133786 structural maintenance of chromosomes 4 520 282 462 NM_020027 HLA-B associated transcript 2 520 96 268 NM_172582 coenzyme Q6 homolog 519 282 179 NM_001081030 SET binding factor 1 518 846 401 NM_008376 GTPase IMAP family member 1 518 375 371 NM_027207 hypothetical protein LOC69770 518 362 263 NM_028809 actin related protein 2/3 complex subunit 517 641 427 NM_028732 Gi24 receptor precursor 517 247 511 NM_207223 centaurin beta 5 517 269 320 NM_011968 proteasome prosome macropain subunit, alpha 516 500 447 NM_026017 Dullard homolog 516 301 512 NM_011379 signal-induced proliferation associated gene 1 516 141 497 NM_019704 transmembrane protein 115 516 238 239 NM_001098836 ataxin 7-like 3 isoform a 516 158 103 NM_011578 transforming growth factor beta receptor III 515 841 265 NM_181730 RNA polymerase 1-3 isoform 2 515 317 624 NM_027257 oligonucleotide/oligosaccharide-binding fold 515 516 247 NM_019586 ubiquitin-conjugating enzyme E2 J1 515 256 407 NM_173741 WD repeat domain 24 515 53 479 NM_007886 dystrobrevin beta 515 40 489 NM_008453 Kruppel-like factor 3 basic 515 13 55 NM_009696 apolipoprotein E 514 299 360 NM_029293 phosphohistidine phosphatase 514 218 218 NM_001081203 sno strawberry notch homolog 1 514 305 444 NM_001078649 transmembrane protein 134 isoform a 514 33 599 NM_145520 TruB pseudouridine psi synthase homolog 2 514 99 428 NM_138681 breast carcinoma amplified sequence 3 513 65 318 NM_019816 apoptosis antagonizing transcription factor 512 1176 1996 NM_008749 nucleobindin 1 512 27 383 NM_010437 human immunodeficiency virus type I enhancer 511 1625 528 NM_010581 CD47 antigen 511 216 198 NM_133697 hypothetical protein LOC68552 510 250 326 NM_008739 nuclear receptor-binding SET-domain protein 1 509 348 218 NM_001033271 transmembrane protein 55b 508 109 377 NM_173038 tubulin folding cofactor E-like 507 486 444 NM_008225 hematopoietic cell specific Lyn substrate 1 507 147 268 NM_016737 stress-induced phosphoprotein 1 506 965 342 NM_025383 NECAP endocytosis associated 2 504 382 503 NM_025516 ERGIC and golgi 3 503 503 175 NM_028024 NFKB inhibitor interacting Ras-like protein 2 503 98 352 NM_001081045 hypothetical protein LOC76719 502 51 164 NM_001081383 myeloid/lymphoid or mixed-lineage leukemia 3 501 185 437 NM_175423 transmembrane protein 142A 501 97 435 NM_134059 DEAD Asp-Glu-Ala-Asp box polypeptide 41 500 542 604 NM_199469 nuclear protein localization 4 500 77 413 NM_011186 proteasome prosome macropain subunit, beta 500 311 137 NM_183426 strawberry notch homolog 500 110 191 NM_023598 AT rich interactive domain 5B Mrf1 like 498 896 210 NM_001110791 splicing factor 1 isoform 1 498 238 290 NM_001080819 AT rich interactive domain 1A 498 1349 397 NM_026591 mitochondrial ribosomal protein L24 498 561 498 NM_021328 bridging integrator 3 498 369 438 NM_025802 patatin-like phospholipase domain containing 2 498 48 625 NM_028767 winged-helix repressor FOXP4 isoform 3 497 798 489 NM_026485 TraB domain containing 497 202 520 NM_030083 LSM domain containing 1 497 87 136 NM_138603 coiled-coil domain containing 22 496 251 479 NM_001111316 protein tyrosine phosphatase receptor type, C 496 163 485 NM_031373 opioid growth factor receptor 495 482 490 NM_029745 TBC1 domain family member 9B 495 638 278 NM_023314 eukaryotic translation initiation factor 4E 495 239 27 NM_009853 CD68 antigen 494 408 236 NM_173761 YTH domain family 1 494 139 221 NM_178394 janus kinase and microtubule interacting protein 493 97 196 NM_009066 ring finger protein 1 492 485 295 NM_133716 stromal membrane-associated GTPase-activating 491 486 678 NM_007875 UDP-N-acetylglucosamine-dolichyl-phosphate 491 802 184 NM_009793 calcium/calmodulin-dependent protein kinase IV 491 128 756 NM_134155 breast cancer metastasis-suppressor 1 491 105 59 NM_001038627 Smad ubiquitination regulatory factor 1 isoform 490 560 390 NM_130879 ubiquitin specific protease 48 490 163 622 NM_011840 mitogen-activated protein kinase kinase 5 490 426 343 NM_007502 Na+/K+ -ATPase beta 3 subunit 490 97 210 NM_030886 ankyrin repeat domain protein 17 isoform a 490 115 186 NM_025912 hypothetical protein LOC67017 490 51 677 NM_001024617 inositol polyphosphate-4-phosphatase type II 490 391 246 NM_178576 cleavage and polyadenylation specific factor 4 490 163 150 NM_145927 farnesyltransferase CAAX box, beta 489 736 331 NM_145996 modulator recognition factor I 489 180 351 NM_029406 NOP17 489 143 223 NM_133705 pyrroline-5-carboxylate reductase family member 488 124 376 NM_019730 expressed in non-metastatic cells 3 486 851 477 NM_024243 fucosidase alpha-L-1, tissue 486 190 296 NM_133967 zinc finger DHHC domain containing 7 486 330 127 NM_153569 cyclin G associated kinase 485 379 141 NM_153555 H326 485 102 325 NM_146251 patatin-like phospholipase domain containing 7 484 887 528 NM_133808 high density lipoprotein binding protein 483 941 473 NM_016763 hydroxyacyl-Coenzyme A dehydrogenase type II 482 176 355 NM_001081345 chromodomain helicase DNA binding protein 2 481 738 646 NM_025440 mitochondrial ribosomal protein S16 480 401 366 NM_016769 MAD homolog 3 480 349 267 NM_028791 hypothetical protein LOC74157 480 147 396 NM_023854 ADP-ribosylation factor GTPase activating 480 89 426 NM_013781 SH2 domain containing 3C 480 143 344 NM_134139 WD repeat domain 74 480 95 251 NM_177778 armadillo repeat containing 7 478 371 260 NM_016966 3-phosphoglycerate dehydrogenase 477 719 478 NM_028230 serine hydroxymethyltransferase 2 477 844 152 NM_028015 LAG1 homolog ceramide synthase 5 476 302 440 NM_026618 coiled-coil domain containing 56 475 537 193 NM_008826 phosphofructokinase liver, B-type 475 226 487 NM_026760 hypothetical protein LOC68544 474 112 517 NM_013907 F-box and WD repeat domain containing 4 474 240 243 NM_133947 nuclear mitotic apparatus protein 1 474 89 574 NM_008831 prohibitin 474 472 106 NM_026376 plexin D1 471 227 433 NM_009422 Tnf receptor-associated factor 2 471 237 318 NM_029339 coiled-coil domain containing 101 470 488 721 NM_026612 NADH dehydrogenase ubiquinone 1 beta 468 3917 659 NM_009421 Tnf receptor-associated factor 1 468 474 202 NM_001077709 solute carrier family 39 member 7 466 319 237 NM_145445 eukaryotic translation initiation factor 2B 466 317 176 NM_024199 cleavage stimulation factor 3' pre-RNA, subunit 466 80 238 NM_028047 hypothetical protein LOC71997 465 904 302 NM_025828 lectin mannose-binding 2 464 152 277 NM_175258 Rap guanine nucleotide exchange factor GEF 6 464 57 335 NM_177318 zinc finger protein Zip67 463 186 331 NM_013909 F-box and leucine-rich repeat protein 6 463 230 263 NM_007457 adaptor protein complex AP-1 sigma 1 463 281 139 NM_008548 mannosidase alpha, class 1A, member 1 462 684 321 NM_009861 cell division cycle 42 462 137 623 NM_080848 WD repeat domain 5 462 273 452 NM_183358 growth arrest and DNA-damage-inducible gamma 460 1346 490 NM_153138 WAS/WASL interacting protein family member 1 460 427 353 NM_021895 actinin alpha 4 460 423 124 NM_023121 guanine nucleotide binding protein G protein 460 400 142 NM_183017 tubulin tyrosine ligase-like family member 12 459 945 186 NM_016884 heterogeneous nuclear ribonucleoprotein C 459 598 289 NM_007598 CAP adenylate cyclase-associated protein 1 458 341 247 NM_027481 splicing factor 4 458 133 90 NM_175133 hypothetical protein LOC68778 457 287 377 NM_144525 hypothetical protein LOC68796 457 30 322 NM_134189 UDP-N-acetyl-alpha-D-galactosamine:polypeptide 456 1152 329 NM_133242 RNA binding motif protein 39 455 311 675 NM_007990 Finkel-Biskis-Reilly murine sarcoma virus 455 605 349 NM_145494 malic enzyme 2 NAD+-dependent, mitochondrial 453 510 966 NM_023203 hypothetical protein LOC66422 451 134 214 NM_016892 copper chaperone for superoxide dismutase 451 97 88 NM_008568 minichromosome maintenance complex component 7 450 1277 374 NM_133794 glutaminyl-tRNA synthetase 450 127 126 NM_011653 tubulin alpha 1 449 340 160 NM_027013 sodium channel modifier 1 448 270 387 NM_011822 phosphatidylinositol glycan anchor biosynthesis 448 255 229 NM_133757 silencer-associated factor 447 131 232 NM_018871 3-monooxgenase/tryptophan 5-monooxygenase 447 75 110 NM_053262 dehydrogenase/reductase SDR family member 8 446 118 428 NM_015828 glucosamine 445 2434 351 NM_009945 cytochrome c oxidase subunit VIIa 2 445 920 220 NM_029565 transmembrane protein 59 445 212 441 NM_018774 polyhomeotic-like 2 445 113 325 NM_001001984 F-box and leucine-rich repeat protein 11 445 119 207 NM_001081320 cytochrome b-561 domain containing 1 isoform 1 444 22265 333 NM_011032 prolyl 4-hydroxylase beta polypeptide 444 259 458 NM_145823 phosphatidylinositol transfer protein 444 548 149 NM_027804 ubiquitin-specific protease 19 444 156 287 NM_029780 protein kinase raf 1 444 118 224 NM_175684 FCH and double SH3 domains 1 443 795 377 NM_145578 ubiquitin-conjugating enzyme E2M 443 236 266 NM_175375 multiple ankyrin repeats single KH-domain 443 168 299 NM_138587 D6Wsu176e protein 443 341 355 NM_010901 cytoplasmic nuclear factor of activated T-cells 442 137 307 NM_144954 peptidylprolyl isomerase-like 2 442 58 275 NM_033613 DOM-3 homolog Z 441 302 459 NM_023247 nuclear protein E3-3 441 158 429 NM_026553 Yip1p-interacting factor 441 128 236 NM_175551 death inducer-obliterator 1 isoform 3 440 247 765 NM_009419 protein-tyrosine sulfotransferase 2 440 349 316 NM_173748 NudC domain containing 3 439 195 496 NM_024267 RANBP4 439 25 44 NM_008823 complement factor properdin 438 175 383 NM_001025597 zinc finger protein subfamily 1A 1 isoform a 438 230 244 NM_001081041 hypothetical protein LOC68505 437 112 476 NM_027189 gem nuclear organelle associated protein 7 436 806 215 NM_153175 GTPase IMAP family member 6 436 288 530 NM_198101 Gem-interacting protein 436 239 414 NM_015801 patatin-like phospholipase domain containing 6 436 204 193 NM_146124 Rho GTPase activating protein 1 436 102 282 NM_019774 A kinase anchor protein 8 435 628 254 NM_026936 oxidase assembly 1-like 435 190 108 NM_031408 PERQ amino acid rich with GYF domain 1 435 402 773 NM_030561 cDNA sequence BC004004 435 194 250 NM_153423 WAS protein family member 2 434 897 415 NM_027360 6.8 kDa mitochondrial proteolipid 434 328 274 NM_011870 calcium and integrin binding 1 434 134 436 NM_023627 myo-inositol 1-phosphate synthase A1 432 542 138 NM_080553 inositol 14,5-triphosphate receptor 3 432 231 257 NM_016699 exosome component 10 432 46 424 NM_025633 methionine aminopeptidase-like 1 432 99 249 NM_011947 mitogen-activated protein kinase kinase kinase 431 194 335 NM_145929 golgi associated gamma adaptin ear containing, 430 802 356 NM_009143 stromal cell derived factor 2 430 325 401 NM_001040106 AP2 associated kinase 1 isoform 1 429 391 158 NM_019739 forkhead box O1 429 160 235 NM_024177 mitochondrial ribosomal protein L38 429 83 292 NM_009149 golgi apparatus protein 1 429 142 159 NM_011680 upstream stimulatory factor 2 428 161 254 NM_028785 dedicator of cytokinesis 8 427 1100 348 NM_175229 serine/arginine repetitive matrix 2 427 98 235 NM_177683 vestigial like 4 427 3179 422 NM_008879 lymphocyte cytosolic protein 1 427 1065 225 NM_013759 selenoprotein X 1 426 162 438 NM_173757 mitochondrial ribosomal protein S27 426 120 178 NM_029581 RIKEN cDNA 2810012L14 426 0 43 NM_001083955 hemoglobin alpha adult chain 2 425 297 602 NM_024192 CUE domain containing 2 425 293 419 NM_019924 ribosomal protein S6 kinase polypeptide 4 425 180 245 NM_013676 suppressor of Ty 5 homolog 424 18 132 NM_145711 thymocyte selection-associated HMG box 423 684 152 NM_031179 splicing factor 3b subunit 1 423 141 267 NM_001038587 adenosine deaminase RNA-specific isoform 2 422 671 305 NM_026688 NADH dehydrogenase ubiquinone Fe-S protein 3 422 248 495 NM_178919 lipase maturation factor 2 421 295 181 NM_019649 cleft lip and palate associated transmembrane 420 860 1325 NM_011487 signal transducer and activator of transcription 420 553 534 NM_008704 nucleoside-diphosphate kinase 1 420 317 292 NM_028076 transmembrane and ubiquitin-like domain 420 417 124 NM_177298 phosphatidylserine decarboxylase 420 122 209 NM_133347 HELG 420 56 94 NM_019912 ubiquitin-conjugating enzyme E2D 2 420 355 335 NM_021446 hypothetical protein LOC58520 420 395 182 NM_007650 CD5 antigen 420 118 321 NM_008800 phosphodiesterase 1B Ca2+-calmodulin dependent 419 84 742 NM_133772 single stranded DNA binding protein 4 419 198 223 NM_054093 ubiquitin protein ligase E3B 419 145 269 NM_145215 abhydrolase domain containing 11 418 516 393 NM_026061 NADH dehydrogenase ubiquinone 1 beta 418 150 466 NM_029365 mediator of RNA polymerase II transcription 417 202 908 NM_024172 hsp70-interacting protein 417 54 103 NM_024228 glycerophosphodiester phosphodiesterase domain 416 409 112 NM_021534 peroxisomal membrane protein 4 416 46 328 NM_145414 NOL1/NOP2/Sun domain family member 5 415 280 186 NM_030240 PTIP-associated 1 412 1458 425 NM_080635 eukaryotic translation initiation factor 3 412 398 174 NM_028099 dual specificity phosphatase 11 RNA/RNP complex 412 213 214 NM_011049 PCTAIRE-motif protein kinase 1 412 2283 233 NM_013660 semaphorin 4D 411 958 240 NM_139144 O-linked N-acetylglucosamine transferase 411 137 322 NM_145604 lin-10 410 905 526 NM_025389 anaphase promoting complex subunit 11 homolog 409 465 286 NM_029624 transmembrane protein 112 408 5982 337 NM_011099 pyruvate kinase muscle 408 1267 113 NM_009007 RAS-related C3 botulinum substrate 1 408 253 306 NM_144530 zinc finger CCCH type containing 11A 408 36 95 NM_175482 ubiquitin specific protease 28 407 2820 141 NM_009850 CD3 antigen gamma polypeptide 407 495 476 NM_008400 integrin alpha L 407 555 232 NM_010443 heme oxygenase decycling 2 407 253 306 NM_024231 zinc finger like protein 1 407 169 307 NM_144812 trinucleotide repeat containing 6b isoform 1 407 248 182 NM_023402 myosin light chain regulatory B 407 139 259 NM_011551 upstream binding transcription factor RNA 407 0 384 NM_011703 vasoactive intestinal peptide receptor 1 406 162 313 NM_026522 chitinase domain containing 1 406 102 282 NM_007949 excision repair cross-complementing rodent 405 573 257 NM_009187 cytochrome c oxidase subunit VIIa polypeptide 405 159 369 NM_025976 bifunctional apoptosis regulator 405 180 260 NM_144901 cold shock domain containing E1 RNA binding 405 213 210 NM_033042 tumor necrosis factor receptor superfamily 404 104 434 NM_198616 coiled-coil domain containing 85B 404 108 402 NM_001008422 SR-related CTD-associated factor 1 404 77 393 NM_138676 Sh3kbp1 binding protein 1 404 53 342 NM_008044 frataxin 404 172 132 NM_001004436 wings apart-like homolog 404 31 205 NM_181039 latrophilin 1 precursor 404 128 86 NM_011390 solute carrier family 12 member 7 403 1209 256 NM_133769 cytoplasmic FMR1 interacting protein 2 403 170 421 NM_001081633 DiGeorge syndrome critical region protein 14 402 141 426 NM_177620 Ras and Rab interactor 3 401 653 178 NM_026169 hypothetical protein LOC67457 401 426 258 NM_025486 HSPC171 protein 401 30 345 NM_001080924 zinc and ring finger 3 400 1594 271 NM_026432 transmembrane protein 66 400 193 267 NM_001029979 scaffold attachment factor B2 400 248 153 NM_025670 hypothetical protein LOC66626 399 7235 774 NM_009400 tumor necrosis factor receptor superfamily 399 326 105 NM_016698 ring finger protein 10 399 69 349 NM_030723 pumilio 2 398 1011 1391 NM_008525 aminolevulinate delta-, dehydratase 398 601 355 NM_009077 ribosomal protein L18 398 42 143 NM_016777 nuclear autoantigenic sperm protein isoform 2 397 1809 306 NM_016772 enoyl coenzyme A hydratase 1 peroxisomal 397 566 293 NM_001081269 Wolf-Hirschhorn syndrome candidate 1-like 1 397 283 294 NM_013764 deoxyguanosine kinase 396 279 308 NM_026896 transcriptional co-activator CRSP8 homolog 396 243 202 NM_019456 amyloid beta A4 precursor protein-binding 396 232 217 NM_020022 replication factor C activator 1 2 395 1456 148 NM_009120 SAR1a gene homolog 395 848 443 NM_008416 Jun-B oncogene 395 346 299 NM_009164 SH3-domain binding protein 1 395 103 362 NM_145393 high glucose-regulated protein 8 394 5522 1455 NM_011659 tumor necrosis factor receptor superfamily 394 554 285 NM_009188 SIN3 homolog B transcription regulator isoform 394 125 189 NM_011407 schlafen 1 392 929 798 NM_175103 BolA-2 protein 392 313 294 NM_201637 chromodomain helicase DNA binding protein 8 392 119 266 NM_153414 cDNA sequence BC028953 392 294 68 NM_133805 COP9 signalosome subunit 8 392 86 201 NM_011432 U1 small nuclear ribonucleoprotein 1C 391 1337 13 NM_207105 histocompatibility 2 class II antigen A, beta 391 385 533 NM_177823 ubiquitin associated and SH3 domain containing 391 114 282 NM_026833 hypothetical protein LOC68767 390 543 270 NM_010937 neuroblastoma ras oncogene 389 369 208 NM_028475 Nice-4 protein homolog isoform 1 388 102 356 NM_170592 hypothetical protein LOC66617 388 63 174 NM_013853 ATP-binding cassette sub-family F GCN20, 388 261 365 NM_145429 arrestin beta 2 388 102 311 NM_007566 baculoviral IAP repeat-containing 6 388 69 337 NM_020497 zinc finger protein 276 388 41 267 NM_001110218 protein phosphatase 1H PP2C domain containing 387 197 269 NM_145500 ubiquitin domain containing 1 387 3 302 NM_013832 RAS protein activator like 1 GAP1 like 386 969 292 NM_025933 HIG1 domain family member 2A 386 679 342 NM_001029837 phosphatidylinositol 3-kinase catalytic delta 386 433 495 NM_008659 myosin IC isoform b 386 41 253 NM_001024699 zinc finger and BTB domain containing 45 385 428 201 NM_138659 pre-mRNA processing factor 8 385 282 201 NM_134078 CHMP family member 7 385 233 191 NM_020508 bromodomain containing 4 isoform 1 383 196 338 NM_178930 golgi-specific brefeldin A-resistance factor 1 383 259 252 NM_001025617 calcium activated nucleotidase 1 383 271 175 NM_145514 WD repeat domain 26 383 113 236 NM_026378 DALR anticodon binding domain containing 3 382 4831 278 NM_025401 ubiquitin-like 5 381 295 322 NM_025302 mitochondrial ribosomal protein L2 381 225 256 NM_153057 nodal modulator 1 381 133 193 NM_029337 E1A binding protein p400 380 14 352 NM_019677 phospholipase C beta 1 379 947 165 NM_030743 zinc finger protein 313 379 811 235 NM_008884 promyelocytic leukemia isoform 1 379 552 367 NM_027259 polymerase RNA II (DNA directed) polypeptide 379 742 146 NM_138584 spastic paraplegia 21 homolog 379 50 222 NM_026741 zinc finger protein 579 379 166 96 NM_198033 senataxin 378 36 258 NM_001038010 general control of amino acid synthesis-like 2 378 77 150 NM_027081 hypothetical protein LOC69440 377 270 354 NM_010592 jun D proto-oncogene 377 93 428 NM_025371 aminoacylase 1 376 153 558 NM_013768 protein arginine N-methyltransferase 5 376 112 170 NM_021411 RAB37 member of RAS oncogene family 375 830 209 NM_009652 thymoma viral proto-oncogene 1 375 397 241 NM_177619 MYST histone acetyltransferase 2 375 291 333 NM_018753 tyrosine 3-monooxygenase/tryptophan 375 65 202 NM_027141 splA/ryanodine receptor domain and SOCS box 374 934 138 NM_033561 eukaryotic translation initiation factor 4H 374 356 461 NM_010119 EH-domain containing 1 374 158 177 NM_001111022 runt-related transcription factor 1 isoform 2 374 112 150 NM_175016 alkB alkylation repair homolog 2 373 305 82 NM_176849 arginine and glutamate rich 1 373 403 291 NM_010833 moesin 373 81 242 NM_025521 hypothetical protein LOC66374 373 74 108 NM_010753 Max dimerization protein 4 372 257 224 NM_146099 hypothetical protein LOC226178 372 62 223 NM_198022 trinucleotide repeat containing 6C 372 172 100 NM_024222 source of immunodominant MHC-associated 371 579 494 NM_018749 eukaryotic translation initiation factor 3 370 214 275 NM_178880 Son cell proliferation protein 369 599 202 NM_008974 protein tyrosine phosphatase 4a2 369 138 176 NM_027933 RAN binding protein 3 369 94 187 NM_013581 component of oligomeric golgi complex 1 368 1068 166 NM_198652 hypothetical protein LOC381280 368 391 150 NM_138604 OTU domain containing 5 368 96 429 NM_001008548 phosphodiesterase 2A cGMP-stimulated 368 144 133 NM_010091 dishevelled dsh homolog 1 367 147 274 NM_025363 hypothetical protein LOC66117 367 103 272 NM_027905 selenoprotein O 366 77 211 NM_001081170 phosphofurin acidic cluster sorting protein 2 366 29 192 NM_009593 ATP-binding cassette subfamily G, member 1 365 841 109 NM_008696 mitogen-activated protein kinase kinase kinase 365 649 270 NM_146110 angio-associated migratory protein 365 649 172 NM_019955 receptor-interacting serine-threonine kinase 3 365 271 277 NM_001110504 calpain 1 large subunit 365 143 323 NM_172424 thyroid hormone receptor associated protein 2 365 38 208 NM_033324 DiGeorge syndrome critical region gene 8 364 71 186 NM_172404 cysteine conjugate-beta lyase 1 362 1427 254 NM_021473 aldo-keto reductase family 1 member A4 362 182 219 NM_001080754 activating molecule in Beclin1-regulated 361 610 247 NM_026631 nucleolar protein family A member 2 361 253 96 NM_010124 eukaryotic translation initiation factor 4E 361 32 193 NM_021366 Kruppel-like factor 13 360 216 229 NM_053208 EGL nine homolog 2 359 346 835 NM_019408 nuclear factor of kappa light polypeptide gene 359 606 290 NM_183390 kelch-like 6 358 575 227 NM_017477 coatomer protein complex subunit gamma isoform 358 142 392 NM_001033231 hypothetical protein LOC192173 358 213 229 NM_001110160 leucine rich repeat containing 61 357 189 320 NM_001009573 unc-13 homolog D 357 772 124 NM_153792 Tnf receptor-associated factor 7 357 32 93 NM_028608 GLI pathogenesis-related 1 glioma 356 1512 141 NM_010330 embigin 355 826 76 NM_026653 replication protein A1 355 476 131 NM_022321 parvin gamma 355 87 252 NM_177150 centromere protein T 354 1182 178 NM_026129 endoplasmic reticulum protein ERp29 precursor 354 788 144 NM_001042593 Hbs1-like isoform 2 354 627 213 NM_145139 eukaryotic translation initiation factor 3 354 183 476 NM_013854 ATP-binding cassette sub-family F GCN20, 353 732 183 NM_010361 glutathione S-transferase theta 2 353 105 219 NM_009089 polymerase RNA II (DNA directed) polypeptide 353 134 160 NM_172514 transmembrane protein 71 352 342 235 NM_001085385 hypothetical protein LOC72244 352 255 125 NM_027931 threonyl-tRNA synthetase 2 mitochondrial 352 109 204 NM_019553 DEAD Asp-Glu-Ala-Asp box polypeptide 21 351 1886 180 NM_007637 chaperonin subunit 5 epsilon 351 386 148 NM_025827 peroxisomal lon protease 350 717 88 NM_018820 SERTA domain containing 1 350 480 165 NM_029702 ADP-ribosylation factor related protein 1 350 109 442 NM_008193 guanylate kinase 1 350 299 192 NM_011385 Sloan-Kettering viral oncogene homolog 349 487 417 NM_001025313 TAP binding protein isoform 1 349 337 296 NM_027151 dynactin 2 349 293 307 NM_007569 B-cell translocation gene 1 anti-proliferative 349 57 277 NM_025399 nudix nucleoside diphosphate linked moiety 348 253 349 NM_023138 mitogen activated protein kinase kinase 2 348 402 141 NM_133673 torsin family 1 member B 348 165 222 NM_001081158 hypothetical protein LOC74148 348 104 184 NM_145427 ATP synthase mitochondrial F1 complex assembly 348 69 187 NM_001029990 D14Ertd209e protein 346 553 143 NM_011188 proteasome prosome macropain 26S subunit, 346 232 168 NM_007920 E74-like factor 1 346 213 84 NM_177771 kelch-like 18 346 68 227 NM_026768 mitochondrial ribosomal protein S18A 346 30 179 NM_178854 CCR4-NOT transcription complex subunit 6-like 346 30 51 NM_028440 hypothetical protein LOC73112 345 499 156 NM_011103 protein kinase C delta 345 348 139 NM_172372 WD repeat domain 45 344 3605 211 NM_009716 activating transcription factor 4 344 734 195 NM_207653 CASP8 and FADD-like apoptosis regulator isoform 343 284 211 NM_030084 G protein-coupled receptor 108 343 157 227 NM_011293 polymerase RNA II (DNA directed) polypeptide 342 9262 9771 NM_025378 interferon induced transmembrane protein 3 342 6268 337 NM_025641 ubiquinol-cytochrome c reductase hinge protein 342 590 287 NM_013677 surfeit 1 342 319 433 NM_013810 drebrin-like 342 193 323 NM_023625 mannose-6-phosphate protein p76 341 305 221 NM_001039514 deoxyhypusine synthase 341 142 373 NM_026636 hypothetical protein LOC68251 341 50 362 NM_173865 solute carrier family 41 member 1 341 1161 203 NM_026885 putative breast adenocarcinoma marker 341 522 125 NM_009054 tripartite motif protein 27 341 183 391 NM_029802 ADP-ribosylation factor interacting protein 2 341 44 344 NM_007462 adenomatosis polyposis coli 340 53 285 NM_001014974 tubulin tyrosine ligase-like family member 4 340 93 146 NM_011151 protein phosphatase 1B magnesium dependent, 339 4972 267 NM_001033166 selenoprotein H 339 238 388 NM_178614 sorting and assembly machinery component 50 339 311 198 NM_008503 ribosomal protein S2 339 275 187 NM_133953 splicing factor 3b subunit 3 339 94 219 NM_172758 solute carrier family 38 member 7 339 118 14 NM_008321 inhibitor of DNA binding 3 339 81 17 NM_001003950 RAB3A interacting protein 338 1363 171 NM_023059 single Ig IL-1 receptor related protein 338 194 180 NM_148930 RNA binding motif protein 5 338 161 136 NM_019426 activating transcription factor 7 interacting 337 318 243 NM_009068 receptor TNFRSF-interacting serine-threonine 337 318 173 NM_028190 Luc7 homolog S. cerevisiae-like isoform 2 337 96 284 NM_001039156 TRIO and F-actin binding protein isoform 3 337 144 188 NM_019927 ariadne ubiquitin-conjugating enzyme E2 binding 337 45 66 NM_009274 serine/arginine-rich protein specific kinase 2 336 118 293 NM_134115 serine/threonine kinase 38 336 229 71 NM_008654 myeloid differentiation primary response gene 336 132 156 NM_175121 solute carrier family 38 member 2 335 1213 180 NM_013683 transporter 1 ATP-binding cassette, sub-family 335 333 571 NM_020255 paroxisome proliferative activated receptor 335 219 195 NM_007527 Bcl2-associated X protein 335 177 147 NM_021501 protein inhibitor of activated STAT 4 335 186 76 NM_183144 inositol polyphosphate-5-phosphatase A 334 959 129 NM_001113563 signal transducer and activator of transcription 334 82 405 NM_027880 TEL2 telomere maintenance 2, homolog 334 248 210 NM_007459 adaptor protein complex AP-2 alpha 2 subunit 334 246 193 NM_010322 glyceronephosphate O-acyltransferase 334 342 93 NM_201226 leucine rich repeat containing 47 334 69 275 NM_145431 Notchless gene homolog 334 73 215 NM_172704 DnaJ Hsp40 homolog subfamily C, member 11 334 85 165 NM_001024205 82-kD FMRP Interacting Protein 333 892 291 NM_001001493 hypothetical protein LOC414077 333 319 266 NM_009288 serine/threonine kinase 10 333 80 206 NM_183154 zinc finger FYVE domain containing 1 332 670 259 NM_025544 mitochondrial ribosomal protein S15 332 185 395 NM_026508 TNF receptor-associated protein 1 332 203 103 NM_019663 protein inhibitor of activated STAT 1 332 86 126 NM_009582 mitogen-activated protein kinase kinase kinase 331 424 222 NM_019640 phosphatidylinositol transfer protein beta 331 154 263 NM_011624 topoisomerase DNA III beta 331 97 226 NM_007705 cold inducible RNA binding protein 330 323 640 NM_026063 hypothetical protein LOC67267 330 572 120 NM_009458 ubiquitin-conjugating enzyme E2B RAD6 homology 330 316 134 NM_021523 HECT UBA and WWE domain containing 1 330 204 221 NM_011417 SWI/SNF related matrix associated, actin 330 26 353 NM_001080977 round spermatid basic protein 1-like 329 2021 303 NM_009536 tyrosine 3-monooxygenase/tryptophan 329 1042 487 NM_001038700 formin binding protein 1 isoform a 329 67 752 NM_020032 polymerase DNA directed lambda 328 643 235 NM_009287 stromal interaction molecule 1 328 541 211 NM_001033630 hypothetical protein LOC69662 328 170 541 NM_024256 beta-13-glucuronyltransferase 3 328 144 211 NM_145954 aldehyde dehydrogenase 16 family member A1 328 39 165 NM_175150 thioredoxin domain containing 15 327 190 495 NM_172148 B9 protein domain 2 327 420 256 NM_001110831 aspartyl aminopeptidase isoform a 327 280 332 NM_027236 eukaryotic translation initiation factor 1A 327 232 240 NM_026246 mitochondrial ribosomal protein L49 327 271 199 NM_013872 phosphomannomutase 1 327 137 159 NM_030064 PHD finger protein 23 326 56 498 NM_001085510 hypothetical protein LOC245405 326 39 249 NM_028101 RIKEN cDNA 2610003J06 326 90 143 NM_007513 solute carrier family 7 cationic amino acid 326 71 84 NM_133977 transferrin 326 1858 198 NM_019642 ribophorin II 326 445 198 NM_175101 transmembrane protein 111 326 86 199 NM_016805 heterogeneous nuclear ribonucleoprotein U 326 57 119 NM_016670 Pbx/knotted 1 homeobox 325 2046 187 NM_180678 glycyl-tRNA synthetase 325 1409 213 NM_021880 protein kinase cAMP dependent regulatory, type 325 182 394 NM_177782 hypothetical protein LOC277360 325 168 355 NM_029878 tubulin-specific chaperone d 325 222 103 NM_019795 DnaJ Hsp40 homolog subfamily C, member 7 325 272 44 NM_181650 PR domain containing 4 323 259 128 NM_029456 SAPS domain family member 3 322 1486 311 NM_181582 eukaryotic translation initiation factor 5A 322 527 241 NM_001039939 additional sex combs like 1 322 69 303 NM_001081433 ankyrin repeat domain 44 321 283 126 NM_175152 THAP domain containing apoptosis associated 320 172 396 NM_133727 kaptin 320 58 133 NM_028369 MON1 homolog A 319 559 2150 NM_019732 runt related transcription factor 3 319 208 121 NM_008951 proteasome 26S non-ATPase subunit 4 318 499 180 NM_144866 eukaryotic translation termination factor 1 318 349 113 NM_030251 ankyrin repeat and BTB POZ domain containing 318 179 244 NM_026615 ubiquitin related modifier 1 homolog 318 42 353 NM_177090 hypothetical protein LOC320169 318 217 168 NM_019983 RAB guanine nucleotide exchange factor GEF 1 318 84 167 NM_017368 CUG triplet repeat RNA-binding protein 1 317 334 122 NM_001081105 ras homolog gene family member H 317 74 377 NM_001085498 chromatin modifying protein 6 317 327 119 NM_139311 myeloid/lymphoid or mixed lineage-leukemia 317 187 104 NM_018808 DnaJ Hsp40 homolog subfamily B, member 1 316 139 344 NM_007533 branched chain ketoacid dehydrogenase E1 alpha 316 67 229 NM_001112699 pleckstrin homology Sec7 and coiled-coil 315 2176 199 NM_010385 H2-K region expressed gene 2 315 43 134 NM_001042671 preimplantation protein 4 isoform 2 315 33 121 NM_016758 regulator of G-protein signaling 14 314 2898 162 NM_012021 peroxiredoxin 5 precursor 314 1677 117 NM_026899 Ssu72 RNA polymerase II CTD phosphatase homolog 314 430 272 NM_026533 ribosomal protein S13 314 87 470 NM_145970 coiled-coil and C2 domain containing 1A 314 169 159 NM_027326 myeloid/lymphoid or mixed lineage-leukemia 313 517 91 NM_138677 ER degradation enhancer mannosidase alpha-like 313 226 198 NM_018879 G21 protein 313 55 250 NM_172134 pyridoxal pyridoxine vitamin B6 kinase 313 89 212 NM_138302 endothelial cell growth factor 1 313 187 103 NM_028820 septin 14 313 1 13 NM_001080934 solute carrier family 16 monocarboxylic acid 312 448 239 NM_025849 hypothetical protein LOC66928 311 1318 88 NM_026064 myosin light chain regulatory B-like 311 309 183 NM_023831 hypothetical protein LOC76568 311 66 267 NM_029857 transmembrane and coiled-coil domains 4 310 740 130 NM_010090 dual specificity phosphatase 2 310 522 159 NM_133810 serine/threonine kinase 17b 310 360 168 NM_031878 SWI/SNF related matrix associated, actin 310 280 189 NM_028753 RPP20 protein 310 211 78 NM_029682 Stam binding protein like 1 310 47 191 NM_010301 guanine nucleotide binding protein alpha 11 310 59 143 NM_001081154 limkain b1 310 190 2138 NM_026428 diacetyl/L-xylulose reductase 310 226 120 NM_001110131 capicua homolog isoform b 309 227 379 NM_028632 FCF1 small subunit 309 461 125 NM_019942 septin 6 309 325 250 NM_009275 signal recognition particle receptor B subunit 309 231 211 NM_010147 epsin 1 308 243 269 NM_009082 ribosomal protein L29 308 277 165 NM_026302 dynactin 4 308 184 211 NM_001001144 SREBF chaperone 308 169 194 NM_178605 hypothetical protein LOC28126 308 153 149 NM_175124 leucine rich repeat containing 28 308 140 155 NM_145824 Ran-binding protein 10 308 33 178 NM_011626 TPA regulated locus 307 883 152 NM_172596 SEC24 related gene family member C 307 200 288 NM_177320 phosphoinositide-3-kinase regulatory subunit 5, 307 127 207 NM_026091 hypothetical protein LOC67326 307 143 190 NM_023324 pellino 1 306 2438 120 NM_025359 tetraspanin 13 306 73 173 NM_139149 pigpen 306 53 25 NM_146228 Als2 C-terminal like 306 0 4 NM_019577 chemokine C-C motif ligand 24 305 4579 171 NM_011563 peroxiredoxin 2 305 2567 448 NM_025589 ribosomal protein L36a-like 305 26 333 NM_172739 glucocorticoid receptor DNA binding factor 1 305 122 193 NM_144824 WD repeat domain 79 305 44 185 NM_001081382 zinc finger protein 777 305 65 141 NM_028833 IQ motif containing E 305 40 70 NM_010576 integrin alpha 4 304 1277 558 NM_010511 interferon gamma receptor 1 304 277 295 NM_153119 PH domain-containing protein homolog 304 329 139 NM_021878 jumonji protein 304 170 204 NM_011308 nuclear receptor co-repressor 1 304 52 193 NM_133678 SAC3 domain containing 1 304 160 42 NM_011711 formin-like 3 protein 303 44 771 NM_016859 bystin-like 303 355 265 NM_030248 CDK5 regulatory subunit associated protein 3 303 137 315 NM_027446 hypothetical protein LOC70511 303 126 138 NM_177093 leucine rich repeat containing 58 303 125 103 NM_201369 phosphonoformate immuno-associated protein 5 302 397 421 NM_023149 CNDP dipeptidase 2 302 317 108 NM_009441 tetratricopeptide repeat domain 3 302 175 143 NM_011673 UDP-glucose ceramide glucosyltransferase 302 494 315 NM_018768 syntaxin 8 302 190 277 NM_008163 growth factor receptor bound protein 2 302 160 255 NM_025292 synaptojanin 2 binding protein 302 39 143 NM_001081409 PHD finger protein 20-like 1 301 319 182 NM_011246 RAS guanyl releasing protein 1 301 134 213 NM_027871 Rho guanine nucleotide exchange factor GEF 3 300 337 115 NM_020579 UDP-Gal:betaGlcNAc beta 300 162 120 NM_178390 dorsal neural-tube nuclear protein 300 41 76 NM_001081323 M-phase phosphoprotein 9 299 329 198 NM_198160 SWI/SNF-related matrix-associated 299 342 71 NM_028379 zinc finger DHHC domain containing 4 299 220 102 NM_177319 zinc finger FYVE domain containing 27 299 22 130 NM_018776 cytokine receptor-like factor 3 298 756 188 NM_022325 cathepsin Z preproprotein 298 496 157 NM_008300 heat shock protein 4 298 94 248 NM_011467 sepiapterin reductase 298 186 139 NM_198162 microrchidia 2A 298 137 159 NM_030722 pumilio 1 298 143 142 NM_178694 zyg-11 homolog B C. elegans-like 298 115 103 NM_008855 protein kinase C beta 1 297 230 468 NM_026601 hydroxypyruvate isomerase homolog 297 488 209 NM_001110500 calnexin 297 53 130 NM_181856 transmembrane channel-like 8 296 123 317 NM_009224 U1 small nuclear ribonucleoprotein 70 kDa 296 163 274 NM_001012638 adrenocortical dysplasia 296 28 354 NM_021555 brain protein 16 296 216 119 NM_009342 dynein light chain Tctex-type 1 296 224 111 NM_183162 hypothetical protein LOC229003 295 371 239 NM_027727 dymeclin 295 372 116 NM_008851 phosphatidylinositol membrane-associated 1 295 296 126 NM_019479 hairy and enhancer of split 6 295 61 260 NM_145620 U3 snoRNP-associated protein 295 54 113 NM_172938 sex comb on midleg-like 4 295 26 24 NM_026641 WD repeat domain 56 294 108 871 NM_145226 2'-5' oligoadenylate synthetase 3 294 63 107 NM_010162 exostosin 1 294 53 66 NM_026510 FtsJ homolog 2 293 98 562 NM_011183 presenilin 2 293 200 294 NM_011131 polymerase DNA directed delta 1, catalytic 293 128 277 NM_133240 acyl-CoA thioesterase 8 293 234 133 NM_016981 solute carrier family 9 sodium/hydrogen 292 503 373 NM_053179 N-acetylneuraminic acid synthase 292 141 256 NM_001005508 Rho GTPase activating protein 30 292 261 121 NM_145528 hypothetical protein LOC51897 292 129 111 NM_009343 PHD finger protein 1 292 76 147 NM_199027 zinc finger protein 335 291 1932 196 NM_007747 cytochrome c oxidase subunit Va 291 225 106 NM_001037846 CCR4-NOT transcription complex subunit 2 290 682 178 NM_011740 tyrosine 3-monooxygenase/tryptophan 290 337 126 NM_011917 5'-3' exoribonuclease 2 290 97 281 NM_139236 nucleolar protein family 6 289 612 93 NM_009177 ST3 beta-galactoside alpha-23-sialyltransferase 289 495 132 NM_177326 p21-activated kinase 2 289 45 284 NM_028762 RNA binding motif protein 19 289 138 155 NM_016843 ataxin 10 289 55 146 NM_198107 mediator complex subunit 16 289 61 44 NM_019765 restin 289 0 14 NM_007995 ficolin A 288 3116 213 NM_024171 Sec61 beta subunit 288 1033 189 NM_028173 translocating chain-associating membrane protein 288 194 335 NM_030566 rabaptin RAB GTPase binding effector protein 2 288 286 240 NM_029385 nudix-type motif 16 288 197 243 NM_133907 ubiquitin protein ligase E3C 288 61 285 NM_009088 RNA polymerase 1-4 288 76 122 NM_178686 coiled-coil domain containing 100 288 111 63 NM_001013370 sestrin 1 287 124 322 NM_009642 angiotensin II receptor-associated protein 287 37 172 NM_010771 matrin 3 287 66 140 NM_001081321 PDS5 regulator of cohesion maintenance, homolog 287 74 103 NM_007839 DEAH Asp-Glu-Ala-His box polypeptide 15 286 424 294 NM_177470 acetyl-Coenzyme A acyltransferase 2 286 577 110 NM_026418 regulator of G-protein signalling 10 286 118 215 NM_011050 programmed cell death 4 286 168 98 NM_175649 tumor necrosis factor receptor superfamily 286 303 302 NM_001077411 glucosidase beta, acid 286 279 287 NM_133781 calcium binding protein 39 286 103 357 NM_170777 elongation factor 1 homolog ELF1 S. 286 76 73 NM_172549 calcineurin binding protein 1 285 646 171 NM_009752 galactosidase beta 1 285 254 227 NM_144822 calcium binding atopy-related autoantigen 1 285 140 183 NM_001039200 hypothetical protein LOC230866 isoform 2 285 79 198 NM_172774 ATR interacting protein 285 96 115 NM_021547 START domain containing 3 284 1680 153 NM_001103166 polyrC binding protein 2 isoform 3 284 884 207 NM_001081457 gamma isoform of regulatory subunit B56 protein 284 383 177 NM_175300 anaphase promoting complex subunit 2 284 205 177 NM_172265 eukaryotic translation initiation factor 2B 284 122 190 NM_009634 adenylosuccinate lyase 284 160 76 NM_011816 Ras-GTPase-activating protein GAP120 283 112 352 NM_030147 bromodomain containing 8 282 276 147 NM_027187 ribonuclease H2 large subunit 282 218 202 NM_023331 mitochondrial ribosomal protein L46 282 143 264 NM_011640 transformation related protein 53 282 90 234 NM_025609 mitogen-activated protein kinase kinase kinase 7 282 41 139 NM_013758 adducin 3 gamma 282 62 45 NM_016926 squamous cell carcinoma antigen recognized by 281 1067 463 NM_025626 hypothetical protein LOC66540 281 508 294 NM_028250 acyl-Coenzyme A binding domain containing 6 281 405 224 NM_025690 modulator of estrogen induced transcription 281 325 143 NM_133345 inhibitor of growth family member 4 281 186 235 NM_022009 flightless I homolog 281 72 255 NM_138755 PHD finger protein 21A isoform 1 281 47 264 NM_029101 hypothetical protein LOC74778 281 56 237 NM_016752 solute carrier family 35 member B1 281 167 74 NM_007935 enhancer of polycomb homolog 1 isoform 1 280 18 334 NM_016844 ribosomal protein S28 280 72 99 NM_010026 development and differentiation enhancing 279 556 227 NM_172498 PTK2 protein tyrosine kinase 2 beta 279 694 56 NM_182806 G protein-coupled receptor 18 279 315 240 NM_026712 zinc finger protein 414 279 330 202 NM_145979 chromodomain helicase DNA binding protein 4 279 55 197 NM_025500 mitochondrial ribosomal protein L37 279 6374 493 NM_010106 eukaryotic translation elongation factor 1 alpha 279 276 90 NM_007644 scavenger receptor class B member 2 279 142 178 NM_011101 protein kinase C alpha 279 153 115 NM_001080706 BTAF1 RNA polymerase II B-TFIID transcription 278 1434 109 NM_027162 MIF4G domain containing 278 602 216 NM_026275 ubiquitin-conjugating enzyme E2R 2 278 343 147 NM_001105667 deoxythymidylate kinase isoform 1 278 193 286 NM_011494 serine/threonine kinase 16 278 154 80 NM_145524 methyltransferase like 8 isoform a 278 69 140 NM_026313 cisplatin resistance-associated overexpressed 277 6307 303 NM_027196 small subunit DNA polymerase delta p12 277 37 238 NM_181569 alpha globin regulatory element containing 277 73 159 NM_172819 DIP2 disco-interacting protein 2 homolog B 276 756 488 NM_026660 tetracycline transporter-like protein 276 260 115 NM_026960 gasdermin D 276 197 100 NM_025518 dihydrouridine synthase 2-like 275 130 305 NM_025946 reactive oxygen species modulator 1 275 193 143 NM_018783 tuftelin interacting protein 11 275 206 115 NM_130864 acetyl-Coenzyme A acyltransferase 1 274 1023 124 NM_178651 solute carrier family 30 zinc transporter 274 147 86 NM_145933 beta galactoside alpha 26 sialyltransferase 1 273 1082 221 NM_008142 guanine nucleotide-binding protein beta-1 273 203 257 NM_144872 echinoderm microtubule associated protein like 273 189 255 NM_021354 developmentally regulated GTP binding protein 2 273 36 222 NM_178379 COX10 homolog cytochrome c oxidase assembly 273 85 157 NM_201245 Rho interacting protein 3 isoform 1 273 70 113 NM_016858 RAB33B member of RAS oncogene family 272 541 219 NM_183256 hypothetical protein LOC66379 272 355 214 NM_024229 phosphate cytidylyltransferase 2 ethanolamine 272 266 228 NM_027349 RNA binding motif protein 25 272 183 107 NM_023305 ubiquitin-associated protein 1 272 65 155 NM_008702 nemo like kinase 271 304 291 NM_016810 golgi SNAP receptor complex member 1 271 410 73 NM_030258 G protein-coupled receptor 146 271 85 163 NM_029492 DHHC-containing protein 20 271 181 371 NM_001039189 phenylalanine-tRNA synthetase 2 mitochondrial 271 261 215 NM_198429 nuclear factor of activated T-cells 271 47 314 NM_016788 tyrosine kinase non-receptor, 2 isoform 1 271 194 141 NM_177089 transforming acidic coiled-coil containing 271 113 159 NM_144849 ankyrin repeat domain 54 270 1516 132 NM_147778 COMM domain containing 3 270 348 172 NM_177592 transmembrane protein 164 270 44 272 NM_008688 nuclear factor I/C isoform a 269 246 294 NM_022992 ADP-ribosylation factor-like 6 interacting 269 193 160 NM_178647 CGG triplet repeat binding protein 1 269 60 208 NM_026681 coiled-coil domain containing 88C 269 58 143 NM_021516 MAP/microtubule affinity-regulating kinase 3 268 943 230 NM_025365 prickle homolog 4 268 458 200 NM_145390 karyopherin importin beta 2b 268 228 361 NM_009473 nuclear receptor subfamily 1 group H, member 2 268 97 309 NM_019489 peptidylprolyl isomerase E 268 50 222 NM_009071 Rho-associated coiled-coil forming kinase 1 268 51 138 NM_027707 delangin isoform A 268 31 17 NM_010848 myeloblastosis proto-oncogene product 267 1465 89 NM_026676 hypothetical protein LOC68327 266 1038 160 NM_028782 protease serine, 15 266 402 181 NM_172661 hypothetical protein LOC227723 266 485 75 NM_146032 signal recognition particle 68 266 46 306 NM_178682 hypothetical protein LOC217684 266 162 172 NM_144846 hypothetical protein LOC223601 266 155 147 NM_026729 immature colon carcinoma transcript 1 266 31 80 NM_009193 stem-loop binding protein 265 413 128 NM_152800 torsin family 2 member A 265 143 69 NM_013587 low density lipoprotein receptor-related protein 265 46 164 NM_008467 karyopherin alpha 4 265 148 54 NM_013865 N-myc downstream regulated gene 3 264 1308 248 NM_008689 nuclear factor kappa-B subunit 1 264 396 148 NM_146150 nardilysin N-arginine dibasic convertase, NRD 264 245 174 NM_019827 glycogen synthase kinase 3 beta 264 93 234 NM_001031814 PI-3-kinase-related kinase SMG-1 264 52 195 NM_001085355 AT rich interactive domain 1B Swi1 like 264 120 113 NM_016882 squamous cell carcinoma antigen recognized by 264 40 110 NM_175419 ARP5 actin-related protein 5 homolog 264 28 106 NM_138601 es1 protein 264 61 72 NM_177798 fibroblast growth factor receptor substrate 2 263 168 478 NM_026965 catechol-O-methyltransferase domain containing 263 214 123 NM_177614 amplified in osteosarcoma 263 169 152 NM_010562 integrin linked kinase 263 188 59 NM_175403 hypothetical protein LOC109154 263 97 142 NM_027221 keratinocyte associated protein 3 263 38 112 NM_145362 beta-14-mannosyltransferase 263 1463 169 NM_008945 proteasome beta 4 subunit 263 922 156 NM_033218 sterol regulatory element binding factor 2 263 463 359 NM_007480 ADP-ribosylation factor 5 263 314 187 NM_026446 regulator of G-protein signaling 19 262 209 133 NM_133815 lamin B receptor 262 208 115 NM_025442 dolichyl-phosphate 262 98 138 NM_009186 splicing factor arginine/serine-rich 10 261 340 95 NM_011842 metastasis-associated gene family member 2 261 160 229 NM_027475 suppressor of S. cerevisiae gcr2 260 651 186 NM_206534 churchill domain containing 1 260 457 168 NM_019837 nudix nucleotide diphosphate linked moiety 260 294 176 NM_011908 ubiquitin-like 3 260 224 216 NM_021389 SH3-domain kinase binding protein 1 260 248 165 NM_026048 cyclin-dependent kinase 2-interacting protein 260 239 165 NM_021887 interleukin 21 receptor 260 229 110 NM_172145 hypothetical protein LOC230752 260 42 52 NM_026242 Morf4 family associated protein 1 259 857 483 NM_178907 mitogen-activated protein kinase-activated 259 938 74 NM_028023 cell division cycle associated 4 259 339 615 NM_024215 zinc finger protein 593 259 158 242 NM_172438 THO complex 5 259 80 293 NM_145610 peter pan homolog 259 145 204 NM_024179 hypothetical protein LOC66839 259 23 235 NM_008627 myeloid ecotropic viral integration site-related 258 1807 143 NM_146200 eukaryotic translation initiation factor 3 258 183 206 NM_001005507 SMG-7 homolog 258 45 197 NM_028727 nucleolar protein 9 257 405 226 NM_019636 TBC1 domain family member 1 256 6654 440 NM_011185 proteasome prosome macropain subunit, beta 256 2920 249 NM_011434 superoxide dismutase 1 soluble 256 111 537 NM_001033293 UDP-N-acteylglucosamine pyrophosphorylase 1-like 256 385 219 NM_008774 poly A binding protein cytoplasmic 1 256 402 181 NM_007898 phenylalkylamine Ca2+ antagonist emopamil 256 437 117 NM_153125 SEC16 homolog A 255 1992 193 NM_001033238 Casitas B-lineage lymphoma b 255 50 601 NM_008635 microtubule-associated protein 7 255 148 338 NM_026468 ATP synthase H+ transporting, mitochondrial F0 255 131 177 NM_001040111 centaurin delta 2 isoform 3 255 130 152 NM_033572 Williams-Beuren syndrome chromosome region 16 255 168 56 NM_010786 transformed mouse 3T3 cell double minute 2 255 646 268 NM_009975 casein kinase 2 beta polypeptide 255 90 407 NM_025931 RAB member of RAS oncogene family-like 4 255 112 292 NM_144941 microtubule-associated protein 7 domain 255 63 157 NM_001033383 hypothetical protein LOC319748 254 27 365 NM_198034 SID1 transmembrane family member 1 254 299 79 NM_026753 hypothetical protein LOC68523 254 151 76 NM_009433 testis-specific protein Y-encoded-like 1 254 84 141 NM_001033430 jumonji C domain-containing histone demethylase 254 20 96 NM_028945 retinoblastoma-associated protein 140 253 403 448 NM_023142 actin related protein 2/3 complex subunit 1B 253 358 254 NM_199197 hypothetical protein LOC68731 253 97 428 NM_175450 WD repeat domain 18 253 159 119 NM_023431 UBE-1C2 protein 253 85 162 NM_028193 transcription initiation factor IIIB 253 93 120 NM_016806 heterogeneous nuclear ribonucleoprotein A2/B1 252 1691 266 NM_133950 KDEL endoplasmic reticulum protein retention 252 800 177 NM_021345 protein tyrosine phosphatase-like A domain 252 783 142 NM_010688 LIM and SH3 protein 1 252 186 231 NM_028162 TBC1 domain family member 5 252 20 60 NM_001001884 hypothetical protein LOC380969 251 530 160 NM_134137 leucyl-tRNA synthetase 251 236 337 NM_009319 TAR HIV RNA binding protein 2 251 233 88 NM_008786 protein-L-isoaspartate D-aspartate 251 20 25 NM_010378 histocompatibility 2 class II antigen A, alpha 250 1471 530 NM_007656 CD82 antigen 250 143 233 NM_144831 DEAH Asp-Glu-Ala-His box polypeptide 8 250 90 99 NM_144880 protein phosphatase 2 regulatory subunit B 250 82 102 NM_020575 membrane-associated ring finger C3HC4 7 249 1063 325 NM_010880 nucleolin 249 84 205 NM_020005 p300/CBP-associated factor 249 127 100 NM_023672 single-stranded DNA-binding protein isoform a 248 833 77 NM_153287 AXIN1 up-regulated 1 247 216 267 NM_026827 hypothetical protein LOC68742 247 268 135 NM_054043 Musashi homolog 2 247 38 243 NM_029643 G protein-coupled receptor 172B 247 158 42 NM_172579 signal-induced proliferation-associated 1 like 247 93 36 NM_010580 integrin beta 5 247 711 272 NM_172665 pyruvate dehydrogenase kinase isoenzyme 1 247 328 206 NM_029673 inner membrane protein mitochondrial 247 104 246 NM_181413 ankyrin repeat and sterile alpha motif domain 247 161 186 NM_013711 thioredoxin reductase 2 precursor 247 130 122 NM_001037810 sialophorin 247 90 137 NM_009431 SH2 domain binding protein 1 tetratricopeptide 247 84 96 NM_145125 bromodomain and WD repeat domain containing 1 246 349 212 NM_022880 equilibrative nucleoside transporter 1 246 114 398 NM_001001566 chondroitin polymerizing factor isoform a 246 157 287 NM_001039509 brain protein 17 isoform 3 246 154 250 NM_144792 phosphatidylcholine:ceramide 246 126 119 NM_009030 retinoblastoma binding protein 4 246 28 93 NM_013767 casein kinase 1 epsilon 245 515 141 NM_025947 dynein light chain roadblock-type 1 245 381 166 NM_133795 tetratricopeptide repeat domain 1 245 167 200 NM_016874 deformed epidermal autoregulatory factor 1 245 195 127 NM_028705 hect domain and RLD 3 245 82 76 NM_176833 protein phosphatase 1F PP2C domain containing 245 52 91 NM_001042660 MAD homolog 7 244 106 3678 NM_009251 serine or cysteine proteinase inhibitor clade 244 296 91 NM_001083927 transducin-like enhancer protein 3 isoform 1 244 112 245 NM_207207 mitochondrial ribosomal protein S26 244 126 118 NM_001045489 milk fat globule-EGF factor 8 protein isoform 2 244 59 127 NM_177394 hypothetical protein LOC338371 244 47 76 NM_016974 D site albumin promoter binding protein 243 234 273 NM_001081011 SLIT-ROBO Rho GTPase activating protein 2 243 39 241 NM_028316 zinc finger protein 444 243 60 137 NM_145607 tetratricopeptide repeat domain 13 243 61 130 NM_013836 transcription factor 20 isoform b 243 76 97 NM_183137 hypothetical protein LOC78777 243 56 74 NM_001080808 coiled-coil domain containing 64 243 20 93 NM_001038999 ATPase aminophospholipid transporter APLT, 242 516 400 NM_020583 interferon stimulated exonuclease 242 63 442 NM_133714 hypothetical protein LOC69612 242 79 296 NM_011989 solute carrier family 27 fatty acid 242 270 93 NM_026942 stomatin-like 1 241 588 217 NM_029735 glutamyl-prolyl-tRNA synthetase 241 368 145 NM_145412 hypothetical protein LOC214987 241 187 254 NM_025966 hypothetical protein LOC67101 241 305 122 NM_138669 eukaryotic translation initiation factor 4A 241 174 148 NM_144791 torsin A interacting protein 1 241 38 106 NM_133919 myeloid/lymphoid or mixed-lineage leukemia 241 23 35 NM_010189 Fc receptor IgG, alpha chain transporter 240 427 204 NM_009942 cytochrome c oxidase subunit Vb 240 128 359 NM_080461 zinc finger protein 358 240 113 272 NM_026000 proteasome 26S non-ATPase subunit 9 240 101 197 NM_027554 ubiquitin specific peptidase 38 240 170 125 NM_028933 hypothetical protein LOC67998 isoform 2 240 137 124 NM_001085492 arginine glutamic acid dipeptide RE repeats 240 72 141 NM_011062 3-phosphoinositide dependent protein kinase-1 239 1555 193 NM_027874 casein kinase 1 delta isoform 2 239 902 78 NM_010886 NADH dehydrogenase ubiquinone 1 alpha 239 247 176 NM_013625 platelet-activating factor acetylhydrolase 239 216 178 NM_025709 GTPase activating protein and VPS9 domains 1 239 175 93 NM_010591 Jun oncogene 239 96 155 NM_028227 BRCA1 associated protein 239 83 51 NM_027604 ubiquitin specific peptidase 15 239 74 54 NM_172725 hypothetical protein LOC231855 239 328 246 NM_009283 signal transducer and activator of transcription 239 216 189 NM_013557 eukaryotic translation initiation factor 2 alpha 239 140 262 NM_025560 hypothetical protein LOC66431 239 126 187 NM_001004144 G protein-coupled receptor kinase-interactor 1 239 97 120 NM_010440 high mobility group 20 B 239 77 69 NM_010811 N-deacetylase/N-sulfotransferase heparan 238 380 166 NM_010718 LIM motif-containing protein kinase 2 isoform a 238 15 143 NM_007923 ELK4 member of ETS oncogene family 237 529 200 NM_025691 signal recognition particle 72 237 508 121 NM_025395 coiled-coil-helix-coiled-coil-helix domain 237 237 189 NM_001039551 cyclin M3 isoform 2 237 72 144 NM_145619 poly ADP-ribose polymerase family member 3 237 89 115 NM_026855 ARV1 homolog 237 93 111 NM_025816 Tax1 binding protein 1 homolog 236 141 297 NM_027204 mitochondrial ribosomal protein L12 236 76 116 NM_024203 PPARgamma constitutive coactivator 1 236 82 99 NM_173440 nuclear receptor interacting protein 1 235 442 143 NM_028887 SMC hinge domain containing 1 235 115 307 NM_016896 mitogen-activated protein kinase kinase kinase 235 138 185 NM_029834 protein phosphatase 1 regulatory subunit 12C 234 519 243 NM_019502 fractured callus expressed transcript 1 234 527 76 NM_026330 non-SMC element 1 homolog 234 156 348 NM_016915 phospholipase A2 group VI 234 375 99 NM_001113470 nuclear LIM interactor-interacting factor 2 234 76 174 NM_001039965 hypothetical protein LOC66869 234 48 193 NM_008284 Harvey rat sarcoma virus oncogene 1 234 45 152 NM_173368 chromodomain helicase DNA binding protein 6 234 30 82 NM_001033273 hypothetical protein LOC223739 234 27 78 NM_001033432 headcase homolog 233 200 191 NM_025358 NADH dehydrogenase ubiquinone 1 alpha 233 118 234 NM_009546 tripartite motif protein 25 233 96 146 NM_011365 SH3 domain protein 1B 233 152 66 NM_001045483 MAPK-interacting and spindle-stabilizing 232 1426 146 NM_027935 transmembrane protein 50A 232 706 237 NM_009870 cyclin-dependent kinase 4 232 552 236 NM_019776 staphylococcal nuclease domain containing 1 232 286 320 NM_019424 pale ear 232 314 176 NM_016852 WW domain binding protein 2 232 50 294 NM_175454 hypothetical protein LOC217310 232 80 220 NM_134011 transforming growth factor beta regulated gene 232 168 115 NM_008620 macrophage activation 2 232 94 150 NM_026370 MYST histone acetyltransferase 1 232 100 127 NM_133747 hypothetical protein LOC72722 232 62 132 NM_011251 RNA binding motif protein 6 isoform a 232 575 137 NM_029896 WD repeat domain containing 82 232 80 325 NM_010879 non-catalytic region of tyrosine kinase adaptor 232 162 235 NM_025569 microsomal glutathione S-transferase 3 232 138 102 NM_001003908 clathrin heavy polypeptide Hc 231 1601 159 NM_011486 signal transducer and activator of transcription 231 1163 123 NM_001003933 reticulon 3 isoform 2 231 426 218 NM_016786 ubiquitin-conjugating enzyme E2-25K 231 239 201 NM_026148 LIM and senescent cell antigen-like domains 1 231 171 236 NM_027883 DEAH Asp-Glu-Ala-His box polypeptide 34 231 150 137 NM_133715 Rho GTPase activating protein 27 isoform 1 231 32 176 NM_028037 acyl-Coenzyme A dehydrogenase family member 10 231 94 103 NM_028041 DEAD Asp-Glu-Ala-Asp box polypeptide 54 230 724 138 NM_016736 Nedd8 ultimate buster-1 230 13 339 NM_175662 histone cluster 2 H2ac 230 74 145 NM_026616 AYP1 protein 230 90 103 NM_022995 transmembrane prostate androgen-induced protein 229 232 192 NM_007952 protein disulfide isomerase associated 3 229 112 244 NM_025671 2-oxoglutarate and iron-dependent oxygenase 229 199 95 NM_145589 proline rich 14 229 39 110 NM_178757 interferon regulatory factor 2 binding protein 229 26 121 NM_207682 kinesin family member 1B isoform b 228 788 73 NM_010027 D-dopachrome tautomerase 228 584 179 NM_010798 macrophage migration inhibitory factor 228 488 235 NM_011952 mitogen activated protein kinase 3 228 205 137 NM_026154 mitochondrial ribosomal protein L10 228 201 136 NM_009682 adaptor-related protein complex 3 sigma 2 228 42 254 NM_130454 RecQ protein-like 5 228 71 215 NM_144858 dihydrouridine synthase 3-like 228 181 101 NM_011492 serine/threonine kinase 11 228 104 87 NM_001110100 Btg3 associated nuclear protein isoform 1 228 38 109 NM_009282 stromal antigen 1 228 38 93 NM_027381 hypothetical protein LOC70312 227 497 426 NM_138656 mevalonate diphospho decarboxylase 227 462 187 NM_011592 translocase of inner mitochondrial membrane 44 227 454 174 NM_007970 enhancer of zeste homolog 1 227 234 236 NM_016857 exocyst complex component 7 227 181 161 NM_009955 dihydropyrimidinase-like 2 227 209 128 NM_148926 zinc finger AN1-type domain 3 227 195 127 NM_026035 mitochondrial ribosomal protein L55 227 86 180 NM_024187 U2 small nuclear ribonucleoprotein auxiliary 227 83 128 NM_029498 zinc finger protein 198 227 53 75 NM_001081279 malignant fibrous histiocytoma amplified 226 406 355 NM_009896 suppressor of cytokine signaling 1 226 544 149 NM_026444 citrate synthase 226 316 210 NM_007604 capping protein actin filament muscle Z-line 226 163 171 NM_008997 RAB11B member RAS oncogene family 226 150 173 NM_133932 transcriptional adaptor 3-like 226 52 210 NM_001077495 phosphatidylinositol 3-kinase regulatory 226 104 129 NM_207234 XPMC2 prevents mitotic catastrophe 2 homolog 225 5441 1411 NM_007585 annexin A2 225 786 204 NM_022417 integral membrane protein 2C 225 694 258 NM_001081274 phosphogluconate dehydrogenase 225 124 235 NM_001083922 WW domain binding protein 1 isoform 2 225 187 132 NM_172965 mSin3A-associated protein 130 225 69 94 NM_172478 TBC1 domain family member 25 224 434 206 NM_023200 protein phosphatase-1 regulatory subunit 7 224 211 227 NM_134000 Traf3 interacting protein 2 224 259 160 NM_008033 farnesyltransferase CAAX box, alpha 224 106 175 NM_178666 hypothetical protein LOC210757 224 119 136 NM_026399 mitogen-activated protein kinase organizer 1 224 147 94 NM_176843 integrator complex subunit 5 224 137 71 NM_007890 dual-specificity tyrosine-Y-phosphorylation 224 480 225 NM_011803 Kruppel-like factor 6 224 173 134 NM_001081381 transmembrane protein 103 224 117 189 NM_026689 hypothetical protein LOC68350 224 144 146 NM_027242 hypothetical protein LOC69871 224 12 38 NM_178111 transformation related protein 53 inducible 223 596 60 NM_017472 sorting nexin 3 223 258 273 NM_019883 ubiquitin A-52 residue ribosomal protein fusion 223 217 176 NM_028771 coiled-coil domain containing 97 223 84 278 NM_026054 hypothetical protein LOC67246 223 69 140 NM_172269 vacuolar protein sorting 18 222 334 213 NM_001048061 heterogeneous nuclear ribonucleoprotein A/B 222 180 185 NM_023371 protein peptidyl-prolyl cis/trans isomerase 222 259 95 NM_025607 ring finger protein 181 222 256 67 NM_033146 hypothetical protein LOC85308 222 120 152 NM_023154 ETHE1 protein 222 120 146 NM_178116 calmodulin binding transcription activator 2 222 119 93 NM_010368 glucuronidase beta 222 51 154 NM_030178 bromodomain and PHD finger containing 1 221 1638 153 NM_020569 DJ-1 protein 221 892 108 NM_019951 Sec11-like 1 221 829 130 NM_134040 DEAD Asp-Glu-Ala-Asp box polypeptide 1 221 224 101 NM_018743 lysophosphatidic acid acyltransferase zeta 221 116 203 NM_025412 pyrroline-5-carboxylate reductase-like 220 2414 173 NM_007642 CD28 antigen 220 1112 184 NM_008617 malate dehydrogenase 2 NAD mitochondrial 220 696 172 NM_008569 anaphase promoting complex subunit 1 220 625 105 NM_009397 tumor necrosis factor alpha-induced protein 3 220 427 144 NM_011241 RAN GTPase activating protein 1 220 349 45 NM_201407 DENN/MADD domain containing 4B 220 198 151 NM_025356 ubiquitin-conjugating enzyme E2D 3 UBC4/5 220 179 157 NM_007481 ADP-ribosylation factor 6 220 83 93 NM_007507 ATP synthase H+ transporting, mitochondrial 220 48 18 NM_023232 diablo 219 698 246 NM_001038492 cathepsin A isoform b 219 313 244 NM_007997 ferredoxin reductase 219 343 136 NM_023162 nuclear RNA polymerase I small specific subunit 219 318 139 NM_008698 4-nitrophenylphosphatase domain and non-neuronal 219 33 406 NM_198119 leucine rich repeat containing 24 219 88 325 NM_025297 trans-2-enoyl-CoA reductase mitochondrial 219 274 138 NM_176831 phosphopantothenoylcysteine decarboxylase 219 116 290 NM_008894 polymerase DNA directed delta 2, regulatory 219 38 112 NM_008960 phosphatase and tensin homolog 219 26 29 NM_178931 tumor necrosis factor receptor superfamily 219 0 5 NM_001037859 colony stimulating factor 1 receptor 218 1321 94 NM_022994 death-associated protein 3 218 283 123 NM_007933 enolase 3 beta muscle 218 229 131 NM_023190 apoptotic chromatin condensation inducer 1 218 130 204 NM_023058 protein kinase membrane associated 218 114 93 NM_173388 solute carrier family 43 member 2 218 62 123 NM_178162 HIV-1 Rev-binding protein-like protein isoform 218 66 118 NM_194262 retinoblastoma binding protein 1-like 1 isoform 218 45 101 NM_016716 cullin 3 218 48 44 NM_001077265 heterogeneous nuclear ribonucleoprotein D 217 736 89 NM_024182 RIO kinase 3 217 614 122 NM_009465 AXL receptor tyrosine kinase 217 439 139 NM_021518 RAB2 member RAS oncogene family 217 220 318 NM_027817 GRB2-related adaptor protein 217 240 228 NM_022331 homocysteine-inducible endoplasmic reticulum 217 275 108 NM_001081412 breakpoint cluster region homolog 217 193 115 NM_153144 zinc finger protein 403 217 47 207 NM_011571 testis specific protein kinase 1 217 48 114 NM_001033536 regulatory factor X domain containing 2 homolog 217 55 43 NM_172696 InaD-like protein isoform 1 216 672 423 NM_010768 megakaryocyte-associated tyrosine kinase 216 568 60 NM_178149 calcineurin-regulated kringle domain protein 216 414 180 NM_022432 sirtuin 2 silent mating type information 216 369 214 NM_024225 sorting nexin 5 216 403 110 NM_016715 cytokine receptor-like factor 2 216 97 268 NM_021429 HCLS1 binding protein 3 216 165 159 NM_009336 transcription factor-like 1 216 160 141 NM_018793 tyrosine kinase 2 216 59 110 NM_027293 pad-1-like isoform 1 216 130 422 NM_011150 lectin galactoside-binding, soluble, 3 binding 216 394 132 NM_207678 cyclin L2 216 153 178 NM_001002764 telomerase subunit EST1A 216 165 154 NM_174852 PHD finger protein 12 216 145 172 NM_008566 minichromosome maintenance deficient 5 cell 216 51 174 NM_001009947 dedicator of cytokinesis 11 216 55 137 NM_001100591 ring finger and CCCH-type zinc finger domains 2 215 282 189 NM_010719 lipase hormone sensitive isoform 1 215 183 94 NM_172538 transmembrane protein vezatin 215 116 151 NM_025648 phenylalanyl-tRNA synthetase alpha subunit 215 43 56 NM_001033262 membrane-associated ring finger C3HC4 9 214 486 123 NM_007799 cathepsin E preproprotein 214 483 70 NM_009754 BCL2-like 11 apoptosis facilitator isoform 3 214 259 202 NM_026144 dehydrodolichyl diphosphate synthase 214 233 150 NM_011691 vav 1 oncogene 214 51 112 NM_183034 pleckstrin homology domain containing family M 213 659 397 NM_025360 transmembrane emp24 domain containing 3 213 758 159 NM_001039581 ATP-binding cassette sub-family A ABC1, 213 288 162 NM_033618 suppressor of Ty 16 homolog 213 233 170 NM_001001983 phosphatidylinositol 4-kinase type 3 alpha 213 125 214 NM_172618 BTB POZ domain containing 9 213 154 164 NM_148929 Na-H exchanger isoform NHE8 isoform a 212 332 140 NM_212470 apoptosis related protein APR-3 isoform 2 212 365 64 NM_007478 ADP-ribosylation factor 3 212 158 188 NM_011955 nucleotide binding protein 1 212 173 137 NM_001039080 RNA binding motif single stranded interacting 212 171 59 NM_144868 pecanex-like 3 212 115 99 NM_198703 WNK lysine deficient protein kinase 1 212 34 135 NM_178183 histone cluster 1 H2ak 211 638 154 NM_011790 ariadne homolog 2 211 499 134 NM_010481 heat shock protein 9 211 318 248 NM_011650 translin 211 297 103 NM_174874 autophagin 1 211 123 177 NM_001039878 zinedin isoform 2 211 240 59 NM_172428 coiled-coil domain containing 134 211 217 80 NM_011056 phosphodiesterase 4D cAMP specific 211 32 35 NM_015796 F-box protein 17 210 14 641 NM_028481 coiled-coil domain containing 18 210 346 202 NM_025403 nucleolar protein family A member 3 210 281 212 NM_010708 lectin galactose binding, soluble 9 210 188 181 NM_010256 phosphoribosylglycinamide formyltransferase 210 174 181 NM_001077661 up-regulated gene 4 isoform 2 210 152 162 NM_172689 DEAD/H box polypeptide RIG-I 210 154 81 NM_016677 hippocalcin-like 1 210 115 108 NM_028487 G+C-rich promoter-binding protein 209 317 22679 NM_013653 chemokine C-C motif ligand 5 209 548 223 NM_026914 hypothetical protein LOC69029 209 273 359 NM_012032 tumor differentially expressed protein 1 209 480 122 NM_053119 enoyl Coenzyme A hydratase short chain, 1, 209 216 272 NM_172639 DPCD protein 209 15 341 NM_023146 RAN binding protein 17 209 183 155 NM_145426 microfibrillar-associated protein 3 208 275 169 NM_027498 hypothetical protein LOC70661 208 116 193 NM_080638 major vault protein 208 86 138 NM_025582 hypothetical protein LOC66469 208 51 75 NM_011161 mitogen-activated protein kinase 11 208 273 118 NM_009774 budding uninhibited by benzimidazoles 3 homolog 208 294 87 NM_025546 ribosomal L1 domain containing 1 208 256 88 NM_027088 Brca1 associated protein 1 208 185 151 NM_011879 IK cytokine 208 105 224 NM_001045520 clathrin interactor 1 208 118 172 NM_023202 NADH dehydrogenase ubiquinone 1 alpha 208 159 123 NM_019402 polyA binding protein nuclear 1 208 141 122 NM_197940 Wire protein 208 170 90 NM_053197 sideroflexin 3 208 128 86 NM_012049 nitrilase 1 208 8 162 NM_001099328 hypothetical protein LOC100043757 208 28 132 NM_207525 OPA3 protein 207 291 69 NM_009761 BCL2/adenovirus E1B interacting protein 3-like 207 61 260 NM_146153 thyroid hormone receptor associated protein 3 207 154 100 NM_011945 mitogen-activated protein kinase kinase kinase 207 76 126 NM_001083328 GTP binding protein 5 207 69 131 NM_001033161 TNFRSF1A-associated via death domain 207 71 101 NM_001081058 cell division cycle 2-like 5 207 13 154 NM_011820 gamma-glutamyltransferase-like activity 1 207 11 17 NM_007680 Eph receptor B6 206 683 195 NM_008633 microtubule-associated protein 4 206 530 132 NM_011358 splicing factor arginine/serine-rich 2 206 129 463 NM_027892 protein phosphatase 1 regulatory inhibitor 206 145 380 NM_023525 carbamoyl-phosphate synthetase 2 aspartate 206 290 136 NM_022022 ubiquitination factor E4B 206 233 135 NM_016802 ras homolog gene family member A 206 167 178 NM_013860 LIM domains containing 1 206 94 167 NM_001081267 remodeling and spacing factor 1 206 47 165 NM_021888 queuine tRNA-ribosyltransferase 1 206 47 144 NM_175137 valyl-tRNA synthetase 2-like 206 70 117 NM_001001882 regulator of telomere elongation helicase 1 206 59 51 NM_028063 tRNA 5-methylaminomethyl-2-thiouridylate 206 17 59 NM_172787 l3mbt-like 3 206 18 56 NM_134135 solute carrier family 39 zinc transporter 205 2823 258 NM_011660 thioredoxin 1 205 368 136 NM_018750 Ras association RalGDS/AF-6 domain family 5 205 258 165 NM_134037 ATP citrate lyase 205 109 193 NM_007406 adenylate cyclase 7 205 141 148 NM_013507 eukaryotic translation initiation factor 4 205 58 96 NM_007872 DNA methyltransferase 3A isoform 1 204 367 187 NM_025397 mediator of RNA polymerase II transcription 204 375 69 NM_009497 vesicle-associated membrane protein 2 204 309 115 NM_023215 hypothetical protein LOC66511 204 175 217 NM_025960 trafficking protein particle complex 6A 204 166 105 NM_178811 tetratricopeptide repeat domain 15 204 34 85 NM_001081490 f-box only protein 9 isoform 2 204 24 22 NM_001081222 establishment of cohesion 1 homolog 1 203 291 66 NM_001003918 ubiquitin specific peptidase 7 203 232 73 NM_019963 signal transducer and activator of transcription 203 182 117 NM_138680 LUC7-like 2 203 85 191 NM_180662 NIK and IKKbeta binding protein isoform 2 203 76 194 NM_023910 TSC22-related inducible leucine zipper 2 203 99 84 NM_172674 PHD finger protein 20 203 57 110 NM_007619 Casitas B-lineage lymphoma 203 29 123 NM_145569 methionine adenosyltransferase II alpha 202 103 168 NM_201357 tumor suppressing subtransferable candidate 1 202 60 141 NM_019796 NS1-associated protein 1 isoform 2 202 73 123 NM_144825 TAO kinase 1 202 63 81 NM_001024952 roquin 201 469 115 NM_024218 ribosomal protein L24 201 411 156 NM_138315 microtubule associated monoxygenase calponin 201 359 179 NM_001081417 chromodomain helicase DNA binding protein 7 201 324 78 NM_152895 PLU1 201 279 101 NM_013931 mitogen-activated protein kinase 8 interacting 201 194 122 NM_201351 cytochrome b ascorbate dependent 3 protein 201 54 227 NM_134083 chromosome condensation 1-like 201 32 247 NM_145713 histone cluster 1 H1d 201 72 183 NM_178787 hypothetical protein LOC320678 isoform b 201 68 138 NM_207670 GRIP1 associated protein 1 201 53 55 NM_016845 proacrosin binding protein 200 527 257 NM_022996 Nedd4 family interacting protein 1 200 213 234 NM_023240 eukaryotic translation elongation factor 1 delta 200 177 164 NM_011956 nucleotide binding protein 2 200 170 144 NM_021394 Z-DNA binding protein 1 200 148 129 NM_010509 interferon receptor 2 isoform a precursor 200 77 150 NM_033565 AF4/FMR2 family member 4 200 59 93 NM_001077712 stromal antigen 2 200 104 35 NM_053183 DEAD Asp-Glu-Ala-Asp box polypeptide 50 200 56 76 NM_178606 receptor accessory protein 3 200 812 102 NM_001111111 autophagy related 16 like 2 200 106 200 NM_020024 TAF10 RNA polymerase II TATA box binding 200 89 180 NM_146176 CCR4-NOT transcription complex subunit 3 200 129 137 NM_009745 B-cell CLL/lymphoma 7B 200 31 173 NM_139229 component of oligomeric golgi complex 8 200 74 93 NM_029843 hypothetical protein LOC77036 200 29 137 NM_009530 alpha thalassemia/mental retardation syndrome 199 729 138 NM_053074 nucleoporin 62 199 400 198 NM_178626 CDC42 small effector 2 199 373 48 NM_029657 mahogunin ring finger 1 199 156 214 NM_010421 hexosaminidase A 199 152 136 NM_016739 cytoplasmic activation/proliferation-associated 199 57 206 NM_177613 cell division cycle 34 homolog 199 196 51 NM_028149 F-box and leucine-rich repeat protein 20 199 115 115 NM_023131 Ras and a-factor-converting enzyme 1 homolog 199 60 125 NM_177359 zinc finger protein 199 27 75 NM_023733 carnitine O-octanoyltransferase 198 101 110 NM_018758 amyloid beta A4 precursor protein-binding 198 73 102 NM_015759 FYVE RhoGEF and PH domain containing 3 198 69 103 NM_001003717 oxysterol-binding protein-like protein 8 isoform 198 48 114 NM_172681 hypothetical protein LOC229473 197 476 310 NM_001081454 furin paired basic amino acid cleaving enzyme 197 154 299 NM_133800 nucleolar protein 12 197 132 258 NM_028898 raptor 197 186 59 NM_146036 AHA1 activator of heat shock 90kDa protein 197 24 210 NM_027122 major facilitator superfamily domain containing 197 39 142 NM_183170 hypothetical protein LOC234384 197 29 108 NM_001035226 exportin 1 CRM1 homolog 197 87 47 NM_027422 mesoderm induction early response 1 family 196 459 124 NM_026070 coiled-coil domain containing 53 196 405 116 NM_144541 brain and reproductive organ-expressed protein 196 153 169 NM_009478 uroporphyrinogen decarboxylase 196 152 138 NM_001007567 solute carrier family 7 member 6 opposite 196 156 88 NM_013716 ras-GTPase-activating protein SH3-domain 196 52 156 NM_001077695 nuclear receptor coactivator 2 isoform b 196 90 114 NM_145955 hypothetical protein LOC210711 196 141 63 NM_053168 tripartite motif protein 11 196 42 157 NM_144536 CDK5 regulatory subunit associated protein 195 3342 153 NM_007636 chaperonin subunit 2 beta 195 271 98 NM_146078 ubiquitin protein ligase E3 component n-recognin 195 182 177 NM_133666 NADH dehydrogenase ubiquinone flavoprotein 1 195 185 93 NM_027995 progestin and adipoQ receptor family member VII 195 123 109 NM_172545 euchromatic histone methyltransferase 1 isoform 195 61 165 NM_178592 HLA-B associated transcript 5 195 115 111 NM_018739 retinitis pigmentosa 9 homolog 195 72 115 NM_010804 myeloid/lymphoid or mixed lineage-leukemia 195 4 85 NM_007901 endothelial differentiation sphingolipid 194 552 85 NM_134151 tyrosyl-tRNA synthetase 194 430 158 NM_010918 natural killer tumor recognition 194 387 100 NM_029570 ATPase class VI, type 11B 194 341 106 NM_008714 Notch 1 194 158 249 NM_080288 engulfment and cell motility 1 isoform 1 194 183 175 NM_133979 transmembrane protein 16K 194 211 76 NM_001039157 ubiquitin-conjugating enzyme E2 J2 homolog 194 154 97 NM_021313 ring finger protein 25 194 11 181 NM_008819 phosphatidylethanolamine N-methyltransferase 193 388 144 NM_025996 translocase of outer mitochondrial membrane 34 193 277 153 NM_172436 solute carrier family 25 mitochondrial carrier 193 215 150 NM_026453 RNA binding motif protein 13 193 252 110 NM_013791 muskelin 1 intracellular mediator containing 193 266 95 NM_001110140 ATPase Ca++ transporting, cardiac muscle, slow 193 140 82 NM_010508 interferon receptor 1 precursor 193 75 67 NM_023248 Shwachman-Bodian-Diamond syndrome homolog 192 457 358 NM_175935 glucose-6-phosphatase catalytic subunit 3 192 318 148 NM_028385 SET domain containing 5 192 250 194 NM_025381 ATPase H+ transporting, lysosomal V1 subunit F 192 276 161 NM_133975 thyroid hormone receptor interactor 12 192 225 125 NM_008856 protein kinase C eta 192 202 131 NM_007454 adaptor protein complex AP-1 beta 1 subunit 192 162 167 NM_008062 glucose-6-phosphate dehydrogenase X-linked 192 189 128 NM_013880 phospholipase C-like 2 192 119 177 NM_001013371 deltex 3-like 192 101 102 NM_029885 GA repeat binding protein beta 2 192 52 118 NM_011930 chloride channel 7 192 48 116 NM_001093752 splicing factor arginine/serine-rich 11 isoform 192 57 67 NM_199143 zinc and ring finger 2 192 1742 207 NM_172393 absent in melanoma 1 192 741 97 NM_145925 pituitary tumor-transforming gene 1 192 482 141 NM_019840 phosphodiesterase 4B cAMP specific 192 438 171 NM_010046 diacylglycerol O-acyltransferase 1 192 403 133 NM_027215 transmembrane protein 147 192 132 212 NM_008383 centrosomal protein 2 192 146 137 NM_001082476 NADPH dependent diflavin oxidoreductase 1 192 98 154 NM_153195 F-box only protein 7 192 166 69 NM_138671 NAD kinase 192 40 158 NM_145993 l3mbt-like 2 192 62 107 NM_026342 hypothetical protein LOC67726 192 50 114 NM_153514 Rho-related BTB domain containing 2 191 305 141 NM_026872 ubiquitin-associated protein 2 191 104 79 NM_146085 amyloid beta A4 precursor protein-binding 191 87 81 NM_024499 small glutamine-rich tetratricopeptide repeat 191 23 133 NM_001081132 UPF2 regulator of nonsense transcripts homolog 191 29 112 NM_001004062 CREB regulated transcription coactivator 1 191 33 59 NM_201646 BTB POZ domain containing 6 190 410 125 NM_023579 RAN binding protein 5 190 228 279 NM_010787 male enhanced antigen 1 190 352 106 NM_010898 neurofibromatosis 2 190 144 283 NM_145405 ubiquitin-like 4 190 195 125 NM_001025246 transformation related protein 53 inducible 190 103 191 NM_028731 chr2 synaptotagmin 190 125 164 NM_025594 zinc finger matrin type 2 190 132 137 NM_026675 nudix nucleoside diphosphate linked moiety 190 112 154 NM_001003909 ankyrin repeat and IBR domain containing 1 190 185 43 NM_198164 cyclin-dependent kinase CDC2-like 11 190 29 196 NM_172543 RIKEN cDNA 5730593F17 190 87 59 NM_001081055 transmembrane protein 1 190 52 43 NM_146118 mitochondrial Ca2+-dependent solute carrier 189 1160 110 NM_172941 zinc finger with KRAB and SCAN domains 17 189 314 185 NM_019715 potassium channel modulatory factor DEBT-91 189 334 117 NM_001040690 RAP1 GTP-GDP dissociation stimulator 1 isoform 189 312 132 NM_024432 UBX domain containing 1 189 357 79 NM_026071 solute carrier family 25 member 19 189 112 275 NM_023872 potassium voltage-gated channel subfamily Q, 189 156 157 NM_054082 metastasis associated 3 189 70 221 NM_007944 epidermal growth factor receptor pathway 189 57 209 NM_027256 integrator complex subunit 4 189 152 110 NM_026499 arginine/serine-rich splicing factor 6 189 66 150 NM_025481 SMAD specific E3 ubiquitin protein ligase 2 189 63 143 NM_001111312 leucine rich repeat in FLII interacting 189 95 71 NM_001033261 proline/serine-rich coiled-coil 2 189 10 121 NM_134188 acyl-CoA thioesterase 2 188 234 189 NM_024249 hypothetical protein LOC72055 188 205 96 NM_001031667 glycogen synthase kinase 3 alpha 188 97 173 NM_001045536 zinc finger ZZ-type with EF hand domain 1 188 156 100 NM_198163 RAB35 member RAS oncogene family 188 57 162 NM_010926 COX4 neighbor 188 76 138 NM_026101 hect domain and RLD 4 188 83 114 NM_008946 proteasome prosome macropain subunit, beta 188 12 180 NM_030256 B-cell CLL/lymphoma 9-like 188 82 86 NM_198298 helicase with zinc finger domain 188 51 21 NM_013698 TXK tyrosine kinase 187 167 380 NM_007379 ATP-binding cassette sub-family A ABC1, 187 272 105 NM_146087 casein kinase 1 alpha 1 187 230 146 NM_007983 Fas-associated factor 1 187 81 286 NM_026897 hydroxyacylglutathione hydrolase-like 187 113 213 NM_013908 F-box and WD repeat domain containing 5 187 152 104 NM_133803 dipeptidyl peptidase III 187 154 92 NM_009353 telomeric repeat binding factor 2 isoform 1 187 79 121 NM_029992 trichoplein keratin filament binding 187 76 88 NM_009410 topoisomerase DNA III alpha 186 523 59 NM_029846 APG16L beta isoform 186 260 84 NM_144516 zinc finger MYND domain containing 11 186 116 173 NM_001039363 tuberous sclerosis 2 isoform 2 186 165 120 NM_021876 embryonic ectoderm development 186 45 223 NM_026434 RNA binding motif protein 18 186 25 96 NM_001081251 polybromo 1 186 5 59 NM_172554 zinc finger DHHC domain containing 17 185 322 160 NM_009790 calmodulin 1 185 338 116 NM_181594 cDNA sequence BC022641 185 214 230 NM_019421 putative VLDL lipoprotein receptor precursor 185 119 173 NM_172703 eukaryotic translation initiation factor 4 185 101 161 NM_134021 pyridoxine 5'-phosphate oxidase 185 77 172 NM_172755 arginine/serine-rich 14 splicing factor 185 19 80 NM_001018042 Sp3 transcription factor isoform 1 185 1140 174 NM_138606 serine-threonine protein kinase pim-2 185 684 279 NM_026695 electron transferring flavoprotein beta 185 229 333 NM_030749 endoplasmic reticulum chaperone SIL1 homolog 185 366 114 NM_178652 suppressor of Ty 3 homolog 185 290 56 NM_178398 WD repeat domain phosphoinositide interacting 185 268 76 NM_010411 histone deacetylase 3 185 136 199 NM_133649 solute carrier family 12 member 6 isoform 2 185 194 117 NM_029924 methyl-CpG binding domain protein 5 185 147 149 NM_001081175 inositol 14,5-trisphosphate 3-kinase B 185 32 170 NM_178699 hypothetical protein LOC230991 185 31 161 NM_198023 REST corepressor 1 185 65 118 NM_010247 X-ray repair complementing defective repair in 185 88 93 NM_172142 NF-kappa B inhibitor 185 102 67 NM_177727 LSM14 homolog B 185 84 61 NM_009055 regulatory factor X 1 influences HLA class II 185 42 94 NM_029546 PWP2 periodic tryptophan protein homolog 185 43 87 NM_001081216 pleckstrin homology domain interacting protein 185 106 15 NM_009656 aldehyde dehydrogenase 2 mitochondrial 185 40 37 NM_013790 ATP-binding cassette sub-family C, member 5 184 386 120 NM_026893 WD repeat domain 40A 184 116 163 NM_146069 leucine rich repeat containing 33 184 129 96 NM_001083317 solute carrier family 35 member A4 184 109 85 NM_030732 IRA1 protein 184 51 57 NM_029888 zinc finger protein 142 183 508 46 NM_080446 helicase DNA B 183 390 110 NM_011936 fat mass and obesity-associated protein 183 328 109 NM_009201 solute carrier family 1 neutral amino acid 183 116 259 NM_025920 THAP domain containing 4 183 255 100 NM_029976 CDKN2A interacting protein N-terminal like 183 85 266 NM_008026 Friend leukemia integration 1 183 18 318 NM_029557 tRNA splicing endonuclease 54 homolog 183 173 97 NM_008794 proprotein convertase subtilisin/kexin type 7 183 181 73 NM_031392 WD repeat domain 6 183 129 118 NM_146122 DENN/MADD domain containing 1A 183 69 172 NM_172958 myotubularin related protein 12 183 147 82 NM_198304 nucleoporin 188 183 98 51 NM_153395 MON2 homolog 183 53 69 NM_001081195 retinoblastoma-binding protein 1 183 26 89 NM_026062 hypothetical protein LOC67266 183 26 60 NM_001111110 cytidine monophospho-N-acetylneuraminic acid 182 170 182 NM_027230 protein kinase C binding protein 1 182 153 160 NM_198169 glucocorticoid modulatory element binding 182 174 128 NM_008385 inositol polyphosphate-5-phosphatase B 182 204 88 NM_026697 RAB14 member RAS oncogene family 182 133 121 NM_194342 unc-84 homolog B 182 100 113 NM_010948 nuclear distribution gene C homolog 182 133 63 NM_011751 zinc finger protein 207 182 61 132 NM_172268 nucleoporin 214 182 106 80 NM_001017426 jumonji domain containing 3 182 144 38 NM_021437 hypothetical protein LOC58248 182 63 59 NM_009176 sialyltransferase 6 181 330 378 NM_019990 START domain containing 10 181 131 420 NM_007682 centromere protein B 181 441 74 NM_173350 oxysterol binding protein-like 9 isoform b 181 287 153 NM_138651 phosphatidate cytidylyltransferase 2 181 284 69 NM_007509 vacuolar H+ATPase B2 181 239 110 NM_011811 phenylalanyl-tRNA synthetase beta subunit 181 211 84 NM_008950 protease prosome macropain 26S subunit, 181 132 116 NM_013663 splicing factor arginine/serine-rich 3 SRp20 181 111 134 NM_198296 hypothetical protein LOC71617 181 68 126 NM_030612 nuclear factor of kappa light polypeptide gene 181 62 88 NM_001081355 retinoblastoma protein-binding zinc finger 181 38 80 NM_001081255 leucine-rich repeats and calponin homology CH 180 2826 20 NM_133655 CD 81 antigen 180 310 172 NM_010777 Golli-mbp isoform 1 180 223 173 NM_026775 transmembrane emp24 domain-containing protein 180 267 110 NM_019411 protein phosphatase 2a catalytic subunit, alpha 180 118 69 NM_008540 MAD homolog 4 180 48 25 NM_177603 frequently rearranged in advanced T-cell 179 218 149 NM_027209 membrane-spanning 4-domains subfamily A, member 179 241 117 NM_019581 GTP binding protein 2 179 242 64 NM_178890 ankyrin repeat and BTB POZ domain containing 179 111 125 NM_138585 SR-related CTD associated factor 6 179 83 151 NM_177445 aspartyl-tRNA synthetase 179 115 113 NM_025507 SKI interacting protein 179 14 204 NM_001033378 hypothetical protein LOC319493 179 102 68 NM_183106 tetratricopeptide repeat domain 17 179 52 93 NM_008131 glutamine synthetase 179 37 61 NM_009121 spermidine/spermine N1-acetyl transferase 1 179 34 59 NM_138756 solute carrier family 25 member 36 179 60 19 NM_144800 actin monomer-binding protein 178 297 359 NM_008940 protease serine, 19 178 510 112 NM_001077363 polypyrimidine tract binding protein 1 isoform 178 309 154 NM_008914 protein phosphatase 3 catalytic subunit, beta 178 336 81 NM_018810 makorin ring finger protein, 1 178 227 149 NM_025301 mitochondrial ribosomal protein L17 178 223 98 NM_010432 homeodomain interacting protein kinase 1 178 167 119 NM_028839 transmembrane protein 110 178 58 180 NM_023429 OCIA domain containing 1 178 65 167 NM_207215 pam highwire, rpm 1 178 97 87 NM_009409 topoisomerase DNA II beta 178 47 133 NM_001030014 malonyl CoA:ACP acyltransferase mitochondrial 178 0 139 NM_033596 histone cluster 2 H4 178 22 85 NM_009833 cyclin T1 178 29 43 NM_172339 small nuclear RNA activating complex 177 233 129 NM_146217 alanyl-tRNA synthetase 177 140 118 NM_030680 regulator of nonsense transcripts 1 177 173 66 NM_016766 microspherule protein 1 177 142 76 NM_172692 bile acid beta-glucosidase 177 36 68 NM_009418 tripeptidyl peptidase II 177 25 6 NM_001081127 a disintegrin-like and metallopeptidase 177 796 233 NM_024197 NADH dehydrogenase ubiquinone 1 alpha 177 431 171 NM_007837 DNA-damage inducible transcript 3 177 224 297 NM_011610 tumor necrosis factor receptor superfamily 177 286 153 NM_138602 PRA1 domain family 2 177 303 55 NM_153563 hypothetical protein LOC229707 177 281 49 NM_019441 palmitoyl-protein thioesterase 2 177 156 91 NM_011550 MAX-like protein X 177 130 61 NM_011809 E26 avian leukemia oncogene 2 3' domain 177 33 129 NM_133834 heterogeneous nuclear ribonucleoprotein F 177 106 32 NM_173764 transmembrane anterior posterior transformation 177 44 83 NM_001003953 F-box and leucine-rich repeat protein 10 isoform 177 14 77 NM_145128 mannoside acetylglucosaminyltransferase 5 176 705 139 NM_007638 chaperonin subunit 7 eta 176 443 156 NM_001045959 misshapen-like kinase 1 isoform 3 176 223 92 NM_020619 glucosidase 1 176 168 123 NM_146194 phosphatidylinositol-binding clathrin assembly 176 118 130 NM_007714 CDC like kinase 4 176 65 166 NM_001081308 TAO kinase 3 176 113 80 NM_053090 down-regulated by Ctnnb1 a 176 34 140 NM_001005419 2-aminoethanethiol cysteamine dioxygenase 176 50 97 NM_020267 DIPB protein 176 71 71 NM_001081122 centrosomal protein 63 175 494 132 NM_010391 histocompatibility 2 Q region locus 10 175 438 136 NM_007453 peroxiredoxin 6 175 413 87 NM_010470 heterochromatin protein 1 binding protein 3 175 262 69 NM_017463 pre B-cell leukemia transcription factor 2 175 67 155 NM_210071 eyes absent 3 homolog isoform 1 175 142 76 NM_145978 PDZ and LIM domain 2 175 99 111 NM_012029 evolutionarily conserved signaling intermediate 175 76 133 NM_026431 hypothetical protein LOC67884 175 42 125 NM_078479 mitochondrial ribosomal protein S21 175 70 96 NM_144871 suppressor of variegation 4-20 homolog 1 175 33 101 NM_134027 Ppar binding protein isoform 2 175 33 45 NM_001025432 CREB binding protein 174 740 207 NM_145625 eukaryotic translation initiation factor 4B 174 162 168 NM_178069 large subunit GTPase 1 homolog 174 234 88 NM_009812 caspase 8 174 184 103 NM_001109913 heterogeneous nuclear ribonucleoprotein M 174 106 125 NM_007435 ATP-binding cassette sub-family D, member 1 174 167 64 NM_080795 PDZ domain containing ring finger 1 174 84 73 NM_018771 GIPC PDZ domain containing family member 1 173 730 119 NM_134469 farnesyl diphosphate synthetase 173 236 191 NM_028662 solute carrier family 35 member B2 173 286 118 NM_023739 nuclear transcription factor X-box binding 1 173 122 147 NM_026270 AKT1 substrate 1 proline-rich 173 160 91 NM_011962 procollagen-lysine 2-oxoglutarate 5-dioxygenase 173 70 135 NM_181322 CCCTC-binding factor 173 72 76 NM_178164 ROD1 regulator of differentiation 1 isoform 2 173 10 101 NM_030176 spermatogenesis associated 2-like 173 34 28 NM_133349 zinc finger AN1-type domain 2A 172 327 103 NM_016903 esterase D/formylglutathione hydrolase 172 274 114 NM_028032 alpha isoform of regulatory subunit B55 protein 172 284 93 NM_029364 glucosamine N-acetyl-6-sulfatase 172 285 52 NM_175329 Nur77 downstream gene 2 172 222 94 NM_010922 mitochondrial ribosomal protein L40 172 159 135 NM_027351 peptidylprolyl isomerase-like 3 isoform 1 172 133 146 NM_001081378 kinase D-interacting substrate of 220 kDa 172 152 83 NM_025598 hypothetical protein LOC66496 172 106 82 NM_144793 solute carrier family 25 member 38 172 89 59 NM_016680 splicing factor arginine/serine-rich 16 isoform 172 62 65 NM_133683 transmembrane protein 19 171 1478 73 NM_011512 surfeit gene 4 171 180 258 NM_001039138 calcium/calmodulin-dependent protein kinase II 171 219 135 NM_023556 mevalonate kinase 171 196 104 NM_001081256 jumonji domain containing 1B 171 151 93 NM_011903 tousled-like kinase 2 isoform B 171 185 41 NM_001001181 hypothetical protein LOC407819 171 123 92 NM_177045 coiled-coil and C2 domain containing 1B 171 114 93 NM_028866 WD repeat domain 33 171 148 50 NM_153796 twinkle 171 8 6 NM_178911 phospholipase D family member 4 170 73 445 NM_026212 1-acylglycerol-3-phosphate O-acyltransferase 2 170 338 76 NM_172785 zinc finger CCCH type containing 12D 170 261 128 NM_007924 elongation factor RNA polymerase II 170 43 237 NM_023637 seryl-aminoacyl-tRNA synthetase 2 170 13 259 NM_021718 membrane-spanning 4-domains subfamily A, member 170 170 86 NM_026849 myotubularin related protein 14 170 133 113 NM_175113 tRNA methyltransferase 6 homolog 170 99 129 NM_001025613 zinc finger A20 domain containing 1 170 84 142 NM_007589 calmodulin 2 170 26 176 NM_054039 forkhead box P3 170 33 66 NM_028273 phosphoglycerate mutase family member 5 169 230 194 NM_026738 RIKEN cDNA 1110007C09 169 223 75 NM_013668 jumonji AT rich interactive domain 1C Rbp2 169 115 150 NM_194339 BMS1-like ribosome assembly protein 169 204 43 NM_031869 AMP-activated protein kinase beta 1 169 119 108 NM_026069 ribosomal protein L37 169 81 135 NM_001080964 Sp2 transcription factor isoform 2 169 100 62 NM_001033393 transmembrane protein 104 169 115 30 NM_023884 Ral-A exchange factor RalGPS2 169 9 70 NM_181328 solute carrier family 25 member 29 169 11 60 NM_001033496 zin finger protein 213 169 1487 110 NM_031257 pleckstrin homology domain-containing family A 169 656 126 NM_173413 RAB8B member RAS oncogene family 169 116 125 NM_025808 leucine-zipper-like transcription regulator 1 169 123 105 NM_019875 ATP-binding cassette sub-family B, member 9 169 44 103 NM_001024560 hypothetical protein LOC225861 169 52 71 NM_175749 nucleoporin 153 169 19 99 NM_133923 tubulin tyrosine ligase-like family member 3 169 31 76 NM_024468 tripartite motif protein 39 168 500 206 NM_007838 dolichyl-di-phosphooligosaccharide-protein 168 344 121 NM_144832 hypothetical protein LOC217370 168 212 182 NM_172736 leukocyte receptor cluster LRC member 8 168 125 142 NM_146243 actin-related protein 2 168 114 149 NM_027086 ubiquitin-like 7 bone marrow stromal 168 140 118 NM_008847 phosphatidylinositol-4-phosphate 5-kinase type 168 103 147 NM_023311 Yip1 domain family member 5 168 63 176 NM_028639 tetratricopeptide repeat domain 7 168 50 170 NM_001109626 Cdc2-related kinase arginine/serine-rich 168 94 120 NM_008628 mutS homolog 2 167 1586 114 NM_172308 methylenetetrahydrofolate dehydrogenase NADP+ 167 377 87 NM_172606 membrane-associated ring finger C3HC4 6 167 171 231 NM_053163 mitochondrial ribosomal protein L36 167 268 97 NM_009391 RAN member RAS oncogene family 167 252 110 NM_001077264 adaptor protein complex AP-2 alpha 1 subunit 167 196 164 NM_021433 syntaxin 6 167 201 73 NM_010485 ELAV embryonic lethal abnormal vision, 167 160 103 NM_007968 Ewing sarcoma breakpoint region 1 167 48 88 NM_027996 hypothetical protein LOC268721 167 10 26 NM_011861 protein kinase C and casein kinase substrate in 166 2269 89 NM_001112738 ATP synthase H+ transporting, mitochondrial F1 166 404 199 NM_148945 ribosomal protein S6 kinase polypeptide 3 166 473 54 NM_007410 alcohol dehydrogenase 5 class III chi 166 306 88 NM_011018 sequestosome 1 166 262 130 NM_011873 DAZ associated protein 2 166 169 89 NM_001081400 hypothetical protein LOC69053 166 138 119 NM_026944 alkB alkylation repair homolog 3 166 83 174 NM_001085495 ADP-ribosylation factor guanine 165 236 82 NM_181397 raft-linking protein 165 141 156 NM_011482 NHP2 non-histone chromosome protein 2-like 1 165 173 73 NM_020493 serum response factor 165 101 135 NM_025791 hypothetical protein LOC66836 165 131 93 NM_025680 nuclear protein NAP 165 97 91 NM_177682 hypothetical protein LOC231874 165 88 96 NM_134012 mbt domain containing 1 165 77 81 NM_011334 chloride channel 4 165 22 114 NM_178693 coenzyme Q4 homolog 165 40 81 NM_009952 cAMP responsive element binding protein 1 165 8 96 NM_011600 transducin-like enhancer protein 4 165 58 42 NM_001033474 hypothetical protein LOC382423 165 7 78 NM_175206 F-box and leucine-rich repeat protein 22 165 5 19 NM_010559 interleukin 6 receptor alpha 164 679 93 NM_145550 Yip1 domain family member 1 164 57 133 NM_009483 ubiquitously transcribed tetratricopeptide 164 87 98 NM_001042743 microtubule associated serine/threonine kinase 2 164 93 85 NM_023130 hnRNP-associated with lethal yellow 164 70 71 NM_023322 zinc finger protein 99 163 985 138 NM_172396 hypothetical protein LOC66818 163 411 119 NM_201406 phosphatidylinositol glycan anchor biosynthesis 163 365 148 NM_145522 Rab9 effector protein with kelch motifs 163 262 136 NM_025739 hypothetical protein LOC66743 163 213 122 NM_153406 SPECC1-like 163 218 113 NM_001033436 ataxin 7-like 1 163 244 75 NM_054057 proline synthetase co-transcribed isoform a 163 15 222 NM_026042 mediator complex subunit 29 163 132 98 NM_001040400 hypothetical protein LOC214133 163 65 103 NM_001025392 BCL2-associated transcription factor 1 isoform 163 62 82 NM_009733 axin 1 162 579 248 NM_153150 solute carrier family 25 member 1 162 488 131 NM_026684 NADH dehydrogenase ubiquinone 1 beta 162 389 147 NM_172675 syntaxin 16 isoform a 162 144 120 NM_177766 solute carrier family 35 member E1 162 42 159 NM_001033326 dehydrogenase/reductase SDR family X 162 67 133 NM_026238 nuclear prelamin A recognition factor-like 162 58 128 NM_145387 ATH1 acid trehalase-like 1 162 76 87 NM_146155 AT hook DNA binding motif, containing 1 162 19 76 NM_001048168 nuclear transcription factor-Y gamma 161 1184 191 NM_023124 histocompatibility 2 Q region locus 8 161 115 292 NM_001109993 transmembrane protein 141 isoform 2 161 243 159 NM_023516 hypoxia-inducible protein 2 161 194 87 NM_001014995 hypothetical protein LOC68521 161 104 143 NM_001039386 nasal embryonic LHRH factor isoform A 161 94 140 NM_001081434 oxysterol-binding protein-like protein 7 161 101 100 NM_025434 mitochondrial ribosomal protein S28 161 80 118 NM_194340 hypothetical protein LOC215476 161 52 127 NM_175341 muscleblind-like 2 isoform 1 161 86 82 NM_019786 TANK-binding kinase 1 161 22 127 NM_175195 signal peptide peptidase-like 2B 161 68 15 NM_153161 hypothetical protein LOC231807 161 13 48 NM_001110327 cyclin D binding myb-like transcription factor 1 161 1817 63 NM_025797 cytochrome b-5 161 418 84 NM_001081394 hypothetical protein LOC71667 161 67 398 NM_026423 hypothetical protein LOC67873 161 179 127 NM_007494 argininosuccinate synthetase 161 181 47 NM_009672 acidic leucine-rich nuclear phosphoprotein 32 161 90 90 NM_030262 protein O-fucosyltransferase 2 161 87 76 NM_001033201 nuclear cap binding protein subunit 1 80kDa 161 31 51 NM_001037727 Rho GTPase activating protein 25 isoform a 160 834 103 NM_016775 DnaJ Hsp40 homolog subfamily C, member 5 160 47 219 NM_144557 myosin VIIA and Rab interacting protein 160 84 89 NM_009462 ubiquitin specific peptidase 10 160 77 77 NM_146066 G1 to S phase transition 1 160 37 91 NM_029078 pre-mRNA cleavage complex II protein Pcf11 159 1751 153 NM_025316 NADH dehydrogenase ubiquinone 1 beta 159 697 426 NM_010578 integrin beta 1 fibronectin receptor beta 159 374 228 NM_018740 S-phase 2 protein 159 342 86 NM_010887 NADH dehydrogenase ubiquinone Fe-S protein 4 159 324 45 NM_020050 TMEM9 domain family member B 159 258 76 NM_029789 LAG1 homolog ceramide synthase 2 159 103 189 NM_172421 polycomb group protein ASXH2 homolog 159 113 174 NM_144811 chromobox 7 159 30 220 NM_172945 ankyrin repeat domain 13b 159 184 42 NM_026523 neuromedin B 159 76 121 NM_177658 hypothetical protein LOC228850 159 47 89 NM_001005868 Erbb2 interacting protein isoform 1 159 12 20 NM_011669 ubiquitin specific peptidase 12 158 823 365 NM_207687 espin isoform 1 158 336 116 NM_007791 cysteine and glycine-rich protein 1 158 313 136 NM_173863 transducer of regulated CREB protein 3 158 56 278 NM_144898 misato 158 95 160 NM_023045 exportin 7 158 128 112 NM_172894 SAPS domain family member 1 158 155 78 NM_025558 cytochrome b5 type B precursor 158 68 165 NM_001081979 methyl CpG binding protein 2 isoform 1 158 119 111 NM_026498 mitochondrial ribosomal protein S11 158 62 97 NM_022979 nucleoporin 98 158 108 48 NM_175344 transmembrane protein 16F 158 43 93 NM_153196 ribokinase 157 586 102 NM_021393 cofactor of BRCA1 157 472 143 NM_007590 calmodulin 3 157 404 164 NM_030559 vacuolar protein sorting 16 157 463 105 NM_030714 deltex 3 157 328 86 NM_145632 polymerase RNA II (DNA directed) polypeptide 157 229 147 NM_019805 anaphase promoting complex subunit 7 157 195 91 NM_145501 phosphatidylinositol 4-kinase type 2 alpha 157 152 88 NM_022019 dual specificity phosphatase 10 157 206 26 NM_009423 Tnf receptor associated factor 4 157 53 161 NM_146128 discs large homolog-associated protein 4 157 89 108 NM_001081557 calmodulin binding transcription activator 1 157 54 71 NM_013933 vesicle-associated membrane protein associated 157 10 110 NM_133942 pleckstrin homology domain containing family A 157 45 67 NM_138679 absent small, or homeotic discs 1 156 281 177 NM_028860 myotubularin-related protein 3 156 242 141 NM_021299 adenylate kinase 3 156 206 164 NM_025400 NAT9 156 8 304 NM_033268 actinin alpha 2 156 225 83 NM_001081081 glutaminase isoform 1 156 77 187 NM_026482 plasma membrane calcium ATPase 1 156 86 153 NM_025654 RAD52 motif 1 156 159 66 NM_009395 tumor necrosis factor alpha-induced protein 1 156 40 106 NM_021791 double C2 gamma 156 75 40 NM_015810 polymerase DNA directed gamma 2, accessory 156 62 51 NM_008787 pericentrin 156 36 31 NM_172571 Fas TNFRSF6 binding factor 1 155 1723 57 NM_029103 arginine-rich mutated in early stage tumors 155 671 196 NM_031248 mitogen-activated protein-binding 155 234 80 NM_138599 translocase of outer mitochondrial membrane 70 155 188 116 NM_008947 protease prosome macropain 26S subunit, 155 156 108 NM_025605 hypothetical protein LOC66508 155 75 114 NM_172276 splicing factor arginine/serine-rich 8 155 129 39 NM_010513 insulin-like growth factor I receptor 155 83 81 NM_001033463 TatD DNase domain containing 2 155 91 69 NM_177083 hypothetical protein LOC320148 155 55 59 NM_022981 zinc finger protein 110 155 20 71 NM_145384 PQ loop repeat containing 2 155 36 55 NM_175022 proline rich 12 154 395 117 NM_153538 zinc finger CCHC domain containing 6 154 34 468 NM_010792 methyltransferase-like 1 154 183 303 NM_009746 B-cell CLL/lymphoma 7C 154 379 74 NM_010260 guanylate nucleotide binding protein 2 154 182 186 NM_016980 ribosomal protein L5 154 158 117 NM_021536 mitochondrial Rho 1 154 50 218 NM_025735 microtubule-associated protein 1 light chain 3 154 87 161 NM_145564 F-box protein 21 154 91 77 NM_134255 elongation of very long chain fatty acids-like 154 76 18 NM_025706 TBC1 domain family member 15 154 48 45 NM_027015 ribosomal protein S27 154 36 32 NM_010560 interleukin 6 signal transducer 153 710 125 NM_012037 vesicle amine transport protein 1 homolog T 153 699 80 NM_001024206 trafficking protein particle complex 1 153 303 58 NM_172451 UDP-N-acetyl-alpha-D-galactosamine:polypeptide 153 166 108 NM_026987 DEAH Asp-Glu-Ala-His box polypeptide 16 153 120 92 NM_024181 DnaJ Hsp40 homolog subfamily C, member 10 153 112 87 NM_011596 ATPase H+ transporting, lysosomal V0 subunit 153 48 131 NM_009658 aldo-keto reductase family 1 member B3 aldose 153 99 58 NM_027861 hypothetical protein LOC71678 153 88 48 NM_175411 protein phosphatase 4 regulatory subunit 1-like 153 98 28 NM_008338 interferon gamma receptor 2 153 14 106 NM_008507 SH2B adaptor protein 3 153 29 69 NM_021441 TATA box binding protein Tbp-associated 153 29 69 NM_172458 hypothetical protein LOC208292 153 5740 333 NM_022891 ribosomal protein L23 153 302 82 NM_001113550 hypothetical protein LOC67392 153 128 150 NM_008363 interleukin-1 receptor-associated kinase 1 153 126 141 NM_172666 alkyldihydroxyacetone phosphate synthase 153 102 160 NM_025548 tubulin folding cofactor B 153 105 143 NM_025757 hypothetical protein LOC66771 153 40 122 NM_001081418 glioma tumor suppressor candidate region gene 1 153 9 95 NM_020578 EH-domain containing 3 152 1809 148 NM_025321 succinate dehydrogenase complex subunit C, 152 375 86 NM_028234 proline rich 8 152 356 87 NM_009456 ubiquitin-conjugating enzyme E2L 3 152 241 177 NM_054078 bromodomain adjacent to zinc finger domain 2A 152 174 99 NM_025895 endothelial-derived gene 1 152 136 124 NM_007456 adaptor-related protein complex AP-1 mu subunit 152 87 133 NM_021510 heterogeneous nuclear ribonucleoprotein H1 152 128 90 NM_011771 aiolos 152 111 104 NM_025839 syndesmos 152 80 115 NM_010121 eukaryotic translation initiation factor 2 alpha 152 55 98 NM_199198 histone deacetylase 10 152 45 99 NM_001081292 mitogen-activated protein kinase kinase kinase 152 87 54 NM_172783 phosphorylase kinase alpha 2 152 4 120 NM_177708 reticulon 4 receptor-like 1 152 39 56 NM_026191 DEAH Asp-Glu-Ala-His box polypeptide 40 151 717 52 NM_008060 alpha glucosidase 2 alpha neutral subunit 151 719 31 NM_025798 histidine triad nucleotide binding protein 3 151 599 110 NM_024207 Der1-like domain family member 1 151 420 111 NM_016787 BCL2/adenovirus E1B interacting protein 1 NIP2 151 313 73 NM_001081069 regulator of G-protein signaling 11 151 232 103 NM_010127 POU domain class 6, transcription factor 1 151 183 143 NM_027188 SET and MYND domain containing 3 151 246 65 NM_001042485 transmembrane protein 183A isoform b 151 172 127 NM_009794 calpain 2 151 125 111 NM_133188 DAZ associated protein 1 151 91 112 NM_011112 poly A polymerase alpha 151 115 85 NM_203280 sphingosine kinase 2 151 73 77 NM_001013391 cleavage and polyadenylation specific factor 6 151 67 68 NM_011885 mitochondrial ribosomal protein S12 150 747 386 NM_008091 GATA binding protein 3 150 806 45 NM_019580 glycerophosphodiester phosphodiesterase 1 150 376 45 NM_026420 polyadenylate-binding protein-interacting 150 256 132 NM_011250 retinoblastoma-like 2 150 38 247 NM_023816 ankyrin repeat domain 36 150 200 80 NM_133701 U5 snRNP-associated 102 kDa protein 150 69 84 NM_028142 NOL1/NOP2/Sun domain family member 4 150 27 112 NM_001077190 spectrin SH3 domain binding protein 1 isoform 1 150 13 67 NM_001034851 hypothetical protein LOC66270 isoform 1 149 1112 175 NM_025967 hypothetical protein LOC67102 149 509 49 NM_009673 annexin A5 149 140 253 NM_010493 intercellular adhesion molecule 149 156 57 NM_029836 nucleolar TGF-beta1 target protein 149 127 66 NM_053268 RAS p21 protein activator 2 149 44 112 NM_011544 transcription factor 12 149 55 49 NM_025793 Wdr45 like 149 8 51 NM_001038845 purinergic receptor P2X7 isoform b 148 456 112 NM_019440 interferon inducible GTPase 2 148 199 96 NM_009439 proteasome 26S non-ATPase subunit 3 148 68 194 NM_172585 La ribonucleoprotein domain family member 5 148 96 46 NM_011374 ST8 alpha-N-acetyl-neuraminide 148 34 102 NM_026574 yeast INO80-like protein 148 34 83 NM_001081065 zinc finger protein 707 148 71 42 NM_145930 hypothetical protein LOC106064 148 5 3 NM_009238 SRY-box containing gene 4 147 654 156 NM_198831 mitochondrial ribosomal protein L48 147 259 160 NM_001033268 hypothetical protein LOC218236 147 143 173 NM_134122 nurim 147 114 187 NM_026813 SAPS domain family member 2 isoform 1 147 110 113 NM_016862 vesicle transport through interaction with 147 54 104 NM_001039512 influenza virus NS1A binding protein isoform 3 147 54 95 NM_025837 mannose phosphate isomerase 147 34 114 NM_010392 histocompatibility 2 Q region locus 2 147 38 70 NM_203319 DEAH Asp-Glu-Ala-His box polypeptide 37 147 17 24 NM_010723 LIM domain only 4 146 640 109 NM_007927 emerin 146 162 524 NM_009101 Harvey rat sarcoma oncogene subgroup R 146 51 630 NM_022653 thimet oligopeptidase 1 146 399 125 NM_009338 acetyl-Coenzyme A acetyltransferase 2 146 329 108 NM_153521 leucine rich repeat containing 41 146 98 139 NM_144801 transmembrane protein 143 146 37 161 NM_027355 ring fnger protein 168 146 66 131 NM_026661 hypothetical protein LOC68295 146 110 82 NM_024233 small fragment nuclease 146 42 123 NM_001099628 ATPase family AAA domain containing 2B 146 97 61 NM_025812 high mobility group 20A 146 1 14 NM_011414 secretory leukocyte peptidase inhibitor 145 587 52 NM_144523 zinc finger protein 622 145 346 42 NM_008854 protein kinase cAMP dependent, catalytic, 145 47 282 NM_153580 coiled-coil domain containing 95 145 247 66 NM_145505 hypothetical protein LOC226252 145 211 95 NM_016800 vesicle transport through interaction with 145 125 178 NM_029746 component of oligomeric golgi complex 2 145 65 190 NM_001025562 pseudouridine synthase 1 isoform 3 145 43 207 NM_144815 cat eye syndrome chromosome region candidate 5 145 114 131 NM_011949 mitogen activated protein kinase 1 145 74 139 NM_173432 protein serine kinase H1 145 154 58 NM_023167 mitochondrial ribosomal protein L4 145 53 85 NM_175445 Ras association RalGDS/AF-6 domain family 2 145 41 93 NM_028643 Smhs2 homolog 145 43 75 NM_026201 cell division cycle and apoptosis regulator 1 145 42 23 NM_153055 SEC63-like protein 145 20 38 NM_001045484 myocyte enhancer factor 2B isoform 2 145 18 37 NM_018754 stratifin 145 1137 86 NM_183250 coiled-coil domain containing 72 145 154 167 NM_019830 protein arginine N-methyltransferase 1 145 182 70 NM_033562 Der1-like domain family member 2 145 158 54 NM_027166 yippee protein homolog 145 87 68 NM_025570 mitochondrial ribosomal protein L20 145 28 9 NM_007771 cryptochrome 1 photolyase-like 144 1652 238 NM_024212 ribosomal protein L4 144 1385 104 NM_007687 cofilin 1 non-muscle 144 991 264 NM_001038637 guanine nucleotide binding protein G protein 144 337 96 NM_009939 COP9 constitutive photomorphogenic homolog 144 285 67 NM_001113362 TBC1 domain family member 14 isoform a 144 77 215 NM_033371 protein phosphatase 1 regulatory inhibitor 144 44 248 NM_183208 zinc finger MIZ-type containing 1 144 150 94 NM_172960 aarF domain containing kinase 5 144 117 94 NM_007649 CD48 antigen 144 19 139 NM_178194 histone cluster 1 H2be 144 39 107 NM_020296 RNA binding motif single stranded interacting 144 75 70 NM_001025426 DEP domain containing 5 isoform 1 144 42 98 NM_009875 cyclin-dependent kinase inhibitor 1B 144 34 52 NM_011240 RAN binding protein 2 144 28 32 NM_133922 KRAB-A domain containing 1 144 8 43 NM_145587 SH3-binding kinase 1 143 5909 243 NM_009429 tumor protein translationally-controlled 1 143 280 257 NM_019818 translocase of inner mitochondrial membrane 22 143 440 32 NM_181516 tafazzin 143 95 88 NM_146034 CTAGE family member 5 143 122 35 NM_001039179 bicaudal D homolog 2 isoform 1 143 74 66 NM_138583 hypothetical protein LOC27883 143 60 68 NM_026880 PTEN induced putative kinase 1 142 522 128 NM_009230 sterol O-acyltransferase 1 142 482 60 NM_001013792 hypothetical protein LOC432940 142 373 104 NM_008669 N-acetyl galactosaminidase alpha 142 330 101 NM_011223 paxillin isoform alpha 142 267 104 NM_026732 mitochondrial ribosomal protein L14 142 268 91 NM_029922 poly ADP-ribose polymerase family member 6 142 187 143 NM_026555 reticulocalbin 3 142 148 98 NM_183020 ataxin 2-like 142 59 184 NM_138747 nucleolar protein 1 142 40 149 NM_011755 zinc finger protein 35 142 104 79 NM_172615 hypothetical protein LOC224118 142 143 41 NM_001039162 cytoplasmic linker 2 isoform b 142 23 160 NM_178189 histone cluster 1 H2ac 142 95 44 NM_025846 related RAS viral r-ras oncogene homolog 2 142 16 98 NM_001081056 exportin tRNA nuclear export receptor for 142 56 43 NM_172707 protein phosphatase 1 catalytic subunit, beta 142 41 49 NM_008397 integrin alpha 6 141 1163 91 NM_010303 guanine nucleotide binding protein alpha 13 141 219 280 NM_008098 myotrophin 141 179 82 NM_011187 proteasome prosome macropain subunit, beta 141 165 69 NM_026933 p53-inducible cell-survival factor 141 189 41 NM_011514 suppressor of variegation 3-9 homolog 1 141 85 143 NM_010731 zinc finger and BTB domain containing 7 141 79 147 NM_011875 proteasome 26S non-ATPase subunit 13 141 133 68 NM_152801 Rac/Cdc42 guanine nucleotide exchange factor 6 141 112 73 NM_133360 acetyl-Coenzyme A carboxylase alpha 141 45 132 NM_183186 checkpoint suppressor 1 141 86 83 NM_029457 SUMO/sentrin specific peptidase 2 141 75 75 NM_013642 dual specificity phosphatase 1 141 43 89 NM_139145 holocarboxylase synthetase 141 71 60 NM_022309 core binding factor beta 141 8 104 NM_001045481 interferon activated gene 203 isoform 1 140 995 89 NM_026395 RER1 homolog 140 343 104 NM_172275 TRAF type zinc finger domain containing 1 140 257 72 NM_153416 achalasia adrenocortical insufficiency, 140 122 148 NM_001045863 RD RNA-binding protein 140 170 73 NM_001004185 WAS protein homology region 2 domain containing 140 52 175 NM_133964 deoxyhypusine hydroxylase/monooxygenase 140 99 122 NM_207209 SEC24 related gene family member B 140 119 71 NM_001040683 mediator complex subunit 15 isoform b 140 69 118 NM_011644 transient receptor potential cation channel 140 31 120 NM_001112714 GTPase activating RANGAP domain-like 1 isoform 140 68 73 NM_016963 tropomodulin 3 140 76 48 NM_012042 cullin 1 140 28 84 NM_027569 sperm associated antigen 9 isoform 1 140 26 77 NM_011202 protein tyrosine phosphatase non-receptor type 140 47 43 NM_175646 Dim1-like protein 140 50 38 NM_008210 H3 histone family 3A 140 47 31 NM_025279 heterogeneous nuclear ribonucleoprotein K 140 22 31 NM_001076676 ubiquitin specific protease 33 isoform 2 139 315 75 NM_010773 methyl-CpG binding domain protein 2 139 273 103 NM_029862 hypothetical protein LOC381356 139 250 71 NM_144889 proteasome inhibitor subunit 1 isoform b 139 170 136 NM_026389 polymerase delta interacting protein 38 139 185 92 NM_001024945 quiescin Q6 sulfhydryl oxidase 1 isoform a 139 81 119 NM_175934 protein phosphatase I 139 93 96 NM_145124 skeletrophin 139 50 79 NM_008575 transformed mouse 3T3 cell double minute 4 139 48 69 NM_198301 hypothetical protein LOC223433 138 922 115 NM_026174 ectonucleoside triphosphate diphosphohydrolase 138 351 171 NM_001109995 elongation factor Tu GTP binding domain 138 328 128 NM_026873 pentatricopeptide repeat domain 2 138 241 161 NM_026816 general transcription factor IIF polypeptide 2 138 244 155 NM_007479 ADP-ribosylation factor 4 138 331 65 NM_172300 ubiquitin-conjugating enzyme E2Z 138 220 142 NM_028014 hypothetical protein LOC71947 138 268 70 NM_181750 R3H domain binds single-stranded nucleic 138 212 94 NM_011787 autocrine motility factor receptor 138 209 96 NM_001109905 staufen RNA binding protein homolog 1 isoform 138 194 97 NM_015797 F-box protein 6 138 141 79 NM_026949 CCR4-NOT transcription complex subunit 8 138 61 141 NM_178801 hypothetical protein LOC338363 138 101 81 NM_009677 adaptor protein complex AP-1 gamma 1 subunit 138 63 117 NM_021343 spermatogenesis associated 5 138 100 70 NM_175251 AT rich interactive domain 2 Arid-rfx like 138 129 39 NM_146239 PCTAIRE protein kinase 2 138 61 105 NM_009078 ribosomal protein L19 138 63 100 NM_172052 kelch-like 26 isoform 1 138 90 68 NM_001008425 WD repeat domain 58 138 90 63 NM_001039147 mortality factor 4 like 1 isoform a 138 9 135 NM_001004361 hypothetical protein LOC66648 138 66 51 NM_146121 RAB GTPase activating protein 1 isoform a 138 68 40 NM_007415 poly ADP-ribose polymerase family member 1 138 60 44 NM_028181 cell cycle progression 1 isoform 2 138 41 25 NM_177777 hypothetical protein LOC276852 138 19 26 NM_133999 Sac domain-containing inositol phosphatase 3 138 227 113 NM_026277 nin one binding protein 138 184 126 NM_001081359 ubiquitin protein ligase E3 component n-recognin 138 136 139 NM_021485 ribosomal protein S6 kinase polypeptide 2 138 199 63 NM_029582 thioredoxin domain containing 11 isoform 1 138 170 80 NM_009671 ankyrin repeat and FYVE domain containing 1 138 127 96 NM_133971 ankyrin repeat domain 10 138 145 68 NM_013497 cAMP responsive element binding protein 3 138 81 129 NM_026666 ubinuclein 1 138 25 100 NM_134063 peripherial benzodiazepine receptor associated 138 39 58 NM_001033634 zyg-ll homolog B 137 637 122 NM_025586 ribosomal protein L15 137 123 206 NM_173185 casein kinase 1 gamma 1 137 257 68 NM_175104 hypothetical protein LOC66306 137 28 203 NM_018811 abhydrolase domain containing 2 137 131 65 NM_021531 coactivator-associated arginine 137 157 9 NM_144820 coiled-coil domain containing 28A 137 39 61 NM_001029934 ubiquitin specific protease 32 137 22 70 NM_025978 tetratricopeptide repeat domain 14 isoform b 137 24 30 NM_016759 RUN domain containing 3A 136 137 88 NM_178635 UV radiation resistance associated 136 123 67 NM_030168 RIKEN cDNA 4921505C17 136 73 86 NM_178923 splicing factor arginine/serine-rich 15 135 2214 81 NM_028022 hypothetical protein LOC71962 135 563 121 NM_029979 tripartite motif-containing 35 135 456 96 NM_023735 ARP3 actin-related protein 3 homolog 135 217 160 NM_025553 mitochondrial ribosomal protein L11 135 136 100 NM_178182 histone cluster 1 H2ai 135 101 127 NM_023041 peroxisome biogenesis factor 19 135 109 109 NM_009085 RNA polymerase 1-1 135 34 148 NM_031165 heat shock protein 8 135 89 93 NM_001110208 thymoma viral proto-oncogene 2 135 68 105 NM_172719 GCN1 general control of amino-acid synthesis 135 132 39 NM_001080129 thymopoietin isoform epsilon 135 88 56 NM_001038589 ubiquitin specific protease 14 isoform 2 135 31 78 NM_001080931 mediator complex subunit 13 135 48 51 NM_028121 ATP-dependent glucokinase 134 252 124 NM_011530 transporter 2 ATP-binding cassette, sub-family 134 290 59 NM_030225 dihydrolipoamide S-succinyltransferase E2 134 130 130 NM_022314 tropomyosin 3 gamma 134 105 155 NM_008395 itchy E3 ubiquitin protein ligase 134 94 166 NM_177103 SUMO/sentrin specific peptidase 5 134 172 82 NM_011235 RAD51-like 3 134 127 96 NM_026360 DEAD Asp-Glu-Ala-Asp box polypeptide 47 134 109 110 NM_025538 spermatogenesis associated 11 134 102 99 NM_018737 cytidine 5'-triphosphate synthase 2 134 12 179 NM_177909 solute carrier family 9 sodium/hydrogen 134 36 154 NM_019726 G protein pathway suppressor 2 134 29 141 NM_022313 Era-like 1 134 70 77 NM_009021 retinoic acid induced 1 134 10 130 NM_009569 zinc finger protein multitype 1 134 59 58 NM_007483 ras homolog gene family member B 133 828 186 NM_013486 CD2 antigen 133 506 144 NM_016895 adenylate kinase 2 isoform b 133 111 329 NM_010899 nuclear factor of activated T-cells 133 269 109 NM_008175 granulin 133 184 40 NM_027186 RPA interacting protein 133 53 145 NM_139294 Braf transforming 133 100 85 NM_018888 basic FGF repressed zinc binding protein 133 90 52 NM_015761 downstream of Stk11 133 72 68 NM_011585 cytotoxic granule-associated RNA binding protein 133 95 43 NM_148673 step II splicing factor SLU7 133 62 74 NM_025573 splicing factor arginine/serine rich 9 133 81 44 NM_022811 RNA polymerase I associated factor 53 133 28 75 NM_175483 SH3 and PX domain containing 3 133 54 43 NM_009315 TAF6 RNA polymerase II TATA box binding protein 133 44 22 NM_025375 Williams-Beuren syndrome critical region protein 132 729 5823 NM_001013384 podocan-like 1 132 295 127 NM_026784 phosphomevalonate kinase 132 258 117 NM_153501 pantothenate kinase 2 132 239 104 NM_008943 presenilin 1 132 196 61 NM_001035525 polycystic kidney disease 1-like isoform 1 132 132 123 NM_025840 basic leucine zipper and W2 domains 2 132 33 213 NM_027711 IQ motif containing GTPase activating protein 2 132 96 81 NM_001002929 nucleoporin 85 132 111 64 NM_011236 RAD52 homolog 132 38 112 NM_175433 zinc finger protein 710 132 43 69 NM_172272 prolyl-tRNA synthetase mitochondrial(putative) 132 41 64 NM_153774 importin 9 131 908 80 NM_175015 ATP synthase H+ transporting, mitochondrial F0 131 506 82 NM_012001 COP9 signalosome subunit 4 131 230 120 NM_001039533 pyridoxal-dependent decarboxylase domain 131 188 106 NM_019752 HtrA serine peptidase 2 131 177 93 NM_026236 WD repeat domain 48 131 109 149 NM_022310 heat shock protein 5 131 76 151 NM_021284 c-K-ras2 protein 131 91 93 NM_007692 choline kinase beta 131 87 91 NM_009702 aquarius 131 63 102 NM_175310 PDS5 regulator of cohesion maintenance, homolog 131 59 106 NM_009148 SEC8 131 69 94 NM_025853 DSN1 MIND kinetochore complex component, 131 20 131 NM_029870 hypothetical protein LOC77128 131 63 80 NM_207217 integrin alpha FG-GAP repeat containing 3 131 38 95 NM_026375 AT hook containing transcription factor 1 131 48 71 NM_001081164 HIV-1 induced protein HIN-1 131 51 63 NM_009053 RFNG O-fucosylpeptide 131 38 42 NM_178599 COMM domain containing 8 131 22 43 NM_134034 SMEK homolog 2 suppressor of mek1 130 2013 76 NM_009837 chaperonin subunit 4 delta 130 1334 59 NM_019713 Ras association RalGDS/AF-6 domain family 1 130 1100 185 NM_025919 ribosomal protein L11 130 512 128 NM_016767 basic leucine zipper transcription factor-like 130 454 72 NM_007853 degenerative spermatocyte homolog 1 130 372 144 NM_025668 signal peptidase complex subunit 2 homolog 130 363 57 NM_027910 kelch domain containing 3 130 268 126 NM_001110305 kelch-like ECH-associated protein 1 130 252 128 NM_019767 actin related protein 2/3 complex subunit 1A 130 286 54 NM_133755 tubulin gamma complex associated protein 2 130 199 109 NM_198631 zinc finger CCCH-type containing 4 130 194 103 NM_008583 multiple endocrine neoplasia 1 130 167 55 NM_023740 zinc finger DHHC domain containing 16 130 125 71 NM_020494 DEAD Asp-Glu-Ala-Asp box polypeptide 24 130 17 172 NM_026472 Mki67 FHA domain interacting nucleolar 130 147 38 NM_001110832 nuclear transcription factor-Y alpha isoform a 130 58 92 NM_146112 trinucleotide repeat containing 15 isoform a 130 30 110 NM_025652 transcription factor IIIA 130 39 90 NM_080419 immunoglobulin superfamily member 8 130 23 93 NM_029721 sorting nexin family member 27 isoform 2 130 4 106 NM_008207 histocompatibility 2 T region locus 24 130 639 60 NM_025366 coiled-coil-helix-coiled-coil-helix domain 130 459 177 NM_008206 histocompatibility 2 O region alpha locus 130 95 238 NM_146127 hypothetical protein LOC73847 130 294 38 NM_009000 RAB24 member RAS oncogene family 130 199 119 NM_007858 diaphanous homolog 1 130 236 49 NM_011874 proteasome 26S ATPase subunit 4 130 148 105 NM_011756 zinc finger protein 36 130 158 60 NM_001025106 transmembrane protein 201 isoform a 130 128 87 NM_183428 erythrocyte protein band 4.1 130 124 85 NM_001081149 MYST histone acetyltransferase monocytic 130 157 43 NM_011959 origin recognition complex subunit 5 130 55 134 NM_031406 solute carrier family 12 potassium/chloride 130 131 55 NM_153570 nucleolar complex associated 4 homolog 130 120 65 NM_001033164 hypothetical protein LOC72307 130 100 83 NM_197990 RIKEN cDNA 1700025G04 130 110 62 NM_001045514 AT-hook transcription factor 130 112 55 NM_001081366 vacuolar protein sorting 8 homolog 130 85 79 NM_018872 transmembrane protein 131 130 32 127 NM_011184 proteasome prosome macropain subunit, alpha 130 45 93 NM_021450 transient receptor potential cation channel 130 7 110 NM_175471 hypothetical protein LOC230582 130 36 63 NM_177710 slingshot-like 2 130 41 56 NM_198102 transformer-2 alpha 130 46 9 NM_013689 cytoplasmic tyrosine kinase Dscr28C related 129 931 130 NM_016905 galactokinase 1 129 168 149 NM_001039089 Sel1 suppressor of lin-12 1 homolog isoform a 129 127 170 NM_008690 nuclear factor of kappa light polypeptide gene 129 155 61 NM_021461 MAP kinase-interacting serine/threonine kinase 129 73 102 NM_011767 zinc finger RNA binding protein 129 89 73 NM_011274 expressed sequence C80913 129 71 77 NM_007953 estrogen related receptor alpha 129 41 54 NM_172749 zinc finger protein 646 128 1569 243 NM_145135 ribonuclease/angiogenin inhibitor 1 128 566 37 NM_019806 vesicle-associated membrane protein associated 128 398 44 NM_027799 ankyrin repeat domain 40 isoform 1 128 80 204 NM_028805 katanin p80 WD40-containing subunit B 1 128 65 216 NM_009191 suppressor of K+ transport defect 3 128 161 79 NM_133201 mitofusin 2 128 162 62 NM_145428 dehydrogenase/reductase SDR family member 7B 128 97 124 NM_029626 glycosyltransferase 8 domain containing 1 128 93 89 NM_023178 DNMT1 associated protein-1 128 90 87 NM_011014 opioid receptor sigma 1 128 108 53 NM_009564 zinc finger protein 64 128 52 106 NM_053100 tripartite motif protein 8 128 60 83 NM_153160 zinc finger CCHC domain containing 17 128 63 72 NM_001081290 BAT2 domain containing 1 128 47 83 NM_011749 zinc finger protein 148 128 32 96 NM_177821 E1A binding protein p300 128 32 59 NM_019740 forkhead box O3a 128 32 46 NM_145529 cleavage stimulation factor subunit 3 isoform 1 128 55 16 NM_139272 UDP-N-acetyl-alpha-D-galactosamine:polypeptide 127 527 102 NM_181392 general transcription factor IIH polypeptide 5 127 156 121 NM_028020 cleavage and polyadenylation specific factor 127 200 69 NM_007510 vacuolar H+ ATPase E1 127 22 232 NM_001080742 vesicle-associated membrane protein 5 127 26 199 NM_029585 de-etiolated homolog 1 127 127 85 NM_001112703 v-abl Abelson murine leukemia oncogene 1 isoform 127 55 146 NM_025616 translocase of inner mitochondrial membrane 50 127 44 106 NM_178935 gamma-taxilin 127 74 75 NM_008676 neighbor of Brca1 gene 1 127 58 65 NM_021414 S-adenosylhomocysteine hydrolase-like 2 127 52 71 NM_024465 abhydrolase domain containing 12 127 40 55 NM_019836 hypothetical protein LOC56412 127 7 69 NM_025943 DAZ interacting protein 1 127 40 13 NM_010577 integrin alpha 5 127 24 20 NM_026720 ankyrin repeat domain 13 family member D 126 283 76 NM_011615 death effector domain-containing 126 199 117 NM_172700 zinc metalloproteinase STE24 homolog 126 166 89 NM_133913 hypothetical protein LOC100910 126 108 144 NM_021419 ring finger protein 8 126 176 39 NM_011841 mitogen activated protein kinase 7 126 119 56 NM_027297 PRP4 pre-mRNA processing factor 4 homolog 126 39 107 NM_001081340 SET domain containing 2 126 60 68 NM_001002004 hypothetical protein LOC72503 125 340 116 NM_033601 B-cell CLL/lymphoma 3 125 203 78 NM_053194 synembryn 125 167 109 NM_033560 vacuolar protein sorting 37A 125 118 93 NM_015821 F-box and leucine-rich repeat protein 8 125 96 115 NM_026447 protein phosphatase 1M isoform 1 125 48 146 NM_175184 hypothetical protein LOC72543 125 81 81 NM_008391 interferon regulatory factor 2 125 32 101 NM_026445 sulfatase modifying factor 2 125 20 64 NM_001039710 coenzyme Q10 homolog B isoform 1 125 31 45 NM_175308 MOB1 Mps One Binder kinase activator-like 2C 124 1289 54 NM_009296 suppressor of Ty 4 homolog 1 124 785 237 NM_175360 oligonucleotide/oligosaccharide-binding fold 124 358 33 NM_172465 zinc finger DHHC domain containing 9 124 132 141 NM_145985 archain 1 124 105 142 NM_013807 polo-like kinase 3 124 96 127 NM_198303 eukaryotic translation initiation factor 5B 124 52 131 NM_026241 ankyrin repeat domain 39 124 86 93 NM_145931 zinc finger CCCH type containing 7 124 61 47 NM_026539 chromodomain helicase DNA binding protein 124 60 44 NM_145432 HEAT repeat containing 6 124 50 54 NM_001081402 WD repeat domain 70 124 31 70 NM_032460 HLA-B associated transcript 4 124 29 28 NM_025717 4921506I22Rik protein 124 17 17 NM_021452 calcium activated potassium channel beta 4 123 1751 87 NM_009079 ribosomal protein L22 123 196 105 NM_080633 aconitase 2 mitochondrial 123 168 104 NM_145476 TBC1 domain family member 22a 123 114 144 NM_011785 thymoma viral proto-oncogene 3 123 179 43 NM_009680 adaptor-related protein complex 3 beta 1 123 52 169 NM_028835 AGP7 123 93 90 NM_026556 dynein light chain LC8-type 2 123 114 65 NM_001081247 polymerase RNA III (DNA directed) polypeptide 123 61 106 NM_019781 peroxisomal biogenesis factor 14 123 87 53 NM_008893 polymerase DNA directed alpha 2 123 68 59 NM_008359 interleukin 17 receptor 123 31 85 NM_133346 ankyrin repeat and SOCS box-containing protein 123 43 51 NM_013720 MAX-interacting protein 123 34 58 NM_025845 PRP38 pre-mRNA processing factor 38 yeast 123 54 37 NM_133726 suppression of tumorigenicity 13 123 27 53 NM_172260 centrosomal protein 68 122 687 2755 NM_009985 cathepsin W preproprotein 122 594 110 NM_028388 NADH dehydrogenase ubiquinone flavoprotein 2 122 399 28 NM_011262 D4 zinc and double PHD fingers family 2 122 243 106 NM_024242 RIO kinase 1 122 216 99 NM_007614 catenin cadherin associated protein beta 1, 122 228 42 NM_008911 protoporphyrinogen oxidase 122 129 133 NM_199012 FCH and double SH3 domains 2 122 44 206 NM_053109 C-type lectin domain family 2 member d 122 157 45 NM_023281 succinate dehydrogenase Fp subunit 122 79 110 NM_001081392 midasin 122 71 72 NM_133671 U2 small nuclear ribonucleoprotein auxiliary 122 94 36 NM_001081495 acyl-Coenzyme A binding domain containing 4 122 57 54 NM_009280 synovial sarcoma translocation Chromosome 18 122 32 56 NM_145401 AMP-activated protein kinase gamma2 subunit 122 12 57 NM_001081237 kelch domain containing 5 122 22 34 NM_145453 zinc finger CCHC domain containing 9 122 1499 94 NM_028132 phosphoglucomutase 2 122 315 46 NM_008942 aminopeptidase puromycin sensitive 122 151 105 NM_198292 testis expressed gene 2 122 145 84 NM_178055 DnaJ Hsp40 homolog subfamily B, member 10 122 127 102 NM_018862 1-acylglycerol-3-phosphate O-acyltransferase 1 122 117 92 NM_001081293 hypothetical protein LOC75137 122 148 22 NM_178684 mitogen-activated protein kinase 1 interacting 122 69 94 NM_007690 chromodomain helicase DNA binding protein 1 122 96 63 NM_010938 nuclear respiratory factor 1 122 82 52 NM_029786 protein O-linked mannose 122 73 43 NM_134134 hypothetical protein LOC106894 isoform 2 122 57 59 NM_177680 YTH domain containing 1 122 22 76 NM_028871 heterogeneous nuclear ribonucleoprotein R 122 19 69 NM_021710 adaptor-related protein complex AP-4 sigma 1 122 40 41 NM_133735 pentatricopeptide repeat domain 1 122 4 58 NM_010439 high mobility group box 1 121 643 507 NM_009741 B-cell leukemia/lymphoma 2 isoform 1 121 481 97 NM_011034 peroxiredoxin 1 121 454 70 NM_009076 ribosomal protein L12 121 305 80 NM_021273 creatine kinase brain 121 198 141 NM_172608 transmembrane protein 184b 121 179 73 NM_018813 cleavage and polyadenylation specificity factor 121 68 160 NM_177296 transportin 3 121 113 104 NM_024188 3-oxoacid CoA transferase 1 121 102 107 NM_026504 coenzyme Q5 homolog methyltransferase 121 69 119 NM_001081276 CLIP-associating protein 1 isoform 1 121 82 83 NM_008837 protein interacting with C kinase 1 121 51 84 NM_053089 NMDA receptor-regulated gene 1 121 76 49 NM_009371 transforming growth factor beta receptor II 121 42 68 NM_019400 rabaptin RAB GTPase binding effector protein 1 121 4 33 NM_144926 seizure related 6 homolog like 2 121 11 25 NM_010185 Fc receptor IgE, high affinity I, gamma 120 7167 34 NM_008681 N-myc downstream regulated gene 1 120 1226 160 NM_019419 ADP-ribosylation factor-like 6 interacting 120 223 51 NM_013923 ring finger protein C3HC4 type 19 120 181 91 NM_008707 N-myristoyltransferase 1 120 103 147 NM_021395 hypoxia up-regulated 1 120 143 96 NM_207239 general transcription factor III C 1 120 143 38 NM_011869 mediator complex subunit 24 120 17 161 NM_011104 protein kinase C epsilon 120 44 127 NM_146205 armadillo repeat containing 5 120 61 102 NM_029091 kinesin light chain 4 120 98 64 NM_026765 uridine-cytidine kinase 1-like 1 120 30 117 NM_001015876 radical S-adenosyl methionine and flavodoxin 120 56 85 NM_172151 zinc finger DHHC domain containing 8 120 50 75 NM_026322 methionine sulfoxide reductase A 120 74 46 NM_001111121 coiled-coil domain containing 6 120 59 59 NM_007788 casein kinase 2 alpha 1 polypeptide 120 65 46 NM_009105 Ras suppressor protein 1 120 17 86 NM_011264 REV3-like catalytic subunit of DNA polymerase 120 34 66 NM_011909 ubiquitin specific peptidase 18 120 30 69 NM_001033439 leucine-rich repeats and calponin homology CH 120 28 71 NM_144816 rhomboid veinlet-like 1 120 40 41 NM_001097623 transcriptional regulating factor 1 isoform 1 120 55 23 NM_019442 serine/threonine kinase 19 120 56 19 NM_001080557 vesicle-associated membrane protein 1 isoform b 120 17 19 NM_010234 FBJ osteosarcoma oncogene 120 0 19 NM_133209 paired immunoglobin-like type 2 receptor beta 119 2258 110 NM_013686 t-complex protein 1 119 1308 144 NM_021552 TGF beta-inducible nuclear protein 1 119 189 57 NM_025882 DNA polymerase epsilon subunit 4 119 144 90 NM_178029 SET domain containing 1A 119 55 165 NM_008369 interleukin 3 receptor alpha chain 119 60 135 NM_009823 core-binding factor runt domain, alpha subunit 119 112 78 NM_026175 splicing factor 3a subunit 1 119 96 43 NM_011258 replication factor C 1 119 41 96 NM_001111324 neural precursor cell expressed developmentally 119 72 62 NM_194341 AP1 gamma subunit binding protein 1 119 9 121 NM_139299 interleukin 31 receptor A 119 45 84 NM_001026214 ectonucleoside triphosphate diphosphohydrolase 5 119 45 70 NM_026561 5'-nucleotidase cytosolic III-like isoform 2 119 20 82 NM_172663 enhancer of polycomb homolog 2 119 57 43 NM_025873 tRNA isopentenyltransferase 1 119 54 40 NM_175477 zinc finger protein 574 118 611 93 NM_013763 transducin beta-like 2 118 513 77 NM_145512 SFT2 domain containing 2 118 422 86 NM_026369 actin related protein 2/3 complex subunit 5 118 161 172 NM_183031 Epstein-Barr virus induced gene 2 118 97 155 NM_174989 TICAM-1 118 141 76 NM_145999 ras homolog gene family member T2 118 152 50 NM_009974 casein kinase 2 alpha prime polypeptide 118 22 73 NM_008846 phosphatidylinositol-4-phosphate 5-kinase type 118 25 58 NM_009553 zinc finger and SCAN domain containing 2 118 36 43 NM_032000 zinc finger transcription factor TRPS1 117 920 44 NM_027148 CBP-interacting protein 3 117 286 105 NM_021336 U2 small nuclear ribonucleoprotein polypeptide 117 239 80 NM_025300 mitochondrial ribosomal protein L15 117 40 263 NM_016740 S100 calcium binding protein A11 calizzarin 117 215 50 NM_133807 leucine rich repeat containing 59 117 181 74 NM_172569 zinc finger CCCH type containing 5 117 150 100 NM_172518 F-box protein 42 117 95 108 NM_177362 zinc finger protein 771 117 109 83 NM_146003 SUMO/sentrin specific protease 6 117 153 38 NM_026033 GATA zinc finger domain containing 1 117 79 78 NM_025314 D-tyrosyl-tRNA deacylase 1 117 104 45 NM_026456 transcription elongation factor B SIII 117 46 62 NM_133656 v-crk sarcoma virus CT10 oncogene homolog 117 43 43 NM_145486 membrane-associated ring finger C3HC4 2 117 34 45 NM_001110198 ring finger protein 146 117 0 9 NM_008220 hemoglobin beta adult major chain 116 536 47 NM_021295 LanC bacterial lantibiotic synthetase component 116 227 85 NM_001029983 mannosidase alpha, class 1B, member 1 116 204 102 NM_013918 ubiquitin specific peptidase 25 116 141 122 NM_023665 hypothetical protein LOC27981 116 191 65 NM_013762 ribosomal protein L3 116 136 100 NM_026998 sorting nexin 6 116 100 106 NM_001039394 RAB43 member RAS oncogene family isoform a 116 103 77 NM_011026 purinergic receptor P2X ligand-gated ion 116 57 98 NM_001078167 splicing factor arginine/serine-rich 1 isoform 116 59 95 NM_133352 transmembrane protein 9 superfamily member 3 116 76 49 NM_009836 chaperonin subunit 3 gamma 116 14 65 NM_001029993 conserved nuclear protein Nhn1 isoform a 116 25 40 NM_145147 GTP binding protein 6 putative 115 349 86 NM_028074 DEAD Asp-Glu-Ala-Asp box polypeptide 42 115 215 110 NM_018794 ATPase H+ transporting, lysosomal accessory 115 232 88 NM_173180 peptidase mitochondrial processing alpha 115 217 85 NM_008146 Golgi autoantigen golgin subfamily a, 3 115 136 121 NM_028065 canopy 3 homolog 115 148 104 NM_019706 ring finger protein 138 isoform 2 115 122 130 NM_022324 stromal cell-derived factor 2-like 1 115 129 73 NM_172252 mitochondrial ribosomal protein L21 115 68 111 NM_181347 DENN/MADD domain containing 1B isoform 1 115 84 87 NM_175273 hypothetical protein LOC78323 115 41 116 NM_178665 LIM domain containing preferred translocation 115 34 120 NM_010763 mannosidase alpha, class 1A, member 2 115 29 56 NM_029077 PU.1 binding protein Pub 115 5 38 NM_021568 polyrC binding protein 3 115 22 3 NM_008538 myristoylated alanine rich protein kinase C 114 606 90 NM_030093 RIKEN cDNA 3300001G02 114 288 169 NM_001110148 mannoside acetylglucosaminyltransferase 1 114 340 60 NM_021607 nicastrin 114 173 116 NM_133758 ubiquitin specific protease 47 114 238 51 NM_172406 trafficking protein kinesin binding 2 114 145 124 NM_016898 CD164 antigen 114 177 79 NM_019720 cytochrome b-561 domain containing 2 114 181 56 NM_011278 ring finger protein 4 114 32 184 NM_175225 taspase 1 114 80 122 NM_012003 COP9 constitutive photomorphogenic homolog 114 111 35 NM_153176 spastic paraplegia 7 homolog 114 117 20 NM_019760 serine incorporator 1 114 30 90 NM_011622 target of myb1 homolog 114 52 68 NM_030138 centaurin beta 2 114 27 73 NM_008637 nudix-type motif 1 114 66 28 NM_183220 1-aminocyclopropane-1-carboxylate synthase 114 33 59 NM_001081034 F-box protein 11 114 38 54 NM_181666 fucokinase isoform 2 114 63 27 NM_025878 mitochondrial ribosomal protein S18B 114 20 47 NM_027149 WD repeat domain 20 114 1470 133 NM_029362 chromatin modifying protein 4B 114 1540 46 NM_011488 signal transducer and activator of transcription 114 553 116 NM_010946 N-terminal Asn amidase 114 312 61 NM_023397 magnesium-dependent phosphatase-1 114 152 101 NM_133957 nuclear factor of activated T-cells 5 isoform a 114 144 93 NM_172924 NKF3 kinase family member 114 82 117 NM_001111100 lysosomal acid lipase A 114 120 66 NM_012017 zinc finger protein 346 114 101 77 NM_172117 ectonucleoside triphosphate diphosphohydrolase 114 55 121 NM_175472 zinc finger CCHC domain containing 11 114 109 51 NM_001033274 bromodomain containing 1 114 59 99 NM_030564 ring finger protein 34 114 41 106 NM_001081548 zinc finger protein 650 isoform 1 114 47 99 NM_179203 AAA-ATPase TOB3 114 84 59 NM_028185 U7 snRNA-associated Sm-like protein Lsm11 114 12 110 NM_001048227 SCF apoptosis response protein 1 114 25 82 NM_001033389 far upstream element FUSE binding protein 3 114 27 68 NM_009408 topoisomerase DNA I 114 31 59 NM_011416 SWI/SNF related matrix associated, actin 114 23 47 NM_173744 hypothetical protein LOC72148 114 22 37 NM_013550 histone cluster 1 H3a 113 452 41 NM_178027 vacuolar protein sorting 26 homolog B 113 116 106 NM_172827 leucyl/cystinyl aminopeptidase 113 43 158 NM_001038643 solute carrier organic anion transporter family 113 105 90 NM_001080932 forkhead box K2 113 105 75 NM_175145 transmembrane protein 127 113 99 79 NM_001080999 HpaII tiny fragments locus 9c isoform 2 113 124 44 NM_019574 POZ BTB and AT hook containing zinc finger 1 113 38 85 NM_145627 RNA binding motif protein 10 113 69 49 NM_019930 RAN binding protein 9 113 28 84 NM_011884 RNA guanylyltransferase and 5'-phosphatase 113 50 59 NM_145076 tripartite motif protein 24 113 31 57 NM_009211 SWI/SNF related matrix associated, actin 113 14 72 NM_009460 SMT3 suppressor of mif two 3 homolog 1 113 8 33 NM_019743 RING1 and YY1 binding protein 113 12 25 NM_019688 cAMP-regulated guanine nucleotide exchange 113 5 26 NM_080595 EMI domain containing 1 112 639 326 NM_053082 tetraspanin 4 112 583 101 NM_016709 AU RNA-binding enoyl-coenzyme A hydratase 112 338 67 NM_133216 X-prolyl aminopeptidase aminopeptidase P 1 112 326 70 NM_177733 E2F transcription factor 2 112 282 98 NM_019434 minichromosome maintenance complex component 3 112 237 101 NM_144925 trinucleotide repeat containing 6A 112 199 121 NM_001024922 DEAD Asp-Glu-Ala-Asp box polypeptide 49 112 195 73 NM_173751 ilvB bacterial acetolactate synthase-like 112 209 18 NM_023564 phospholipid scramblase 3 112 145 38 NM_001004190 zinc finger protein 560 112 141 36 NM_001077638 heterogeneous nuclear ribonucleoprotein 112 37 125 NM_177806 PRP39 pre-mRNA processing factor 39 homolog 112 27 133 NM_138305 adenylate cyclase 3 112 72 72 NM_001081168 SAP30-like 112 24 118 NM_144932 acyl-CoA synthetase family member 3 112 48 64 NM_033134 inositol polyphosphate-5-phosphatase E 112 4 97 NM_001081231 lipoma HMGIC fusion partner-like 3 112 20 74 NM_011083 phosphatidylinositol 3-kinase C2 domain 112 31 55 NM_178020 hyaluronoglucosaminidase 3 112 8 78 NM_011265 regulatory factor X 3 influences HLA class II 112 15 68 NM_175666 histone cluster 2 H2bb 112 58 21 NM_133672 vacuolar protein sorting 26 isoform a 111 713 82 NM_022000 GNAS complex locus isoform c 111 323 125 NM_008404 integrin beta 2 111 351 63 NM_013742 cysteinyl-tRNA synthetase 111 152 130 NM_026095 small nuclear ribonucleoprotein D3 111 130 136 NM_198647 TBC1 domain family member 22B 111 114 88 NM_028419 glutaredoxin 5 111 143 57 NM_001025438 calcium/calmodulin-dependent protein kinase II 111 102 91 NM_001039530 poly ADP-ribose polymerase family member 14 111 97 86 NM_025287 speckle-type POZ protein 111 14 135 NM_172595 ADP-ribosylation factor-like 15 111 47 99 NM_001081103 stromal interaction molecule 2 111 31 102 NM_133783 prostaglandin E synthase 2 111 42 88 NM_170588 copine I 111 47 67 NM_013672 trans-acting transcription factor 1 111 33 80 NM_008717 zinc finger protein 638 111 27 68 NM_199449 zinc fingers and homeoboxes protein 2 111 44 38 NM_052973 striatin calmodulin binding protein 3 111 20 57 NM_001030296 proline rich 7 synaptic 111 44 31 NM_001110233 nerve growth factor receptor TNFRSF16 111 19 53 NM_001100618 hypothetical protein LOC100043225 111 16 43 NM_145991 hyperparathyroidism 2 homolog 111 18 23 NM_133904 acetyl-Coenzyme A carboxylase beta 110 354 35 NM_019571 tetraspanin 5 110 187 85 NM_178745 hypothetical protein LOC268567 110 229 26 NM_007941 syntaxin 2 110 177 76 NM_001033134 hypothetical protein LOC67513 110 210 31 NM_010438 hexokinase 1 110 147 51 NM_011546 zinc finger E-box binding homeobox 1 110 137 61 NM_001039723 transmembrane protein 120B 110 115 62 NM_173002 ZXD family zinc finger C isoform 2 110 19 121 NM_146065 activating transcription factor 7 110 82 47 NM_008534 lymphocyte antigen 9 110 42 68 NM_176968 5'-nucleotidase cytosolic II-like 1 protein 110 44 62 NM_145743 lactation elevated 1 110 43 59 NM_001013806 ankyrin repeat domain 13c 110 26 70 NM_010418 hect homologous to the E6-AP (UBE3A carboxyl 110 51 43 NM_175183 ataxin 7-like 2 110 19 67 NM_134154 solute carrier family 25 member 45 110 45 35 NM_010765 MAP kinase-activated protein kinase 5 110 23 49 NM_001024920 transformation related protein 53 inducible 109 709 38 NM_013864 N-myc downstream regulated gene 2 109 530 42 NM_052835 ribosomal protein 10 109 212 210 NM_146115 hypothetical protein LOC227612 109 222 61 NM_010893 neuraminidase 1 109 173 70 NM_008683 neural precursor cell expressed developmentally 109 134 105 NM_026390 UBX domain containing 2 109 99 126 NM_013562 interferon-related developmental regulator 1 109 166 26 NM_029623 colon cancer-associated protein Mic1 homolog 109 54 133 NM_013548 histone cluster 1 H3f 109 113 73 NM_026968 mannosidase beta A, lysosomal-like 109 76 90 NM_172611 hypothetical protein LOC223752 109 63 93 NM_011714 bromodomain adjacent to zinc finger domain 1B 109 70 83 NM_145832 GDP-fucose transporter 1 isoform 2 109 97 45 NM_178347 CDC23 cell division cycle 23 yeast, homolog 109 74 66 NM_028151 superkiller viralicidic activity 2-like 2 109 48 81 NM_029736 solute carrier family 10 sodium/bile acid 109 48 74 NM_199196 suppressor of zeste 12 homolog 109 47 28 NM_033573 papillary renal cell carcinoma 109 47 27 NM_021499 WD repeat domain 8 109 16 31 NM_011277 ring finger protein 2 108 1581 115 NM_025491 sushi domain containing 3 108 1189 80 NM_177231 arrestin beta 1 isoform A 108 668 11 NM_022980 regulator of calcineurin 3 108 475 76 NM_019785 ARP10 actin-related protein 10 homolog 108 370 83 NM_008442 kinesin family member 2A 108 359 74 NM_153064 NADH dehydrogenase ubiquinone Fe-S protein 2 108 156 87 NM_010048 DiGeorge syndrome protein C isoform 1 108 196 31 NM_145130 membrane bound O-acyltransferase domain 108 20 181 NM_175106 transmembrane protein 177 108 152 31 NM_027886 serine/threonine kinase 11 interacting protein 108 122 28 NM_019937 cyclin L1 108 65 73 NM_026484 cyclin fold protein 1 108 89 45 NM_001038993 ring finger protein 38 isoform 2 108 62 69 NM_025682 paraspeckle protein 1 108 34 90 NM_001081225 hypothetical protein LOC226151 108 58 59 NM_009481 ubiquitin specific protease 9 X chromosome 108 34 79 NM_172763 zinc finger protein 809 108 46 56 NM_153085 WW domain containing adaptor with coiled-coil 108 38 59 NM_173187 hypothetical protein LOC227446 108 52 41 NM_026331 solute carrier family 25 member 37 108 30 59 NM_177186 solute carrier family 35 member E2 108 48 27 NM_033563 Kruppel-like factor 7 ubiquitous 108 16 9 NM_001004362 hypothetical protein LOC72128 107 624 126 NM_026027 prefoldin 1 107 503 64 NM_011970 proteasome prosome macropain subunit, beta 107 303 134 NM_009736 Bcl2-associated athanogene 1 isoform 1L 107 196 117 NM_172833 mucosa associated lymphoid tissue lymphoma 107 122 103 NM_026959 syntaxin 18 107 91 103 NM_028850 cysteine-rich hydrophobic domain 2 107 123 44 NM_013745 nuclear fragile X mental retardation protein 107 82 82 NM_010155 Ets2 repressor factor 107 80 58 NM_007596 calcium modulating ligand 107 99 38 NM_010472 HIV-1 Rev binding protein 107 18 116 NM_011552 treacle 107 82 48 NM_011247 retinoblastoma binding protein 6 isoform 1 107 17 104 NM_001077410 GTPase IMAP family member 8 107 62 57 NM_028019 ring finger protein 135 107 23 68 NM_027435 ATPase family AAA domain containing 2 107 19 66 NM_008448 kinesin family member 5B 107 41 42 NM_028298 zinc finger protein 655 isoform a 107 60 15 NM_028815 centrosomal protein 97 107 13 32 NM_145358 calcium/calmodulin-dependent protein kinase 106 306 106 NM_011969 proteasome prosome macropain subunit, alpha 106 122 108 NM_010613 KH-type splicing regulatory protein FUSE 106 122 80 NM_001033279 hypothetical protein LOC224647 isoform 1 106 139 59 NM_145436 cell division cycle 27 homolog 106 55 131 NM_144509 ADP-ribosylation factor-like 6 interacting 106 43 137 NM_172297 coiled-coil domain containing 9 106 105 62 NM_133763 terminal deoxynucleotidyltransferase interacting 106 100 53 NM_144873 ubiquitin-like containing PHD and RING finger 106 105 47 NM_008910 protein phosphatase 1A magnesium dependent, 106 96 54 NM_028814 hypothetical protein LOC74200 106 63 76 NM_001033142 ring finger protein 166 106 88 51 NM_001038593 glutaredoxin 2 isoform b 106 48 77 NM_144835 BAP28 protein 106 37 82 NM_030252 hypothetical protein LOC80284 106 70 30 NM_020271 pyridoxal phosphate phosphatase 106 40 49 NM_001039388 WD repeat domain 37 isoform a 106 15 32 NM_028876 transmembrane emp24 protein transport domain 106 33 6 NM_178729 F-box and leucine-rich repeat protein 5 106 302 99 NM_011942 lysophospholipase 2 106 217 160 NM_013862 RAB GTPase activating protein 1-like isoform a 106 200 151 NM_008214 histidyl-tRNA synthetase 106 189 139 NM_028846 ubiquitin specific peptidase 20 106 151 149 NM_025336 coiled-coil-helix-coiled-coil-helix domain 106 125 51 NM_001012667 hypothetical protein LOC102032 106 91 35 NM_145576 Zinc finger protein 212 106 18 7 NM_172856 LAG1 homolog ceramide synthase 6 105 932 70 NM_007573 complement component 1 q subcomponent binding 105 156 110 NM_010546 inhibitor of kappaB kinase beta 105 111 149 NM_019573 WW-domain oxidoreductase 105 199 53 NM_021435 solute carrier family 35 member B4 105 173 74 NM_011145 peroxisome proliferator activator receptor 105 133 106 NM_009739 branched chain ketoacid dehydrogenase kinase 105 156 46 NM_033398 jumonji domain containing 6 105 158 43 NM_001113213 outer dense fiber of sperm tails 2 isoform a 105 120 77 NM_027238 hypothetical protein LOC69863 105 131 66 NM_030695 LPS-responsive beige-like anchor isoform alpha 105 116 59 NM_197982 DEAD Asp-Glu-Ala-Asp box polypeptide 39 105 109 61 NM_178397 UBX domain containing 8 105 88 56 NM_021884 tumor susceptibility gene 101 protein 105 74 59 NM_028375 CAAX box 1 homolog C 105 44 70 NM_019658 soc-2 suppressor of clear homolog 105 58 54 NM_133817 zinc finger protein 451 104 1972 160 NM_016764 peroxiredoxin 4 104 342 80 NM_008640 lysosomal-associated protein transmembrane 4A 104 343 61 NM_144794 transmembrane protein 63a 104 113 124 NM_008487 rho/rac guanine nucleotide exchange factor GEF 104 146 87 NM_153799 enhancer of mRNA decapping 3 104 88 142 NM_029291 activating signal cointegrator 1 complex subunit 104 97 98 NM_173867 RCC1-like 104 150 32 NM_019993 aldehyde dehydrogenase 9 subfamily A1 104 136 31 NM_178901 hypothetical protein LOC101602 104 50 75 NM_016799 serine/arginine repetitive matrix 1 104 83 36 NM_024284 hydroxyacyl glutathione hydrolase 104 79 31 NM_177260 transmembrane protein 154 104 61 42 NM_019710 SMC1 structural maintenance of chromosomes 104 54 42 NM_021897 transformation related protein 53 inducible 104 12 72 NM_198420 hypothetical protein 9530053N22 104 24 38 NM_011739 tyrosine 3-monooxygenase/tryptophan 104 12 33 NM_001008233 pleckstrin homology domain containing family N 103 10074 38 NM_001081005 hypothetical protein LOC68949 103 1435 120 NM_010699 lactate dehydrogenase A 103 332 316 NM_025384 DnaJ Hsp40 homolog subfamily D, member 1 103 519 55 NM_016690 heterogeneous nuclear ribonucleoprotein D-like 103 299 90 NM_139061 vacuolar protein sorting 54 103 111 229 NM_009046 avian reticuloendotheliosis viral v-rel 103 303 34 NM_001083319 upstream binding protein 1 isoform a 103 209 55 NM_146047 CLPTM1-like 103 156 104 NM_145540 integrator complex subunit 3 103 150 106 NM_024219 heat shock factor binding protein 1 103 47 166 NM_013659 semaphorin 4B precursor 103 127 72 NM_146252 TBC1 domain family member 13 103 143 41 NM_001033174 oxysterol binding protein 103 79 61 NM_001081118 hypothetical protein LOC101471 103 67 71 NM_008980 protein tyrosine phosphatase receptor type, A 103 77 44 NM_194052 reticulon 4 isoform B1 103 41 80 NM_175256 HEG homolog 1 isoform a 103 26 94 NM_153459 dual specificity phosphatase 7 103 37 82 NM_001005509 eukaryotic translation initiation factor 2A 103 36 78 NM_172677 YTH domain family 3 103 43 67 NM_197981 hypothetical protein LOC72440 103 58 46 NM_020603 WD repeat domain 46 103 20 69 NM_172935 amidohydrolase domain containing 2 103 17 60 NM_133948 lens epithelium-derived growth factor 103 30 45 NM_026301 ring finger protein 125 103 36 38 NM_009826 RB1-inducible coiled-coil 1 103 36 37 NM_011394 solute carrier family 20 member 2 103 52 19 NM_175311 zinc finger protein 513 103 30 30 NM_001039536 phosphatidylinositol glycan anchor biosynthesis 103 15 13 NM_029645 glutamyl-tRNAGln amidotransferase subunit C 102 201 125 NM_026917 zinc finger DHHC domain containing 3 102 100 97 NM_133850 COMM domain containing 7 102 91 75 NM_025948 LSM14 homolog A 102 52 103 NM_013881 Unc-51 like kinase 2 102 66 76 NM_133767 mitochondrial translational initiation factor 2 102 51 72 NM_027427 TAF15 RNA polymerase II TATA box binding 102 17 81 NM_023336 bromodomain containing 3 isoform 2 102 56 39 NM_001042707 interleukin enhancer binding factor 3 isoform 2 102 30 64 NM_198005 hypothetical protein LOC75763 102 25 63 NM_018804 synaptotagmin XI 102 46 13 NM_011182 pleckstrin homology Sec7 and coiled-coil 102 19 38 NM_053182 phosphoprotein associated with glycosphingolipid 102 4 46 NM_172557 RUN and FYVE domain containing 1 101 239 93 NM_178760 expressed sequence AI790205 101 263 26 NM_138589 ubiquitin family domain containing 1 101 172 70 NM_026171 nuclear VCP-like 101 173 67 NM_028177 NADH dehydrogenase ubiquinone 1 alpha/beta 101 68 140 NM_030253 B aggressive lymphoma 101 117 78 NM_146002 rhomboid domain containing 2 101 97 97 NM_130892 reticulon 4 interacting protein 1 101 116 54 NM_028751 tight junction associated protein 1 101 74 85 NM_008244 HGF-regulated tyrosine kinase substrate 101 104 53 NM_134079 adenosine kinase 101 72 76 NM_145380 eukaryotic translation initiation factor 3 101 59 82 NM_011479 serine palmitoyltransferase long chain base 101 112 26 NM_009584 DnaJ Hsp40 homolog subfamily C, member 2 101 90 18 NM_029723 death associated protein-like 1 101 41 56 NM_026566 hypothetical protein LOC68118 101 37 51 NM_001110101 snRNP core protein SMX5 isoform 2 101 20 61 NM_199008 COX11 homolog cytochrome c oxidase assembly 101 7 75 NM_153173 histone cluster 1 H4h 101 18 60 NM_019825 nuclear receptor coactivator 6 100 238 105 NM_008379 karyopherin importin beta 1 100 53 203 NM_029635 COMM domain containing 9 100 200 54 NM_054070 AFG3ATPase family gene 3-like 1 100 187 49 NM_029354 hypothetical protein LOC72083 100 187 44 NM_172120 vacuolar protein sorting 41 100 160 44 NM_016916 bladder cancer associated protein 100 143 46 NM_011327 sterol carrier protein 2 liver 100 117 43 NM_011609 tumor necrosis factor receptor superfamily 100 55 102 NM_026002 LYRIC 100 40 116 NM_153062 solute carrier family 37 member 1 100 55 87 NM_178708 PCI domain containing 2 100 67 61 NM_178778 hypothetical protein LOC320271 100 28 50 NM_146000 BUD13 homolog 100 16 48 NM_144819 coiled-coil domain containing 92 100 18 45 NM_007399 a disintegrin and metallopeptidase domain 10 100 16 43 NM_177608 hypothetical protein LOC70354 99 726 43 NM_025936 arginyl-tRNA synthetase 99 222 78 NM_001039824 hypothetical protein LOC68165 99 89 139 NM_198894 active BCR-related isoform 2 99 163 40 NM_028410 interferon-inducible double stranded RNA 99 134 68 NM_177910 GDP-mannose pyrophosphorylase B 99 82 120 NM_012024 epsilon isoform of regulatory subunit B56 99 129 68 NM_133734 WD repeat domain 23 99 91 104 NM_145458 PX domain containing serine/threonine kinase 99 118 64 NM_178719 hypothetical protein LOC239555 99 138 36 NM_025418 1110059P08Rik protein 99 75 82 NM_172766 nuclear factor related to kappa B binding 99 59 92 NM_153389 ATPase class V, type 10D 99 70 74 NM_009179 ST3 beta-galactoside alpha-23-sialyltransferase 99 59 63 NM_001003971 SUMO1/sentrin specific protease 7 isoform 2 99 40 81 NM_134091 small G protein signaling modulator 3 99 62 50 NM_175675 hypothetical protein LOC74919 99 22 87 NM_027748 TAF3 RNA polymerase II TATA box binding protein 99 45 61 NM_019689 dead ringer homolog 2 99 7 91 NM_175652 histone cluster 4 H4 99 52 45 NM_007862 discs large homolog 1 99 81 16 NM_013736 transcription elongation factor B SIII 99 52 41 NM_172722 hypothetical protein LOC231713 99 52 34 NM_173363 eukaryotic translation initiation factor 5 99 28 40 NM_001081109 lemur tyrosine kinase 2 98 1032 191 NM_027862 ATP synthase H+ transporting, mitochondrial F0 98 333 70 NM_023214 zinc transporter like 2 98 349 25 NM_153194 zinc finger protein 740 98 62 97 NM_053069 autophagy-related 5-like 98 39 103 NM_026549 programmed cell death 2-like 98 62 44 NM_010568 insulin receptor 98 48 54 NM_025985 ubiquitin-conjugating enzyme E2G 1 98 58 43 NM_001081362 transformation/transcription domain-associated 98 45 44 NM_019826 isovaleryl coenzyme A dehydrogenase 98 38 51 NM_198607 mesenchymal stem cell protein DSCD75 homolog 98 50 35 NM_001039376 phosphodiesterase 4D interacting protein isoform 98 28 51 NM_010282 geranylgeranyl diphosphate synthase 1 98 48 29 NM_026267 NECAP endocytosis associated 1 98 30 41 NM_144787 jumonji domain containing 2C 98 22 21 NM_199470 cadherin-like 24 98 466 20 NM_172304 testis expressed gene 10 98 198 88 NM_009424 Tnf receptor-associated factor 6 98 143 63 NM_009886 cadherin EGF LAG seven-pass G-type receptor 1 98 24 180 NM_144920 phosphoinositol 3-phosphate-binding protein-2 98 117 85 NM_001033132 COMM domain containing 6 98 106 83 NM_027226 forty-two-three domain containing 1 98 63 118 NM_177345 mitogen-activated protein kinase associated 98 144 35 NM_080561 ubiquitin conjugating enzyme 7 interacting 98 51 117 NM_138646 Hermansky-Pudlak syndrome 4 homolog 98 66 92 NM_145466 hypothetical protein LOC223267 98 73 62 NM_029654 ATG2 autophagy related 2 homolog B 98 76 43 NM_172566 RUN domain containing 1 98 29 86 NM_172760 engulfment and cell motility 3 ced-12 homolog 98 54 49 NM_009032 RNA binding motif protein 4 98 53 48 NM_194334 TBC1 domain family member 2B 98 24 54 NM_010717 LIM-domain containing protein kinase 98 10 65 NM_177027 zinc finger CCHC domain containing 7 98 25 37 NM_001081371 Dmx-like 1 98 15 9 NM_009172 seven in absentia 1A 97 433 101 NM_021383 rcd1 required for cell differentiation homolog 97 280 53 NM_028028 zinc finger SWIM domain containing 1 97 190 73 NM_030243 RNA binding motif protein 43 97 173 76 NM_011276 ring finger protein 12 97 171 74 NM_175107 hypothetical protein LOC66367 97 55 165 NM_013789 secretion regulating guanine nucleotide exchange 97 141 77 NM_133766 RIKEN cDNA C920006C10 97 140 53 NM_001081145 tigger transposable element derived 2 homolog 97 63 126 NM_153530 DIS3 mitotic control homolog S. 97 34 125 NM_133694 F-box and leucine-rich repeat protein 15 97 72 66 NM_028881 transducer of regulated cAMP response 97 58 52 NM_008753 ornithine decarboxylase antizyme 1 97 43 62 NM_001033962 ubiquitin protein ligase E3A isoform 3 97 27 78 NM_010881 nuclear receptor coactivator 1 97 46 58 NM_001025586 nuclear receptor 2C2-associated protein isoform 97 43 59 NM_001080948 La ribonucleoprotein domain family member 4 97 26 61 NM_024282 hypothetical protein LOC78825 97 40 43 NM_026487 ATPase family AAA domain containing 1 97 39 27 NM_016910 protein phosphatase 1D magnesium-dependent 96 395 67 NM_030259 Rab interacting lysosomal protein-like 2 96 338 71 NM_148952 E2F transcription factor 4 96 319 67 NM_011695 voltage-dependent anion channel 2 96 67 249 NM_172768 GRAM domain containing 1B 96 163 92 NM_010696 lymphocyte cytosolic protein 2 96 105 130 NM_021421 D1Ertd396e protein 96 169 21 NM_175141 hypothetical protein LOC69155 96 106 59 NM_001008550 zinc finger FYVE domain containing 26 96 129 27 NM_010735 lymphotoxin A 96 36 117 NM_175287 hypothetical protein LOC97159 96 70 57 NM_030174 multiple C2 domains transmembrane 1 96 45 76 NM_001003919 DEAD/H Asp-Glu-Ala-Asp/His box polypeptide 11 96 44 64 NM_139153 centaurin gamma 3 96 42 46 NM_030675 KRIT1 ankyrin repeat containing 96 29 31 NM_023341 chaperone ABC1 activity of bc1 complex like 96 4 43 NM_018787 neuropeptide FF-amide peptide precursor 96 1 33 NM_025806 hypothetical protein LOC66857 95 1316 163 NM_175035 GTPase IMAP family member 5 95 493 76 NM_011975 ribosomal protein L27a 95 303 78 NM_026306 TRM112-like 95 259 76 NM_018828 formin binding protein 4 95 186 74 NM_028775 cytochrome P450 family 2, subfamily s, 95 193 52 NM_175114 trafficking protein kinesin binding 1 95 80 140 NM_025563 hypothetical protein LOC66439 95 117 102 NM_027827 arylformamidase 95 126 90 NM_001111049 CD151 antigen 95 165 29 NM_134060 solute carrier family 35 member B3 95 85 103 NM_001025067 leucine-rich repeats and immunoglobulin-like 95 118 60 NM_027357 proteasome 26S non-ATPase subunit 1 95 81 79 NM_016861 carboxyl terminal LIM domain protein 1 95 85 73 NM_207669 GA repeat binding protein beta 1 isoform a 95 42 113 NM_001033422 THO complex subunit 2 95 91 41 NM_177088 coiled-coil domain containing 45 95 112 15 NM_023065 interferon gamma inducible protein 30 95 74 43 NM_008564 minichromosome maintenance deficient 2 mitotin 95 75 37 NM_027985 MAD2 mitotic arrest deficient-like 2 95 47 62 NM_001081682 guanine nucleotide binding protein G protein 95 42 61 NM_029090 hypothetical protein LOC74763 95 20 55 NM_172871 kelch-like 9 95 2 4 NM_010601 potassium voltage-gated channel subfamily H 94 1455 32 NM_025275 archaemetzincins-2 94 640 93 NM_019511 receptor activity modifying protein 3 94 494 191 NM_008027 flotillin 1 94 269 111 NM_008133 glutamate dehydrogenase 1 94 234 69 NM_027696 mesoderm induction early response 1 isoform a 94 109 184 NM_020491 C184L-22 94 171 85 NM_008927 mitogen-activated protein kinase kinase 1 94 61 125 NM_019492 regulator of G-protein signaling 3 isoform 1 94 120 60 NM_025994 EF hand domain containing 2 94 99 65 NM_145559 solute carrier family 2 member 9 isoform 4 94 67 54 NM_211355 SMEK homolog 1 suppressor of mek1 94 34 60 NM_001110351 transcriptional regulator SIN3A isoform 1 94 37 44 NM_145415 digestive-organ expansion factor homolog 94 60 16 NM_011914 Wolf-Hirschhorn syndrome candidate 2 homolog 94 25 47 NM_170680 ATP-binding cassette sub-family C, member 10 94 20 37 NM_176972 ubiquitin specific peptidase 37 94 18 3 NM_011639 thyroid receptor-interacting protein 6 93 659 48 NM_025394 translocase of outer mitochondrial membrane 7 93 222 203 NM_028079 aminopeptidase O 93 190 158 NM_146023 ecotropic viral integration site 2b 93 112 136 NM_001025444 aprataxin isoform b 93 117 83 NM_199466 echinoderm microtubule associated protein like 4 93 2 193 NM_145211 2'-5' oligoadenylate synthetase 1A 93 109 43 NM_001013374 lectin mannose-binding 2-like 93 38 93 NM_013814 UDP-N-acetyl-alpha-D-galactosamine:polypeptide 93 55 64 NM_030074 zinc finger protein 687 93 50 65 NM_013799 arginine-tRNA-protein transferase 1 isoform 1 93 13 82 NM_146259 zinc finger protein 668 93 56 38 NM_138598 hypothetical protein LOC28081 93 58 26 NM_133780 nuclear pore complex-associated protein Tpr 93 18 62 NM_011916 5'-3' exoribonuclease 1 93 8 72 NM_175529 leukocyte receptor cluster LRC member 9 92 3579 134 NM_025592 ribosomal protein L35 92 631 73 NM_008517 leukotriene A4 hydrolase 92 448 84 NM_138660 cancer susceptibility candidate 3 92 284 84 NM_025387 transmembrane protein 14C 92 96 100 NM_172400 DnaJ Hsp40 homolog subfamily C, member 8 92 129 54 NM_183091 I-kappa-B-related protein 92 125 55 NM_001081241 hypothetical protein LOC75687 92 75 78 NM_001039521 RRN3 RNA polymerase I transcription factor 92 98 46 NM_008550 mannosidase alpha class 2B member 2 92 69 66 NM_133927 integrin alpha FG-GAP repeat containing 2 92 52 80 NM_177267 WD repeat domain 22 92 50 76 NM_144842 zinc finger MYM-type 5 92 42 80 NM_032008 sarcolemma associated protein 92 60 54 NM_001039092 target of myb1-like 2 isoform b 92 50 52 NM_009029 retinoblastoma 1 92 2 96 NM_028870 clathrin light polypeptide Lcb 92 52 46 NM_023742 deltex 2 92 70 26 NM_001017959 lysosomal membrane glycoprotein 2 isoform 1 92 58 31 NM_053075 RAS-homolog enriched in brain 91 1696 60 NM_053207 EGL nine homolog 1 91 519 66 NM_026403 hypothetical protein LOC67842 91 170 140 NM_023133 ribosomal protein S19 91 229 63 NM_007856 7-dehydrocholesterol reductase 91 116 113 NM_018730 ribosomal protein L36 91 127 85 NM_001024508 bromodomain containing 9 91 65 127 NM_181417 cysteine and glycine-rich protein 2 binding 91 155 28 NM_025821 calcium-regulated heat-stable protein 24kD 91 59 116 NM_025928 polyamine-modulated factor 1 91 90 80 NM_001102430 ADP-ribosylation factor guanine 91 40 72 NM_172806 BTB POZ domain containing 7 91 27 80 NM_001081341 S phase cyclin A-associated protein in the ER 91 50 51 NM_013919 ubiquitin-specific protease 21 91 34 47 NM_173737 hypothetical protein LOC232210 91 33 43 NM_023596 equilibrative nucleoside transporter 3 91 22 51 NM_172772 hypothetical protein LOC235461 91 666 117 NM_009383 Tial1 cytotoxic granule-associated RNA binding 91 220 54 NM_019803 ubiquitin-conjugating enzyme E2G 2 91 165 83 NM_028995 NIPA-like domain containing 3 91 155 61 NM_021535 smu-1 suppressor of mec-8 and unc-52 homolog 91 145 31 NM_172735 zinc finger C3HC type 1 91 56 119 NM_027346 coiled-coil domain containing 44 91 136 38 NM_001110309 zinc finger protein 426 91 111 49 NM_177242 T-cell activation protein phosphatase 2C 91 75 81 NM_010306 guanine nucleotide binding protein G protein 91 88 67 NM_178616 proteasome 26S non-ATPase subunit 11 91 62 91 NM_009320 solute carrier family 6 neurotransmitter 91 46 103 NM_001040686 zinc finger protein 692 91 124 23 NM_011603 TATA box binding protein-like 1 91 106 40 NM_148928 general transcription factor III polypeptide 5 91 72 73 NM_011159 protein kinase DNA activated, catalytic 91 97 29 NM_028633 UCH37-interacting protein 1 isoform 1 91 70 53 NM_001081423 tubulin tyrosine ligase-like family member 5 91 33 87 NM_133741 SNF related kinase 91 83 21 NM_025294 transcript expressed during hematopoiesis 2 91 77 13 NM_009480 upstream stimulatory factor 1 91 14 72 NM_001035239 transient receptor potential cation channel 91 37 43 NM_001007465 ring finger and FYVE like domain containing 91 32 40 NM_134003 zinc finger CCCH type containing 10 91 56 15 NM_011292 ribosomal protein L9 91 37 18 NM_178654 protein kinase N2 91 19 28 NM_027295 RAB28 member RAS oncogene family 91 3 14 NM_030558 carbonic anhydrase 15 90 1743 327 NM_018796 eukaryotic translation elongation factor 1 beta 90 419 60 NM_053092 lysyl-tRNA synthetase 90 270 71 NM_025338 aurora kinase A interacting protein 1 90 216 60 NM_030131 cornichon homolog 4 90 101 121 NM_145928 tetraspanin 14 90 171 48 NM_025482 tumor protein D52-like 2 90 130 60 NM_153516 BCL2-like 13 90 86 86 NM_009713 arylsulfatase A 90 120 51 NM_025861 PQ loop repeat containing 1 90 80 85 NM_024459 protein phosphatase 3 regulatory subunit B, 90 76 81 NM_008619 Moloney leukemia virus 10 90 134 23 NM_153198 high mobility group box transcription factor 1 90 82 63 NM_025762 hypothetical protein LOC99650 isoform 1 90 105 31 NM_145597 transmembrane protein 161A 90 12 117 NM_175464 plakophilin 4 isoform 2 90 32 94 NM_199068 forkhead box K1 90 27 71 NM_013792 alpha-N-acetylglucosaminidase 90 37 47 NM_026810 MutL protein homolog 1 90 29 53 NM_001113533 Wilms' tumour 1-associating protein isoform a 90 10 37 NM_007622 chromobox homolog 1 89 485 90 NM_026737 PHD-finger 5A 89 432 53 NM_013718 trafficking protein particle complex 3 89 411 50 NM_008959 phosphatidylserine synthase 1 89 30 261 NM_008924 protein kinase cAMP dependent regulatory, type 89 122 81 NM_001079814 cytokine-like nuclear factor n-pac isoform 1 89 148 52 NM_172843 torsin A interacting protein 2 89 137 38 NM_183285 potassium channel tetramerisation domain 89 73 82 NM_009072 Rho-associated coiled-coil forming kinase 2 89 109 43 NM_174997 hypothetical protein LOC214469 89 114 37 NM_020520 carnitine/acylcarnitine translocase 89 99 48 NM_133835 ubiquitin associated domain containing 1 89 97 33 NM_133889 BSD domain containing 1 89 90 35 NM_001080949 tetratricopeptide repeat domain 5 isoform a 89 53 68 NM_145420 ubiquitin-conjugating enzyme E2D 1 UBC4/5 89 87 32 NM_008502 lethal giant larvae homolog 89 41 69 NM_026551 dephospho-CoA kinase domain containing 89 34 69 NM_025877 solute carrier family 25 member 23 89 52 41 NM_008211 H3 histone family 3B 89 27 63 NM_001015507 Vpr-binding protein 89 28 59 NM_007764 v-crk sarcoma virus CT10 oncogene homolog 89 42 30 NM_175317 elongation factor Tu GTP binding domain 89 3 63 NM_026495 BTB POZ domain containing 14A isoform 1 89 37 11 NM_008445 kinesin family member 3C 88 838 158 NM_008348 interleukin 10 receptor alpha 88 485 99 NM_133976 IMP3 U3 small nucleolar ribonucleoprotein, 88 431 34 NM_016755 ATP synthase H+ transporting, mitochondrial F0 88 85 164 NM_008580 mitogen-activated protein kinase kinase kinase 88 61 113 NM_008977 protein tyrosine phosphatase non-receptor type 88 123 52 NM_008224 host cell factor C1 88 74 98 NM_008064 acid alpha-glucosidase 88 119 44 NM_134126 intraflagellar transport 140 88 142 20 NM_146141 inorganic pyrophosphatase 2 88 100 47 NM_013883 sex comb on midleg homolog 1 88 29 72 NM_029348 zinc finger and BTB domain containing 4 88 14 80 NM_011212 protein tyrosine phosphatase receptor type, E 88 55 32 NM_001001182 bromodomain adjacent to zinc finger domain 2B 88 39 43 NM_008465 karyopherin importin alpha 1 87 1653 97 NM_026055 ribosomal protein L39 87 919 47 NM_009227 small nuclear ribonucleoprotein E 87 684 76 NM_025965 signal sequence receptor alpha 87 257 100 NM_133847 transmembrane 9 superfamily protein member 4 87 265 36 NM_133232 6-phosphofructo-2-kinase/fructose-2 87 232 17 NM_025894 proteasome 26S non-ATPase subunit 12 87 157 68 NM_028906 dipeptidylpeptidase 8 87 106 59 NM_148948 dicer1 87 108 46 NM_021525 RNA terminal phosphate cyclase-like 1 87 82 61 NM_177387 uronyl-2-sulfotransferase 87 60 59 NM_001077696 histone deacetylase 5 isoform 1 87 73 42 NM_025456 E2F-associated phosphoprotein 87 44 63 NM_028360 tetratricopeptide repeat domain 19 isoform 1 87 53 51 NM_028301 ankyrin repeat and sterile alpha motif domain 87 68 33 NM_011317 KH domain containing RNA binding, signal 87 53 44 NM_152809 casein kinase 1 gamma 3 87 52 24 NM_133740 protein arginine N-methyltransferase 3 87 37 9 NM_178380 DEAH Asp-Glu-Ala-His box polypeptide 38 87 5 26 NM_177712 hypothetical protein LOC238692 87 8 9 NM_024444 cytochrome P450 CYP4F18 86 682 61 NM_028320 adiponectin receptor 1 86 379 62 NM_022813 secretory carrier membrane protein 2 86 202 145 NM_144829 alanyl-tRNA synthetase domain containing 1 86 234 91 NM_007761 calcitonin gene-related peptide-receptor 86 280 43 NM_146177 suppressor of variegation 4-20 homolog 2 86 182 98 NM_010220 FK506 binding protein 5 86 187 57 NM_023434 epidermal Langerhans cell protein LCP1 86 60 151 NM_001001806 zinc finger protein 36 C3H type-like 2 86 138 41 NM_029634 inositol hexaphosphate kinase 2 86 82 72 NM_025468 Sec11-like 3 86 102 32 NM_028126 protein kinase LYK5 86 68 54 NM_146224 suppressor of hairy wing homolog 4 86 53 63 NM_019673 actin-like 6A 86 55 45 NM_146081 protein phosphatase 4 regulatory subunit 1 86 34 29 NM_027432 WD repeat domain 77 86 37 15 NM_013830 PRP4 pre-mRNA processing factor 4 homolog B 86 27 24 NM_023603 splicing factor proline/glutamine rich 86 9 21 NM_175474 hypothetical protein LOC231717 85 877 85 NM_025272 ATPase H+ transporting, V0 subunit e 85 540 34 NM_009637 AE binding protein 2 isoform 3 85 354 72 NM_019435 neuronal protein 15.6 85 228 58 NM_172943 alkB alkylation repair homolog 5 85 193 79 NM_133897 AD158 85 223 16 NM_146107 ARP1 actin-related protein 1 homolog B 85 197 9 NM_028865 hypothetical protein LOC74319 85 110 86 NM_001081344 tomosyn 85 124 72 NM_001109746 cellular nucleic acid binding protein isoform 3 85 88 98 NM_025811 NHL repeat containing 2 85 117 53 NM_133872 amine oxidase flavin containing domain 2 85 22 138 NM_153421 polyhomeotic-like 3 85 84 66 NM_133770 aarF domain containing kinase 4 85 84 62 NM_030692 SAC1 supressor of actin mutations 1 85 83 48 NM_177073 RELT tumor necrosis factor receptor 85 74 48 NM_172401 hypothetical protein LOC68832 85 82 25 NM_178050 ADP-ribosylation factor-like 6 interacting 85 53 48 NM_009595 v-abl Abelson murine leukemia viral oncogene 2 85 25 64 NM_030113 Rho GTPase activating protein 10 85 15 62 NM_026298 intraflagellar transport 172 protein 85 25 47 NM_001079830 tripartite motif protein 33 isoform 2 85 22 44 NM_010017 dystroglycan 1 85 30 22 NM_009796 calpain 7 85 30 20 NM_172405 coiled-coil domain containing 98 85 1 7 NM_008076 gamma-aminobutyric acid GABA-C receptor 84 253 55 NM_178065 hypothetical protein LOC68497 84 230 63 NM_008655 growth arrest and DNA-damage-inducible 45 beta 84 258 14 NM_023144 non-POU-domain-containing octamer binding 84 196 74 NM_027143 hypothetical protein LOC219094 84 33 234 NM_146090 zinc binding alcohol dehydrogenase domain 84 89 140 NM_009124 ataxin 1 84 62 159 NM_145221 DIP13 alpha 84 137 77 NM_027976 acyl-CoA synthetase long-chain family member 5 84 80 133 NM_001048206 Tnf receptor-associated factor 3 isoform b 84 156 52 NM_153089 protein phosphatase 1 regulatory inhibitor 84 139 55 NM_009269 serine palmitoyltransferase subunit 1 84 169 19 NM_017382 RAB11a member RAS oncogene family 84 143 43 NM_011672 ubiquitin fusion degradation 1 like 84 81 104 NM_021605 NIMA never in mitosis gene a-related expressed 84 126 59 NM_146091 hypothetical protein LOC109168 84 122 50 NM_029274 WW domain binding protein 7 84 140 26 NM_023290 makorin ring finger protein, 2 84 82 67 NM_025835 propionyl Coenzyme A carboxylase beta 84 69 73 NM_026374 interleukin enhancer binding factor 2 84 65 67 NM_133665 myocyte enhancer factor 2D 84 77 48 NM_001037940 DnaJ Hsp40 homolog subfamily B, member 6 84 82 43 NM_008095 glioblastoma amplified 84 96 25 NM_019709 membrane-bound transcription factor peptidase 84 40 71 NM_172382 jumonji domain containing 2A 84 50 43 NM_001033348 hypothetical protein LOC241694 84 27 57 NM_031494 Zinc finger protein 275 84 30 53 NM_008715 integrator complex subunit 6 84 26 56 NM_009239 trans-acting transcription factor 4 84 14 31 NM_007489 aryl hydrocarbon receptor nuclear 84 22 24 NM_001110214 artemis protein isoform 3 84 13 32 NM_024433 methylthioadenosine phosphorylase 84 19 9 NM_026113 general transcription factor IIIC polypeptide 83 1115 64 NM_016891 alpha isoform of regulatory subunit A protein 83 741 81 NM_009169 split hand/foot deleted gene 1 83 387 51 NM_010761 cyclin D-type binding-protein 1 83 227 74 NM_010585 inositol 14,5-triphosphate receptor 1 83 251 39 NM_016714 nucleoporin 50 83 227 59 NM_030700 melanoma antigen family D 2 83 201 64 NM_011932 dual adaptor for phosphotyrosine and 83 160 105 NM_026211 transmembrane emp24 protein transport domain 83 196 58 NM_001033908 surfeit gene 5 isoform 2 83 103 120 NM_177562 C-type lectin domain family 16 member A 83 126 21 NM_148932 nuclear pore membrane protein 121 83 52 78 NM_022985 zinc finger AN1-type domain 6 83 48 80 NM_009461 ubiquitin protein ligase E3 component n-recognin 83 57 66 NM_001081077 CWF19-like 1 cell cycle control 83 26 95 NM_011946 mitogen activated protein kinase kinase kinase 83 48 65 NM_133744 coiled-coil domain containing 71 83 60 50 NM_001003899 TAR DNA binding protein isoform 3 83 94 16 NM_024236 quinoid dihydropteridine reductase 83 41 64 NM_177941 endothelin converting enzyme 2 isoform a 83 27 70 NM_010210 fragile histidine triad 83 14 80 NM_172992 putative homeodomain transcription factor 2 83 61 28 NM_172713 SDA1 domain containing 1 83 38 50 NM_025362 Williams-Beuren syndrome critical region 18 83 32 54 NM_183251 hypothetical protein LOC66273 83 31 43 NM_011506 succinate-Coenzyme A ligase ADP-forming, beta 83 27 25 NM_027909 transmembrane protein 24 83 20 9 NM_183286 dehydrogenase/reductase SDR family member 13 83 424 157 NM_023117 cell division cycle 25 homolog B isoform a 83 261 37 NM_011130 polymerase DNA directed beta 83 142 110 NM_001080127 ribonucleic acid binding protein S1 isoform 1 83 123 127 NM_010858 myosin light polypeptide 4 83 51 132 NM_001105196 transcription factor E3 isoform b 83 41 117 NM_026876 N2N2-dimethylguanosine tRNA 83 52 83 NM_181411 aftiphilin protein 83 76 54 NM_178601 U3 snoRNP protein 4 homolog 83 50 78 NM_022889 pescadillo homolog 1 containing BRCT domain 83 87 27 NM_033523 sprouty-related protein with EVH-1 domain 2 83 83 26 NM_027310 hypothetical protein LOC70088 83 74 28 NM_153515 AMME chromosomal region gene 1-like 83 42 57 NM_027772 prenyl diphosphate synthase subunit 2 83 16 73 NM_139309 fukutin 83 36 46 NM_025283 preimplantation protein 3 83 17 64 NM_026698 transmembrane protein 129 83 25 49 NM_146222 hypothetical protein LOC235184 83 13 52 NM_021512 nucleoporin 160 83 18 29 NM_008298 DnaJ Hsp40 homolog subfamily A, member 1 83 10 30 NM_019694 leucine zipper-EF-hand containing transmembrane 82 572 22 NM_173001 jumonji domain containing 1A isoform 1 82 523 39 NM_009729 ATPase H+ transporting, lysosomal V0 subunit C 82 445 38 NM_133900 phosphoserine phosphatase 82 331 36 NM_172717 checkpoint with forkhead and ring finger 82 165 70 NM_010888 NADH dehydrogenase ubiquinone Fe-S protein 6 82 184 28 NM_011779 coronin actin binding protein 1C 82 120 48 NM_145433 mitochondrial rRNA methyltransferase 1 homolog 82 89 58 NM_001037737 aryl hydrocarbon receptor nuclear translocator 82 61 84 NM_033604 ring finger 111 82 76 69 NM_029868 GC-rich promoter binding protein 1-like 1 82 39 98 NM_016877 CCR4-NOT transcription complex subunit 4 82 36 96 NM_172757 HEAT repeat containing 3 82 86 45 NM_010716 ligase III DNA, ATP-dependent 82 115 14 NM_001018063 CAAX box 1 homolog B 82 62 65 NM_175143 glutamine-rich 1 82 63 51 NM_028248 transmembrane protein 87B 82 28 85 NM_001033375 hypothetical protein LOC319277 82 62 46 NM_172558 gem nuclear organelle associated protein 5 82 57 47 NM_028777 SEC14-like 1 82 34 68 NM_175530 F-box protein 46 82 55 47 NM_007998 ferrochelatase 82 48 43 NM_029509 guanylate binding protein 8 82 33 48 NM_011307 ubiquitin interaction motif containing 1 82 36 36 NM_173423 fem-1 homolog c 82 13 43 NM_019770 transmembrane emp24 domain trafficking protein 82 37 15 NM_026411 hypothetical protein LOC67851 82 23 23 NM_026570 YEATS domain containing 4 82 37 1 NM_175274 tweety 3 81 388 67 NM_144900 Na+/K+ -ATPase alpha 1 subunit 81 300 119 NM_016738 ribosomal protein L13 81 283 61 NM_009938 coatomer protein complex subunit alpha 81 276 49 NM_015792 F-box protein 18 81 217 46 NM_025334 endoplasmic reticulum protein ERp19 81 128 46 NM_025323 splicing factor 3B 14 kDa subunit 81 54 119 NM_178909 WD repeat domain 92 81 69 98 NM_010123 eukaryotic translation initiation factor 3 81 99 53 NM_029926 interleukin-1 receptor-associated kinase 4 81 67 82 NM_178898 hypothetical protein LOC101197 81 90 29 NM_197993 terminal uridylyl transferase 1 U6 81 30 74 NM_175335 general transcription factor II A 1 isoform 2 81 54 44 NM_001033466 zinc finger and BTB domain containing 2 81 23 58 NM_023479 elaC homolog 2 81 30 46 NM_020566 heat shock 40kD protein 2 81 16 55 NM_198103 exocyst complex component 8 81 19 48 NM_020586 HERPUD family member 2 81 34 32 NM_178873 aarF domain containing kinase 2 81 41 26 NM_198294 TPR domain ankyrin-repeat and 81 30 28 NM_197998 hypothetical protein LOC72355 81 12 45 NM_023423 hypothetical protein LOC68050 80 458 26 NM_019478 polyglutamine binding protein 1 80 313 66 NM_175134 ankyrin repeat domain 46 80 254 44 NM_026011 ADP-ribosylation factor-like 10C 80 163 125 NM_026490 mitochondrial ribosomal protein L19 80 170 33 NM_015729 acyl-Coenzyme A oxidase 1 palmitoyl 80 116 43 NM_009358 delta isoform of regulatory subunit B56 protein 80 79 65 NM_145518 NADH dehydrogenase ubiquinone Fe-S protein 1 80 79 63 NM_011052 programmed cell death 6 interacting protein 80 98 33 NM_145510 RAB-interacting factor 80 69 50 NM_207225 histone deacetylase 4 80 25 91 NM_009183 ST8 alpha-N-acetyl-neuraminide 80 19 80 NM_011810 Fas apoptotic inhibitory molecule 80 25 73 NM_177171 HEAT repeat containing 5A 80 29 61 NM_198644 zinc finger and AT hook domain containing 80 26 62 NM_145452 RAS p21 protein activator 1 80 39 48 NM_010815 GRB2-related adaptor protein 2 80 31 52 NM_013827 metal response element binding transcription 80 17 64 NM_134094 neurocalcin delta 80 37 36 NM_019721 methyltransferase-like 3 80 54 18 NM_001009927 Smith-Magenis syndrome chromosome region 80 59 11 NM_027978 para-hydroxybenzoate-polyprenyltransferase 80 48 20 NM_133750 hypothetical protein LOC73225 isoform a 80 16 42 NM_175001 mitochondrial ribosomal protein L22 80 10 40 NM_133738 anthrax toxin receptor 2 80 22 25 NM_027494 zinc finger CCHC domain containing 8 80 24 18 NM_011931 ring finger and WD repeat domain 2 80 19 12 NM_030266 inositol polyphosphate-4-phosphatase type I 80 25 4 NM_183392 nucleoporin 54 79 499 46 NM_019800 acid phosphatase 6 lysophosphatidic 79 377 99 NM_008402 integrin alpha V 79 273 32 NM_001005506 taxilin alpha 79 244 44 NM_025304 leucine carboxyl methyltransferase 1 79 238 37 NM_020035 phosphatidylinositol glycan anchor biosynthesis 79 232 28 NM_007465 baculoviral IAP repeat-containing 2 79 152 100 NM_001111062 catechol-O-methyltransferase 79 166 37 NM_026067 three prime histone mRNA exonuclease 1 79 140 43 NM_016676 RAB10 member RAS oncogene family 79 129 50 NM_026441 PEF protein with a long N-terminal hydrophobic 79 76 87 NM_026913 MIT microtubule interacting and transport, 79 113 40 NM_175130 transient receptor potential cation channel 79 45 87 NM_172660 hypothetical protein LOC227695 79 50 65 NM_009541 zinc finger and BTB domain containing 17 79 16 84 NM_001081061 B double prime 1 subunit of RNA polymerase III 79 24 71 NM_025422 CD302 antigen 79 26 67 NM_011507 succinate-Coenzyme A ligase GDP-forming, beta 79 32 60 NM_001081009 poly ADP-ribose polymerase family member 8 79 46 44 NM_028095 hypothetical protein LOC72096 79 22 59 NM_001025572 ankyrin repeat domain 12 79 41 39 NM_010276 GTP binding protein gene overexpressed in 79 32 44 NM_028105 aarF domain containing kinase 1 79 23 49 NM_007842 DEAH Asp-Glu-Ala-His box polypeptide 9 79 25 33 NM_009926 collagen type XI, alpha 2 79 22 32 NM_177137 guanine nucleotide binding protein alpha 79 1 3 NM_016704 complement component 6 78 690 43 NM_133774 StAR-related lipid transfer START domain 78 399 59 NM_080456 mitochondrial ribosomal protein S6 78 383 51 NM_172609 translocase of outer mitochondrial membrane 22 78 272 66 NM_025388 ubiquitin-fold modifier conjugating enzyme 1 78 188 106 NM_207636 fibronectin type III domain containing 3a 78 0 283 NM_001033813 hypothetical protein LOC619310 78 155 95 NM_007464 baculoviral IAP repeat-containing 3 78 202 47 NM_199307 endothelin converting enzyme 1 78 0 163 NM_178185 histone cluster 1 H2ao 78 23 140 NM_009326 transcription elongation factor A protein 2 78 110 41 NM_144500 oxysterol-binding protein-like protein 2 78 56 92 NM_009010 RAD23a homolog 78 133 10 NM_007913 early growth response 1 78 98 43 NM_029810 5'-nucleotidase cytosolic II 78 17 110 NM_198110 guanine nucleotide binding protein-like 3 78 53 68 NM_028233 leucine-rich PPR motif-containing protein 78 72 46 NM_024240 SLD5 78 76 38 NM_146165 JTV1 78 39 75 NM_011249 retinoblastoma-like protein 1 78 69 39 NM_027423 RNA polymerase III subunit RPC2 78 0 102 NM_145227 2'-5' oligoadenylate synthetase 2 78 42 49 NM_025819 hypothetical protein LOC66875 78 47 43 NM_011721 Werner syndrome protein 78 37 51 NM_057172 far upstream element FUSE binding protein 1 78 25 60 NM_028287 hypothetical protein LOC72580 78 50 17 NM_011981 zinc finger protein 260 78 25 41 NM_133185 leucine zipper domain protein 78 18 34 NM_024258 ubiquitin specific peptidase 16 78 38 13 NM_024288 required for meiotic nuclear division 5 homolog 77 5542 6 NM_008479 lymphocyte-activation gene 3 77 840 58 NM_007594 calumenin isoform 1 77 822 56 NM_007793 cystatin B 77 604 79 NM_011421 sphingomyelin phosphodiesterase 1 acid 77 403 41 NM_027959 protein disulfide isomerase-associated 6 77 276 56 NM_001037736 Rho guanine nucleotide exchange factor GEF 10 77 211 43 NM_028123 solute carrier family 37 glycerol-3-phosphate 77 145 103 NM_153126 N-acetyltransferase 10 77 148 66 NM_008408 intergral membrane protein 1 77 154 52 NM_019584 beclin 1 77 99 101 NM_030100 within bgcn homolog 77 114 62 NM_010945 neutral sphingomyelinase N-SMase activation 77 101 75 NM_029020 ATP-binding cassette sub-family B MDR/TAP, 77 90 74 NM_001033277 SPRY domain containing 3 77 81 80 NM_025606 mitochondrial ribosomal protein L16 77 89 53 NM_026511 hypothetical protein LOC68020 77 86 49 NM_017479 MYST histone acetyltransferase monocytic 77 114 21 NM_008602 protein inhibitor of activated STAT 2 77 95 22 NM_026065 mitochondrial ribosomal protein L42 77 59 56 NM_028036 transmembrane and coiled-coil domains 6 77 15 87 NM_001045486 zinc finger protein 180 77 52 45 NM_029282 hypothetical protein LOC75425 77 44 51 NM_011986 neurochondrin 77 80 9 NM_026004 5'-nucleotidase cytosolic III 77 22 47 NM_177464 growth inhibition and differentiation related 77 27 42 NM_026417 Yip1 domain family member 4 77 20 47 NM_008478 L1 cell adhesion molecule 77 15 41 NM_178925 NOL1/NOP2/Sun domain family 3 77 31 25 NM_018785 formin binding protein 3 77 32 20 NM_011594 TIMP metallopeptidase inhibitor 2 77 39 6 NM_172597 thioredoxin domain containing 16 76 541 95 NM_182990 structure specific recognition protein 1 76 590 20 NM_008084 glyceraldehyde-3-phosphate dehydrogenase 76 448 53 NM_023119 enolase 1 alpha non-neuron 76 412 62 NM_017374 protein phosphatase 2a catalytic subunit, beta 76 360 27 NM_019769 calcium binding protein P22 76 189 84 NM_197985 adiponectin receptor 2 76 194 68 NM_144884 torsin A 76 191 67 NM_011065 period homolog 1 76 212 43 NM_001080813 RAB11 family interacting protein 1 76 184 64 NM_001081183 hypothetical protein LOC66185 76 186 6 NM_174995 microsomal glutathione S-transferase 2 76 133 43 NM_181414 phosphoinositide-3-kinase class 3 76 116 54 NM_001037725 amyotrophic lateral sclerosis 2 juvenile 76 108 52 NM_134015 F-box and WD-40 domain protein 11 76 129 27 NM_011192 proteasome activator subunit 3 76 15 119 NM_019401 N-mcy and STAT interactor 76 57 75 NM_001033140 hypothetical protein LOC68332 76 75 54 NM_145377 tripartite motif-containing 41 76 40 79 NM_001048208 cofactor required for Sp1 transcriptional 76 29 90 NM_025818 ELG protein 76 32 73 NM_027541 PRP3 pre-mRNA processing factor 3 homolog 76 56 39 NM_026932 EBNA1 binding protein 2 76 22 65 NM_001081422 hypothetical protein LOC665775 76 24 62 NM_001104551 vomeronasal receptor Vmn2r99 76 53 26 NM_145958 kelch repeat and BTB POZ domain containing 2 76 52 24 NM_007610 caspase 2 76 39 35 NM_178363 YLP motif containing 1 76 8 55 NM_175187 transmembrane protein 161B 76 16 26 NM_019766 prostaglandin E synthase 3 cytosolic 76 12 28 NM_145370 G protein pathway suppressor 1 76 9 17 NM_177047 autism susceptibility candidate 2 75 673 51 NM_011694 voltage-dependent anion channel 1 75 462 51 NM_009840 chaperonin subunit 8 theta 75 265 74 NM_134095 hypothetical protein LOC28075 75 195 72 NM_026170 endoplasmic reticulum-golgi intermediate 75 129 56 NM_001099917 hypothetical protein LOC72273 75 85 85 NM_024436 RAB22A member RAS oncogene family 75 27 94 NM_178633 kelch-like 2 Mayven 75 74 39 NM_027764 regulator of chromosome condensation RCC1 and 75 70 29 NM_019736 acyl-CoA thioesterase 9 75 22 74 NM_025644 exosome component 1 75 30 59 NM_178207 histone cluster 1 H3i 75 41 29 NM_199145 hypothetical protein LOC78412 75 37 29 NM_008173 nuclear receptor subfamily 3 group C, member 1 75 16 45 NM_010192 feminization 1 homolog a 75 18 26 NM_011224 muscle glycogen phosphorylase 75 16 26 NM_011086 1-phosphatidylinositol-4-phosphate 5-kinase 75 19 17 NM_138605 protein phosphatase 1 regulatory inhibitor 75 4 21 NM_001081229 TSC22 domain family 2 75 1931 84 NM_011817 growth arrest and DNA-damage-inducible 45 gamma 75 880 44 NM_025710 ubiquinol-cytochrome c reductase Rieske 75 434 55 NM_025345 hypothetical protein LOC66086 75 73 295 NM_028013 endonuclease domain containing 1 75 234 87 NM_178746 hypothetical protein LOC268706 75 123 94 NM_007961 ets variant gene 6 TEL oncogene 75 89 94 NM_011100 protein kinase cAMP dependent, catalytic, beta 75 30 140 NM_133719 meteorin 75 59 96 NM_028844 apoptosis caspase activation inhibitor 75 118 37 NM_010023 dodecenoyl-Coenzyme A delta isomerase 32 75 91 58 NM_198671 genetic suppressor element 1 75 68 76 NM_013489 CD84 antigen 75 55 87 NM_016924 RWD domain containing 2B 75 103 33 NM_010706 lectin galactose binding, soluble 4 75 55 71 NM_011814 fragile X mental retardation-related protein 2 75 87 37 NM_145558 mitochondrial trifunctional protein beta 75 62 61 NM_024272 single-stranded DNA binding protein 2 isoform 2 75 86 32 NM_010066 DNA methyltransferase cytosine-5 1 75 23 89 NM_080562 U box domain containing 5 75 5 99 NM_026012 death domain containing membrane protein NRADD 75 90 14 NM_016754 myosin light chain phosphorylatable, fast 75 48 53 NM_010213 four and a half LIM domains 3 75 37 59 NM_172662 glycosyltransferase-like domain containing 1 75 68 25 NM_001030306 hypothetical protein LOC231128 75 59 26 NM_028950 NOL1/NOP2/Sun domain family 6 75 32 43 NM_020506 exportin 4 75 74 0 NM_010358 glutathione S-transferase mu 1 75 37 26 NM_024480 SH3 binding domain protein 5 like 75 27 36 NM_172495 nuclear receptor coactivator 7 isoform 1 75 12 39 NM_025886 Ras association RalGDS/AF-6 domain family 7 75 10 22 NM_009437 thiosulfate sulfurtransferase mitochondrial 74 679 94 NM_025796 mitochondrial ribosomal protein L33 74 300 98 NM_026077 hypothetical protein LOC67290 74 341 41 NM_026911 signal peptidase 12kDa 74 343 23 NM_009832 cyclin K 74 268 37 NM_026195 5-aminoimidazole-4-carboxamide ribonucleotide 74 52 218 NM_011436 sortilin-related receptor LDLR class A 74 172 65 NM_028148 splicing factor arginine/serine-rich 2, 74 114 109 NM_144543 thymocyte protein Thy28 74 184 32 NM_026455 hypothetical protein LOC67922 74 197 18 NM_025832 NMDA receptor regulated 1-like 74 143 35 NM_026392 transmembrane protein 70 isoform 2 74 89 84 NM_023668 NudeL protein 74 108 42 NM_010064 dynein cytoplasmic 1 intermediate chain 2 74 97 50 NM_019667 signal transducing adaptor molecule SH3 domain 74 40 107 NM_198013 CUE domain containing 1 74 69 76 NM_027288 mannosidase beta A, lysosomal 74 74 69 NM_029629 fumarylacetoacetate hydrolase domain containing 74 100 39 NM_026869 pygopus 2 74 27 97 NM_133905 PAP associated domain containing 4 74 79 43 NM_009679 adaptor protein complex AP-2 mu1 74 30 86 NM_198248 zinc finger and BTB domain containing 40 74 86 29 NM_001081188 exosome component 7 74 69 35 NM_018824 solute carrier family 23 nucleobase 74 62 26 NM_011368 src homology 2 domain-containing transforming 74 26 61 NM_177338 homeobox containing 1 74 47 34 NM_025441 serologically defined colon cancer antigen 1 74 16 59 NM_001081177 kinesin family member 13B 74 15 40 NM_027007 zinc finger protein 397 74 0 3 NM_177686 C-type lectin domain family 12 member a 73 620 124 NM_011350 sema domain immunoglobulin domain Ig, TM 73 116 261 NM_008802 phosphodiesterase 7A 73 301 30 NM_019879 succinate-CoA ligase GDP-forming, alpha 73 269 58 NM_026347 isoamyl acetate-hydrolyzing esterase 1 homolog 73 217 43 NM_008254 3-hydroxy-3-methylglutaryl-Coenzyme A lyase 73 177 59 NM_021521 mediator of RNA polymerase II transcription 73 132 85 NM_020009 FK506 binding protein 12-rapamycin associated 73 97 80 NM_025433 ribosomal protein L7-like 1 73 123 34 NM_172738 hypothetical protein LOC232853 73 116 27 NM_177732 solute carrier family 35 UDP-glucuronic 73 117 26 NM_024451 unc-84 homolog A 73 89 52 NM_172416 osteopetrosis associated transmembrane protein 73 30 104 NM_144908 UDP-N-acetyl-alpha-D-galactosamine:polypeptide 73 42 86 NM_026476 U2-associated SR140 protein 73 74 46 NM_175400 selenophosphate synthetase 1 73 70 47 NM_173369 ubiquitin carboxyl-terminal hydrolase CYLD 73 27 90 NM_025343 required for meiotic nuclear division 1 homolog 73 83 32 NM_009092 ribosomal protein S17 73 71 43 NM_025550 proteasome 26S, non-ATPase regulatory subunit 73 53 57 NM_013840 ubiquitously expressed transcript 73 68 38 NM_145417 arginyl aminopeptidase aminopeptidase B 73 31 59 NM_018814 pecanex homolog 73 34 48 NM_172575 zinc finger protein 277 isoform 1 73 53 12 NM_010721 lamin B1 73 15 48 NM_053187 golgi associated PDZ and coiled-coil motif 73 11 26 NM_001034862 glutamate-rich 1 73 11 24 NM_001079849 polyA binding protein interacting protein 1 73 11 16 NM_001103182 type I interferon receptor beta chain-associated 73 16 9 NM_001001881 hypothetical protein LOC72190 72 1033 87 NM_008618 malate dehydrogenase 1 NAD soluble 72 432 53 NM_001109971 SEC61 gamma subunit isoform 2 72 239 105 NM_134141 cytokine induced apoptosis inhibitor 1 72 175 52 NM_027946 WD-repeat protein 72 88 126 NM_010414 huntingtin 72 143 47 NM_013890 F-box and WD-40 domain protein 2 72 84 97 NM_001040005 ring finger protein 213 72 105 57 NM_009157 mitogen-activated protein kinase kinase 4 72 43 68 NM_026401 mitochondrial ribosomal protein 63 72 31 76 NM_001085507 zinc finger and BTB domain containing 34 72 43 62 NM_019458 Paf1 RNA polymerase II associated factor, 72 44 54 NM_001081028 signal-induced proliferation-associated 1 like 72 22 76 NM_134025 peroxisomal biogenesis factor 12 72 39 56 NM_145590 hypothetical protein LOC233913 72 22 72 NM_009728 ATPase class V, type 10A 72 15 72 NM_029801 SSTK-interacting protein 72 20 57 NM_026658 MTO1 72 36 37 NM_016801 syntaxin 1A brain 72 34 35 NM_007625 chromobox homolog 4 72 20 28 NM_008043 GSK-3 binding protein FRAT1 72 18 14 NM_029236 BCDIN3 domain containing 72 13 18 NM_001093749 myelin protein zero-like 3 isoform 2 72 18 2 NM_001033929 threonine synthase-like 2 71 367 312 NM_008915 protein phosphatase 3 catalytic subunit, gamma 71 520 55 NM_028018 hypothetical protein LOC71955 71 338 48 NM_053272 24-dehydrocholesterol reductase precursor 71 136 98 NM_016722 galactosamine N-acetyl-6-sulfate sulfatase 71 201 15 NM_008541 MAD homolog 5 71 85 108 NM_008793 proprotein convertase subtilisin/kexin type 4 71 93 96 NM_173408 DCN1 defective in cullin neddylation 1, domain 71 74 105 NM_172529 N-acetylglucosamine-1-phosphotransferase gamma 71 113 59 NM_007869 DnaJ Hsp40 homolog subfamily C, member 1 71 80 84 NM_054051 phosphatidylinositol-5-phosphate 4-kinase type 71 147 9 NM_008621 membrane protein palmitoylated 71 120 15 NM_001042558 apoptotic protease activating factor 1 71 75 53 NM_008168 glutamate receptor ionotropic, kainate 5 gamma 71 40 86 NM_145138 NIMA-related expressed kinase 9 71 45 79 NM_001081068 zinc finger protein 294 71 55 53 NM_013747 golgi autoantigen golgin subfamily a, 5 71 65 43 NM_178632 integrator complex subunit 7 71 71 36 NM_153405 developmentally regulated RNA binding protein 1 71 26 77 NM_001102613 pleckstrin homology-like domain family B, 71 80 17 NM_027493 ARP8 actin-related protein 8 homolog 71 30 58 NM_028534 stromal membrane-associated protein 1 71 54 28 NM_198109 slingshot homolog 1 71 25 57 NM_009859 cell division cycle 10 homolog 71 33 46 NM_175294 nuclear casein kinase and cyclin-dependent 71 13 62 NM_029758 hypothetical protein LOC76820 71 50 23 NM_027405 hypothetical protein LOC70373 71 33 39 NM_020046 dihydroorotate dehydrogenase 71 12 58 NM_001081093 ADP-ribosylation factor interacting protein 1 71 34 20 NM_028713 raftlin family member 2 71 22 28 NM_178242 zinc finger protein 469 71 26 22 NM_029211 ring finger protein 121 71 27 18 NM_001081092 TAF4A RNA polymerase II TATA box binding 71 11 30 NM_001024846 zinc finger protein 62 isoform 2 71 8 19 NM_025683 ribulose-5-phosphate-3-epimerase 71 1 6 NM_009913 chemokine C-C motif receptor 9 70 648 80 NM_026724 ribosomal protein L34 70 8 345 NM_008116 gamma-glutamyltransferase 1 70 239 72 NM_024209 protein phosphatase 6 catalytic subunit 70 181 41 NM_024180 ORM1-like 2 70 120 61 NM_080463 protein O-fucosyltransferase 1 isoform 1 70 106 70 NM_013671 superoxide dismutase 2 mitochondrial 70 5 142 NM_010623 kinesin family member 17 70 60 76 NM_030004 crystallin lambda 1 70 86 48 NM_001013012 zinc finger protein 787 70 59 73 NM_027347 mediator complex subunit 23 70 88 38 NM_025382 transmembrane protein 57 70 65 49 NM_001110253 FYVE and coiled-coil domain containing 1 70 102 11 NM_026644 1-acylglycerol-3-phosphate O-acyltransferase 4 70 43 67 NM_009615 a disintegrin and metalloprotease domain 17 70 47 59 NM_017406 cAMP responsive element binding protein-like 1 70 36 69 NM_172162 MBD2-interacting zinc finger 70 30 74 NM_172699 forkhead box J3 70 28 74 NM_133917 MLX interacting protein isoform 2 70 44 55 NM_001013025 TGF beta receptor associated protein -1 70 74 24 NM_013636 protein phosphatase 1 catalytic subunit, gamma 70 65 33 NM_028262 SET domain containing 3 70 53 44 NM_026891 congenital dyserythropoietic anemia type I 70 17 64 NM_001013802 MACRO domain containing 2 isoform 1 70 26 50 NM_175312 hypothetical protein LOC101148 70 20 39 NM_001033222 PDZ domain containing 8 70 13 43 NM_001083312 guanylate binding protein 7 70 45 7 NM_001081315 bromodomain and PHD finger containing 3 70 22 28 NM_177389 melanoma inhibitory activity 3 69 1760 36 NM_013842 X-box binding protein 1 69 275 76 NM_013594 methyl-CpG binding domain protein 1 69 288 16 NM_026329 polymerase RNA II (DNA directed) polypeptide 69 194 40 NM_025291 steroid receptor RNA activator 1 69 188 43 NM_008246 hippocampus abundant gene transcript 1 69 174 41 NM_016890 dynactin 3 69 193 21 NM_026714 hypothetical protein LOC68394 69 61 131 NM_025673 golgi phosphoprotein 3 69 169 24 NM_001033600 acyl-CoA synthetase long-chain family member 4 69 128 47 NM_001081184 hypothetical protein LOC230393 69 117 53 NM_153562 hypothetical protein LOC229503 69 112 33 NM_008492 lactate dehydrogenase B 69 67 77 NM_001081098 zinc finger protein 362 69 60 78 NM_030081 zinc finger FYVE domain containing 20 69 59 76 NM_001033139 hypothetical protein LOC68229 69 34 62 NM_009001 RAB3A member RAS oncogene family 69 25 66 NM_001081302 triple functional domain PTPRF interacting 69 32 45 NM_011770 helios 69 15 59 NM_029491 hypothetical protein LOC75964 69 41 33 NM_018878 Pax transcription activation domain interacting 69 33 32 NM_026231 glutathione S-transferase C-terminal domain 69 17 43 NM_139227 ataxin 7 69 46 12 NM_026866 dispatched homolog 1 69 25 33 NM_176962 hypothetical protein LOC319615 69 11 43 NM_172573 endo-beta-N-acetylglucosaminidase 69 24 30 NM_134077 RNA binding motif protein 26 69 34 19 NM_001081182 Atpase class I, type 8B, member 2 69 14 21 NM_001013829 Src homology 2 domain containing F 69 1 5 NM_011518 spleen tyrosine kinase 68 5374 234 NM_011701 vimentin 68 547 54 NM_021329 RAN guanine nucleotide release factor 68 240 297 NM_008677 neutrophil cytosolic factor 4 68 281 58 NM_011119 ErbB3-binding protein 1 68 193 57 NM_029037 hypothetical protein LOC74653 68 122 126 NM_010828 Cbp/p300-interacting transactivator with 68 204 35 NM_016682 ubiquitin-like modifier activating enzyme 2 68 153 40 NM_007414 ADP-ribosylarginine hydrolase 68 110 72 NM_133968 small nuclear RNA activating complex 68 105 74 NM_001029855 proteasome activator subunit 2 isoform 2 68 119 36 NM_138303 Yip1 domain family member 2 68 98 54 NM_030719 opposite strand transcription unit to Stag3 68 80 72 NM_145962 pantothenate kinase 3 68 109 32 NM_016865 HIV-1 tat interactive protein 2 homolog 68 47 85 NM_025674 transcription factor 19 68 54 74 NM_133991 Ftsj homolog 68 99 16 NM_026912 sorting nexin 15 68 54 55 NM_010515 insulin-like growth factor 2 receptor 68 43 36 NM_146096 Cgi67 serine protease precursor 68 15 62 NM_009744 B-cell leukemia/lymphoma 6 68 44 33 NM_025645 U5 snRNP-specific protein Prp8-binding 68 20 54 NM_026350 coiled-coil domain containing 130 68 16 56 NM_001004357 contactin associated protein-like 2 isoform a 68 37 35 NM_029166 UHRF1 ICBP90 binding protein 1-like 68 65 5 NM_010389 histocompatibility 2 O region beta locus 68 30 29 NM_146008 t-complex 11 mouse like 2 68 31 27 NM_145541 RAS-related protein-1a 68 19 35 NM_010028 DEAD/H Asp-Glu-Ala-Asp/His box polypeptide 3 68 29 11 NM_013727 5-azacytidine induced 2 isoform a 68 4 9 NM_007420 adrenergic receptor beta 2 67 4032 867 NM_007763 cysteine-rich protein 1 intestinal 67 475 37 NM_054081 metastasis associated 1 67 410 43 NM_024174 mitochondrial ribosomal protein S23 67 134 103 NM_028007 integrin alpha FG-GAP repeat containing 1 67 209 15 NM_020010 cytochrome P450 family 51 67 193 27 NM_001025360 kinesin light chain 1 isoform 1D 67 148 31 NM_134093 LETM1 domain containing 1 67 125 55 NM_009294 syntaxin 4A placental 67 53 123 NM_025324 zinc finger protein 524 67 89 72 NM_194462 A kinase PRKA anchor protein (yotiao) 9 67 102 42 NM_153136 nudix nucleoside diphosphate linked moiety 67 89 34 NM_026794 differentially expressed in B16F10 1 67 29 80 NM_001033237 YEATS domain containing 2 67 54 55 NM_027434 hypothetical protein LOC70470 67 57 51 NM_008233 hepatoma-derived growth factor-related protein 67 84 23 NM_152807 coiled-coil domain containing 137 67 24 82 NM_172591 Fcho2 67 77 26 NM_153178 eukaryotic translation initiation factor 2C 2 67 60 39 NM_025339 transmembrane protein 42 67 56 36 NM_173753 folliculin interacting protein 1 67 60 28 NM_010274 glycerol phosphate dehydrogenase 2 67 59 26 NM_146033 ankyrin repeat and MYND domain containing 2 67 74 7 NM_025611 cullin 7 67 38 40 NM_022885 solute carrier family 30 zinc transporter 67 36 41 NM_009950 CASP2 and RIPK1 domain containing adaptor with 67 12 60 NM_008514 low density lipoprotein receptor-related protein 67 46 25 NM_010435 histone cell cycle regulation defective homolog 67 23 45 NM_028083 chromatin assembly factor 1 subunit B 67 12 42 NM_009730 attractin 67 29 19 NM_019648 methionine aminopeptidase 2 67 24 20 NM_026532 nuclear transport factor 2 67 5 34 NM_029342 nonhomologous end-joining factor 1 67 12 18 NM_026039 mediator of RNA polymerase II transcription 67 162 335 NM_198411 formin inverted 67 436 38 NM_011030 procollagen-proline 2-oxoglutarate 67 386 67 NM_011295 ribosomal protein S12 67 380 45 NM_178645 bleomycin hydrolase 67 179 109 NM_008979 protein tyrosine phosphatase non-receptor type 67 179 52 NM_001104616 radixin isoform a 67 200 27 NM_133934 ISY1 splicing factor homolog 67 180 25 NM_146105 hypothetical protein LOC226744 67 142 31 NM_001033297 hypothetical protein LOC228715 67 55 93 NM_001029843 vaccinia related kinase 1 isoform b 67 61 77 NM_001110497 transmembrane protein 87A isoform 3 67 104 26 NM_001039718 Zfp91-Cntf readthrough protein 67 84 40 NM_008886 postmeiotic segregation increased 2 67 17 104 NM_011138 POU domain class 2, transcription factor 2 67 77 37 NM_183308 paraoxonase 2 67 18 93 NM_001037713 XIAP associated factor-1 67 73 36 NM_153091 suppression of tumorigenicity 7-like 67 45 53 NM_178046 supervillin isoform 2 67 59 38 NM_199149 hypothetical protein LOC232947 67 62 34 NM_023420 collagen type IV, alpha 3 Goodpasture antigen 67 48 47 NM_023524 TCF3 E2A fusion partner 67 67 9 NM_025958 TBP-interacting protein b 67 53 22 NM_001003912 Rho guanine nucleotide exchange factor GEF 11 67 34 37 NM_032396 kringle-containing transmembrane protein 1 67 40 31 NM_181402 poly ADP-ribose polymerase family member 11 67 44 26 NM_080556 transmembrane 9 superfamily member 2 67 20 49 NM_001033382 calcium channel voltage-dependent, alpha 67 54 15 NM_021720 downstream neighbor of SON 67 36 31 NM_177725 leucine-rich repeat-containing 8 67 19 45 NM_001076791 regulator of sex-limitation candidate 16 67 4 37 NM_001083318 ets variant gene 3 67 5 30 NM_198608 alanyl-tRNA synthetase like 67 25 6 NM_029627 lymphocyte antigen 6 complex locus K 67 3 4 NM_019417 PDZ and LIM domain 4 66 289 949 NM_133348 acyl-CoA thioesterase 7 66 473 46 NM_080287 engulfment and cell motility 2 ced-12 homolog 66 442 58 NM_026470 spermatogenesis associated 6 66 281 61 NM_020048 Trf-proximal protein homolog 66 261 42 NM_019668 ubiquitin-conjugating enzyme E2A RAD6 homolog 66 215 82 NM_145385 myeloid leukemia factor 2 homolog 66 195 88 NM_019748 SUMO1 activating enzyme subunit 1 66 143 82 NM_019988 G protein beta subunit-like 66 179 43 NM_001047433 zinc finger CSL domain containing 2 isoform 2 66 69 134 NM_025772 dystrobrevin binding protein 1 66 185 12 NM_001004143 ubiquitin specific peptidase 22 66 125 46 NM_009096 ribosomal protein S6 66 73 64 NM_001030307 dyskerin 66 60 74 NM_015769 excision repair cross-complementing rodent 66 62 66 NM_178620 major facilitator superfamily domain containing 66 95 31 NM_172652 hypothetical protein LOC226976 66 69 36 NM_030199 zinc finger protein 623 66 19 78 NM_023731 coiled-coil domain containing 86 66 32 63 NM_028399 cyclin T2 66 2 90 NM_019469 histone cluster 2 H3c1 isoform 1 66 47 41 NM_001081373 centrosomal protein 164 66 33 54 NM_001024703 multiple C2 domains transmembrane 2 66 46 25 NM_145479 kelch-like 22 66 47 19 NM_001113188 fragile X mental retardation-related protein 1 66 42 21 NM_001102458 antizyme inhibitor 1 66 14 40 NM_009665 S-adenosylmethionine decarboxylase 1 66 41 12 NM_001039552 hypothetical protein LOC381062 isoform 1 66 38 15 NM_019550 polypyrimidine tract binding protein 2 66 31 17 NM_153139 solute carrier family 36 member 1 66 11 37 NM_001045529 microrchidia 3 66 32 15 NM_008622 Mpv17 transgene kidney disease mutant 66 32 11 NM_001033379 DCP1 decapping enzyme homolog b 66 16 26 NM_001077707 SNF2 histone linker PHD RING helicase isoform a 66 10 27 NM_173037 transmembrane and coiled-coil domains 7 66 11 25 NM_175211 Ral GEF with PH domain and SH3 binding motif 1 66 14 20 NM_030682 toll-like receptor 1 65 1223 91 NM_008248 histidine triad nucleotide binding protein 1 65 330 34 NM_009273 signal recognition particle 14 65 166 86 NM_133739 transmembrane protein 123 65 227 13 NM_025571 mitochondria-associated granulocyte macrophage 65 211 28 NM_001002846 F-box and leucine-rich repeat protein 12 isoform 65 197 32 NM_007620 carbonyl reductase 1 65 152 48 NM_053162 mitochondrial ribosomal protein L34 65 145 41 NM_001076789 chromobox homolog 5 65 100 74 NM_009687 apurinic/apyrimidinic endonuclease 1 65 39 131 NM_178205 histone cluster 1 H3e 65 144 25 NM_011991 COP9 constitutive photomorphogenic subunit 3 65 120 48 NM_019936 cysteine-rich PDZ-binding protein 65 83 77 NM_134023 TBC1 domain family member 10a 65 130 19 NM_133839 hypothetical protein LOC109129 65 120 15 NM_011035 p21 CDKN1A-activated kinase 1 65 83 39 NM_207219 hypothetical protein LOC106821 65 61 53 NM_054097 phosphatidylinositol-5-phosphate 4-kinase type 65 75 37 NM_030261 sestrin 3 65 51 61 NM_026218 FGFR1 oncogene partner 2 65 75 29 NM_212433 F-box only protein 3 isoform 1 65 17 73 NM_026846 zinc finger AN1 type domain 2B 65 33 56 NM_053011 low density lipoprotein-related protein 1B 65 32 51 NM_182805 glutamic pyruvic transaminase 1 soluble 65 17 65 NM_011958 origin recognition complex subunit 4 65 28 49 NM_028776 ezrin-binding partner PACE-1 65 20 56 NM_175091 tankyrase TRF1-interacting ankyrin-related 65 34 42 NM_153128 kelch-like 12 65 24 46 NM_029432 hypothetical protein LOC228602 65 41 26 NM_021463 phosphoribosyl pyrophosphate synthetase 1 65 22 44 NM_022655 iron responsive element binding protein 2 65 46 19 NM_053204 Rab6-interacting protein 2 isoform 1 65 10 53 NM_010949 numb gene homolog 65 44 18 NM_029561 Nedd4 family interacting protein 2 65 40 14 NM_024185 2310047O13Rik protein 65 5 44 NM_178283 ankyrin repeat and SOCS box-containing protein 65 18 26 NM_007943 epidermal growth factor receptor pathway 65 12 24 NM_001113354 PHD finger protein 8 isoform b 64 2585 688 NM_008368 interleukin 2 receptor beta chain 64 242 94 NM_207648 histocompatibility 2 Q region locus 6 64 223 98 NM_026529 hypothetical protein LOC68046 64 272 40 NM_007713 CDC-like kinase 3 64 231 58 NM_026365 jagunal homolog 1 64 231 58 NM_025588 exocyst complex component 2 64 254 31 NM_026579 hypothetical protein LOC28109 64 127 129 NM_001039150 CD44 antigen isoform b 64 196 45 NM_001013360 neuronal pentraxin with chromo domain isoform 1 64 139 87 NM_018788 exostoses multiple-like 3 64 202 20 NM_027315 ubiquitin-conjugating enzyme E2Q 64 155 43 NM_172015 isoleucyl-tRNA synthetase 64 148 39 NM_010709 ligatin 64 89 86 NM_015818 heparan sulfate 6-O-sulfotransferase 1 64 122 40 NM_175097 prickle homolog 3 64 114 34 NM_028057 cytochrome b5 reductase 1 64 53 93 NM_001033448 hypothetical protein LOC381201 64 102 41 NM_001085407 serologically defined colon cancer antigen 3 64 81 54 NM_025942 GTP-binding protein PTD004 isoform a 64 101 33 NM_134084 peptidylprolyl isomerase F 64 61 73 NM_001081196 heterogeneous nuclear ribonucleoprotein U-like 64 106 26 NM_173011 isocitrate dehydrogenase 2 NADP+ 64 13 98 NM_178112 integrator complex subunit 8 64 31 65 NM_026274 ring finger and SPRY domain containing 1 64 43 42 NM_146170 hypothetical protein LOC232196 64 62 15 NM_023773 M-phase phosphoprotein mpp8 64 15 62 NM_027585 hypothetical protein LOC70873 64 59 15 NM_023646 DnaJ Hsp40 homolog subfamily A, member 3 64 48 24 NM_029278 probable nucleolar complex protein 14 64 16 51 NM_028774 ring finger protein C3H2C3 type 6 64 52 12 NM_029945 sphingomyelin phosphodiesterase 4 64 10 52 NM_026303 alkB alkylation repair homolog 8 64 18 39 NM_027830 minichromosome maintenance complex component 9 64 31 26 NM_019986 hyaluronic acid binding protein 4 64 13 39 NM_001033336 ATP-binding cassette sub-family C CFTR/MRP, 64 22 29 NM_133658 excision repair cross-complementing rodent 64 10 39 NM_011504 syntaxin binding protein 3 64 8 40 NM_026197 methyltransferase 10 domain containing 64 10 31 NM_134420 solute carrier family 26 member 6 64 24 5 NM_153407 cDNA sequence BC035295 64 11 15 NM_019747 zinc finger protein 113 64 14 10 NM_007982 PTK2 protein tyrosine kinase 2 64 0 11 NM_138673 stabilin-2 64 0 9 NM_001024932 paired immunoglobin-like type 2 receptor beta 2 63 21938 26 NM_013602 metallothionein 1 63 1649 98 NM_019865 ribosomal protein L36a 63 304 47 NM_001082548 serine protease inhibitor Kunitz type 2 isoform 63 218 70 NM_001111065 RalBP1 associated Eps domain containing 1 63 201 29 NM_010072 dolichol-phosphate beta-D mannosyltransferase 63 193 38 NM_017375 osteoclast stimulating factor 1 63 82 121 NM_199322 DOT1-like histone H3 methyltransferase 63 62 112 NM_178762 hypothetical protein LOC319513 63 76 94 NM_178709 ring finger protein 214 63 126 42 NM_016959 ribosomal protein S3a 63 103 57 NM_146229 dynein cytoplasmic 1 light intermediate chain 1 63 101 57 NM_145430 hypothetical protein LOC216971 63 37 119 NM_007398 adenosine deaminase 63 14 133 NM_001039149 platelet and T cell activation antigen 1 isoform 63 111 32 NM_026474 SGT1 suppressor of G2 allele of SKP1 63 118 12 NM_145705 TRF1-interacting nuclear factor 2 63 103 26 NM_024213 anaphase-promoting complex subunit 4 63 19 99 NM_027642 PHD finger protein 6 63 43 76 NM_010236 folylpolyglutamyl synthetase 63 74 39 NM_172730 hypothetical protein LOC232236 63 70 43 NM_025435 Ngg1 interacting factor 3 like 1 binding protein 63 62 47 NM_010757 v-maf musculoaponeurotic fibrosarcoma oncogene 63 42 63 NM_001001333 hexosaminidase glycosyl hydrolase family 20 63 18 83 NM_011818 germ cell-less 63 60 26 NM_201372 coiled-coil domain containing 84 63 40 45 NM_172754 Kruppel-like zinc finger protein 63 31 52 NM_026662 phosphoribosyl pyrophosphate synthetase 2 63 32 48 NM_028634 chibby homolog 1 63 13 62 NM_001081012 hypothetical protein LOC320226 63 56 19 NM_001081218 host cell factor 2 63 25 43 NM_029031 carbohydrate kinase-like 63 7 57 NM_198168 protein phosphatase 2 regulatory subunit B 63 29 30 NM_182999 ring finger protein 20 63 41 17 NM_027373 actin filament associated protein 1 63 15 43 NM_133354 SMT3 supressor of mif two 3 homolog 2 63 43 10 NM_010830 mutS homolog 6 63 14 29 NM_009847 CD2-associated protein 63 18 21 NM_173400 hypothetical protein LOC230376 62 547 96 NM_029752 Bri3 binding protein 62 457 9 NM_019472 myosin X 62 412 28 NM_146057 death-associated protein 62 179 79 NM_026007 eukaryotic translation elongation factor 1 62 203 53 NM_001003913 methionine-tRNA synthetase 62 183 51 NM_198031 tubulin gamma complex associated protein 3 62 167 43 NM_033370 coatomer protein complex subunit beta 1 62 69 135 NM_181316 Bardet-Biedl syndrome 9 62 115 49 NM_019727 sorting nexin 1 62 128 23 NM_146154 protein phosphatase 1 regulatory inhibitor 62 59 64 NM_008820 peptidase D 62 89 26 NM_153798 polymerase RNA II (DNA directed) polypeptide 62 40 74 NM_019933 protein tyrosine phosphatase non-receptor type 62 47 58 NM_007466 apoptosis inhibitor 5 62 53 47 NM_001033537 per1-like domain containing 1 62 40 59 NM_024287 RAB6A member RAS oncogene family 62 38 60 NM_001025391 suppressor of fused homolog isoform 2 62 17 78 NM_053266 gtf2ird2 62 61 33 NM_029756 centrosomal colon cancer autoantigen 62 28 63 NM_029825 sec1 family domain containing 1 62 66 26 NM_001033225 proline-rich nuclear receptor coactivator 1 62 65 26 NM_175523 protein phosphatase 1K PP2C domain containing 62 62 18 NM_001031808 mitochondrial ribosomal protein L41 62 48 23 NM_172877 hypothetical protein LOC242736 62 24 43 NM_133225 acyl-Coenzyme A binding domain containing 3 62 48 18 NM_134024 tubulin gamma 1 62 34 30 NM_001081426 DIP2 disco-interacting protein 2 homolog C 62 13 49 NM_019914 ALL1-fused gene from chromosome 1q 62 27 30 NM_008824 6-phosphofructo-2-kinase/fructose-2 62 47 7 NM_009163 sphingosine phosphate lyase 1 62 18 21 NM_178670 hypothetical protein LOC212163 61 309 155 NM_176837 Rho GTPase activating protein 18 61 203 38 NM_009908 cytidine monophospho-N-acetylneuraminic acid 61 193 27 NM_139308 START domain containing 7 61 156 21 NM_008775 platelet-activating factor acetylhydrolase 61 77 66 NM_031156 insulin degrading enzyme 61 128 10 NM_028119 damage specific DNA binding protein 2 61 108 28 NM_001081179 HEAT repeat containing 5B 61 93 35 NM_009357 testis expressed gene 261 61 87 36 NM_001111343 similar to Tu translation elongation factor 61 65 57 NM_144922 heterogeneous nuclear ribonucleoprotein U-like 1 61 72 49 NM_026719 liver regeneration p-53 related protein 61 58 49 NM_010175 Fas-associated via death domain 61 41 64 NM_026746 non-SMC element 2 MMS21 homolog 61 72 22 NM_009009 RAD21 homolog 61 55 37 NM_175353 exocyst complex component 6 61 39 53 NM_013771 YME1-like 1 61 44 43 NM_172280 EMSY protein 61 38 48 NM_009125 ataxin 2 61 46 33 NM_172684 rosbin round spermatid basic protein 1 61 17 59 NM_178710 SNF1-like kinase 2 61 43 31 NM_008996 RAB1 member RAS oncogene family 61 31 39 NM_007499 ataxia telangiectasia mutated homolog 61 14 46 NM_021322 WD repeat domain 4 61 52 1 NM_011129 septin 4 61 45 6 NM_001085417 zinc finger protein 467 isoform c 61 5 44 NM_023538 acylglycerol kinase 61 11 39 NM_198014 SLAIN motif family member 1 61 34 15 NM_007658 cell division cycle 25 homolog A 61 18 23 NM_009982 cathepsin C preproprotein 61 24 12 NM_001081684 zinc finger protein 295 isoform 2 61 7 18 NM_020507 transducer of ERBB2 2 61 9 3 NM_007601 calpain 3 isoform a 60 308 45 NM_019661 YKT6 v-SNARE protein 60 318 29 NM_172601 RAB2B protein 60 255 38 NM_015824 origin recognition complex subunit 3-like 60 196 62 NM_145154 angiopoietin-like 6 60 42 184 NM_010047 DiGeorge syndrome critical region gene 6 60 166 42 NM_008944 proteasome prosome macropain subunit, alpha 60 66 89 NM_172698 hypothetical protein LOC230648 60 90 51 NM_021567 polyrC binding protein 4 60 65 75 NM_025463 hypothetical protein LOC66276 60 101 38 NM_080554 proteasome 26S non-ATPase subunit 5 60 60 63 NM_025918 coiled-coil domain containing 43 60 37 82 NM_010902 nuclear factor erythroid derived 2, like 2 60 89 26 NM_175224 methionyl aminopeptidase 1 60 77 33 NM_026557 androgen receptor N-terminal-interacting 60 46 51 NM_178376 Ras-related GTP binding A 60 53 42 NM_020611 steroid 5 alpha-reductase 3 60 46 46 NM_023403 mesoderm development candidate 2 60 67 26 NM_013511 erythrocyte protein band 4.1-like 2 60 53 38 NM_009924 cannabinoid receptor 2 60 45 33 NM_027807 cullin 5 60 29 43 NM_026032 LSM1 homolog U6 small nuclear RNA associated 60 23 43 NM_133729 serine/threonine protein kinase MST4 60 28 34 NM_001103181 tubby like protein 4 isoform b 60 27 27 NM_029998 hypothetical protein LOC77877 60 17 37 NM_019562 ubiquitin carboxyl-terminal esterase L5 60 13 41 NM_016694 parkin 60 13 34 NM_017398 diaphanous homolog 2 60 33 11 NM_001042623 polyhomeotic-like 1 isoform b 60 34 7 NM_001079824 heterogeneous nuclear ribonucleoprotein H3 60 26 9 NM_153550 disrupted in renal carcinoma 2 60 15 10 NM_053196 sideroflexin 2 59 329 37 NM_025899 ubiquinol cytochrome c reductase core protein 2 59 286 78 NM_026442 hypothetical protein LOC67899 59 233 93 NM_177214 U5 snRNP-specific protein 200 kDa 59 185 82 NM_001009818 septin 11 59 176 87 NM_026058 longevity assurance homolog 4 59 176 34 NM_026452 coenzyme Q9 homolog 59 152 55 NM_053257 ribosomal protein L31 59 159 11 NM_023377 StAR-related lipid transfer protein 5 59 91 70 NM_145513 TIP41 TOR signalling pathway regulator-like 59 91 44 NM_001081040 coenzyme Q10 homolog A 59 83 45 NM_010269 ganglioside-induced 59 71 48 NM_027375 GRIP and coiled-coil domain-containing 2 59 60 57 NM_175244 HECT domain containing 3 59 40 76 NM_019797 thyroid hormone receptor interactor 4 59 25 90 NM_172631 hypothetical protein LOC52662 59 89 19 NM_021449 cereblon isoform 1 59 74 28 NM_133215 myotubularin related protein 4 59 37 59 NM_028211 hypothetical protein LOC72357 59 73 23 NM_028873 DnaJ Hsp40 homolog subfamily C, member 14 59 28 67 NM_011590 translocase of inner mitochondrial membrane 17a 59 67 22 NM_008598 O-6-methylguanine-DNA methyltransferase 59 28 57 NM_019734 N-acylsphingosine amidohydrolase acid 59 59 25 NM_001081960 CLIP-associating protein CLASP2 isoform b 59 42 42 NM_134136 F-box protein 38 59 53 30 NM_080557 sorting nexin 4 59 29 54 NM_025364 cytokine induced protein 29 kDa 59 23 57 NM_019570 REV1-like 59 47 29 NM_026107 zinc finger with KRAB and SCAN domains 6 59 68 6 NM_008668 Ngfi-A binding protein 2 59 42 31 NM_023662 pericentriolar material 1 59 23 50 NM_153402 eukaryotic translation initiation factor 2C 3 59 45 23 NM_172587 CDC14 cell division cycle 14 homolog B 59 46 16 NM_028223 transmembrane protein 175 59 29 32 NM_001033196 zinc finger NFX1-type containing 1 59 14 41 NM_016888 UDP-GlcNAc:betaGal 59 19 34 NM_030236 F-box protein 34 59 19 33 NM_001081360 calmodulin regulated spectrin-associated protein 59 40 9 NM_194444 cyclin-dependent kinase 10 isoform 2 59 9 40 NM_175238 telomere-associated protein RIF1 59 13 23 NM_178113 non-SMC condensin II complex subunit D3 59 7 17 NM_016712 tropomodulin 4 59 0 4 NM_009721 Na+/K+ -ATPase beta 1 subunit 59 1195 34 NM_053071 cytochrome c oxidase subunit VIc 59 795 285 NM_027450 GLI pathogenesis-related 2 59 704 5 NM_145220 adaptor protein phosphotyrosine interaction, PH 59 436 48 NM_130796 sorting nexin associated golgi protein 1 59 113 334 NM_172721 F-box protein FBX29 59 273 76 NM_028800 serine/threonine kinase 40 59 282 23 NM_024439 selenoprotein S 59 183 102 NM_172723 centaurin alpha 1 59 276 8 NM_010431 hypoxia inducible factor 1 alpha subunit 59 95 122 NM_027328 PRP31 59 74 112 NM_001037170 translocase of outer mitochondrial membrane 40 59 56 124 NM_026034 SVH protein 59 136 28 NM_009360 transcription factor A mitochondrial 59 46 108 NM_172381 hypothetical protein LOC230249 59 111 40 NM_178625 hypothetical protein LOC72649 59 41 97 NM_029955 coiled-coil domain containing 93 isoform c 59 68 59 NM_153167 WD repeat domain 32 59 72 46 NM_009147 SEC23A 59 53 65 NM_024471 lipoic acid synthetase 59 75 40 NM_019443 NADH dehydrogenase ubiquinone 1 alpha 59 99 15 NM_144529 nadrin 59 82 29 NM_178253 kelch domain containing 1 59 86 15 NM_178696 solute carrier family 25 member 44 59 45 55 NM_008444 kinesin family member 3B 59 44 47 NM_153545 leucine rich repeat containing 45 59 29 55 NM_010302 guanine nucleotide binding protein alpha 12 59 13 66 NM_180974 forkhead box N2 59 25 54 NM_001102436 acyl-Coenzyme A binding domain containing 5 59 44 32 NM_011828 heparan sulfate 2-O-sulfotransferase 1 59 62 9 NM_025566 tumor necrosis factor alpha-induced protein 59 28 42 NM_026386 sorting nexin 2 59 34 26 NM_024448 RAB12 member RAS oncogene family 59 25 35 NM_028118 WD repeat SAM and U-box domain containing 1 59 47 10 NM_178882 D-2-hydroxyglutarate dehydrogenase 59 40 12 NM_001033298 hypothetical protein LOC228730 59 19 26 NM_007657 CD9 antigen 59 26 16 NM_152824 RNA binding motif protein 17 59 31 7 NM_025824 basic leucine zipper and W2 domains 1 59 3 31 NM_001081090 ABT1-associated protein 59 4 27 NM_001033391 hypothetical protein LOC320495 59 8 16 NM_008466 karyopherin importin alpha 3 59 1 21 NM_001033245 hexokinase 3 59 7 13 NM_001081193 LEM domain containing 3 59 7 11 NM_144550 coiled-coil domain containing 52 59 13 3 NM_001033206 PWWP domain containing 2 isoform 2 58 353 24 NM_025596 PX19 homolog 58 182 36 NM_001003917 autophagy-related 9-like 1 58 146 53 NM_133949 prostate tumor over expressed gene 1 58 140 56 NM_026937 activating signal cointegrator 1 complex subunit 58 100 38 NM_177381 component of oligomeric golgi complex 3 58 60 67 NM_007522 Bcl-associated death promoter 58 82 45 NM_026554 nuclear cap binding protein subunit 2 58 68 41 NM_010163 exostosin 2 58 56 43 NM_001008506 zinc finger CCCH-type containing 14 isoform b 58 59 32 NM_026173 hypothetical protein LOC67463 58 66 26 NM_027769 copine III 58 13 77 NM_183172 resistance to inhibitors of cholinesterase 8B 58 26 61 NM_001081280 NLR family CARD domain containing 3 58 65 16 NM_026083 RIKEN cDNA 3110050K21 58 26 53 NM_010748 lysosomal trafficking regulator 58 25 51 NM_146218 ring finger and WD repeat domain 3 58 44 22 NM_025578 mitochondrial ribosomal protein S25 58 11 46 NM_030184 armadillo repeat containing 9 isoform 1 58 9 42 NM_011541 transcription elongation factor A SII 1 58 17 26 NM_178142 ligand dependent nuclear receptor 58 26 10 NM_172807 peptidylprolyl isomerase domain and WD repeat 57 1059 30 NM_027130 AFG3ATPase family gene 3-like 2 57 484 24 NM_173398 G protein-coupled receptor 171 57 371 58 NM_030678 glycogen synthase 1 muscle 57 285 72 NM_021448 signal transducer and activator of transcription 57 225 84 NM_010999 olfactory receptor 56 57 262 43 NM_025987 NADH dehydrogenase ubiquinone 1 alpha 57 228 59 NM_010700 low density lipoprotein receptor 57 215 51 NM_025872 golgi transport 1 homolog B 57 84 54 NM_172866 RGP1 retrograde golgi transport homolog 57 104 31 NM_026678 biliverdin reductase A 57 55 74 NM_133806 UDP-N-acetylglucosamine pyrophosphorylase 1 57 33 93 NM_009145 neuroplastin 57 80 38 NM_016796 vesicle-associated membrane protein 4 57 41 67 NM_013506 eukaryotic translation initiation factor 4A2 57 63 43 NM_009231 son of sevenless 1 57 38 66 NM_008549 mannosidase 2 alpha 1 57 44 57 NM_144844 propionyl-Coenzyme A carboxylase alpha 57 57 43 NM_145355 ring finger protein 185 57 73 21 NM_133898 NEDD4 binding protein 2-like 1 57 42 50 NM_026182 mitochondrial fission regulator 1 57 67 25 NM_025614 RWD domain containing 1 57 51 41 NM_146133 golgi phosphoprotein 3-like 57 62 26 NM_146045 xylosylprotein beta 14-galactosyltransferase, 57 58 26 NM_176840 oxysterol binding protein-like 11 57 41 39 NM_016683 zinc finger with KRAB and SCAN domains 5 57 42 36 NM_001081221 excision repair cross-complementing rodent 57 61 15 NM_145145 protein-O-mannosyltransferase 1 57 18 44 NM_009532 X-ray repair complementing defective repair in 57 50 13 NM_144851 SUMO1/sentrin specific peptidase 1 57 56 7 NM_022007 FXYD domain-containing ion transport regulator 57 57 5 NM_010722 lamin B2 57 32 23 NM_029607 RIKEN cDNA 2310003C23 57 30 18 NM_172291 FAD-dependent oxidoreductase domain containing 57 40 8 NM_007564 zinc finger protein 36 C3H type-like 1 57 22 23 NM_138667 mitogen-activated protein kinase kinase kinase 7 57 14 25 NM_011137 POU domain class 2, transcription factor 1 57 15 22 NM_172777 guanylate binding protein family member 6 57 16 13 NM_008018 SH3 and PX domains 2A 57 9 5 NM_001024917 Nedd4 binding protein 2 56 872 115 NM_009113 S100 calcium binding protein A13 56 393 76 NM_145070 huntingtin interacting protein 1 related 56 400 59 NM_010324 glutamate oxaloacetate transaminase 1 soluble 56 358 43 NM_027194 TM2 domain containing 2 56 349 52 NM_021565 midnolin 56 234 22 NM_001039045 phosphatidylinositol glycan classC 56 104 113 NM_019650 golgi SNAP receptor complex member 2 56 161 51 NM_001008421 nucleolar protein 10 56 90 122 NM_022433 sirtuin 3 silent mating type information 56 171 19 NM_078478 growth hormone inducible transmembrane protein 56 153 35 NM_178798 solute carrier family 7 cationic amino acid 56 159 25 NM_026309 LSM3 homolog U6 small nuclear RNA associated 56 34 148 NM_175654 histone cluster 1 H4d 56 138 27 NM_133350 APC-binding protein EB2 56 57 77 NM_016717 selenocysteine lyase 56 97 36 NM_024200 mitofusin 1 56 27 99 NM_001081430 N-acetyltransferase 12 56 72 47 NM_001048207 glycophorin C 56 82 33 NM_001042489 hydrogen voltage-gated channel 1 56 102 12 NM_144553 discs large homolog 7 56 66 45 NM_022997 vacuolar protein sorting 35 56 85 16 NM_133931 protection of telomeres 1A 56 51 50 NM_152817 tetratricopeptide repeat domain 27 56 13 87 NM_026735 MOB1 Mps One Binder kinase activator-like 1A 56 9 90 NM_001099792 tRNAm1A58-methyltransferase subunit TRM61 56 57 37 NM_178716 transportin 1 isoform 1 56 57 33 NM_018765 WW domain binding protein 4 56 25 62 NM_172765 zinc finger and BTB domain containing 44 56 43 43 NM_029231 proline- glutamic acid-, leucine-rich protein 56 34 50 NM_010436 H2A histone family member X 56 32 52 NM_178060 thyroid hormone receptor alpha 56 47 35 NM_001033352 kelch-like 21 56 34 45 NM_175109 S19 binding protein 56 36 43 NM_001081080 PHD finger protein 3 56 34 39 NM_001081113 importin 8 56 31 39 NM_001025093 activating transcription factor 2 isoform 1 56 18 49 NM_015771 large tumor suppressor 2 56 24 39 NM_177239 myb-like SWIRM and MPN domains 1 56 37 24 NM_009210 SWI/SNF related matrix associated, actin 56 34 24 NM_020601 transducin beta-like 1 X-linked 56 24 34 NM_001081191 echinoderm microtubule associated protein like 56 23 32 NM_001099624 Rap guanine nucleotide exchange factor GEF 2 56 15 39 NM_146092 TAF6-like RNA polymerase II p300/CBP-associated 56 10 37 NM_175389 RNA guanine-9- methyltransferase domain 56 1 45 NM_013606 myxovirus influenza virus resistance 2 56 1 42 NM_019945 microtubule associated serine/threonine kinase 56 13 26 NM_011252 RNA binding motif protein X-linked 56 10 14 NM_001081111 TATA element modulatory factor 1 56 15 6 NM_176940 NACHT and WD repeat domain containing 1 56 7 4 NM_054085 myocyte induction differentiation originator 56 0 5 NM_144538 RAB3A interacting protein rabin3-like 1 55 588 32 NM_009725 ATP synthase H+ transporting, mitochondrial F0 55 346 57 NM_027030 histidine triad protein member 5 55 340 41 NM_001033367 NLR family CARD domain containing 4 55 273 37 NM_021500 erythroblast macrophage protein 55 222 33 NM_019929 SMT3 supressor of mif two 3 homolog 1 55 175 45 NM_019482 pannexin 1 55 162 56 NM_001013367 protein kinase AMP-activated, alpha 1 catalytic 55 179 36 NM_173453 transmembrane protein 11 55 184 26 NM_172150 intraflagellar transport 52 homolog 55 156 37 NM_027216 solute carrier family 39 metal ion 55 161 28 NM_001109752 postsynaptic density protein 95 isoform 2 55 96 48 NM_024183 FIP1 like 1 55 132 10 NM_026585 hypothetical protein LOC28006 55 138 2 NM_181820 transmembrane channel-like gene family 4 55 108 26 NM_011480 sterol regulatory element binding transcription 55 37 90 NM_173028 vacuolar protein sorting 13A 55 88 35 NM_001033313 PDGFA associated protein 1 55 97 26 NM_152234 ubiquilin 1 isoform 2 55 101 21 NM_026521 zinc finger protein 706 55 80 37 NM_172391 RIKEN cDNA 1110064P04 55 99 16 NM_181586 sirtuin 6 55 95 19 NM_133788 isoprenylcysteine carboxyl methyltransferase 55 77 34 NM_198620 RUN domain containing 3B 55 73 38 NM_146193 BTB POZ domain containing 1 55 33 63 NM_001033270 solute carrier family 4 sodium bicarbonate 55 41 55 NM_009011 RAD23b homolog 55 39 56 NM_024223 LIM only protein HLP 55 50 44 NM_022887 tuberous sclerosis 1 55 61 32 NM_133966 TAF5-like RNA polymerase II p300/CBP-associated 55 48 43 NM_009081 ribosomal protein L28 55 32 41 NM_025825 amyloid beta precursor protein cytoplasmic 55 31 39 NM_028596 hypothetical protein LOC381668 55 23 44 NM_023320 TNF intracellular domain-interacting protein 55 38 23 NM_175552 WD repeat domain 3 55 36 21 NM_013843 zinc finger protein 53 55 16 38 NM_019812 sirtuin 1 55 33 17 NM_011960 poly ADP-ribose glycohydrolase 55 19 29 NM_026493 centrosome and spindle pole associated protein 55 18 29 NM_153552 THO complex 1 55 32 12 NM_177681 zinc finger protein 12 55 14 26 NM_010630 kinesin family member C2 55 7 28 NM_001045530 cyclin J-like 55 18 15 NM_026983 endoplasmic reticulum protein 27 55 23 6 NM_170756 spermatogenesis associated 2 55 7 17 NM_025699 oxidative stress responsive 1 55 13 10 NM_011203 protein tyrosine phosphatase non-receptor type 55 12 6 NM_178114 amphoterin induced gene 2 54 4905 70 NM_027342 growth and transformation-dependent protein 54 772 45 NM_011665 ubiquitin-conjugating enzyme E2I 54 390 115 NM_170669 ribosomal protein S15a 54 336 52 NM_027350 asparaginyl-tRNA synthetase 54 8 294 NM_008365 interleukin 18 receptor 1 54 140 138 NM_027324 sideroflexin 1 54 231 40 NM_030730 steroid receptor-interacting SNF2 domain 54 161 68 NM_175095 COMM domain containing 2 54 128 74 NM_206536 hypothetical protein LOC382062 54 170 13 NM_026721 solute carrier family 39 metal ion 54 133 43 NM_146075 LEM domain containing 2 54 145 25 NM_012039 centromere/kinetochore protein zw10 54 67 95 NM_008188 THUMP domain containing 3 54 24 127 NM_001079686 synaptic nuclear envelope 1 isoform 3 54 112 22 NM_010120 eukaryotic translation initiation factor 1A 54 113 12 NM_025509 DC2 protein 54 62 60 NM_015765 heat shock 70kDa protein 14 isoform 1 54 56 66 NM_025424 neuron derived neurotrophic factor 54 55 67 NM_026830 ras responsive element binding protein 1 isoform 54 65 51 NM_010754 MAD homolog 2 54 8 108 NM_178734 zinc finger protein 473 54 15 90 NM_025675 ATP binding domain 4 54 90 11 NM_031842 SWI/SNF related matrix associated, actin 54 36 59 NM_028464 molybdenum cofactor synthesis 1 isoform 2 54 50 45 NM_199446 phosphorylase kinase beta 54 41 38 NM_029665 importin 11 54 25 50 NM_145477 alpha-16-mannosyltransferase ALG12 54 32 33 NM_145471 leucine rich repeat containing 14 54 33 31 NM_021539 WSB-2 protein 54 38 26 NM_011697 vascular endothelial growth factor B 54 46 10 NM_172714 lin-54 homolog 54 13 43 NM_010878 non-catalytic region of tyrosine kinase adaptor 54 25 25 NM_001015099 G2/M phase-specific E3 ubiquitin-protein 54 22 26 NM_175334 mastermind like 1 54 16 28 NM_030729 NCK interacting protein with SH3 domain 54 28 16 NM_175146 TSR2 20S rRNA accumulation, homolog 54 4 38 NM_173424 zinc finger and BTB domain containing 37 54 28 11 NM_030609 histone cluster 1 H1a 54 27 12 NM_001081020 a disintegrin-like and metalloprotease 54 14 19 NM_001081278 TBC1 domain family member 4 53 9540 193 NM_009415 triosephosphate isomerase 1 53 5018 528 NM_009895 cytokine inducible SH2-containing protein 53 809 66 NM_019703 phosphofructokinase platelet 53 422 32 NM_001001491 tropomyosin 4 53 348 20 NM_029934 membrane bound O-acyltransferase domain 53 298 34 NM_011965 proteasome prosome macropain subunit, alpha 53 251 76 NM_013929 SIVA1 apoptosis-inducing factor 53 203 110 NM_016780 integrin beta 3 precursor 53 283 26 NM_133981 disrupted in bipolar disorder 1 homolog 53 276 13 NM_009469 Unc-51 like kinase 1 53 216 73 NM_028005 hypothetical protein LOC71923 53 216 47 NM_011778 coronin actin binding protein 1B 53 228 29 NM_023317 nuclear distribution gene E homolog 1 isoform a 53 210 24 NM_028339 thioredoxin domain containing 1 53 157 74 NM_153408 lung-inducible neuralized-related C3HC4 RING 53 169 59 NM_019428 ribonuclease P/MRP 30kDa subunit 53 163 39 NM_026187 ankyrin repeat and zinc finger domain containing 53 133 45 NM_027376 fuzzy homolog 53 76 93 NM_011574 cirhin 53 125 37 NM_019439 gamma-aminobutyric acid GABA-B receptor 1 53 106 37 NM_001013366 WD repeat domain 91 53 61 78 NM_009787 protein disulfide isomerase associated 4 53 33 103 NM_031260 Moloney leukemia virus 10-like 1 53 87 45 NM_028221 hypothetical protein LOC102122 53 91 31 NM_144802 heterogeneous nuclear ribonucleoprotein L-like 53 38 81 NM_177266 G elongation factor mitochondrial 2 53 77 39 NM_028722 hampin 53 4 109 NM_175645 xylosyltransferase 1 53 46 66 NM_212450 CTD carboxy-terminal domain RNA polymerase II, 53 14 97 NM_008697 ninein isoform 2 53 83 27 NM_009533 X-ray repair complementing defective repair in 53 4 103 NM_028709 BTB POZ domain containing 11 isoform 1 53 96 11 NM_007916 Ddx19-like protein 53 18 80 NM_028108 Mak3p homolog 53 69 19 NM_177370 rhomboid domain containing 3 53 43 35 NM_144843 myotubularin related protein 6 53 22 56 NM_021793 transmembrane protein 8 five membrane-spanning 53 15 61 NM_008860 protein kinase C zeta isoform a 53 66 8 NM_011548 transcription factor E2a 53 32 41 NM_026396 BRIX 53 63 1 NM_027406 aldehyde dehydrogenase 1 family member L1 53 16 46 NM_028604 RIKEN cDNA 2410075D05 53 26 30 NM_007868 dystrophin muscular dystrophy 53 15 41 NM_145151 HCF-binding transcription factor Zhangfei 53 36 13 NM_029949 small nuclear RNA activating complex 53 11 38 NM_172473 HECT domain and ankyrin repeat containing E3 53 18 30 NM_019491 ras related v-ral simian leukemia viral oncogene 53 23 22 NM_026165 solute carrier family 25 member 46 53 18 21 NM_133686 quinolinate phosphoribosyltransferase 53 22 17 NM_027872 solute carrier family 46 member 3 53 16 20 NM_001013405 hypothetical protein LOC382117 53 23 10 NM_030082 histone cluster 3 H2ba 53 4 28 NM_021365 X-linked lymphocyte-regulated 4B 53 13 15 NM_172885 transmembrane protein 132D 53 7 19 NM_146190 tubulin gamma complex associated protein 5 53 2 20 NM_031185 A kinase PRKA anchor protein (gravin) 12 53 3 18 NM_001081350 nucleolar protein 8 53 13 8 NM_207522 hypothetical protein LOC216292 53 4 11 NM_134006 retinol dehydrogenase 5 53 9 2 NM_001039231 kruppel-related zinc finger protein-like 53 3 6 NM_172991 hypothetical protein LOC269623 52 8 1257 NM_177265 hypothetical protein LOC320802 52 294 27 NM_009351 telomerase associated protein 1 52 69 174 NM_026940 hypothetical protein LOC69101 52 199 34 NM_016783 progesterone receptor membrane component 52 218 12 NM_029985 leucine rich repeat containing 42 52 165 64 NM_011631 tumor rejection antigen gp96 52 189 39 NM_133684 MOCO sulphurase C-terminal domain containing 2 52 186 36 NM_009507 von Hippel-Lindau syndrome protein homolog 52 171 47 NM_023565 chromosome segregation 1-like 52 162 23 NM_177411 RAB5B member RAS oncogene family 52 141 43 NM_178367 DEAH Asp-Glu-Ala-His box polypeptide 33 52 123 59 NM_009075 ribose 5-phosphate isomerase A 52 150 30 NM_144521 hypothetical protein LOC67826 52 97 66 NM_001004721 cell division cycle 91-like 1 52 106 51 NM_025679 suppressor of IKK epsilon 52 102 48 NM_172572 rhomboid-like protein 6 52 124 23 NM_020587 splicing factor arginine/serine-rich 4 52 113 27 NM_008558 Max protein 52 117 13 NM_026787 hypothetical protein LOC68618 52 116 9 NM_026602 breast carcinoma amplified sequence 2 52 76 47 NM_001037762 zinc finger DHHC domain containing 12 isoform 52 99 24 NM_021028 thymidine kinase 2 mitochondrial 52 73 43 NM_028198 exportin 5 52 65 52 NM_212438 widely-interspaced zinc finger motifs isoform 1 52 94 16 NM_028758 golgi associated gamma adaptin ear containing, 52 94 16 NM_012047 bromodomain containing 7 52 32 75 NM_029148 thioredoxin domain containing 13 52 87 16 NM_028975 transmembrane protein 33 isoform 1 52 29 61 NM_026140 glutamyl-tRNA synthetase 2 52 12 75 NM_172911 pragmin 52 68 13 NM_134033 coiled-coil domain containing 117 52 8 73 NM_008036 FBJ osteosarcoma oncogene B 52 54 26 NM_172678 very-long-chain acyl-CoA dehydrogenase VLCAD 52 23 55 NM_177648 transmembrane protein 15 52 58 16 NM_009537 YY1 transcription factor 52 55 19 NM_175372 retinol dehydrogenase 13 all-trans and 9-cis 52 8 66 NM_144524 angel homolog 1 52 32 38 NM_144877 RIKEN cDNA 5630401D24 52 38 29 NM_018748 golgi autoantigen golgin subfamily a, 4 52 11 56 NM_011500 striatin calmodulin binding protein 52 27 39 NM_001109688 hypothetical protein LOC74741 isoform 3 52 24 40 NM_021477 ataxin 2 binding protein 1 isoform gamma 52 3 55 NM_001081666 hypothetical protein LOC245376 52 9 46 NM_177673 glycine- glutamate-, 52 33 19 NM_023647 non-imprinted in Prader-Willi/Angelman syndrome 52 15 37 NM_172555 polyA polymerase gamma 52 11 41 NM_001081477 bromodomain and WD repeat domain containing 3 52 33 18 NM_025473 family 3 member A protein 52 15 34 NM_025310 FtsJ homolog 3 52 25 21 NM_028677 peptidylprolyl isomerase H isoform 1 52 15 21 NM_025780 THAP domain containing apoptosis associated 52 3 26 NM_178802 tripartite motif-containing 65 51 416 34 NM_146126 sorbitol dehydrogenase 51 267 66 NM_001081102 Wolf-Hirschhorn syndrome candidate 1 51 222 68 NM_023743 eukaryotic translation initiation factor 4E 51 205 73 NM_001039103 RAS p21 protein activator 4 isoform 2 51 218 41 NM_029409 hypothetical protein LOC75734 51 177 76 NM_001110311 sorting nexin 12 isoform 2 51 159 77 NM_178337 tubulin-specific chaperone e 51 159 44 NM_009012 RAD50 homolog 51 110 74 NM_016776 MYB binding protein P160 1a 51 109 72 NM_001029841 src-like adaptor isoform a 51 151 22 NM_026792 1-acylglycerolphosphate acyltransferase-epsilon 51 123 38 NM_001033202 ubiquitin specific peptidase 30 51 125 35 NM_053068 chromatin accessibility complex 1 51 128 30 NM_172635 protein associated with topoisomerase II homolog 51 116 35 NM_025504 ATP5S-like 51 108 43 NM_175397 Sp110 nuclear body protein 51 98 47 NM_178070 vacuolar protein sorting 33B 51 133 10 NM_013551 hydroxymethylbilane synthase isoform 1 51 88 44 NM_009471 uridine monophosphate synthetase 51 104 26 NM_183149 zinc finger protein 598 51 124 6 NM_172503 zinc finger SWIM domain containing 4 51 104 18 NM_019712 ring-box 1 51 43 64 NM_175255 SEC24 related gene family member A 51 20 85 NM_001081300 teashirt zinc finger family member 1 51 40 59 NM_010062 deoxyribonuclease II alpha 51 31 64 NM_144491 diptheria toxin resistance protein required for 51 54 42 NM_013761 serine racemase 51 42 41 NM_001081029 hypothetical protein LOC652925 51 7 55 NM_009442 transcription termination factor 1 51 44 14 NM_133993 periodic tryptophan protein 1 homolog 51 23 33 NM_008167 glutamate receptor ionotropic, delta 2 51 30 25 NM_025476 hypothetical protein LOC66302 51 20 31 NM_010829 mutS homolog 3 51 32 19 NM_153594 protein-L-isoaspartate D-aspartate 51 18 30 NM_027629 phosphoglucomutase 2-like 1 51 28 19 NM_172422 FAST kinase domains 2 51 27 19 NM_199011 diacylglycerol kinase theta 51 15 30 NM_175306 phosphatase and actin regulator 4 51 38 5 NM_025774 Prkr interacting protein 1 IL11 inducible 51 13 22 NM_001081107 helicase mus308-like 51 9 25 NM_001081307 protein phosphatase 1 regulatory inhibitor 51 5 26 NM_177663 interferon stimulated exonuclease gene 20-like 51 16 13 NM_001102611 SET and MYND domain containing 4 51 3 18 NM_018782 calcitonin receptor-like 51 11 9 NM_178446 RNA binding motif protein 47 51 1 1 NM_029162 zinc finger protein 509 51 2103 34 NM_023211 upregulated during skeletal muscle growth 5 51 1616 36 NM_133984 HemK methyltransferase family member 1 51 466 42 NM_009254 serine or cysteine proteinase inhibitor clade 51 449 38 NM_008063 solute carrier family 37 glucose-6-phosphate 51 462 11 NM_008409 integral membrane protein 2A 51 352 37 NM_018807 pleiomorphic adenoma gene-like 2 51 291 25 NM_001111025 phosphatidylinositol glycan anchor biosynthesis 51 225 84 NM_001111300 similar to ribosomal protein S26 51 158 57 NM_027742 leucine rich repeat in FLII interacting 51 168 46 NM_027098 mitochondrial ribosomal protein L30 51 106 81 NM_009061 regulator of G-protein signaling 2 51 125 33 NM_053164 mitochondrial ribosomal protein L43 51 89 51 NM_134013 proteasome prosome macropain activator 51 102 34 NM_001077631 hypothetical protein LOC69882 51 96 34 NM_025535 SAR1a gene homolog 2 51 112 14 NM_001083114 periphilin 1 isoform 3 51 68 49 NM_133869 choline/ethanolaminephosphotransferase 1 51 54 62 NM_023635 RAB27A protein 51 53 48 NM_020012 ring finger protein 14 51 32 68 NM_145937 sulfatase modifying factor 1 precursor 51 45 43 NM_001113283 hypothetical protein LOC235493 isoform 1 51 28 60 NM_001081057 hypothetical protein LOC104859 51 32 53 NM_027044 prefoldin 5 51 8 76 NM_018868 nucleolar protein 5 51 55 15 NM_019662 Ras-related associated with diabetes 51 44 24 NM_133702 nucleolar protein 11 51 40 23 NM_008228 histone deacetylase 1 51 25 29 NM_001080755 zinc finger ZZ domain containing 3 51 14 39 NM_009278 Sjogren syndrome antigen B 51 28 19 NM_001039474 transcription elongation regulator 1 51 12 32 NM_009166 sorbin and SH3 domain containing 1 isoform 1 51 18 26 NM_145615 electron transferring flavoprotein alpha 51 16 22 NM_019518 GRP1 general receptor for phosphoinositides 51 10 24 NM_001081086 peptidyl-prolyl isomerase G cyclophilin G 51 4 24 NM_008332 interferon-induced protein with 51 24 1 NM_007405 adenylate cyclase 6 51 12 9 NM_007551 chemochine C-X-C motif receptor 5 51 11 8 NM_027990 hypothetical protein LOC71897 51 1 1 NM_153510 paired immunoglobin-like type 2 receptor alpha 51 0 1 NM_008694 neutrophilic granule protein 50 22626 82 NM_011401 solute carrier family 2 facilitated glucose 50 2625 756 NM_010738 lymphocyte antigen 6 complex locus A 50 311 38 NM_008928 mitogen-activated protein kinase kinase 3 50 151 82 NM_010928 Notch gene homolog 2 50 189 36 NM_133992 ubiquitin specific peptidase 52 50 184 26 NM_023175 Nit protein 2 50 141 34 NM_029841 hypothetical protein LOC77034 50 129 43 NM_026036 CKLF-like MARVEL transmembrane domain containing 50 93 76 NM_053159 mitochondrial ribosomal protein L3 50 36 122 NM_207206 acyltransferase like 3 50 84 73 NM_009874 cyclin-dependent kinase 7 homolog of Xenopus 50 127 26 NM_019788 pallidin 50 131 21 NM_001080793 ash2-like isoform b 50 39 105 NM_029441 chromodomain protein Y chromosome-like 2 50 103 37 NM_007707 suppressor of cytokine signaling 3 50 36 97 NM_028343 transmembrane protein 135 50 82 43 NM_018858 phosphatidylethanolamine binding protein 1 50 71 52 NM_010891 septin 2 50 83 30 NM_022023 glia maturation factor beta 50 83 22 NM_018877 SET domain bifurcated 1 50 1 95 NM_029815 breast carcinoma amplified sequence 1 50 60 33 NM_144905 hypothetical protein LOC230279 50 66 22 NM_019869 RNA binding motif protein 14 50 53 32 NM_144887 zinc finger DHHC domain containing 5 50 10 73 NM_008913 protein phosphatase 3 catalytic subunit, alpha 50 36 41 NM_023323 brix domain containing 1 isoform 1 50 33 40 NM_001081214 peroxisome proliferative activated receptor 50 12 57 NM_175136 ring finger protein 122 homolog 50 23 43 NM_011529 TRAF family member-associated Nf-kappa B 50 19 42 NM_175025 calcium-transporting ATPase 2C1 50 29 31 NM_013693 tumor necrosis factor 50 39 21 NM_176902 hypothetical protein LOC319370 50 25 30 NM_145612 zinc finger protein ZFP 50 30 23 NM_134010 nucleoporin 107 50 15 37 NM_026283 sterile alpha motif domain containing 8 50 16 35 NM_028712 RAP2B member of RAS oncogene family 50 16 33 NM_197944 hematopoietic SH2 domain containing 50 20 26 NM_008229 histone deacetylase 2 50 14 30 NM_025298 sex-lethal interactor homolog 50 17 23 NM_028150 SPTF-associated factor 65 gamma 50 15 24 NM_028288 cullin 4B 50 23 16 NM_001081119 abhydrolase domain containing 13 50 30 9 NM_145374 hypothetical protein LOC252875 50 22 17 NM_029404 PHD finger protein 14 50 4 15 NM_026252 cytoplasmic polyadenylation element binding 50 7 3 NM_008491 lipocalin 2 50 0 2 NM_031181 SIGLEC-like 1 49 586 27 NM_011051 programmed cell death 6 49 248 304 NM_027982 protein phosphatase 1J 49 300 213 NM_178577 transmembrane protein 205 49 374 49 NM_023906 ankyrin repeat and SOCS box-containing protein 49 387 35 NM_001004164 N-acetylglucosamine-1-phosphate transferase 49 245 27 NM_011826 HCLS1 associated X-1 49 125 60 NM_020272 phosphoinositide-3-kinase catalytic, gamma 49 155 13 NM_133985 oxidative-stress responsive 1 49 148 10 NM_023231 stomatin-like protein 2 49 47 111 NM_001025311 ST6 49 69 67 NM_027462 mitochondrial tryptophanyl tRNA synthetase 2 49 102 32 NM_027314 membrane-associated ring finger C3HC4 5 49 87 35 NM_026254 TBC1 domain family member 23 49 84 38 NM_012048 polymerase DNA directed kappa 49 88 31 NM_025952 implantation-associated protein 49 58 49 NM_176842 Tp53rk binding protein 49 10 97 NM_001039351 nucleolar and coiled-body phosphoprotein 1 49 46 59 NM_030255 apolipoprotein B editing complex 3 49 73 25 NM_020483 SAP30 binding protein 49 54 35 NM_027045 granule cell antiserum positive 14 isoform 1 49 38 48 NM_133722 hypothetical protein LOC70178 49 45 40 NM_011055 phosphodiesterase 3B cGMP-inhibited 49 65 17 NM_175364 LYR motif containing 2 49 67 14 NM_019542 N-acetylglucosamine kinase 49 56 25 NM_133761 MAD homolog 4 interacting transcription 49 27 40 NM_175542 rotatin 49 47 19 NM_023858 myotubularin related protein 2 49 28 35 NM_001093759 hypothetical protein LOC66975 isoform 2 49 19 43 NM_181278 hypothetical protein LOC78521 49 32 28 NM_177184 vacuolar protein sorting 13C 49 18 37 NM_026406 Rabring 7 49 29 24 NM_172697 PRP38 pre-mRNA processing factor 38 yeast 49 7 44 NM_177879 sidekick 1 49 34 13 NM_001001980 LIM and calponin homology domains 1 49 15 31 NM_008031 fragile X mental retardation protein 1 49 5 33 NM_144545 eukaryotic translation initiation factor 3 49 8 21 NM_175179 RIKEN cDNA 2810002O09 49 16 10 NM_026220 microfibrillar-associated protein 1A 48 232 87 NM_007711 chloride channel 3 isoform a 48 209 75 NM_026198 hypothetical protein LOC67495 48 195 79 NM_010176 fumarylacetoacetate hydrolase 48 243 26 NM_134080 filamin B beta 48 190 46 NM_025836 mannose-6-phosphate receptor binding protein 1 48 133 97 NM_010909 nuclear factor of kappa light polypeptide gene 48 175 55 NM_133777 ubiquitin-conjugating enzyme E2S 48 126 81 NM_025576 PTEN-like phosphatase 48 140 38 NM_146135 protein inhibitor of activated STAT 3 isoform 1 48 59 98 NM_199447 ribosomal RNA processing 12 homolog 48 70 67 NM_176836 hypothetical protein LOC72826 48 71 48 NM_197995 ADP-ribosylation factor-like 16 48 87 27 NM_001081240 hypothetical protein LOC102182 48 57 56 NM_001110320 CD72 antigen isoform 1 48 43 67 NM_011743 SH3-domain binding protein 3 48 86 16 NM_133826 ATPase H+ transporting, lysosomal V1 subunit H 48 75 20 NM_026141 peptidylprolyl isomerase-like 4 48 70 23 NM_053177 mucolipin 1 48 34 54 NM_007958 SWI/SNF-related matrix-associated 48 51 37 NM_178198 histone cluster 1 H2bj 48 45 39 NM_028696 oligonucleotide/oligosaccharide-binding fold 48 23 60 NM_001039090 SKI-like isoform b 48 43 40 NM_001033122 CD69 antigen 48 27 43 NM_001034895 hypothetical protein LOC103406 48 57 12 NM_001033300 guanine monphosphate synthetase 48 51 10 NM_007987 Fas TNF receptor superfamily member 48 41 18 NM_029036 S100P binding protein 48 13 43 NM_177684 zinc finger protein 637 48 32 20 NM_145605 kelch domain containing 4 48 28 23 NM_133765 F-box protein 31 48 7 43 NM_011858 odd Oz/ten-m homolog 4 48 33 10 NM_016978 ornithine aminotransferase 48 16 22 NM_139304 transcription repressor p66 component of the 48 37 1 NM_011984 homer homolog 3 48 15 18 NM_029749 ubiquitin specific protease 42 48 14 15 NM_172918 zinc finger protein 75 48 11 18 NM_030221 NAD synthetase 1 48 13 15 NM_027545 CWF19-like 2 cell cycle control 48 17 9 NM_173765 aminoadipate-semialdehyde dehydrogenase 48 2 8 NM_010797 midline 1 47 8733 147 NM_009977 cystatin F leukocystatin 47 780 53 NM_025409 immediate early response 3 interacting protein 47 476 73 NM_178602 glutamate receptor ionotropic, N-methyl 47 454 66 NM_028447 proline-rich coiled-coil 1 47 212 13 NM_001008542 Max interactor 1 isoform b 47 172 36 NM_029505 adaptor-related protein complex 3 mu 2 subunit 47 153 34 NM_144784 acetyl-Coenzyme A acetyltransferase 1 precursor 47 133 27 NM_053252 tangerin isoform B 47 69 87 NM_009531 xeroderma pigmentosum complementation group C 47 116 32 NM_013700 ubiquitin specific protease 5 isopeptidase T 47 88 54 NM_018886 lectin galactose binding, soluble 8 47 89 47 NM_133801 general transcription factor IIF polypeptide 1 47 93 37 NM_001048189 carboxypeptidase 6 cytosolic isoform 2 47 120 9 NM_001044741 calcium channel voltage-dependent, beta 3 47 87 42 NM_009691 amyloid beta A4 precursor-like protein 2 47 26 101 NM_028874 sorting nexin 19 47 89 34 NM_028412 Cip1-interacting zinc finger protein 47 47 74 NM_001029889 hypothetical protein LOC207806 47 71 39 NM_172302 pre-mRNA cleavage factor I 59 kDa subunit 47 73 34 NM_024473 hypothetical protein LOC79555 47 45 57 NM_026902 malignant T cell amplified sequence 1 47 46 54 NM_026041 ribosomal RNA processing 15 homolog 47 25 62 NM_021899 forkhead box J2 47 36 34 NM_010690 large tumor supressor homolog 1 47 56 13 NM_175090 solute carrier family 31 member 1 47 26 39 NM_001081236 hypothetical protein LOC76792 47 38 26 NM_176923 WD repeat domain 59 47 17 45 NM_178772 arylacetamide deacetylase-like 1 47 31 23 NM_138657 suppressor of cytokine signaling 7 47 11 41 NM_025884 coiled-coil domain containing 16 47 7 42 NM_053171 CUB and Sushi multiple domains 1 47 5 39 NM_173450 RNA pseudouridylate synthase domain containing 47 12 29 NM_175656 histone cluster 1 H4i 47 10 29 NM_153567 SLAIN motif family member 2 isoform a 47 18 13 NM_001033355 zinc finger protein 568 47 22 9 NM_001001880 myelin protein zero-like 1 isoform b 47 11 18 NM_028031 zinc finger DHHC domain containing 13 47 3 25 NM_001081391 CUB and Sushi multiple domains 3 46 503 36 NM_026155 signal sequence receptor gamma 46 142 74 NM_183019 Rho guanine nucleotide exchange factor 4 46 139 75 NM_183161 hypothetical protein LOC228993 46 117 46 NM_153548 hypothetical protein LOC223593 46 97 66 NM_026908 calcium binding protein 39-like 46 103 43 NM_009498 vesicle-associated membrane protein 3 46 72 72 NM_025954 hypothetical protein LOC67078 46 83 52 NM_001005767 presenilin associated rhomboid-like 46 103 21 NM_025346 required for meiotic nuclear division 5 homolog 46 54 69 NM_175127 F-box protein 28 46 102 18 NM_198167 transmembrane protein 63b 46 89 21 NM_022015 TBP-associated factor 8 46 50 59 NM_027184 inositol polyphosphate multikinase 46 10 93 NM_018757 expressed in non-metastatic cells 6 protein 46 54 44 NM_023210 acidic leucine-rich nuclear phosphoprotein 32 46 54 43 NM_173371 hexose-6-phosphate dehydrogenase glucose 46 53 43 NM_026584 general transcription factor II E polypeptide 2 46 29 59 NM_028599 WD repeat domain 75 46 33 54 NM_001024806 CCAAT/enhancer binding protein zeta 46 76 9 NM_145371 eukaryotic translation initiation factor 2B 46 61 19 NM_009503 valosin containing protein 46 10 65 NM_172307 membrane-bound transcription factor peptidase 46 48 26 NM_008898 cytochrome P450 reductase 46 43 30 NM_029956 methylmalonic aciduria cobalamin deficiency 46 30 39 NM_011729 excision repair cross-complementing rodent 46 57 11 NM_001001321 solute carrier family 35 member D2 46 48 19 NM_145487 proline-rich protein 3 46 41 26 NM_172277 sorting nexin 8 46 32 34 NM_024205 JNK1-associated membrane protein 46 26 38 NM_183028 protein-L-isoaspartate D-aspartate 46 13 49 NM_001081101 hypothetical protein LOC71101 46 15 45 NM_021881 quaking protein 46 32 26 NM_030197 hypothetical protein LOC78832 46 34 21 NM_133227 nucleoporin 155 46 34 16 NM_148924 zinc finger protein 263 46 2 48 NM_023386 receptor transporter protein 4 46 36 10 NM_023651 peroxisomal biogenesis factor 13 46 34 10 NM_175358 zinc finger DHHC domain containing 15 46 33 11 NM_133819 protein phosphatase 1 regulatory subunit 15B 46 15 29 NM_025887 RAB5A member RAS oncogene family 46 42 2 NM_175438 aldehyde dehydrogenase 4 family member A1 46 22 20 NM_001033713 myocyte enhancer factor 2A 46 19 22 NM_028012 X-ray repair complementing defective repair in 46 8 19 NM_178741 kelch-like 8 46 8 17 NM_007715 circadian locomoter output cycles kaput 46 10 14 NM_198295 thioredoxin domain containing 10 46 7 9 NM_007956 estrogen receptor 1 alpha 46 12 1 NM_013569 voltage-gated potassium channel subfamily H, 46 7 5 NM_029086 hypothetical protein LOC74753 46 3 4 NM_027439 ATPase H+ transporting, lysosomal accessory 45 890 10 NM_025510 hypothetical protein LOC66358 45 248 21 NM_177460 poly ADP-ribose polymerase family member 16 45 171 52 NM_134101 proteasome 26S non-ATPase subunit 2 45 85 99 NM_133228 zinc finger protein 87 45 148 28 NM_146094 delta-5 desaturase 45 61 104 NM_020559 aminolevulinic acid synthase 1 45 144 17 NM_016756 cyclin-dependent kinase 2 isoform 2 45 117 42 NM_025335 transmembrane protein 167 45 104 52 NM_026438 pyrophosphatase 45 115 26 NM_175226 ring finger protein 139 45 48 74 NM_029649 transmembrane protein 101 45 103 11 NM_008991 ATP-binding cassette sub-family D, member 3 45 54 60 NM_021504 N-glycanase 1 45 46 57 NM_011948 mitogen activated protein kinase kinase kinase 45 47 55 NM_028009 RNA pseudouridylate synthase domain containing 45 51 47 NM_025579 TAF12 RNA polymerase II TATA box binding 45 31 66 NM_025494 ATPase H+ transporting, lysosomal V1 subunit 45 44 53 NM_010907 nuclear factor of kappa light chain gene 45 38 55 NM_001033299 zinc finger protein 217 45 41 48 NM_028381 coiled-coil domain containing 94 45 42 46 NM_025736 tetratricopeptide repeat domain 35 45 53 35 NM_028717 alsin 45 45 40 NM_172592 splicing factor arginine/serine-rich 12 45 9 75 NM_027993 hypothetical protein LOC71901 45 58 16 NM_027193 diphthine synthase 45 57 17 NM_175245 hypothetical protein LOC76789 45 32 41 NM_028923 GLE1 RNA export mediator 45 54 18 NM_007508 ATPase H+ transporting, lysosomal V1 subunit A 45 45 26 NM_009103 ribonucleotide reductase M1 45 3 64 NM_001102607 collagen type VI alpha 6 isoform 1 45 14 53 NM_001017966 DNA-damage inducible protein 2 45 17 45 NM_021315 nucleolar complex associated 3 homolog 45 15 47 NM_175116 purinergic receptor P2Y G-protein coupled, 5 45 29 32 NM_018818 choroidermia 45 24 35 NM_177612 catenin cadherin associated protein alpha 3 45 29 28 NM_001004155 hypothetical protein LOC268759 isoform 1 45 16 41 NM_178385 tubulin-specific chaperone c 45 17 38 NM_001040695 signaling molecule ATTP 45 31 24 NM_177815 RFT1 homolog 45 34 20 NM_172536 zinc finger protein 609 45 18 34 NM_025446 androgen-induced 1 45 25 26 NM_030057 trafficking protein particle complex 6B 45 14 36 NM_029320 progesterone-induced blocking factor 1 isoform 45 31 15 NM_175286 hypothetical protein LOC97031 45 30 9 NM_029468 zinc finger protein 821 45 32 6 NM_153794 hypothetical protein LOC108654 45 23 15 NM_177870 solute carrier family 5 sodium-dependent 45 5 24 NM_001039532 RIKEN cDNA C730049F21 45 3 15 NM_001003893 mannan-binding lectin serine protease 2 isoform 45 2 12 NM_019808 PDZ and LIM domain 5 isoform ENH1 44 789 73 NM_134152 leupaxin 44 501 31 NM_010273 guanosine diphosphate GDP dissociation 44 72 264 NM_001002011 lamin A isoform A 44 304 17 NM_011364 SH2 domain protein 1A 44 197 103 NM_010433 homeodomain interacting protein kinase 2 44 257 26 NM_078484 solute carrier family 35 member A2 isoform 1 44 247 20 NM_011722 dynactin 6 44 248 11 NM_008189 guanylate cyclase activator 1a retina 44 210 26 NM_010364 general transcription factor II H polypeptide 44 66 138 NM_010304 guanine nucleotide binding protein alpha 15 44 89 82 NM_013782 phosphatidylserine synthase 2 44 115 40 NM_019961 peroxisomal biogenesis factor 3 44 30 110 NM_144915 diacylglycerol lipase beta 44 95 42 NM_017478 coatomer protein complex subunit gamma 2 44 60 52 NM_144892 nuclear receptor coactivator 5 44 84 15 NM_019561 endosulfine alpha isoform a 44 83 9 NM_080452 mitochondrial ribosomal protein S2 44 66 21 NM_001012400 hypothetical protein LOC230696 44 31 48 NM_145400 ubiquitination factor E4A 44 39 40 NM_146041 GDP-mannose 4 6-dehydratase 44 48 28 NM_026693 gamma-aminobutyric acid GABA-A 44 46 30 NM_011591 translocase of inner mitochondrial membrane 17b 44 23 52 NM_144731 UDP-N-acetyl-alpha-D-galactosamine: polypeptide 44 38 30 NM_173443 valosin-containing protein p97/p47 44 36 27 NM_178403 pseudouridylate synthase 7 homolog 44 27 36 NM_028965 sorting nexin 11 44 25 37 NM_022328 myeloid/lymphoid or mixed lineage-leukemia 44 44 16 NM_146185 zinc finger protein 790 44 33 25 NM_029436 kelch-like 24 44 23 35 NM_001025947 dynamin 1-like isoform b 44 13 42 NM_030234 WD repeat domain 76 44 28 26 NM_172926 sorting nexin 14 44 14 39 NM_008866 lysophospholipase 1 44 28 21 NM_020618 SWI/SNF related matrix associated, actin 44 24 21 NM_011738 tyrosine 3/tryptophan 5 -monooxygenase 44 15 26 NM_178752 hypothetical protein LOC269952 44 30 11 NM_144519 zinc finger protein 639 44 16 19 NM_013499 complement receptor related protein 44 30 4 NM_028354 tyrosyl-DNA phodphodiesterase 1 44 8 25 NM_133236 glucocorticoid induced transcript 1 isoform 1 44 11 19 NM_013726 activator of S phase kinase 44 12 15 NM_001014390 dual-specificity tyrosine-Y-phosphorylation 44 7 19 NM_026582 G protein-coupled receptor 177 44 8 4 NM_011200 protein tyrosine phosphatase 4a1 44 240 52 NM_025333 hypothetical protein LOC66072 44 225 55 NM_009873 cyclin-dependent kinase 6 44 212 24 NM_016741 scavenger receptor class B member 1 44 195 38 NM_027457 hypothetical protein LOC70544 44 191 40 NM_025480 transmembrane protein 128 44 170 58 NM_207523 ribosomal protein L23a 44 139 59 NM_007422 adenylosuccinate synthetase non muscle 44 150 31 NM_009919 cornichon homolog 44 150 26 NM_025427 response gene to complement 32 44 133 38 NM_030685 stress-associated endoplasmic reticulum protein 44 109 51 NM_019835 UDP-Gal:betaGlcNAc beta 44 72 77 NM_133718 transmembrane protein 30A 44 51 93 NM_153420 acid phosphatase-like 2 44 116 11 NM_133756 XPA binding protein 1 44 98 15 NM_023230 ubiquitin-conjugating enzyme E2 variant 1 44 67 43 NM_019873 FK506 binding protein-like 44 84 25 NM_145582 ATP binding domain 3 44 85 23 NM_025813 major facilitator superfamily domain containing 44 40 58 NM_023876 elongation protein 4 homolog 44 82 11 NM_172790 ankyrin repeat domain 52 44 61 29 NM_133798 exonuclease 3''-5'' domain-like 2 44 32 52 NM_145448 hypothetical protein LOC217830 44 74 7 NM_023132 renin binding protein 44 41 37 NM_001042438 zinc finger and homeodomain protein 1 44 31 39 NM_053122 inner mitochondrial membrane peptidase 2-like 44 39 30 NM_181593 inositol 14,5-trisphosphate 3-kinase C 44 27 40 NM_026550 PAK/PLC-interacting protein 1 44 29 36 NM_133752 optic atrophy 1 homolog 44 43 22 NM_001039088 sec13-like protein isoform a 44 29 35 NM_028315 RIKEN cDNA 2810028N01 44 54 9 NM_026823 ADP-ribosylation factor-like 8A 44 45 17 NM_001005916 zinc finger and BTB domain containing 9 44 23 36 NM_023220 signal peptide peptidase-like 2A 44 11 46 NM_178726 protein phosphatase 1 formerly 2C-like 44 45 11 NM_007387 acid phosphatase 2 lysosomal 44 34 18 NM_024472 glycolipid transfer protein domain containing 1 44 23 26 NM_028136 DEAH Asp-Glu-Ala-His box polypeptide 36 44 4 43 NM_025911 GGA binding partner 44 24 24 NM_146231 zinc finger protein 825 44 12 35 NM_027382 histone deacetylase 8 44 17 28 NM_019921 A kinase PRKA anchor protein 10 44 5 40 NM_029606 coiled-coil domain containing 46 isoform 2 44 30 12 NM_172528 leucine rich repeat containing 1 44 14 28 NM_030208 hypothetical protein LOC78890 44 3 38 NM_028964 hypothetical protein LOC74478 44 20 19 NM_026573 UPF3 regulator of nonsense transcripts homolog 44 27 11 NM_177472 BTB POZ domain containing 12 44 15 23 NM_025663 G patch domain containing 4 44 4 11 NM_153393 collagen type XXIII, alpha 1 44 10 1 NM_026629 hypothetical protein LOC68235 43 670 9 NM_008320 interferon regulatory factor 8 43 547 14 NM_029083 DNA-damage-inducible transcript 4 43 270 28 NM_026130 signal recognition particle receptor 43 243 5 NM_175696 hypothetical protein LOC319352 43 140 27 NM_023721 ATPase H+ transporting, V1 subunit D 43 138 29 NM_028811 elongation protein 3 homolog 43 125 36 NM_145919 abhydrolase domain containing 14A isoform a 43 119 17 NM_016961 mitogen activated protein kinase 9 isoform b 43 114 13 NM_177344 hypothetical protein LOC227615 43 68 51 NM_016962 spastin 43 87 31 NM_013556 hypoxanthine guanine phosphoribosyl transferase 43 55 60 NM_146175 zinc finger protein 282 43 108 2 NM_010914 nuclear transcription factor-Y beta 43 93 11 NM_001007575 zinc finger protein 58 43 70 33 NM_001017985 C2 calcium-dependent domain containing 3 43 84 13 NM_008468 karyopherin importin alpha 6 43 29 66 NM_011273 xenotropic and polytropic retrovirus receptor 1 43 76 17 NM_175277 bolA-like 3 43 74 16 NM_007888 dishevelled 2 dsh homolog 43 68 21 NM_010799 multiple inositol polyphosphate histidine 43 59 28 NM_025862 acyl-Coenzyme A dehydrogenase family member 8 43 60 25 NM_027925 tRNA selenocysteine associated protein 1 43 42 38 NM_172054 thioredoxin domain containing 9 43 71 5 NM_026260 tectonic family member 3 43 58 15 NM_008065 GA repeat binding protein alpha 43 37 36 NM_178766 mitochondrial carrier family protein 43 25 46 NM_145406 protein P3 43 34 35 NM_019729 ubiquitin specific peptidase 8 43 30 37 NM_001083110 praja1 isoform 1 43 50 15 NM_028197 KIF1 binding protein 43 18 45 NM_009403 tumor necrosis factor ligand superfamily 43 45 18 NM_011135 CCR4-NOT transcription complex subunit 7 43 41 21 NM_020285 tumor-suppressing subchromosomal transferable 43 42 18 NM_025876 CDK5 regulatory subunit associated protein 1 43 23 36 NM_026450 GLI-Kruppel family member HKR1 43 10 45 NM_019707 cadherin 13 43 16 34 NM_023370 cadherin 23 43 22 28 NM_011742 zinc finger protein 1 isoform 2 43 30 18 NM_178364 zinc finger protein 369 43 25 22 NM_207659 hook homolog 3 43 20 26 NM_173444 neurobeachin like 1 43 20 23 NM_027469 glucose-fructose oxidoreductase domain 43 13 28 NM_026255 solute carrier family 25 mitochondrial carrier 43 15 23 NM_027782 potassium channel tetramerisation domain 43 15 21 NM_015830 small optic lobes 43 10 24 NM_198636 acyl-CoA synthetase short-chain family member 3 43 2 27 NM_023852 RAB3C member RAS oncogene family 43 25 1 NM_011692 von Hippel-Lindau binding protein 1 43 9 15 NM_025547 MTERF domain containing 1 43 17 2 NM_022014 fructosamine 3 kinase isoform a 43 10 8 NM_013454 ATP-binding cassette 1 sub-family A, member 1 43 7 9 NM_030265 potassium channel interacting protein 4 42 136 82 NM_021554 methyltransferase like 9 42 176 39 NM_198606 WD repeats and SOF domain containing 1 42 151 6 NM_001033242 ceroid-lipofuscinosis neuronal 5 42 118 26 NM_144888 virus-induced signaling adapter 42 103 36 NM_019780 vacuolar protein sorting 29 42 86 51 NM_026030 eukaryotic translation initiation factor 2 42 96 36 NM_172456 endonuclease G-like 1 42 71 52 NM_172541 transmembrane protein 120A 42 89 31 NM_021537 serine/threonine kinase 25 42 77 43 NM_144911 RNA polymerase II associated protein 2 42 88 23 NM_026186 coiled-coil domain containing 49 42 71 39 NM_001029850 membrane associated guanylate kinase WW and PDZ 42 69 38 NM_027485 mediator complex subunit 26 42 27 77 NM_015800 cysteine rich transmembrane BMP regulator 1 42 96 9 NM_008810 pyruvate dehydrogenase E1 alpha 1 42 90 13 NM_134017 methionine adenosyltransferase II beta 42 72 25 NM_176958 hypoxia-inducible factor 1 alpha subunit 42 33 62 NM_008339 CD79B antigen 42 75 17 NM_146248 coiled-coil alpha-helical rod protein 1 42 53 33 NM_013495 carnitine palmitoyltransferase 1a liver 42 38 45 NM_027900 R3H domain containing 2 42 53 30 NM_028779 adenosine monophosphate deaminase 2 isoform L 42 55 27 NM_009628 activity-dependent neuroprotective protein 42 75 6 NM_001081343 hypothetical protein LOC73205 42 59 22 NM_153159 zinc finger CCCH type containing 12A 42 19 60 NM_020505 vav 3 oncogene isoform 1 42 62 16 NM_009949 carnitine palmitoyltransferase 2 42 42 36 NM_176860 ubiquitin associated and SH3 domain containing 42 50 27 NM_025783 neuroendocrine differentiation factor 42 20 49 NM_026208 hypothetical protein LOC67507 42 18 51 NM_175160 zinc finger DHHC domain containing 1 42 16 48 NM_001039692 Rho GTPase activating protein 12 isoform 1 42 3 57 NM_008504 granzyme M 42 38 22 NM_007893 E4F transcription factor 1 42 34 23 NM_001040396 selenoprotein T 42 38 18 NM_153526 insulin induced gene 1 42 24 29 NM_201638 hypothetical protein LOC210529 42 7 43 NM_001081982 nuclear factor I/X isoform 1 42 19 29 NM_027425 RUN and FYVE domain-containing 2 42 20 27 NM_026295 CTD carboxy-terminal domain RNA polymerase II, 42 3 43 NM_009370 transforming growth factor beta receptor I 42 29 16 NM_027213 mediator of RNA polymerase II transcription 42 23 22 NM_172742 myotubularin related protein 10 42 9 34 NM_001013786 zinc finger protein 187 42 28 14 NM_028054 zinc finger FYVE domain containing 19 42 3 38 NM_009799 carbonic anhydrase 1 42 14 26 NM_024273 hypothetical protein LOC76916 42 20 20 NM_001024512 hypothetical protein LOC105428 isoform 1 42 13 26 NM_153065 DEAD Asp-Glu-Ala-Asp box polypeptide 27 42 24 14 NM_016746 cyclin C 42 8 30 NM_008166 glutamate receptor ionotropic, delta 1 42 18 16 NM_007790 chondroitin sulfate proteoglycan 6 42 23 9 NM_026344 diptheria toxin resistance protein required for 42 10 22 NM_181545 schlafen 8 42 9 21 NM_023750 zinc finger protein 84 42 11 18 NM_011122 procollagen-lysine 2-oxoglutarate 5-dioxygenase 42 9 16 NM_018759 zinc finger protein 326 42 2 22 NM_026046 zinc finger protein 329 42 8 11 NM_026234 phosphatidylinositol glycan anchor biosynthesis 42 9 6 NM_008325 iduronidase alpha-L- 42 4 9 NM_008512 low density lipoprotein receptor-related protein 41 782 317 NM_023049 ankyrin repeat and SOCS box-containing protein 41 126 427 NM_029186 transmembrane protein 180 41 161 79 NM_023044 solute carrier family 15 member 3 41 175 52 NM_029157 splicing factor 3a subunit 3 41 204 9 NM_023671 chloride channel nucleotide-sensitive, 1A 41 167 38 NM_028761 polyA-specific ribonuclease (deadenylation 41 170 34 NM_001013256 hypothetical protein LOC68964 isoform b 41 128 72 NM_027722 nudix-type motif 4 41 143 55 NM_009178 ST3 beta-galactoside alpha-23-sialyltransferase 41 106 62 NM_144931 NEDD8 activating enzyme E1 subunit 1 41 126 41 NM_019758 mitochondrial carrier homolog 2 41 133 11 NM_139064 TNFAIP3 interacting protein 2 41 108 37 NM_001099675 hypothetical protein LOC68512 41 109 26 NM_001042499 RAB member of RAS oncogene family-like 3 41 60 73 NM_130889 acidic nuclear phosphoprotein 32 family member 41 123 9 NM_019821 glycolipid transfer protein 41 38 91 NM_024442 cytochrome P450 family 4, subfamily f, 41 69 47 NM_011399 solute carrier family 25 mitochondrial carrier 41 40 68 NM_133829 macrophage MHC receptor 2 isoform 1 41 66 41 NM_010074 dipeptidylpeptidase 4 41 83 20 NM_028459 Wiskott-Aldrich syndrome-like 41 53 48 NM_001080930 ataxin 1-like 41 26 72 NM_027444 HMG-BOX transcription factor BBX 41 73 21 NM_133771 C21orf19-like protein 41 82 11 NM_029793 golgi autoantigen golgin subfamily a, 1 41 69 18 NM_027922 hypothetical protein LOC71782 41 43 42 NM_172561 sperm associated antigen 7 41 55 27 NM_025868 thioredoxin-related transmembrane protein 2 41 61 19 NM_030702 SUMO/sentrin specific peptidase 3 41 59 21 NM_026045 PRP18 pre-mRNA processing factor 18 homolog 41 41 39 NM_008636 metal response element binding transcription 41 18 59 NM_145633 VPS9-ankyrin repeat-containing protein isoform 41 30 45 NM_025615 hypothetical protein LOC66523 41 65 8 NM_030254 tumor suppressor candidate 3 41 2 68 NM_173437 neuron navigator 1 41 42 24 NM_001113352 synaptojanin 2 isoform b 41 29 34 NM_009206 solute carrier family 4 anion exchanger 41 37 26 NM_001033275 glycosyltransferase 8 domain containing 3 41 46 15 NM_153398 zinc finger and BTB domain containing 24 41 44 17 NM_212484 CCR4-NOT transcription complex subunit 6 41 32 27 NM_018736 meiotic recombination 11 homolog A 41 34 25 NM_001033294 DEAD/H Asp-Glu-Ala-Asp/His box polypeptide 31 41 23 36 NM_172695 phospholipase A2 activating protein 41 22 37 NM_144886 exosome component 2 41 16 40 NM_024289 oxysterol-binding protein-like protein 5 41 19 32 NM_025526 nitrogen fixation cluster-like 41 42 9 NM_080634 Hermansky-Pudlak syndrome 3 homolog 41 32 17 NM_146207 cullin 4A 41 16 33 NM_025630 angiogenic factor with G patch and FHA domains 41 17 26 NM_010864 myosin Va 41 17 25 NM_008710 nicotinamide nucleotide transhydrogenase 41 10 29 NM_001034013 amiloride-sensitive cation channel 1 neuronal 41 28 10 NM_020273 glucocorticoid modulatory element binding 41 9 26 NM_001040691 uracil DNA glycosylase isoform a 41 8 26 NM_177814 ELKS/RAB6-interacting/CAST family member 2 41 15 18 NM_001081039 dedicator of cytokinesis 9 41 11 22 NM_201227 DAN domain family member 5 41 25 7 NM_025773 ubiquitin-conjugating enzyme E2W putative 41 15 15 NM_133250 mutY homolog 41 18 9 NM_009212 immunoglobulin mu binding protein 2 41 7 21 NM_010241 AKT interacting protein 41 14 10 NM_031881 neural precursor cell expressed developmentally 41 9 15 NM_007445 anti-Mullerian hormone 41 8 15 NM_009686 amyloid beta A4 precursor protein-binding 41 4 7 NM_001081401 a disintegrin-like and metalloprotease 40 167 61 NM_023475 serine hydrolase protein 40 184 41 NM_024193 nucleolar protein 5A 40 185 15 NM_146018 folliculin 40 52 143 NM_001080944 ATPase class I, type 8B, member 4 40 160 30 NM_008511 lymphoid-restricted membrane protein 40 140 49 NM_145462 hypothetical protein LOC219072 40 116 70 NM_134086 solute carrier family 38 member 1 40 91 70 NM_134064 ring finger protein 44 40 79 62 NM_001047436 par-6 partitioning defective 6 homolog alpha 40 73 55 NM_010500 immediate early response 5 40 111 14 NM_172993 zinc finger protein 512 40 85 40 NM_022988 Ngg1 interacting factor 3-like 1 40 75 46 NM_026890 neuroguidin EIF4E binding protein 40 65 53 NM_198035 zinc finger and BTB domain containing 39 40 54 59 NM_016686 vascular endothelial zinc finger 1 40 39 68 NM_178590 inhibitor of kappaB kinase gamma isoform 2 40 56 49 NM_170591 nucleoporin like 1 40 60 44 NM_001110015 WD repeat domain 36 isoform 1 40 67 36 NM_009289 STE20-like kinase 40 82 19 NM_008917 palmitoyl-protein thioesterase 1 40 81 16 NM_198017 hypothetical protein LOC109359 40 38 58 NM_199033 tRNA splicing endonuclease 2 homolog 40 61 25 NM_172540 hypothetical protein LOC215201 40 46 37 NM_178420 NOD9 protein 40 70 9 NM_024427 tropomyosin 1 alpha 40 36 43 NM_024176 Dr1 associated protein 1 negative cofactor 2 40 68 10 NM_019787 SEC23B 40 53 17 NM_176979 topoisomerase DNA II beta binding protein 40 68 2 NM_011977 solute carrier family 27 member 1 40 46 23 NM_026079 inhibitor of kappa light polypeptide enhancer in 40 46 22 NM_177474 D19Bwg1357e protein 40 53 15 NM_026400 DnaJ Hsp40 homolog subfamily B, member 11 40 36 27 NM_025534 coiled-coil domain containing 82 40 14 47 NM_152825 ubiquitin specific protease 45 40 17 38 NM_001081750 zinc finger protein 664 40 18 35 NM_031256 pleckstrin homology domain-containing family A 40 40 12 NM_001013380 dynein cytoplasmic 1 light intermediate chain 40 13 30 NM_007917 eukaryotic translation initiation factor 4E 40 30 9 NM_029466 ADP-ribosylation factor-like 5B 40 29 9 NM_144806 phosphoribosyl pyrophosphate 40 7 30 NM_007832 deoxycytidine kinase 40 15 19 NM_153780 hypothetical protein LOC72139 40 4 24 NM_011630 nuclear receptor subfamily 2 group C, member 2 40 9 18 NM_172593 mesoderm induction early response 1 family 40 13 13 NM_009261 spermatid perinuclear RNA-binding protein 40 7 19 NM_001111268 glutamate receptor ionotropic, kainate 2 40 4 17 NM_153789 myosin regulatory light chain interacting 40 7 11 NM_015822 F-box and leucine-rich repeat protein 3 40 5 11 NM_177086 zinc finger matrin type 4 40 4 3 NM_028335 zinc finger protein 248 40 1 4 NM_172546 Cnksr family member 3 40 1 2 NM_153422 phosphodiesterase 5A cGMP-specific 39 13419 53 NM_001077508 tumor necrosis factor receptor superfamily 39 331 19 NM_001009949 mitochondrial carrier triple repeat 1 39 300 38 NM_027430 brain protein 44 39 105 90 NM_001111279 WD repeat and FYVE domain containing 1 isoform 39 138 39 NM_183037 tripartite motif protein 46 isoform 2 39 119 37 NM_175021 sterile alpha motif domain containing 4B 39 124 20 NM_024170 mammalian retrotransposon derived 8b 39 74 59 NM_001081335 p53-associated parkin-like cytoplasmic protein 39 119 5 NM_028394 hypothetical protein LOC72938 39 75 41 NM_029512 hypothetical protein LOC76080 39 103 9 NM_011920 ATP-binding cassette sub-family G, member 2 39 100 6 NM_026177 hypothetical protein LOC67467 39 86 15 NM_001025582 transmembrane protein 77 isoform 1 39 59 35 NM_199199 transmembrane protein 199 39 58 29 NM_030250 nuclear undecaprenyl pyrophosphate synthase 1 39 50 38 NM_015806 mitogen-activated protein kinase 6 39 68 15 NM_133837 D123 gene product 39 56 20 NM_139297 UDP-glucose pyrophosphorylase 2 39 52 22 NM_008186 general transcription factor II H polypeptide 39 31 42 NM_023502 ets family transcription factor ELF2A2 39 18 53 NM_001039519 general transcription factor II A 2 39 43 24 NM_181732 axin interaction partner and dorsalization 39 4 56 NM_145836 hypothetical protein LOC238330 39 0 59 NM_013549 histone cluster 2 H2aa1 39 18 40 NM_011997 caspase 8 associated protein 2 39 26 31 NM_009453 U2 small nuclear ribonucleoprotein auxiliary 39 1 56 NM_011584 nuclear receptor subfamily 1 group D, member 2 39 23 33 NM_207652 TSC22 domain family member 1 isoform 1 39 20 35 NM_013646 RAR-related orphan receptor alpha 39 37 16 NM_178374 snurportin 1 39 29 23 NM_001024604 ankyrin repeat domain 28 39 34 17 NM_172588 serine incorporator 5 39 10 42 NM_173184 relaxin 3 39 17 31 NM_009688 baculoviral IAP repeat-containing 4 39 15 29 NM_025665 putative nucleic acid binding protein RY-1 39 8 35 NM_175518 hypothetical protein LOC242474 39 2 35 NM_013739 docking protein 3 39 8 28 NM_023422 histone cluster 1 H2bc 39 8 27 NM_020332 progressive ankylosis protein 39 10 25 NM_001013375 WD repeat domain 50 39 7 25 NM_001005510 synaptic nuclear envelope 2 39 11 16 NM_019778 zinc finger and BTB domain containing 20 39 16 10 NM_028247 solute carrier family 16 monocarboxylic acid 39 13 10 NM_201519 mitogen-activated protein kinase kinase kinase 39 5 17 NM_198308 pyruvate dehydrogenase phosphatase regulatory 39 10 7 NM_199056 inositol 13,4,5,6-pentakisphosphate 2-kinase 39 4 7 NM_175098 coiled-coil domain containing 126 39 1 9 NM_013839 nuclear receptor subfamily 1 group H, member 3 38 453 671 NM_001039959 AHNAK nucleoprotein isoform 3 38 410 52 NM_028994 mitochondrial phosphoenolpyruvate carboxykinase 38 282 68 NM_025610 asparaginase like 1 38 310 28 NM_025430 mitochondrial ribosomal protein L35 38 260 21 NM_029508 polycomb group ring finger 5 38 190 38 NM_030724 uridine-cytidine kinase 2 38 96 99 NM_019794 DnaJ Hsp40 homolog subfamily A, member 2 38 89 84 NM_028209 tetratricopeptide repeat domain 4 38 154 17 NM_008612 menage a trois 1 38 139 30 NM_020329 dolichyl pyrophosphate phosphatase 1 38 89 75 NM_001042523 thioredoxin reductase 1 isoform 1 38 103 59 NM_009098 ribosomal protein S8 38 55 93 NM_011801 craniofacial development protein 1 38 115 21 NM_001013779 absent in melanoma 2 38 103 12 NM_015827 coatomer protein complex subunit beta 2 beta 38 61 52 NM_144885 cDNA sequence BC005624 38 75 38 NM_011943 mitogen-activated protein kinase kinase 6 38 37 57 NM_178208 histone cluster 1 H4c 38 27 66 NM_019966 malonyl-CoA decarboxylase 38 58 32 NM_181406 arginyl-tRNA synthetase-like 38 75 13 NM_001005341 yippee-like 2 38 47 37 NM_026259 ring finger protein 41 38 61 23 NM_001081013 rearranged L-myc fusion sequence 38 27 46 NM_032544 GTP binding protein 3 38 31 40 NM_010165 eyes absent 2 homolog 38 45 26 NM_145943 hypothetical protein LOC208768 38 53 18 NM_024191 ADP-ribosylation factor-like 2 binding protein 38 26 43 NM_175687 hypothetical protein LOC319278 38 16 52 NM_001044371 RAD17 homolog 38 55 11 NM_144923 biliverdin reductase B flavin reductase 38 44 22 NM_144875 RAB7 member RAS oncogene family-like 1 38 26 37 NM_021310 junction-mediating and regulatory protein 38 41 18 NM_021312 WD repeat domain 12 38 22 36 NM_028944 hypoxia-inducible factor prolyl 4-hydroxylase 38 30 26 NM_029418 hypothetical protein LOC75758 38 17 37 NM_023266 zinc finger protein 120 isoform 2 38 25 27 NM_153121 LysM putative peptidoglycan-binding, domain 38 9 42 NM_028768 armadillo repeat containing 8 38 17 31 NM_029705 ataxin 3 38 26 21 NM_175557 zinc finger protein 384 38 20 21 NM_001081319 hypothetical protein LOC226089 38 31 9 NM_001098227 syndecan binding protein isoform 1 38 31 9 NM_028127 FERM domain containing 6 38 27 6 NM_080443 ankyrin repeat and SOCS box-containing protein 38 24 8 NM_007696 oviductal glycoprotein 1 38 7 24 NM_001081206 diacylglycerol kinase iota 38 12 17 NM_176976 hypothetical protein LOC319675 38 7 22 NM_001081257 similar to Heparanase-2 Hpa2 38 9 17 NM_030688 interleukin 1 receptor accessory protein-like 2 38 8 17 NM_020252 neurexin I 38 3 19 NM_009162 secretory granule neuroendocrine protein 1 7B2 38 11 8 NM_146073 zinc finger DHHC domain containing 14 38 7 10 NM_133220 serum/glucocorticoid regulated kinase 3 38 5 9 NM_183201 schlafen 5 38 8 4 NM_028904 RMI1 RecQ mediated genome instability 1, 37 681 53 NM_019464 SH3-domain GRB2-like B1 37 569 89 NM_029942 PRELI domain containing 2 37 563 39 NM_013629 putative homeodomain transcription factor 1 37 349 59 NM_001037722 a disintegrin and metalloprotease domain 15 37 67 296 NM_175661 histone cluster 1 H2af 37 172 22 NM_138309 Cd99 antigen-like 2 37 138 46 NM_026229 G protein-coupled receptor 89 37 129 51 NM_025939 phosphoribosylaminoimidazole carboxylase 37 120 43 NM_172947 LSM12 homolog 37 139 19 NM_009094 ribosomal protein S4 X-linked 37 131 20 NM_178648 UBX domain containing 6 37 125 12 NM_029759 hypothetical protein LOC76824 37 96 30 NM_008403 integrin beta 1 binding protein 1 37 51 75 NM_172747 potassium channel tetramerisation domain 37 100 23 NM_009515 Wiskott-Aldrich syndrome homolog 37 82 31 NM_133887 syntaxin 12 37 79 29 NM_178918 UTP15 U3 small nucleolar ribonucleoprotein, 37 81 19 NM_031182 transcription factor AP4 37 76 23 NM_138607 DNA segment human DXS9928E 37 47 43 NM_173189 microcephaly primary autosomal recessive 1 37 85 6 NM_024261 hypothetical protein LOC73419 37 66 24 NM_027000 GTP binding protein 4 37 75 9 NM_015781 nucleosome assembly protein 1-like 1 37 42 43 NM_175537 zinc finger and BTB domain containing 38 37 47 34 NM_025617 hypothetical protein LOC66526 37 39 43 NM_173441 IWS1 homolog 37 38 36 NM_001081016 ubiquitous tetratricopeptide containing protein 37 57 9 NM_009451 tubulin beta 4 37 32 34 NM_133688 ghiso 37 39 26 NM_172672 glucosidase alpha neutral C 37 25 40 NM_133667 pyruvate dehydrogenase kinase isoenzyme 2 37 39 22 NM_178392 small nuclear RNA activating complex 37 34 26 NM_001013833 protein kinase cGMP-dependent, type I alpha 37 53 7 NM_178115 hypothetical protein LOC214764 isoform 2 37 16 42 NM_001044747 zinc finger protein 68 isoform b 37 16 40 NM_177224 chromodomain helicase DNA binding protein 9 37 39 13 NM_022011 general transcription factor II H polypeptide 37 28 24 NM_033623 testis derived transcript 3 37 17 33 NM_001081232 hypothetical protein LOC320661 37 16 34 NM_028050 hypothetical protein LOC72000 37 27 9 NM_178700 G-rich RNA sequence binding factor 1 isoform 1 37 16 16 NM_009044 reticuloendotheliosis oncogene 37 12 12 NM_182939 protein phosphatase 4 regulatory subunit 2 37 11 13 NM_001100454 WAP FS, Ig, KU, and NTR-containing protein 1 37 3 19 NM_030889 VPS10 domain receptor protein SORCS 2 37 15 5 NM_001033217 prickle like 1 37 15 5 NM_001111320 isocitrate dehydrogenase 1 NADP+ soluble 37 4 15 NM_013722 synapsin III 37 0 2 NM_011461 Spi-C transcription factor Spi-1/PU.1 related 36 720 210 NM_010496 inhibitor of DNA binding 2 36 822 15 NM_026125 C1q domain containing 2 36 556 42 NM_198006 hypothetical protein LOC76178 36 436 50 NM_001110794 annexin A7 36 110 110 NM_016866 serine/threonine kinase 39 STE20/SPS1 homolog 36 177 42 NM_019657 hydroxysteroid 17-beta dehydrogenase 12 36 184 29 NM_029701 signal peptidase complex subunit 3 36 114 45 NM_010397 histocompatibility 2 T region locus 22 36 94 43 NM_027354 WD repeat domain 51A 36 97 39 NM_021526 proteasome prosome macropain 26S subunit, 36 100 33 NM_026031 UTP11-like U3 small nucleolar 36 90 35 NM_133941 helicase DDX32 36 106 13 NM_007408 adipose differentiation related protein 36 85 32 NM_026304 lethal Chr 7, Rinchik 6 36 54 63 NM_173755 ubiquitin-conjugating enzyme E2O 36 81 26 NM_027248 zinc finger protein 219 36 61 44 NM_011941 mitogen-activated protein kinase binding protein 36 28 76 NM_001037746 hypothetical protein LOC328099 36 16 85 NM_134249 T-cell immunoglobulin and mucin domain 36 81 20 NM_029402 cullin 2 36 73 26 NM_001040026 SCO cytochrome oxidase deficient homolog 1 36 59 36 NM_153410 G-protein signalling modulator 1 AGS3-like C. 36 42 53 NM_023536 muscle protein684 36 47 39 NM_146083 splicing factor arginine/serine-rich 7 36 62 18 NM_133676 O-sialoglycoprotein endopeptidase 36 54 19 NM_027873 UbiA prenyltransferase domain containing 1 36 28 43 NM_026168 PTX1 protein isoform 1 36 45 24 NM_008652 myeloblastosis oncogene-like 2 36 17 41 NM_153546 membrane bound O-acyltransferase domain 36 53 5 NM_145851 Cdk5 and Abl enzyme substrate 2 36 43 12 NM_011396 solute carrier family 22 member 5 36 53 0 NM_011232 RAD1 homolog 36 40 11 NM_009804 catalase 36 27 24 NM_145956 BRCA1/BRCA2-containing complex subunit 3 36 11 40 NM_172121 zinc finger CCCH type containing 3 36 31 18 NM_013924 activator of basal transcription 36 27 22 NM_001025309 ring finger protein 131 isoform a 36 3 45 NM_178936 transmembrane protein 56 36 31 17 NM_133884 ATP binding domain 1 family member B 36 31 16 NM_197987 tripartite motif protein 37 36 28 18 NM_026025 zinc finger CCHC-type and RNA binding motif 1 36 20 26 NM_172544 neurexin III 36 31 14 NM_011728 xeroderma pigmentosum complementation group A 36 22 24 NM_027260 vaccinia related kinase 2 36 28 15 NM_026137 WD repeat domain 13 36 13 27 NM_009118 retinal S-antigen 36 16 24 NM_080788 tau tubulin kinase 2 isoform 1 36 33 4 NM_028259 ribosomal protein S6 kinase polypeptide 1 36 5 28 NM_001024606 pyruvate dehydrogenase phosphatase isoenzyme 2 36 12 19 NM_178061 Mob3b protein 36 7 24 NM_145438 lethal giant larvae homolog 2 36 8 15 NM_145969 hypothetical protein LOC211922 36 22 1 NM_177758 zinc finger and SCAN domains 20 36 15 2 NM_178641 inositol polyphosphate-5-phosphatase F 36 5 9 NM_145838 sialyltransferase 8 F 36 345 44 NM_026982 hypothetical protein LOC69186 36 219 28 NM_011045 proliferating cell nuclear antigen 36 222 9 NM_010941 NADP dependent steroid dehydrogenase-like 36 185 30 NM_009195 solute carrier family 12 member 4 36 183 20 NM_175212 transmembrane protein 65 36 172 29 NM_001002239 ribosomal protein L17 36 172 26 NM_199305 transmembrane protein 39b 36 172 13 NM_145148 GRP1-binding protein GRSP1 36 123 43 NM_027353 CD2 antigen cytoplasmic tail binding protein 36 130 17 NM_029742 hypothetical protein LOC76788 36 114 33 NM_026928 hypothetical protein LOC69064 36 105 30 NM_133692 polymerase DNA directed delta 3 36 120 8 NM_011657 tubby-like protein 3 36 97 24 NM_178704 dpy-19-like 3 36 105 12 NM_001048192 carboxypeptidase 5 cytosolic isoform 3 36 106 3 NM_144528 ring finger protein 126 36 42 62 NM_028184 oral cancer overexpressed 1 36 60 34 NM_019952 cardiotrophin-like cytokine factor 1 36 73 21 NM_009771 beta-transducin repeat containing protein 36 56 28 NM_025636 hypothetical protein LOC66566 36 8 76 NM_001081014 DENN/MADD domain containing 4C 36 71 8 NM_027093 hypothetical protein LOC69487 36 42 33 NM_030185 zinc finger CCHC domain containing 4 36 50 23 NM_026009 coiled-coil domain containing 47 36 32 37 NM_080560 ubiquitin-conjugating enzyme E2N 36 16 51 NM_016979 protein kinase X-linked 36 23 43 NM_001080981 DEAD Asp-Glu-Ala-Asp box polypeptide 23 36 11 51 NM_007497 activating transcription factor 1 36 48 12 NM_008922 DNA primase p58 subunit 36 25 34 NM_026799 ribonuclease III 36 13 43 NM_007700 conserved helix-loop-helix ubiquitous kinase 36 31 24 NM_145441 UBX domain containing 4 36 41 12 NM_001081022 hypothetical protein LOC233865 36 29 21 NM_027016 translocation protein 1 36 3 45 NM_007757 coproporphyrinogen oxidase 36 16 32 NM_172600 hypothetical protein LOC218989 36 5 43 NM_172712 ubiquitin-like modifier activating enzyme 6 36 32 13 NM_018829 adaptor-related protein complex 3 mu 1 subunit 36 17 24 NM_153532 zinc finger protein 280c 36 8 33 NM_027740 WD repeat domain 51B 36 20 20 NM_009352 telomeric repeat binding factor 1 36 5 34 NM_133249 peroxisome proliferative activated receptor 36 36 3 NM_146182 kinesin light chain 3 36 25 11 NM_175175 phafin 2 36 24 11 NM_080575 acetyl-CoA synthetase 2-like 36 25 9 NM_011604 toll-like receptor 6 36 13 20 NM_019811 acyl-CoA synthetase short-chain family member 2 36 13 15 NM_212468 single-stranded DNA binding protein 1 isoform 1 36 12 16 NM_181857 DNA polymerase N 36 11 13 NM_001081436 hypothetical protein LOC227195 isoform 2 36 10 14 NM_011485 steroidogenic acute regulatory protein 36 18 3 NM_172511 abhydrolase domain containing 10 36 8 13 NM_016700 mitogen-activated protein kinase 8 36 8 11 NM_001025286 Na+/K+ transporting ATPase interacting 2 short 36 16 2 NM_177000 hypothetical protein LOC319772 36 13 4 NM_001081464 general transcription factor II I repeat 36 7 1 NM_009223 stannin 36 2 5 NM_019823 cytochrome P450 family 2, subfamily d, 36 3 2 NM_177573 hypothetical protein LOC194268 36 0 1 NM_013612 solute carrier family 11 proton-coupled 35 2159 2 NM_009373 transglutaminase 2 C polypeptide 35 386 101 NM_026617 transmembrane BAX inhibitor motif containing 4 35 432 39 NM_019953 canopy 2 homolog 35 382 26 NM_199029 zinc finger protein 395 35 47 248 NM_018767 CD160 antigen 35 117 135 NM_011244 retinoic acid receptor gamma isoform 1 35 173 37 NM_011499 serine/threonine kinase receptor associated 35 123 42 NM_026703 NADH dehydrogenase ubiquinone 1 alpha 35 140 17 NM_008180 glutathione synthetase 35 105 48 NM_019802 gamma-glutamyl carboxylase 35 117 35 NM_026371 loss of heterozygosity 12, chromosomal region 1 35 38 109 NM_029495 epithelial stromal interaction 1 isoform a 35 105 26 NM_001039578 hypothetical protein LOC213027 35 90 29 NM_146068 hypothetical protein LOC224008 35 90 26 NM_144933 mediator complex subunit 17 35 71 42 NM_029573 isocitrate dehydrogenase 3 NAD+ alpha 35 96 5 NM_009911 chemokine C-X-C motif receptor 4 35 84 11 NM_010734 leukocyte specific transcript 1 35 54 36 NM_001082975 hypothetical protein LOC654795 35 11 74 NM_009425 tumor necrosis factor ligand superfamily 35 45 38 NM_013600 mutS homolog 5 35 56 21 NM_019653 WD repeat and SOCS box-containing 1 isoform 1 35 40 37 NM_001081050 par-3 partitioning defective 3 homolog B 35 24 50 NM_008388 eukaryotic translation initiation factor 3 35 60 11 NM_019682 dynein light chain LC8-type 1 35 16 49 NM_181815 hypothetical protein LOC75216 35 56 9 NM_025455 coiled coil domain containing 28B 35 27 36 NM_009099 tripartite motif protein 30 35 18 43 NM_172761 methenyltetrahydrofolate synthetase domain 35 56 5 NM_025536 COMM domain containing 5 35 44 15 NM_144514 COMM domain containing 1 35 48 9 NM_009016 retinoic acid early transcript 1 alpha 35 34 21 NM_019941 zinc finger protein 235 35 45 9 NM_021339 cell adhesion molecule-related/down-regulated by 35 26 28 NM_008801 phosphodiesterase 6D cGMP-specific, rod, delta 35 20 32 NM_178677 SEC22 vesicle trafficking protein-like 3 35 39 13 NM_013528 glutamine fructose-6-phosphate transaminase 1 35 38 13 NM_026934 erythropoietin 4 immediate early response 35 10 40 NM_013925 adenosine deaminase tRNA-specific 1 35 32 11 NM_030153 MAK10 homolog amino-acid N-acetyltransferase 35 38 4 NM_021551 solute carrier family 22 organic cation 35 13 27 NM_001039106 DDHD domain containing 1 isoform 1 35 18 20 NM_011053 programmed cell death protein 11 35 17 21 NM_133925 RNA binding motif protein 28 35 13 23 NM_023585 ubiquitin-conjugating enzyme E2 variant 2 35 7 27 NM_001037745 zinc finger protein 791 35 9 23 NM_172413 RAP2C member of RAS oncogene family 35 12 15 NM_001080818 CDC14 cell division cycle 14 homolog A 35 15 9 NM_010178 FUS interacting protein serine-arginine rich 1 35 17 6 NM_001044386 zinc finger protein X-linked 35 2 18 NM_139141 zinc finger protein 192 35 10 6 NM_133857 ubiquitin specific peptidase 53 35 3 11 NM_177622 zin finger protein 595 35 0 14 NM_029850 B-cell CLL/lymphoma 7A 35 12 2 NM_146260 integral membrane protein TMIE 35 7 7 NM_177310 X-prolyl aminopeptidase aminopeptidase P 3 35 4 7 NM_133853 membrane associated guanylate kinase WW and PDZ 35 7 2 NM_001033606 acyl-CoA synthetase long-chain family member 3 34 1313 70 NM_145516 pleckstrin homology domain containing family B 34 453 20 NM_025649 MAD2L1 binding protein 34 315 77 NM_009743 Bcl2-like 1 34 308 74 NM_025982 tetraspanin 31 34 342 25 NM_001042557 mitogen-activated protein kinase kinase 7 34 289 14 NM_175352 unc-119 homolog B 34 280 12 NM_008798 programmed cell death 1 34 230 32 NM_028803 glucan 14-alpha-, branching enzyme 1 34 161 95 NM_144918 SET and MYND domain containing 5 34 194 34 NM_008231 hepatoma-derived growth factor 34 196 26 NM_021528 carbohydrate sulfotransferase 12 34 151 57 NM_007512 ATPase inhibitory factor 1 34 159 9 NM_028766 transmembrane protein 43 34 130 9 NM_026958 hypothetical protein LOC380773 34 109 28 NM_010444 nuclear receptor subfamily 4 group A, member 1 34 59 73 NM_153587 ribosomal protein S6 kinase polypeptide 5 34 13 98 NM_026106 down-regulator of transcription 1 34 85 23 NM_008686 nuclear factor erythroid derived 2,-like 1 34 76 31 NM_029738 clusterin associated protein 1 34 86 17 NM_001081265 HEAT repeat containing 2 34 47 52 NM_026454 NEDD8-conjugating enzyme 34 81 15 NM_023685 zinc finger with KRAB and SCAN domains 3 34 72 19 NM_001037957 dual-specificity tyrosine-Y-phosphorylation 34 0 89 NM_172795 sterile alpha and TIR motif containing 1 34 38 45 NM_001044389 caseinolytic protease X isoform 2 34 2 77 NM_177282 flavoprotein oxidoreductase MICAL2 34 47 29 NM_013770 solute carrier family 25 mitochondrial carrier 34 29 47 NM_027797 transmembrane protein 80 34 28 48 NM_001111017 serine active site containing 1 isoform 3 34 37 39 NM_025937 NFKB activating protein 34 12 56 NM_025341 abhydrolase domain containing 6 34 26 41 NM_007772 human immunodeficiency virus type I enhancer 34 55 11 NM_020616 hypothetical protein LOC57373 34 57 9 NM_178188 histone cluster 1 H2ad 34 37 27 NM_010363 glutathione transferase zeta 1 34 44 19 NM_133679 crystallin zeta quinone reductase-like 1 34 28 35 NM_180600 ubiquitin-conjugating enzyme E2Q 2 34 38 25 NM_173012 leucine zipper-EF-hand containing transmembrane 34 4 53 NM_008663 myosin VIIa 34 45 11 NM_021281 cathepsin S preproprotein 34 42 10 NM_026203 Abelson helper integration site 34 23 24 NM_001035231 zinc finger protein 748 isoform 1 34 31 13 NM_019579 membrane protein palmitoylated 3 MAGUK p55 34 10 33 NM_172513 hypothetical protein LOC213056 34 10 33 NM_019919 latent transforming growth factor beta binding 34 23 20 NM_010657 human immunodeficiency virus type I enhancer 34 10 30 NM_010434 homeodomain interacting protein kinase 3 34 28 9 NM_026546 hypothetical protein LOC68073 34 26 11 NM_026643 hypothetical protein LOC103268 34 16 16 NM_130885 oxidation resistance 1 34 23 9 NM_029943 apurinic/apyrimidinic endonuclease 2 34 9 22 NM_008174 glutamate receptor metabotropic 8 34 3 23 NM_009027 RAS protein-specific guanine 34 12 12 NM_026164 intracellular membrane-associated 34 9 15 NM_013605 mucin 1 transmembrane 34 7 13 NM_027671 syntrophin gamma 1 34 12 3 NM_025349 LSM7 homolog U6 small nuclear RNA associated 34 11 3 NM_172762 RNA binding motif protein 34 34 7 6 NM_011616 CD40 ligand 33 773 34 NM_013795 ATP synthase H+ transporting, mitochondrial F0 33 479 48 NM_133728 asparagine synthetase domain containing 1 33 411 37 NM_001081066 DENN/MADD domain containing 3 33 341 24 NM_010325 glutamate oxaloacetate transaminase 2 33 252 64 NM_008576 ATP-binding cassette sub-family C, member 1 33 33 272 NM_011125 phospholipid transfer protein 33 260 30 NM_007926 small inducible cytokine subfamily E member 1 33 36 208 NM_009229 syntrophin basic 2 33 100 84 NM_198424 ORAI calcium release-activated calcium modulator 33 163 20 NM_027241 polymerase RNA III (DNA directed) polypeptide 33 151 18 NM_009831 cyclin G1 33 153 7 NM_029035 splA/ryanodine receptor domain and SOCS box 33 146 11 NM_016784 pleiotropic regulator 1 33 80 55 NM_029787 diaphorase 1 33 89 41 NM_178701 leucine rich repeat containing 8D 33 80 22 NM_001005223 zinc finger HIT type 3 33 69 31 NM_025784 BCS1-like 33 71 27 NM_172974 COP9 constitutive photomorphogenic homolog 33 76 21 NM_026341 nudix-type motif 13 33 66 29 NM_207214 exocyst complex component 5 33 68 25 NM_026327 hypothetical protein LOC67708 33 39 51 NM_018855 growth arrest specific 8 33 67 22 NM_054046 differentially expressed in FDCP 8 33 76 3 NM_024196 TBC1 domain family member 20 33 41 35 NM_010726 phytanoyl-CoA hydroxylase 33 57 17 NM_007635 cyclin G2 33 61 10 NM_001102407 RNA binding motif protein 8a isoform a 33 33 36 NM_025770 autophagy-related 10-like 33 48 19 NM_025902 CDGSH iron sulfur domain 2 33 12 53 NM_026213 tetratricopeptide repeat domain 33 33 14 48 NM_053124 SWI/SNF related matrix associated, actin 33 44 15 NM_009963 cryptochrome 2 photolyase-like 33 57 2 NM_010593 junction plakoglobin 33 32 26 NM_008439 ketohexokinase 33 31 26 NM_178932 amine oxidase copper containing 2 33 15 42 NM_145121 calcium channel voltage-dependent, beta 1 33 7 48 NM_015803 ATPase aminophospholipid transporter-like, 33 23 27 NM_172567 methyltransferase like 2 33 23 26 NM_178892 TCDD-inducible polyADP-ribose polymerase 33 26 19 NM_025897 hypothetical protein LOC101867 33 24 21 NM_029659 serine/threonine/tyrosine interacting-like 1 33 27 14 NM_145600 zinc finger protein 330 33 26 13 NM_198617 TSPY-like 3 33 29 9 NM_013684 TATA box binding protein 33 22 15 NM_175094 pyruvate dehydrogenase complex component X 33 12 21 NM_009781 calcium channel voltage-dependent, L type, 33 12 21 NM_010900 nuclear factor of activated T-cells 33 9 24 NM_009681 adaptor-related protein complex 3 sigma 1 33 22 10 NM_212449 hypothetical protein LOC270156 33 4 26 NM_172485 thrombospondin type I, domain containing 7B 33 8 21 NM_001007568 zinc finger protein 251 33 9 15 NM_008667 Ngfi-A binding protein 1 33 16 5 NM_007425 advanced glycosylation end product-specific 33 16 0 NM_009372 TG-interacting factor 33 3 12 NM_001033178 transmembrane protein 181 33 3 10 NM_152922 EGF-like domain 8 32 3449 218 NM_017373 nuclear factor interleukin 3, regulated 32 1076 321 NM_139269 HRAS like suppressor 3 32 302 50 NM_024438 dual specificity phosphatase 19 32 220 119 NM_009630 adenosine A2a receptor 32 224 114 NM_024266 ribosomal protein S25 32 277 43 NM_053108 glutaredoxin 32 269 20 NM_008813 ectonucleotide pyrophosphatase/phosphodiesterase 32 214 59 NM_028264 transmembrane protein 55A 32 216 10 NM_026812 HD domain containing 3 32 163 11 NM_011793 barrier to autointegration factor 1 32 125 28 NM_029734 hypothetical protein LOC76773 32 120 19 NM_011772 zinc finger protein subfamily 1A, 4 32 67 66 NM_019449 unc93 homolog B 32 99 25 NM_025666 hypothetical protein LOC66622 32 104 18 NM_013735 transformation related protein 53 binding 32 56 52 NM_134138 Clast3 protein 32 57 49 NM_172380 RIKEN cDNA 9630046K23 32 82 20 NM_010911 nitrogen fixation gene yeast homolog 1 32 66 32 NM_013841 vacuolar protein sorting 45 32 68 28 NM_133858 hypothetical protein LOC75007 32 59 37 NM_030750 sphingosine-1-phosphate phosphatase 1 32 72 22 NM_008377 leucine-rich repeats and immunoglobulin-like 32 65 22 NM_001044744 glutaryl-Coenzyme A dehydrogenase 32 60 22 NM_145567 3-hydroxyisobutyrate dehydrogenase precursor 32 60 15 NM_181540 transmembrane 6 superfamily member 2 32 50 26 NM_028347 nei endonuclease VIII-like 1 32 24 49 NM_178196 histone cluster 1 H2bg 32 47 22 NM_018817 Swi/SNF related matrix associated actin 32 59 9 NM_198937 hematological and neurological expressed 1-like 32 59 9 NM_019405 centrin 2 32 28 37 NM_173870 mannoside acetylglucosaminyltransferase 4 32 38 24 NM_011732 nuclease sensitive element binding protein 1 32 30 30 NM_178667 transcription factor Dp-2 32 41 18 NM_011275 ribonuclease H1 32 50 8 NM_133895 solute carrier family 15 member 4 32 33 23 NM_001004359 G protein-coupled receptor associated sorting 32 30 20 NM_001081420 hypothetical protein LOC230234 32 25 22 NM_080708 BMP2 inducible kinase 32 36 9 NM_029720 cysteine-rich with EGF-like domains 2 32 32 12 NM_021506 SH3 multiple domains 2 32 26 16 NM_144830 transmembrane protein 106A 32 33 6 NM_199304 zinc finger protein 341 32 20 17 NM_026995 hypothetical protein LOC69225 32 11 26 NM_001081756 Nck-associated protein 5 isoform 1 32 20 12 NM_172279 MAP/microtubule affinity-regulating kinase 4 32 9 20 NM_007439 anaplastic lymphoma kinase 32 24 5 NM_001045559 hypothetical protein LOC240067 32 15 12 NM_028002 dihydrouridine synthase 4-like 32 20 7 NM_029898 ankyrin repeat domain 55 32 2 20 NM_026481 tubulin polymerization-promoting protein family 32 1 20 NM_009365 transforming growth factor beta 1 induced 32 5 15 NM_026448 SBBI26 protein 32 11 9 NM_199476 ribonucleotide reductase M2 B TP53 inducible 32 5 13 NM_021408 usherin 32 10 8 NM_008892 polymerase DNA directed alpha 1 32 1 14 NM_009509 villin 1 32 5 8 NM_001109757 ATPase Cu++ transporting, alpha polypeptide 32 3 9 NM_008481 laminin alpha 2 32 2 9 NM_011074 PFTAIRE protein kinase 1 32 4 7 NM_001010973 histamine receptor H 2 isoform 1 32 1 9 NM_001081567 mitogen activated protein kinase 10 isoform 2 32 4 6 NM_001081205 NIPA-like domain containing 1 32 4 6 NM_177721 RAN binding protein 6 31 570 10 NM_025841 KDEL Lys-Asp-Glu-Leu endoplasmic reticulum 31 369 47 NM_001080928 recombining binding protein suppressor of 31 314 13 NM_007834 Down syndrome critical region protein 3 31 185 40 NM_028129 exonuclease NEF-sp isoform 2 31 197 26 NM_021557 retinol dehydrogenase 11 31 187 16 NM_026115 histone aminotransferase 1 31 5 177 NM_175460 nicotinamide nucleotide adenylyltransferase 2 31 143 36 NM_026646 solute carrier family 25 mitochondrial carrier 31 84 87 NM_008889 protein phosphatase 1 regulatory inhibitor 31 118 52 NM_010749 mannose-6-phosphate receptor cation dependent 31 140 26 NM_177906 opioid binding protein/cell adhesion 31 97 32 NM_028244 ribosomal RNA processing 1 homolog B 31 77 43 NM_026407 transmembrane protein 39a 31 90 26 NM_028769 synovial apoptosis inhibitor 1 synoviolin 31 84 26 NM_080837 hypothetical protein LOC28106 31 72 36 NM_020580 TH1 homolog 31 81 26 NM_019725 transducin-like enhancer protein 2 31 82 24 NM_027777 peroxin1 31 82 23 NM_029775 DCN1 defective in cullin neddylation 1, domain 31 103 0 NM_033612 elastase 1 pancreatic 31 81 22 NM_009069 Ras-like without CAAX 1 31 96 6 NM_001026211 translocase of the inner mitochondrial membrane 31 82 17 NM_146247 hypothetical protein LOC239706 31 68 25 NM_008976 protein tyrosine phosphatase non-receptor type 31 67 24 NM_011155 protein phosphatase 5 catalytic subunit 31 73 15 NM_145585 THUMP domain containing 1 31 73 14 NM_133792 lysophospholipase 3 31 51 29 NM_009517 wild-type p53-induced gene 1 31 68 3 NM_011405 solute carrier family 7 cationic amino acid 31 56 13 NM_024428 dosage compensation-related protein DPY30 31 44 20 NM_028276 UTP14 U3 small nucleolar ribonucleoprotein, 31 19 43 NM_026962 kelch repeat and BTB POZ domain containing 3 31 12 43 NM_033620 partitioning-defective protein 3 homolog isoform 31 15 36 NM_029869 zinc finger protein 36 isoform 2 31 41 9 NM_001007581 hypothetical protein LOC381406 31 9 42 NM_172688 mitogen-activated protein kinase kinase kinase 31 36 14 NM_019685 RuvB-like protein 1 31 19 30 NM_008822 peroxisome biogenesis factor 7 31 16 31 NM_019505 diacylglycerol kinase epsilon 31 41 6 NM_021434 G protein-coupled receptor 180 31 28 18 NM_146097 dopamine-responsive protein 31 5 39 NM_011372 ST6 31 15 28 NM_052993 core 1 synthase 31 20 21 NM_009281 zinc finger protein 143 31 27 14 NM_175151 TatD DNase domain containing 1 31 19 20 NM_146169 polyA binding protein interacting protein 2B 31 27 12 NM_030096 DEAD Asp-Glu-Ala-Asp box polypeptide 52 31 18 20 NM_026963 leucine zipper and CTNNBIP1 domain containing 31 29 7 NM_008513 low density lipoprotein receptor-related protein 31 11 25 NM_173747 G patch domain and KOW motifs 31 18 16 NM_173034 zinc finger protein 398 isoform 2 31 18 14 NM_001014973 sorting nexin 13 31 2 30 NM_172803 dedicator of cytokinesis 4 31 10 22 NM_172753 RIKEN cDNA 4732435N03 31 22 9 NM_178869 tubulin tyrosine ligase-like 1 31 19 11 NM_177670 transmembrane protein 69 31 23 6 NM_001040684 hydroxy-delta-5-steroid dehydrogenase 3 beta- 31 15 9 NM_001044703 zinc finger proliferation 1 31 7 17 NM_029045 hypothetical protein LOC74666 31 3 13 NM_175111 Hspb associated protein 1 31 9 5 NM_148927 pleckstrin homology domain-containing family A 31 9 4 NM_025923 Fanconi anemia complementation group L 31 2 2 NM_009914 CC chemokine receptor 3 30 104 511 NM_025326 hepatocellular carcinoma-associated antigen 112 30 416 50 NM_001034085 protein phosphatase 2 formerly 2A regulatory 30 53 266 NM_026161 C1q and tumor necrosis factor related protein 4 30 247 26 NM_024214 translocase of outer mitochondrial membrane 20 30 247 10 NM_028431 mitochondrial processing peptidase beta subunit 30 139 43 NM_206924 jumping translocation breakpoint 30 173 9 NM_001042484 golgi autoantigen golgin subfamily a, 7 30 167 14 NM_172733 deoxyribose-phosphate aldolase-like 30 134 34 NM_172149 BCL2/adenovirus E1B interacting protein 1 NIP1 30 94 45 NM_178637 HIV-1 tat interactive protein homolog 30 34 88 NM_175164 Rho GTPase activating protein 26 30 86 34 NM_198942 DEAH Asp-Glu-Ala-Asp/His box polypeptide 57 30 74 45 NM_011342 SEC22 vesicle trafficking protein-like 1 30 98 20 NM_027896 Coenzyme A synthase 30 9 108 NM_009455 ubiquitin-conjugating enzyme E2E 1 UBC4/5 30 3 108 NM_181584 growth factor receptor bound protein 30 110 1 NM_020006 CDC42 effector protein Rho GTPase binding 4 30 95 13 NM_144958 eukaryotic translation initiation factor 4A1 30 77 30 NM_182994 ADP-ribosylation factor-like 5 30 80 24 NM_144948 RNA binding motif protein 7 30 62 39 NM_007996 ferredoxin 1 30 54 41 NM_183086 mitochondrial ribosomal protein S10 30 40 54 NM_130881 polyA binding protein cytoplasmic 4 isoform 30 76 14 NM_027412 tetratricopeptide repeat domain 9C 30 59 29 NM_145475 ceramide kinase 30 32 53 NM_019995 hypothetical protein LOC56790 30 52 29 NM_001039126 ankyrin repeat and SOCS box-containing protein 1 30 57 23 NM_028794 nudix nucleoside diphosphate linked moiety 30 60 19 NM_001042501 hypothetical protein LOC68152 30 15 59 NM_025454 inhibitor of growth family member 5 30 53 21 NM_133833 dystonin isoform a 30 38 36 NM_023633 RIKEN cDNA 2410016O06 30 26 44 NM_018889 phosphatidylinositol glycan anchor biosynthesis 30 27 42 NM_027371 brix domain containing 5 isoform 2 30 29 28 NM_183140 zinc finger protein 691 30 28 27 NM_177594 myotubularin related protein 9 30 31 23 NM_008477 kinectin 1 30 22 32 NM_001033156 F-box protein 33 30 27 24 NM_153577 hypothetical protein LOC233066 30 28 17 NM_145546 general transcription factor IIB 30 32 10 NM_207301 tryptophan rich basic protein 30 11 31 NM_026368 hypothetical protein LOC67770 30 17 25 NM_008765 origin recognition complex subunit 2-like 30 9 33 NM_146219 hypothetical protein LOC234796 30 15 24 NM_001081282 inhibitor of Bruton's tyrosine kinase 30 20 16 NM_172594 DEAH Asp-Glu-Ala-His box polypeptide 29 30 20 16 NM_024166 coiled-coil-helix-coiled-coil-helix domain 30 26 9 NM_027570 D-lactate dehydrogenase 30 0 34 NM_172729 nucleotide-binding oligomerization domain 30 12 22 NM_172773 solute carrier family 17 anion/sugar 30 8 26 NM_019635 serine/threonine kinase 3 Ste20 yeast homolog 30 20 9 NM_010822 N-methylpurine-DNA glycosylase 30 3 26 NM_007544 BH3 interacting domain death agonist 30 25 3 NM_026232 solute carrier family 25 member 30 30 4 22 NM_028719 copine IV 30 17 8 NM_053157 TM2 domain containing 1 precursor 30 17 5 NM_175546 WD repeat and FYVE domain containing 2 30 0 22 NM_009056 regulatory factor X 2 influences HLA class II 30 15 4 NM_053180 cell cycle related kinase 30 13 5 NM_010424 hemochromatosis 30 9 8 NM_177368 transmembrane and tetratricopeptide repeat 30 3 12 NM_026324 membrane protein mKirre 30 3 6 NM_001039652 opioid receptor mu 1 30 3 4 NM_029096 hypothetical protein LOC100764 30 0 6 NM_030070 leucine rich repeat containing 9 30 4 1 NM_133921 ovarian zinc finger protein 30 1 0 NM_001080816 chitinase like 29 1792 36 NM_011521 syndecan 4 29 198 498 NM_008372 interleukin 7 receptor precursor 29 222 50 NM_027101 polymerase RNA II (DNA directed) polypeptide D 29 230 16 NM_011664 ubiquitin B 29 230 15 NM_145367 thioredoxin domain containing 5 29 168 62 NM_134142 transmembrane protein 109 29 197 31 NM_001080968 golgi autoantigen golgin subfamily a, 2 isoform 29 219 4 NM_025318 transmembrane protein 93 29 197 19 NM_172950 lipin 1 isoform a 29 69 127 NM_053178 acyl-CoA synthetase bubblegum family member 1 29 127 56 NM_013885 chloride intracellular channel 4 29 54 126 NM_007563 23-bisphosphoglycerate mutase 29 104 49 NM_027644 testis-specific serine protease 1 29 13 137 NM_053173 kinesin family member C1 29 124 18 NM_177992 guanosine monophosphate reductase 2 29 11 125 NM_010654 killer cell lectin-like receptor subfamily D, 29 124 8 NM_008020 FK506 binding protein 2 29 112 10 NM_026217 autophagy-related 12-like 29 82 34 NM_011835 katanin p60 ATPase-containing subunit A1 29 95 12 NM_011638 transferrin receptor 29 71 34 NM_011618 troponin T1 skeletal, slow 29 26 76 NM_029499 membrane-spanning 4-domains subfamily A, member 29 61 40 NM_029777 rhomboid domain containing 1 29 47 53 NM_153114 otospiralin 29 47 46 NM_025423 hypothetical protein LOC66206 29 83 8 NM_025461 hypothetical protein LOC66272 29 38 47 NM_023483 hypothetical protein LOC68721 29 31 50 NM_198011 hypothetical protein LOC101604 29 65 15 NM_021305 Sec61 alpha subunit 2 29 22 55 NM_021372 transcriptional regulator interacting with the 29 58 17 NM_026622 hypothetical protein LOC269423 29 28 44 NM_177692 reduced pigmentation protein 29 58 10 NM_021428 dexamethasone-induced protein 29 58 9 NM_028115 TruB pseudouridine psi synthase homolog 1 29 61 5 NM_001077694 dysferlin isoform 2 29 23 43 NM_133880 platelet-activating factor acetylhydrolase 2 29 57 8 NM_029653 death associated protein kinase 1 29 56 7 NM_172599 hypothetical protein LOC218978 29 37 22 NM_001013577 hypothetical protein LOC66209 29 45 10 NM_133787 NMD3 homolog 29 45 8 NM_133797 hypothetical protein LOC97820 29 41 11 NM_009817 calpastatin 29 34 14 NM_028976 Golgi reassembly stacking protein 1 29 31 17 NM_133891 solute carrier family 44 member 1 29 28 15 NM_183115 coiled-coil domain containing 125 29 31 9 NM_007386 aconitase 1 29 19 21 NM_175550 adaptor-related protein complex AP-4 epsilon 1 29 12 26 NM_029619 methionine sulfoxide reductase B2 29 18 20 NM_001033263 centaurin gamma 1 29 13 21 NM_029556 citrate lyase beta like 29 18 15 NM_015728 solute carrier family 33 acetyl-CoA 29 31 2 NM_008838 phosphatidylinositol glycan anchor biosynthesis 29 23 8 NM_026111 glutaminyl-peptide cyclotransferase-like 29 11 19 NM_198105 hypothetical protein LOC207375 29 19 9 NM_198092 ubiquitin-specific protease 2 isoform Usp2-69 29 16 12 NM_007624 chromobox homolog 3 29 14 14 NM_027534 follicular lymphoma variant translocation 1 29 3 24 NM_172910 SAP90/PSD-95 associated protein 2 29 10 13 NM_024254 hypothetical protein LOC72425 29 9 14 NM_011263 RE1-silencing transcription factor 29 9 13 NM_177275 adhesion molecule with Ig like domain 3 29 4 15 NM_028915 leucine rich repeat and coiled-coil domain 29 2 14 NM_029548 rabphilin 3A-like without C2 domains 29 0 12 NM_018790 activity regulated cytoskeletal-associated 29 1 10 NM_026352 peptidylprolyl isomerase D 29 10 0 NM_153074 leucine rich repeat containing 25 29 1 3 NM_020001 C-type lectin domain family 4 member n 29 1 1 NM_013667 solute carrier family 22 member 2 28 311 63 NM_011865 polyrC binding protein 1 28 347 13 NM_001013365 oncostatin M 28 310 21 NM_008255 3-hydroxy-3-methylglutaryl-Coenzyme A reductase 28 259 17 NM_009119 Sin3-associated polypeptide 18 28 215 21 NM_024270 MLN64 N-terminal homolog 28 184 43 NM_001025102 hypothetical protein LOC212772 28 166 47 NM_017401 polymerase DNA directed mu 28 179 30 NM_019939 membrane protein palmitoylated 3 MAGUK p55 28 180 19 NM_029572 thioredoxin domain containing 4 28 153 19 NM_013730 signaling lymphocytic activation molecule family 28 141 25 NM_009093 ribosomal protein S29 28 117 26 NM_026318 Huntingtin interacting protein K 28 99 27 NM_001081032 hypothetical protein LOC667977 28 84 37 NM_009003 RAB4A member RAS oncogene family 28 34 75 NM_007881 dentatorubral pallidoluysian atrophy 28 82 22 NM_133838 EH-domain containing 4 28 86 16 NM_031375 neugrin 28 61 41 NM_009266 selenophosphate synthetase 2 28 93 9 NM_011289 ribosomal protein L27 28 93 7 NM_001112729 hypothetical protein LOC234138 28 40 55 NM_001001295 DIS3 mitotic control homolog S. 28 58 36 NM_138592 ubiquitin specific peptidase 39 28 71 19 NM_173033 hypothetical protein LOC272027 28 71 12 NM_197992 polycomb group ring finger 1 28 73 9 NM_013531 guanine nucleotide-binding protein beta-4 28 10 71 NM_008399 integrin alpha E, epithelial-associated isoform 28 44 36 NM_030017 retinol dehydrogenase 12 28 67 9 NM_153808 structural maintenance of chromosomes 5 28 38 36 NM_011699 lin 7 homolog c 28 52 21 NM_021430 Rab interacting lysosomal protein-like 1 28 15 54 NM_178672 sec1 family domain containing 2 isoform b 28 28 35 NM_198653 isoleucine-tRNA synthetase 2 mitochondrial 28 12 48 NM_010022 dihydrolipoamide branched chain transacylase E2 28 24 30 NM_001039482 kelch-like 20 28 39 15 NM_178640 UDP-GalNAc:betaGlcNAc beta 28 33 19 NM_026425 N-acetyltransferase 5 ARD1 homolog S. 28 16 36 NM_153525 transmembrane protein 41B 28 40 11 NM_153566 yrdC domain containing 28 17 31 NM_178187 histone cluster 1 H2ae 28 14 34 NM_011929 chloride channel 6 28 34 13 NM_023626 inhibitor of growth family member 3 28 28 19 NM_015733 caspase 9 28 34 12 NM_008708 N-myristoyltransferase 2 28 41 5 NM_023348 GS32 protein 28 25 20 NM_009881 chromodomain protein Y chromosome-like 28 40 4 NM_008187 gene trap locus 3 28 15 27 NM_001110209 lunapark isoform b 28 16 26 NM_001081549 calcipressin 1 isoform 1 28 11 30 NM_173032 hypothetical protein LOC271981 28 19 21 NM_021464 protein tyrosine phosphatase receptor type, T 28 12 28 NM_145990 CDK5 regulatory subunit associated protein 2 28 28 9 NM_025959 proteasome 26S ATPase subunit 6 28 4 32 NM_001081351 hypothetical protein LOC214642 28 5 27 NM_007611 caspase 7 28 18 14 NM_177003 RIKEN cDNA 9630033F20 gene 28 20 11 NM_178782 BCL6 co-repressor-like 1 28 1 28 NM_198860 hypothetical protein LOC192734 28 8 22 NM_001110017 DAZ interacting protein 3 zinc finger isoform 28 24 4 NM_001081415 sterile alpha motif domain containing 1 28 25 2 NM_027859 ring finger protein 215 28 10 16 NM_024260 coiled-coil domain containing 132 28 10 16 NM_001033475 transmembrane emp24 domain containing 8 28 20 4 NM_173399 zinc finger and BTB domain containing 5 28 19 5 NM_001004176 mastermind-like 3 28 15 9 NM_025854 CBF1 interacting corepressor 28 12 10 NM_001081152 nuclear protein in the AT region 28 15 6 NM_145923 RELT-like 1 28 15 6 NM_028982 hypothetical protein LOC74525 28 2 16 NM_001039214 ring finger and KH domain containing 2 28 0 17 NM_175026 pyrin and HIN domain family member 1 28 14 1 NM_030557 myoneurin 28 5 9 NM_009981 phosphate cytidylyltransferase 1 choline, alpha 28 10 5 NM_172683 pogo transposable element with ZNF domain 28 4 4 NM_147155 T-cell activation GTPase activating protein 1 28 1 7 NM_007937 Eph receptor A5 28 1 7 NM_175155 SAM and SH3 domain containing 1 28 2 2 NM_138951 hypothetical protein LOC192653 28 1 2 NM_170758 CD300A antigen 28 0 3 NM_172832 prenylcysteine oxidase 1 like 28 1 0 NM_008969 prostaglandin-endoperoxide synthase 1 28 4067 24 NM_028133 EGL nine homolog 3 28 1913 9 NM_001110850 cAMP responsive element modulator isoform 4 28 332 1054 NM_009402 peptidoglycan recognition protein 1 28 459 8 NM_007681 centromere protein A 28 154 16 NM_026506 small nuclear ribonucleoprotein polypeptide G 28 104 45 NM_031196 solute carrier family 19 sodium/hydrogen 28 116 26 NM_181415 attractin-like 1 28 104 27 NM_013469 annexin A11 28 97 35 NM_019651 protein tyrosine phosphatase non-receptor type 28 117 12 NM_026422 mitochondrial ribosome recycling factor 28 66 60 NM_021714 WW domain binding protein 11 28 110 14 NM_028314 hypothetical protein LOC72658 28 98 26 NM_029437 cytoskeleton associated protein 5 28 57 60 NM_023912 SCY1-like 1 28 14 94 NM_018784 alpha23-sialyltransferase VI 28 76 31 NM_019996 RNA U small nuclear RNA export adaptor 28 86 21 NM_007452 peroxiredoxin 3 28 75 25 NM_025635 ZW10 interacting protein-1 28 62 29 NM_026044 WD40 repeat domain 85 28 30 58 NM_199035 alpha-13-glucosyltransferase ALG8 28 70 14 NM_001037719 B and T lymphocyte associated isoform 1 28 56 26 NM_146001 huntingtin interacting protein 1 28 47 32 NM_177327 WW domain-containing protein 1 28 42 30 NM_009190 vacuolar protein sorting 4b 28 61 6 NM_009678 adaptor protein complex AP-1 mu 2 subunit 28 28 39 NM_172605 tudor domain containing 3 28 34 29 NM_001111028 potassium channel tetramerisation domain 28 18 43 NM_023197 hypothetical protein LOC66356 28 31 26 NM_001081008 TAF1 RNA polymerase II TATA box binding protein 28 30 26 NM_181517 importin 7 28 9 45 NM_010569 inversin 28 12 42 NM_175565 carnitine deficiency-associated gene expressed 28 12 41 NM_145618 NMDA receptor-regulated gene 2 28 32 19 NM_009454 ubiquitin-conjugating enzyme E2E 3 UBC4/5 28 41 6 NM_144833 zinc finger protein 410 28 22 24 NM_025722 hypothetical protein LOC66714 28 38 8 NM_020577 arsenic +3 oxidation state methyltransferase 28 26 18 NM_181649 coiled-coil domain containing 75 28 4 37 NM_025718 deoxyribonuclease 1-like 2 28 1 39 NM_011891 sarcoglycan delta dystrophin-associated 28 17 22 NM_146151 testis-specific kinase 2 28 14 25 NM_013588 leucine-rich B7 protein 28 7 31 NM_008074 gamma-aminobutyric acid GABA-A receptor 28 26 9 NM_008799 programmed cell death 2 28 17 17 NM_027698 exonuclease domain containing 1 28 23 10 NM_013861 thiamine pyrophosphokinase 28 10 22 NM_028576 hypothetical protein LOC73582 28 8 23 NM_173364 zinc finger protein 445 28 8 23 NM_177788 exocyst complex component 3-like 28 22 9 NM_138757 hypothetical protein LOC71177 28 1 28 NM_172409 formin-like domain containing protein MAN 28 14 14 NM_177899 hypothetical protein LOC330788 28 19 6 NM_172809 sacsin 28 20 4 NM_054054 bromodomain testis-specific isoform A 28 11 12 NM_001109749 contactin 4 isoform 1 28 3 20 NM_030014 hook homolog 1 28 18 5 NM_026507 Zwilch 28 8 12 NM_011215 protein tyrosine phosphatase receptor type, N 28 7 13 NM_001037925 hypothetical protein LOC625360 28 7 13 NM_146144 ubiquitin specific peptdiase 1 28 0 19 NM_026056 CAP adenylate cyclase-associated protein, 2 28 4 14 NM_001081199 MAM domain containing 4 28 7 10 NM_176917 methyltransferase like 4 28 10 7 NM_178218 histone cluster 3 H2a 28 7 9 NM_001111096 Yamaguchi sarcoma viral v-yes-1 oncogene 28 4 10 NM_144942 cysteine sulfinic acid decarboxylase 28 9 5 NM_053117 par-6 partitioning defective 6 homolog gamma 28 7 6 NM_010208 proto-oncogene tyrosine-protein kinase Fgr 28 1 9 NM_019868 heterogeneous nuclear ribonucleoprotein H2 28 3 7 NM_177911 transglutaminase 4 prostate 28 3 7 NM_001025600 immunoglobulin superfamily member 4A isoform d 28 1 4 NM_001029872 integrin alpha D 27 3489 29 NM_009128 stearoyl-Coenzyme A desaturase 2 27 510 26 NM_008567 minichromosome maintenance complex component 6 27 416 8 NM_007971 enhancer of zeste homolog 2 27 373 33 NM_007476 ADP-ribosylation factor 1 27 299 58 NM_001048177 Janus kinase 2 27 283 14 NM_130860 cyclin-dependent kinase 9 27 173 65 NM_001085390 dual specificity phosphatase 5 27 184 21 NM_010193 feminization 1 homolog b 27 162 26 NM_017475 small GTPase homolog 27 137 50 NM_144527 coiled-coil domain containing 21 27 159 19 NM_021604 agrin 27 143 25 NM_008384 inositol polyphosphate-1-phosphatase 27 152 5 NM_020258 solute carrier family 37 glycerol-3-phosphate 27 44 92 NM_013796 N-acetylglucosamine-1-phosphodiester 27 105 17 NM_007908 eukaryotic elongation factor-2 kinase 27 88 18 NM_021337 superkiller viralicidic activity 2-like 27 73 24 NM_153387 gamma tubulin ring complex protein 27 80 16 NM_010831 SNF1-like kinase 27 12 66 NM_175180 WD repeat domain 44 27 65 13 NM_145606 chromatin modifying protein 1A 27 57 19 NM_026014 chromatin licensing and DNA replication factor 27 62 12 NM_009937 collagen-like tail subunit single strand of 27 61 13 NM_026131 PDZ and LIM domain 7 isoform c 27 55 19 NM_016792 thioredoxin-like 1 27 66 4 NM_019772 small acidic protein 27 13 56 NM_001048145 hypothetical protein LOC668110 isoform 1 27 58 9 NM_009740 B-cell leukemia/lymphoma 10 27 52 10 NM_145959 hypothetical protein LOC210998 27 46 12 NM_201359 transmembrane protein 106C 27 31 25 NM_008378 imprinted and ancient 27 15 40 NM_198246 tyrosyl-tRNA synthetase 2 mitochondrial 27 41 13 NM_175123 hypothetical protein LOC228356 27 7 46 NM_009568 zinc finger protein 94 27 29 20 NM_134089 PDZ-domain protein scribble 27 36 12 NM_028658 RIKEN cDNA 1110018J12 27 14 31 NM_029017 mitochondrial ribosomal protein L47 27 40 3 NM_011213 protein tyrosine phosphatase receptor type, F 27 25 18 NM_016706 coilin 27 23 19 NM_178612 canopy 4 homolog 27 10 30 NM_001079844 glypican 6 isoform 1 27 24 14 NM_023644 methylcrotonoyl-Coenzyme A carboxylase 1 27 25 13 NM_010049 dihydrofolate reductase 27 5 29 NM_145571 Mob4B protein 27 26 9 NM_134048 Casitas B-lineage lymphoma-like 1 27 8 26 NM_001001798 Atpase class VI, type 11C isoform b 27 23 10 NM_011568 THO complex 4 27 12 19 NM_008984 protein tyrosine phosphatase receptor type, M 27 1 29 NM_172508 dermatan sulfate epimerase 27 25 5 NM_019731 nucleoside diphosphate kinase 4 27 8 22 NM_175500 glypican 5 27 8 16 NM_172821 mitogen-activated protein kinase kinase kinase 27 22 2 NM_012000 ceroid-lipofuscinosis neuronal 8 27 17 6 NM_009196 solute carrier family 16 member 1 27 8 15 NM_001081259 feline leukemia virus subgroup C cellular 27 12 9 NM_027144 Rho guanine nucleotide exchange factor 12 27 7 9 NM_001081037 SLIT-ROBO Rho GTPase activating protein 1 27 10 4 NM_001033385 hypothetical protein LOC544696 27 8 0 NM_172550 hypothetical protein LOC216119 27 0 6 NM_172262 amine oxidase flavin containing 1 27 2 3 NM_011261 reelin precursor 27 1 4 NM_001098225 a disintegrin and metalloprotease domain 22 26 779 125 NM_025385 proline rich 13 26 301 0 NM_021546 N-terminal EF-hand calcium binding protein 3 26 269 19 NM_007712 CDC-like kinase 2 26 260 10 NM_011231 RAB geranylgeranyl transferase b subunit 26 184 36 NM_145354 NOL1/NOP2/Sun domain family 2 26 182 26 NM_001098810 Bcl-2 inhibitor of transcription isoform b 26 185 16 NM_010813 max binding protein 26 134 59 NM_145375 transmembrane 6 superfamily member 1 26 140 40 NM_026598 emopamil binding protein-like 26 151 11 NM_001033310 COX18 cytochrome c oxidase assembly homolog 26 111 48 NM_008750 nucleoredoxin 26 133 24 NM_027590 integrator complex subunit 10 26 112 43 NM_009838 chaperonin subunit 6a zeta 26 128 17 NM_010283 glycoprotein galactosyltransferase alpha 1 3 26 128 12 NM_027008 potassium channel tetramerisation domain 26 97 32 NM_027109 deoxyribonuclease 1-like 1 26 82 46 NM_001111277 eukaryotic translation initiation factor 2B 26 41 85 NM_134054 hypothetical protein LOC104725 26 83 40 NM_027270 exocyst complex component 1 26 89 25 NM_145542 S-adenosylhomocysteine hydrolase-like 1 26 96 16 NM_001033136 hypothetical protein LOC67809 26 45 66 NM_007760 carnitine acetyltransferase 26 50 55 NM_027539 doublecortin-like kinase 2 26 86 13 NM_030210 acetoacetyl-CoA synthetase 26 14 81 NM_001042407 peroxisome biogenesis factor 10 26 39 54 NM_028521 phosphatase orphan 2 26 81 9 NM_199301 GTP binding protein 7 putative 26 66 21 NM_026343 syntaxin 17 26 57 27 NM_029279 SECIS binding protein 2 26 15 68 NM_025800 protein phosphatase 1 regulatory inhibitor 26 52 31 NM_013719 eukaryotic translation initiation factor 2 alpha 26 63 15 NM_134046 centromere protein O 26 42 30 NM_172741 hypothetical protein LOC233103 26 43 24 NM_001033291 ubiquitin specific peptidase 40 26 20 46 NM_001081128 5-methyltetrahydrofolate-homocysteine 26 31 35 NM_173785 hypothetical protein LOC216792 26 29 34 NM_001024622 PEST proteolytic signal containing nuclear 26 37 26 NM_153591 asparaginyl-tRNA synthetase 2 26 34 26 NM_178607 ring finger protein 24 26 44 14 NM_025907 methyltransferase like 6 26 28 30 NM_011361 serum/glucocorticoid regulated kinase 1 26 48 9 NM_025602 coiled-coil domain containing 59 26 8 47 NM_172435 purinergic receptor P2Y G-protein coupled 10 26 38 17 NM_172650 potassium channel tetramerisation domain 26 42 12 NM_001042673 Fanconi anemia complementation group C 26 17 37 NM_173036 G protein-coupled receptor 97 26 45 7 NM_009560 zinc finger protein 60 26 22 30 NM_023587 protein tyrosine phosphatase-like protein PTPLB 26 31 20 NM_198609 ribosomal protein L24-like 26 29 21 NM_001037938 NADPH-dependent retinol dehydrogenase/reductase 26 15 34 NM_008957 patched 26 29 16 NM_030246 WD repeat domain 21 26 26 17 NM_025372 timeless interacting protein 26 30 12 NM_026402 autophagy Apg3p/Aut1p-like 26 11 29 NM_001013387 zinc finger protein 182 26 22 17 NM_001038635 serine/threonine kinase 35 isoform b 26 14 24 NM_177115 membrane-associated RING-CH protein III 26 22 16 NM_001037906 protein kinase C-binding protein NELL1 26 11 26 NM_001081374 protease serine, 36 26 13 24 NM_008734 neuregulin 3 26 3 33 NM_173756 lin-52 homolog 26 24 11 NM_177386 Scm-like with four mbt domains 2 26 11 24 NM_001033472 hypothetical protein LOC382252 26 8 26 NM_008288 hydroxysteroid 11-beta dehydrogenase 1 26 8 26 NM_177687 cAMP responsive element binding protein-like 2 26 5 27 NM_153589 transmembrane protein 16B 26 5 27 NM_033325 lysyl oxidase-like 2 26 24 9 NM_024467 zinc finger protein 319 26 13 17 NM_145964 hypothetical protein LOC211556 26 19 10 NM_001081091 centrosomal protein 152 26 17 12 NM_029852 coiled-coil domain containing 41 26 4 25 NM_029094 phosphatidylinositol 3-kinase catalytic, beta 26 22 5 NM_175118 dual specificity phosphatase 28 26 10 14 NM_008729 catenin cadherin associated protein delta 2 26 10 12 NM_133252 translocating chain-associating membrane protein 26 3 17 NM_026637 hypothetical protein LOC68252 26 12 7 NM_007477 ADP-ribosylation factor 2 26 7 8 NM_145398 CAS1 domain containing 1 26 5 7 NM_010321 glycine N-methyltransferase 26 4 8 NM_145483 zinc finger protein 160 26 3 9 NM_001014836 hypothetical protein LOC432479 26 2 9 NM_175115 IKAROS family zinc finger 5 26 3 8 NM_175140 carbohydrate N-acetylgalactosamine 4-0 26 5 4 NM_001081073 centrosomal protein 76 26 1 8 NM_172849 hypothetical protein LOC241134 26 3 4 NM_178722 zinc finger protein 438 26 4 0 NM_172879 hypothetical protein LOC242838 26 0 3 NM_138665 sarcosine dehydrogenase 26 0 2 NM_183319 X Kell blood group precursor related X linked 25 2313 29 NM_030696 solute carrier family 16 member 3 25 1915 3 NM_013509 enolase 2 gamma neuronal 25 313 44 NM_025474 mitochondrial ribosomal protein S14 25 313 37 NM_024206 SEC13-like 1 25 346 1 NM_001033458 hypothetical protein LOC381633 25 162 27 NM_025776 RNA binding motif protein 22 25 150 33 NM_138743 hypothetical protein LOC68936 25 131 26 NM_010567 inositol polyphosphate phosphatase-like 1 25 125 24 NM_138590 zinc finger CCHC domain containing 7 25 131 15 NM_026528 hypothetical protein LOC68045 25 116 28 NM_001001184 coiled-coil domain containing 111 25 95 32 NM_177678 actin-binding LIM protein 2 25 14 112 NM_001039546 myosin VI 25 122 3 NM_010755 v-maf musculoaponeurotic fibrosarcoma oncogene 25 111 12 NM_009448 tubulin alpha 1C 25 109 8 NM_020044 linker for activation of T cells family member 25 109 6 NM_025595 mitochondrial ribosomal protein L51 25 79 29 NM_009298 surfeit gene 6 25 37 68 NM_001033228 integrin alpha 1 25 67 30 NM_011893 SH3-domain binding protein 2 25 75 17 NM_008292 hydroxysteroid 17-beta dehydrogenase 4 25 73 18 NM_178613 hypothetical protein LOC66787 25 47 36 NM_010751 MAX dimerization protein 1 25 52 30 NM_011420 survival motor neuron 1 25 39 43 NM_172630 metallophosphoesterase 1 25 72 9 NM_025450 mitochondrial ribosomal protein S17 25 67 9 NM_001081213 endoplasmic reticulum metallopeptidase 1 25 51 22 NM_019822 adhesion regulating molecule 1 25 14 57 NM_175534 G protein-coupled receptor MrgE 25 55 13 NM_178761 zinc finger protein 672 25 62 5 NM_009413 tumor protein D52-like 1 25 34 31 NM_144881 hedgehog acyltransferase 25 17 46 NM_001081357 mitogen-activated protein kinase kinase kinase 25 45 18 NM_173783 melanoma antigen family B 18 25 10 53 NM_016893 fucosyltransferase 8 25 44 16 NM_138654 hypothetical protein LOC192136 25 16 41 NM_015791 F-box protein 8 25 43 12 NM_008839 phosphatidylinositol 3-kinase catalytic, alpha 25 46 9 NM_026192 calcium binding and coiled coil domain 1 25 32 22 NM_028042 excision repaiross-complementing rodent repair 25 44 7 NM_007723 cyclic nucleotide gated channel alpha 1 25 31 19 NM_013685 transcription factor 4 isoform a 25 27 23 NM_015751 ATP-binding cassette subfamily E, member 1 25 18 29 NM_031249 cleavage stimulation factor 3' pre-RNA subunit 25 32 14 NM_027436 mitochondrial intermediate peptidase 25 26 18 NM_025924 UPF3 regulator of nonsense transcripts homolog 25 9 34 NM_178721 immunoglobulin superfamily member 4D 25 34 7 NM_181423 suppressor of var1 3-like 1 25 31 9 NM_028355 transmembrane protein 48 25 14 26 NM_011856 odd Oz/ten-m homolog 2 isoform 1 25 14 26 NM_178017 high mobility group box 2-like 1 25 19 19 NM_001005247 Hermansky-Pudlak syndrome 5 isoform 1 25 9 29 NM_146027 secernin 2 25 23 13 NM_017395 regulatory factor X 5 25 20 15 NM_027919 threonine aldolase 1 25 24 11 NM_001045807 RNA binding motif protein 15 25 23 10 NM_133223 RAS-related C3 botulinum substrate 3 25 28 5 NM_133854 SNAP-associated protein 25 10 23 NM_172876 G patch domain containing 3 25 15 17 NM_026181 G patch domain containing 1 25 19 12 NM_025647 UMP-CMP kinase 25 18 12 NM_134029 5'3'-nucleotidase, mitochondrial 25 23 8 NM_001099319 hypothetical protein LOC100039968 25 19 10 NM_027275 Pentatricopeptide repeat domain 3 25 22 7 NM_025888 potassium channel tetramerisation domain 25 10 18 NM_011070 prefoldin 2 25 8 20 NM_145218 UDP-GalNAc:polypeptide 25 12 14 NM_027654 polycomb group ring finger 6 25 3 23 NM_007684 centrin 3 25 26 0 NM_024263 matrix-remodelling associated 8 25 8 18 NM_053253 zinc finger MYND domain-containing 10 25 7 17 NM_027398 Kv channel-interacting protein 1 25 2 21 NM_183027 adaptor-related protein complex AP-1 sigma 3 25 9 12 NM_178744 zinc finger and BTB domain containing 1 25 12 9 NM_181541 caprin family member 2 25 14 6 NM_173445 RCC1 domain containing 1 25 5 14 NM_001010833 mediator of DNA damage checkpoint 1 25 10 9 NM_025707 BTB POZ domain containing 5 25 1 16 NM_031255 radial spokehead-like 1 25 3 13 NM_175446 zinc finger matrin type 1 25 5 10 NM_146241 TRH-degrading enzyme 25 12 3 NM_026486 tectonic family member 2 25 9 6 NM_153807 acyl-CoA synthetase family member 2 25 7 8 NM_172653 solute carrier family 39 zinc transporter 25 10 3 NM_001081272 similar to low density lipoprotein receptor A 25 7 5 NM_001113198 microphthalmia-associated transcription factor 25 2 8 NM_181585 phosphatidylinositol 3 kinase regulatory 25 3 5 NM_029788 RIKEN cDNA 0610013E23 25 2 4 NM_001033460 hypothetical protein LOC381738 25 0 0 NM_011426 sialoadhesin 24 1988 17 NM_011400 solute carrier family 2 facilitated glucose 24 439 9 NM_010191 farnesyl diphosphate farnesyl transferase 1 24 395 7 NM_176933 dual specificity phosphatase 4 24 255 29 NM_013755 glycogenin 1 24 194 41 NM_001099674 hypothetical protein LOC69126 24 212 12 NM_023764 toll interacting protein 24 190 20 NM_016985 myotubularin-related protein 1 24 189 20 NM_011363 SH2-B PH domain containing signaling mediator 1 24 173 13 NM_025927 mitochondrial ribosomal protein L45 24 109 52 NM_001029842 solute carrier family 16 member 6 isoform a 24 126 34 NM_010333 endothelial differentiation sphingolipid 24 139 6 NM_021556 mitochondrial ribosomal protein S30 24 47 93 NM_007955 protein tyrosine phosphatase receptor type, V 24 113 19 NM_027652 selenoprotein I 24 73 55 NM_138675 mediator of RNA polymerase II transcription 24 106 16 NM_009906 tripeptidyl-peptidase I 24 79 43 NM_173439 F-box protein 45 24 88 18 NM_008443 kinesin family member 3A 24 75 29 NM_011284 replication protein A2 24 75 26 NM_010840 510-methylenetetrahydrofolate reductase 24 55 40 NM_177780 dedicator of cytokinesis 5 24 26 68 NM_133972 armadillo repeat containing 6 24 79 15 NM_029851 dynein cytoplasmic 2 heavy chain 1 24 73 20 NM_011239 RAN binding protein 1 24 62 28 NM_027287 DnaJ Hsp40 homolog subfamily B, member 4 24 10 76 NM_011305 retinoid X receptor alpha 24 44 34 NM_019773 RAB9 member RAS oncogene family 24 37 38 NM_026143 male sterility domain containing 2 24 44 28 NM_001039493 hypothetical protein LOC241075 24 12 60 NM_172842 lymphocyte transmembrane adaptor 1 24 39 33 NM_176785 Hermansky-Pudlak syndrome 6 24 7 62 NM_028201 hypothetical protein LOC74243 isoform 2 24 63 2 NM_011830 inosine 5'-phosphate dehydrogenase 2 24 40 23 NM_011807 chapsyn-110 24 38 23 NM_021507 sulfide quinone reductase-like 24 45 14 NM_175266 EPM2A laforin interacting protein 1 24 30 27 NM_027460 mitochondrial carrier protein 24 25 30 NM_026367 G patch domain containing 2 24 24 30 NM_001081033 phosphodiesterase 11A 24 36 18 NM_023054 UTP3 small subunit SSU processome component, 24 43 9 NM_153053 splicing factor 3b subunit 4 24 29 21 NM_145413 hypothetical protein LOC215015 24 43 7 NM_011844 monoglyceride lipase 24 13 34 NM_175436 zinc finger protein 526 24 28 19 NM_145628 ubiquitin specific peptidase 11 24 44 3 NM_172517 retinoblastoma binding protein 5 24 22 23 NM_008152 G-protein coupled receptor 65 24 28 16 NM_138745 methylenetetrahydrofolate dehydrogenase 1 24 33 10 NM_027592 TAF9 RNA polymerase II TATA box binding protein 24 30 13 NM_010695 lipocalin 4 24 16 25 NM_178404 zinc finger CCCH type containing 6 24 23 18 NM_001083315 low density lipoprotein-related protein 12 24 15 22 NM_029963 mitochondrial ribosomal protein S5 24 7 30 NM_007938 Eph receptor A6 24 34 2 NM_011538 T-box 6 24 12 20 NM_001083901 hippocampus abundant transcript-like 1 24 10 21 NM_170778 dihydropyrimidine dehydrogenase 24 12 18 NM_010784 midkine 24 8 20 NM_001033330 FERM and PDZ domain containing 4 24 17 9 NM_028536 hypothetical protein LOC73420 24 24 3 NM_013749 tumor necrosis factor receptor superfamily 24 16 9 NM_199032 centrosomal protein 135 24 18 7 NM_021346 zinc finger protein 318 isoform 2 24 7 17 NM_023507 RAD26L hypothetical protein 24 4 19 NM_001039478 receptor-interacting factor 1 isoform 3 24 2 21 NM_172253 TWIST neighbor 24 7 15 NM_025900 DEK oncogene DNA binding 24 3 18 NM_027673 testis-specific serine kinase 4 24 15 5 NM_009466 UDP-glucose dehydrogenase 24 12 8 NM_019392 TYRO3 protein tyrosine kinase 3 24 2 17 NM_172410 nucleoporin 93 24 12 6 NM_028595 membrane-spanning 4-domains subfamily A, member 24 7 10 NM_172813 ecto-NOX disulfide-thiol exchanger 1 24 11 4 NM_001080548 USP6 N-terminal like isoform b 24 3 10 NM_001001327 vitamin K epoxide reductase complex subunit 24 1 3 NM_021320 netrin 4 23 4403 2963 NM_030694 interferon induced transmembrane protein 2 23 866 3 NM_010634 fatty acid binding protein 5 epidermal 23 374 10 NM_019831 zinc finger MYM-type 3 23 293 21 NM_007830 diazepam binding inhibitor isoform 2 23 188 125 NM_175190 hypothetical protein LOC72931 23 246 32 NM_173733 sulfite oxidase 23 218 50 NM_011676 UNC-119 homolog 23 222 39 NM_019698 pyrroline-5-carboxylate synthetase isoform 1 23 205 26 NM_025523 NADH dehydrogenase ubiquinone 1 subcomplex 23 200 9 NM_010715 ligase I DNA, ATP-dependent 23 126 32 NM_021893 CD274 antigen 23 103 33 NM_175149 hypothetical protein LOC69551 23 88 34 NM_021540 ring finger protein 130 23 79 42 NM_025788 transcriptional repressor NAC1 23 95 22 NM_010278 growth factor independent 1 23 84 26 NM_025517 RNA terminal phosphate cyclase domain 1 23 62 46 NM_001085493 hypothetical protein LOC76947 23 52 35 NM_026845 peptidylprolyl isomerase-like 1 23 76 6 NM_025656 survivor of motor neuron protein interacting 23 80 1 NM_028044 calponin 3 acidic 23 70 9 NM_016856 cleavage and polyadenylation specific factor 2 23 70 9 NM_138314 non-metastatic cells 7 protein expressed in 23 54 16 NM_175045 BCL-6 interacting corepressor isoform c 23 52 18 NM_011069 peroxisomal biogenesis factor 11b 23 53 14 NM_138721 U7 snRNP-specific Sm-like protein LSM10 23 32 32 NM_175331 5'-nucleotidase domain containing 3 23 36 26 NM_139143 solute carrier family 39 metal ion 23 56 5 NM_020000 mediator of RNA polymerase II transcription 23 43 16 NM_026894 MMP37-like protein mitochondrial 23 34 25 NM_013899 translocase of inner mitochondrial membrane 13 23 50 9 NM_199448 fasciculation and elongation protein zeta 2 23 23 33 NM_023328 ATP/GTP binding protein 1 isoform 1 23 27 28 NM_026382 U11/U12 snRNP 48K 23 32 23 NM_139063 muted 23 36 18 NM_025864 transmembrane protein 206 23 29 24 NM_053158 mitochondrial ribosomal protein L1 isoform 1 23 50 3 NM_019975 2-hydroxyacyl-CoA lyase 1 23 10 39 NM_001039198 zinc finger homeobox 2 23 29 18 NM_001113424 antagonist of mitotic exit network 1 homolog 23 12 34 NM_026494 phosphopantothenoylcysteine synthetase 23 12 33 NM_133940 F-box and leucine-rich repeat protein 14 23 32 12 NM_025910 myc induced nuclear antigen 23 10 34 NM_001005426 zinc finger CW type with PWWP domain 1 23 31 12 NM_023173 dual specificity phosphatase 12 23 20 23 NM_207668 acid phosphatase prostate isoform 1 23 1 40 NM_001110254 hypothetical protein LOC240041 isoform a 23 25 16 NM_177215 phosphatidylinositol polyphosphate 23 32 6 NM_008682 neural precursor cell expressed developmentally 23 28 8 NM_001033192 Autosomal Highly Conserved Protein 23 19 14 NM_153075 sperm-associated cation channel 2 23 11 23 NM_008316 Hus1 homolog 23 13 20 NM_011505 syntaxin binding protein 4 23 10 22 NM_026904 anaphase promoting complex subunit 10 23 30 1 NM_026435 ubiquitin-fold modifier 1 23 25 6 NM_008923 protein kinase cAMP dependent regulatory, type 23 11 19 NM_009333 transcription factor 7-like 2 T-cell specific, 23 18 10 NM_153547 guanine nucleotide binding protein-like 3 23 18 10 NM_018797 plexin C1 23 15 13 NM_145552 guanine nucleotide binding protein-like 2 23 3 23 NM_009427 transducer of ErbB-2.1 23 12 13 NM_177263 zinc fingers and homeoboxes 3 23 2 23 NM_178629 hypothetical protein LOC75847 23 23 2 NM_175009 ey2 protein 23 11 13 NM_007964 ecotropic viral integration site 5 23 8 16 NM_001038619 dynamin 3 23 9 12 NM_008539 MAD homolog 1 23 8 13 NM_019756 tubulin delta 1 23 16 3 NM_009305 synaptophysin 23 7 10 NM_001039644 ER degradation enhancer mannosidase alpha-like 23 3 13 NM_015823 membrane associated guanylate kinase WW and PDZ 23 5 10 NM_033322 leucine zipper transcription factor-like 1 23 8 8 NM_019497 G protein-coupled receptor kinase 2 groucho 23 11 3 NM_011716 Wolfram syndrome 1 protein homolog 23 2 11 NM_177829 serine protease inhibitor Kazal type 10 23 4 9 NM_001081270 Down syndrome cell adhesion molecule-like 1 23 2 7 NM_026763 collagen type VI alpha 4 23 5 3 NM_026050 STAT3-interacting protein as a repressor 23 5 2 NM_029600 ATP-binding cassette sub-family C CFTR/MRP, 23 3 3 NM_030203 TSPY-like 4 23 2 2 NM_010419 hairy and enhancer of split 5 23 1 3 NM_001081324 neuropilin- and tolloid-like protein 2 23 1 2 NM_172525 Rho GTPase activating protein 29 22 3542 13 NM_053261 inositol myo-1(or 4)-monophosphatase 2 22 1275 10 NM_026785 ubiquitin-conjugating enzyme E2C 22 372 17 NM_001110331 peroxisomal delta3 delta2-enoyl-Coenzyme A 22 236 17 NM_153571 J-type co-chaperone HSC20 22 174 70 NM_029669 DnaJ Hsp40 homolog subfamily C, member 18 22 130 10 NM_177700 ATM interactor 22 126 13 NM_011078 PHD finger protein 2 22 125 12 NM_025390 POP4 processing of precursor S. cerevisiae 22 103 26 NM_023514 mitochondrial ribosomal protein S9 22 99 25 NM_008732 solute carrier family 11 proton-coupled 22 55 67 NM_010897 neurofibromin 22 96 22 NM_025436 sterol-C4-methyl oxidase-like 22 101 9 NM_008349 interleukin 10 receptor beta 22 59 39 NM_145588 kinesin family member 22 22 85 10 NM_029023 serine carboxypeptidase 1 22 62 32 NM_008746 neurotrophic tyrosine kinase receptor, type 3 22 75 19 NM_010209 fumarate hydratase 1 22 58 30 NM_011132 DNA polymerase epsilon catalytic subunit 22 36 52 NM_001033457 nucleolar protein with MIF4G domain 1-like 22 50 33 NM_022018 niban protein 22 53 19 NM_201230 Fgfr1 oncogene partner 22 56 12 NM_007930 ectodermal-neural cortex 1 22 53 15 NM_133954 hypothetical protein LOC101985 22 11 55 NM_018822 N-sulfoglucosamine sulfohydrolase sulfamidase 22 48 15 NM_134129 nuclear matrix protein SNEV 22 25 38 NM_009344 pleckstrin homology-like domain family A, 22 42 20 NM_080636 histidyl-tRNA synthetase-like 22 27 34 NM_181410 general transcription factor IIH polypeptide 3 22 41 18 NM_198702 latrophilin 3 22 18 40 NM_183183 GPRIN family member 3 22 31 24 NM_025857 hypothetical protein LOC66939 22 51 2 NM_009612 activin A receptor type II-like 1 22 27 26 NM_010480 heat shock protein 1 alpha 22 11 42 NM_013914 snail homolog 3 22 12 37 NM_026114 eukaryotic translation initiation factor 2 22 29 19 NM_025708 transmembrane protein 186 22 43 5 NM_026512 biphenyl hydrolase-like serine hydrolase 22 1 45 NM_017383 contactin 6 22 15 31 NM_001003960 DNA methyltransferase 3B isoform 2 22 22 22 NM_019514 astrotactin 2 isoform a 22 28 12 NM_028130 zinc finger protein 157 22 18 22 NM_019490 USO1 homolog vesicle docking protein 22 20 18 NM_027560 arrestin domain containing 2 22 36 1 NM_029621 hypothetical protein LOC76478 22 19 17 NM_145391 TAP binding protein-like 22 27 9 NM_025278 guanine nucleotide binding protein G protein 22 29 6 NM_177128 IQ calmodulin-binding motif containing 1 22 18 16 NM_022323 MAP-1 protein 22 3 29 NM_172402 solute carrier family 25 member 32 22 23 9 NM_133939 U6 snRNA-associated Sm-like protein LSm8 22 15 15 NM_172290 neurotrimin 22 7 23 NM_011796 calpain 10 22 16 12 NM_011654 tubulin alpha 1B 22 8 21 NM_029389 hypothetical protein LOC75698 22 16 10 NM_173396 TGFB-induced factor 2 22 12 14 NM_008891 pinin 22 9 17 NM_175434 solute carrier family 35 member F3 22 8 17 NM_198619 hypothetical protein LOC242747 22 9 15 NM_028981 calcium channel voltage-dependent, L type, 22 15 9 NM_024216 ATP binding domain 1 family member C 22 17 6 NM_029248 Josephin domain containing 3 isoform 2 22 10 13 NM_031386 testis expressed gene 14 22 16 7 NM_013626 peptidylglycine alpha-amidating monooxygenase 22 13 9 NM_019680 E74-like factor 4 22 2 19 NM_138666 neuroligin 1 22 18 3 NM_007395 activin A receptor type 1B 22 13 7 NM_144902 solute carrier family 35 22 18 1 NM_144906 SH3-domain GRB2-like endophilin interacting 22 10 9 NM_053242 forkhead box P2 22 9 9 NM_152812 OTU domain containing 6B 22 3 14 NM_178660 RNA binding motif single stranded interacting 22 14 1 NM_026639 ADP-ribosyltransferase 4 22 3 11 NM_198306 UDP-N-acetyl-alpha-D-galactosamine:polypeptide 22 4 9 NM_027835 interferon induced with helicase C domain 1 22 12 1 NM_009635 advillin 22 3 9 NM_028765 acyl-Coenzyme A oxidase-like 22 10 2 NM_029522 LGN protein 22 2 8 NM_172882 WD repeat and FYVE domain containing 3 22 1 8 NM_009706 Rho GTPase activating protein 5 22 2 4 NM_011589 timeless homolog 22 0 6 NM_198297 T cell receptor associated transmembrane adaptor 22 4 1 NM_011992 reticulocalbin 2 22 1 3 NM_001099631 SH2 domain containing 5 22 1 0 NM_001033303 adenosine monophosphate deaminase 1 isoform M 21 1880 67 NM_008367 interleukin 2 receptor alpha chain 21 1004 29 NM_007451 solute carrier family 25 member 5 21 1000 14 NM_009843 cytotoxic T-lymphocyte-associated protein 4 21 375 30 NM_001017429 cytochrome c oxidase subunit XVII assembly 21 275 7 NM_001025263 tumor protein D52 isoform 3 21 225 23 NM_023380 SAM domain SH3 domain and nuclear localization 21 223 9 NM_026774 hepatitis B virus x interacting protein 21 165 29 NM_013715 COP9 signalosome subunit 5 21 172 19 NM_021514 phosphofructokinase muscle 21 114 14 NM_134068 dual specificity phosphatase TS-DSP2 isoform b 21 76 43 NM_013678 surfeit gene 2 21 81 36 NM_026999 zinc finger protein 688 21 74 29 NM_023153 CWC15 homolog 21 88 14 NM_028792 Josephin domain containing 1 21 79 22 NM_146171 non-SMC condensin I complex subunit D2 21 82 13 NM_022327 v-ral simian leukemia viral oncogene homolog B 21 80 3 NM_008971 twinfilin 1 21 42 38 NM_177475 zinc finger protein 280b 21 46 32 NM_001081309 phosphatidylinositol 3 kinase regulatory 21 28 46 NM_145376 lysophosphatidylcholine acyltransferase 1 21 54 17 NM_026603 density-regulated protein 21 63 7 NM_013819 histocompatibility 2 M region locus 3 21 45 25 NM_023732 ATP-binding cassette sub-family B MDR/TAP, 21 38 30 NM_026993 dimethylarginine dimethylaminohydrolase 1 21 48 18 NM_016748 cytidine 5'-triphosphate synthase 21 1 61 NM_145209 2'-5' oligoadenylate synthetase-like 1 21 39 23 NM_016688 programmed cell death protein 7 21 41 18 NM_009067 ralA binding protein 1 21 31 26 NM_007859 DNA fragmentation factor beta subunit 21 51 5 NM_027453 basic transcription factor 3-like 4 21 32 18 NM_146043 spindlin isoform 2 21 23 27 NM_010629 kinesin-associated protein 3 21 34 11 NM_024255 hydroxysteroid dehydrogenase like 2 21 30 14 NM_009863 cell division cycle 7 21 22 23 NM_008720 Niemann Pick type C1 21 23 19 NM_183025 hypothetical protein LOC243308 21 12 28 NM_172701 oxidored-nitro domain-containing protein 21 33 5 NM_001024385 cardiolipin synthase 1 isoform 1 21 4 32 NM_016667 syntrophin basic 1 21 20 16 NM_001024926 cytochrome b5 domain containing 2 21 22 13 NM_177471 coiled-coil domain containing 69 21 13 21 NM_001077425 contactin associated protein-like 5A 21 10 23 NM_001012309 coiled-coil domain containing 55 21 9 23 NM_010687 like-glycosyltransferase 21 15 16 NM_010150 nuclear receptor subfamily 2 group F, member 6 21 19 11 NM_173735 RIKEN cDNA 2310044G17 21 9 22 NM_010075 dipeptidylpeptidase 6 21 2 27 NM_025527 signal recognition particle 19 21 17 12 NM_029475 adenosine deaminase-like 21 25 4 NM_172267 phytanoyl-CoA dioxygenase domain containing 1 21 16 12 NM_028319 zinc finger protein 518 21 7 22 NM_009602 neuronal nicotinic acetylcholine receptor beta 21 18 9 NM_001081204 beta 13-galactosyltransferase-like 21 9 19 NM_010905 nuclear factor I/A 21 5 21 NM_013780 neuronal PAS domain protein 3 21 16 9 NM_023042 RecQ protein-like 21 0 25 NM_028892 sperm associated antigen 17 21 15 9 NM_013769 tight junction protein 3 21 18 5 NM_007688 cofilin 2 muscle 21 5 16 NM_172552 thymine DNA glycosylase isoform 2 21 5 15 NM_026162 plexin domain containing 2 precursor 21 12 9 NM_009543 ring finger protein 103 21 19 1 NM_001037747 caspase recruitment domain family member 9 21 17 3 NM_025972 N-acylsphingosine amidohydrolase acid 21 5 14 NM_199021 dipeptidyl peptidase 10 21 8 11 NM_001081653 contactin associated protein-like 5C 21 4 14 NM_175549 roundabout homolog 2 21 4 13 NM_009879 carnitine deficiency-associated gene expressed 21 3 14 NM_001081089 hypothetical protein LOC215456 21 7 10 NM_030595 neurobeachin 21 8 9 NM_025613 CREBBP/EP300 inhibitory protein 1 21 10 6 NM_026898 WD repeat domain 53 21 7 9 NM_138758 trimethyllysine hydroxylase epsilon 21 12 3 NM_008199 histocompatibility 2 blastocyst 21 7 8 NM_001042591 arrestin domain containing 3 21 9 4 NM_011629 nuclear receptor subfamily 2 group C, member 1 21 4 4 NM_133167 parvin beta 21 2 5 NM_183146 hypothetical protein LOC212281 21 1 4 NM_029796 leucine-rich alpha-2-glycoprotein 21 2 2 NM_138301 transient receptor potential cation channel 21 3 1 NM_020257 C-type lectin domain family 2 member i 21 3 1 NM_205823 toll-like receptor 12 21 0 3 NM_010167 eyes absent 4 homolog 20 1435 88 NM_017480 inducible T-cell co-stimulator precursor 20 1101 13 NM_023196 group XII-1 phospholipase A2 isoform 1 20 670 22 NM_001025427 high mobility group AT-hook 1 20 294 23 NM_007918 eukaryotic translation initiation factor 4E 20 215 28 NM_026157 PAP associated domain containing 1 20 195 9 NM_145573 mitochondrial ribosomal protein S35 20 191 7 NM_138596 mediator complex subunit 10 20 126 53 NM_031874 RAB3D member RAS oncogene family 20 95 54 NM_011156 prolyl endopeptidase 20 86 43 NM_008139 guanine nucleotide binding protein alpha q 20 81 37 NM_026796 SET and MYND domain containing 2 20 106 9 NM_001013389 MRS2 magnesium homeostasis factor homolog 20 102 9 NM_134007 CDGSH iron sulfur domain 1 20 63 46 NM_175401 F-box and WD-40 domain protein 17 20 77 31 NM_009174 seven in absentia 2 20 102 4 NM_021529 phosphatase subunit gene g4-1 20 81 25 NM_001081266 coiled-coil domain containing 142 20 94 10 NM_009014 RAD51-like 1 20 90 10 NM_019746 programmed cell death 5 20 9 91 NM_175543 Rab11-FIP4-like 20 94 3 NM_027977 RIKEN cDNA 2310001A20 20 50 43 NM_145951 ecto-NOX disulfide-thiol exchanger 2 20 44 38 NM_009086 RNA polymerase I polypeptide B 20 24 57 NM_001033135 ring finger protein 149 20 20 57 NM_001113517 PAK-interacting exchange factor beta isoform a 20 52 18 NM_026826 mitochondrial ribosomal protein S18C 20 61 8 NM_026759 mitochondrial ribosomal protein L13 20 7 59 NM_134112 potassium channel tetramerisation domain 20 59 3 NM_173019 6-phosphofructo-2-kinase/fructose-2 20 41 19 NM_025991 kelch repeat and BTB POZ domain containing 4 20 26 33 NM_183316 small nuclear RNA activating complex 20 50 7 NM_027986 cytidine and dCMP deaminase domain containing 1 20 25 31 NM_009632 poly ADP-ribose polymerase family member 2 20 19 36 NM_153527 spermatogenesis apoptosis-related protein 20 39 15 NM_025794 electron transferring flavoprotein 20 28 26 NM_008535 lymphoblastomic leukemia 20 16 36 NM_025822 arginine/serine-rich coiled-coil 1 20 5 46 NM_026854 DTW domain containing 2 20 20 31 NM_011894 SH3-domain binding protein 5 BTK-associated 20 45 6 NM_080849 NIMA never in mitosis gene a-related expressed 20 29 17 NM_027532 hypothetical protein LOC75430 20 22 22 NM_017404 mitochondrial ribosomal protein L39 20 27 16 NM_172693 UDP-N-acetyl-alpha-D-galactosamine:polypeptide 20 27 15 NM_026273 hypothetical protein LOC67609 20 14 26 NM_001033530 hypothetical protein LOC101835 20 17 23 NM_025950 cell division cycle 37 homolog S. 20 22 17 NM_177662 cathepsin O 20 23 15 NM_019987 intestinal cell kinase 20 24 13 NM_026383 proline-rich nuclear receptor coactivator 2 20 27 9 NM_172590 WD repeat domain 41 20 8 28 NM_001081288 TBP-associated factor 2 20 20 15 NM_178206 histone cluster 1 H3h 20 12 24 NM_020558 nuclear DNA binding protein 20 2 30 NM_001081215 DEAD Asp-Glu-Ala-Asp box polypeptide 60 20 10 23 NM_023868 ryanodine receptor 2 cardiac 20 14 18 NM_010489 hyaluronoglucosaminidase 2 20 20 11 NM_019979 selenoprotein K 20 17 12 NM_025505 basic leucine zipper nuclear factor 1 20 24 6 NM_030229 polymerase RNA III (DNA directed) polypeptide 20 4 25 NM_001081678 zinc finger protein 800 20 10 16 NM_010154 v-erb-a erythroblastic leukemia viral oncogene 20 15 10 NM_181070 RAB18 member RAS oncogene family 20 12 10 NM_001008973 hypothetical protein LOC381107 20 7 14 NM_199195 branched chain ketoacid dehydrogenase E1 beta 20 13 8 NM_001079822 transcription factor 3 isoform 1 20 17 3 NM_023053 twisted gastrulation homolog 1 20 13 6 NM_011113 plasminogen activator urokinase receptor 20 11 7 NM_010295 glutamate-cysteine ligase catalytic subunit 20 1 15 NM_001033420 dedicator of cytokinesis 1 20 3 12 NM_178193 histone cluster 1 H4b 20 9 7 NM_028603 zinc finger and BTB domain containing 8 20 2 12 NM_001079513 kaiso protein 20 3 10 NM_015820 heparan sulfate 6-O-sulfotransferase 3 20 2 10 NM_173071 brain-specific angiogenesis inhibitor 2 20 3 9 NM_021559 zinc finger protein 191 20 9 4 NM_019583 interleukin 17 receptor B 20 3 9 NM_177066 TNNI3 interacting kinase 20 9 2 NM_172980 solute carrier family 28 sodium-coupled 20 8 0 NM_008243 macrophage stimulating 1 hepatocyte growth 20 2 3 NM_001004177 cadherin EGF LAG seven-pass G-type receptor 2 20 2 1 NM_001002842 PML-RARA regulated adaptor molecule 1 20 9 455 NM_029384 hypothetical protein LOC664968 20 248 13 NM_025551 13kDa differentiation-associated protein 20 56 135 NM_020581 angiopoietin-like 4 20 136 44 NM_207633 Yip1 domain family member 6 20 123 9 NM_134020 transmembrane emp24 protein transport domain 20 72 59 NM_001032413 platelet endothelial aggregation receptor 1 20 62 55 NM_027949 PHD finger protein 7 20 84 27 NM_175154 galactokinase 2 20 83 17 NM_030018 transmembrane protein 50B 20 86 12 NM_172676 sterile alpha motif domain containing 10 20 70 27 NM_015804 ATPase class VI, type 11A 20 91 5 NM_025296 WD40 protein Ciao1 20 82 9 NM_207302 zinc finger RAN-binding domain containing 1 20 63 26 NM_026430 UDP-glucuronate decarboxylase 1 20 56 28 NM_134163 muscleblind-like 3 20 25 53 NM_144896 PET112-like 20 45 31 NM_178377 COMM domain containing 10 20 66 9 NM_198113 slingshot homolog 3 20 56 17 NM_001081377 protocadherin 9 20 65 2 NM_001039153 tectonic 1 20 52 11 NM_001082532 phosphatidylinositol glycan anchor biosynthesis 20 16 46 NM_027421 integrator complex subunit 2 20 23 39 NM_026543 hypothetical protein LOC68067 20 53 9 NM_144861 cDNA sequence BC021395 20 5 55 NM_023500 Kell blood group precursor McLeod phenotype 20 18 42 NM_021385 RAD18 homolog 20 19 40 NM_001024853 translocase of inner mitochondrial membrane 10 20 44 13 NM_173382 hypothetical protein LOC212127 20 46 10 NM_026597 hypothetical protein LOC68176 20 7 49 NM_175430 coiled-coil domain containing 40 20 19 35 NM_133248 glomulin FKBP associated protein 20 33 16 NM_011294 RNA polymerase II transcriptional coactivator 20 24 26 NM_001004156 neuronal RhoA GEF protein 20 27 21 NM_007382 acyl-Coenzyme A dehydrogenase medium chain 20 32 14 NM_025590 acyl-CoA thioesterase 11 20 24 20 NM_144826 UTP6 small subunit SSU processome component, 20 14 27 NM_201358 cDNA sequence BC034664 20 38 4 NM_029545 hypothetical protein LOC328092 20 24 17 NM_001037136 centaurin gamma 2 isoform 2 20 8 32 NM_001040426 thrombospondin type I, domain containing 4 20 32 7 NM_020625 zinc finger protein 297 20 1 38 NM_010272 growth differentiation factor 11 20 12 26 NM_054053 G protein-coupled receptor 98 20 13 24 NM_145944 coiled-coil domain containing 25 20 7 26 NM_019742 tumor suppressor candidate 2 20 29 4 NM_022028 salvador homolog 1 20 13 20 NM_001037756 breast cancer metastasis-suppressor 1-like 20 18 14 NM_001113413 ring finger protein 13 isoform a 20 2 30 NM_198711 collagen type XXV, alpha 1 isoform 2 20 23 9 NM_178775 ribosomal protein S6 kinase 52kDa, polypeptide 20 20 10 NM_183270 coiled-coil-helix-coiled-coil-helix domain 20 9 22 NM_028281 pterin-4 alpha-carbinolamine dehydratase 2 20 12 18 NM_009819 catenin cadherin associated protein alpha 2 20 7 23 NM_175392 hypothetical protein LOC108958 20 27 1 NM_026967 Ras homolog enriched in brain like 1 20 26 2 NM_008876 phospholipase D2 20 15 12 NM_177630 leucine zipper down-regulated in cancer 1-like 20 14 12 NM_173182 FAD104 20 13 13 NM_144798 solute carrier family 30 zinc transporter 20 7 19 NM_181045 calneuron 1 isoform a 20 11 14 NM_009306 synaptotagmin I 20 16 9 NM_008451 kinesin light chain 2 20 5 17 NM_010492 islet cell autoantigen 1 20 5 17 NM_001024504 DCN1 defective in cullin neddylation 1, domain 20 4 18 NM_028560 hypothetical protein LOC73523 isoform a 20 10 12 NM_172577 solute carrier family 25 mitochondrial 20 9 13 NM_007831 deleted in colorectal carcinoma 20 7 15 NM_011409 schlafen 3 20 4 17 NM_001011874 X Kell blood group precursor related family 20 12 9 NM_029932 spinster homolog 3 20 1 19 NM_020260 Cdc42 GTPase-activating protein 20 1 18 NM_198659 hypothetical protein LOC381476 20 2 16 NM_001081097 glutamate receptor ionotropic, kainate 3 20 13 4 NM_175664 histone cluster 1 H2bb 20 7 9 NM_001033343 SEC31-like 2 20 2 13 NM_028718 TNF receptor-associated factor 3 interacting 20 2 12 NM_145952 TBC1D12: TBC1 domain family member 12 20 2 12 NM_001082412 mitochondrial carrier triple repeat 6 isoform 1 20 3 11 NM_028370 protection of telomeres 1B 20 1 12 NM_001113373 SH3/ankyrin domain gene 2 isoform b 20 1 12 NM_001004180 hypothetical protein LOC433940 20 11 2 NM_001036293 nuclear receptor binding factor 2 20 3 9 NM_009707 Rho GTPase activating protein 6 isoform a 20 8 5 NM_028829 progestin and adipoQ receptor family member 20 5 7 NM_172916 hydrocephalus inducing 20 12 0 NM_021330 acid phosphatase 1 soluble isoform 2 20 11 1 NM_001045482 RB-associated KRAB repressor 20 3 7 NM_001038990 iduronate 2-sulfatase isoform b 20 5 4 NM_153586 RNA binding motif protein 41 20 3 6 NM_181860 gene trap insertion site 4-1 20 2 6 NM_010228 FMS-like tyrosine kinase 1 20 1 7 NM_177759 coiled-coil domain containing 60 20 5 2 NM_010387 histocompatibility 2 class II, locus Mb1 20 4 2 NM_025914 actin-related protein 6 20 0 6 NM_013650 S100 calcium binding protein A8 calgranulin A 20 2 3 NM_025781 transmembrane protein 170 20 2 2 NM_010821 macrophage expressed gene 1 20 3 0 NM_001109902 transmembrane protein 118 isoform 2 20 0 2 NM_016917 solute carrier family 40 iron-regulated 19 734 19 NM_145455 basic transcription factor 3 19 486 8 NM_030150 RNA helicase LGP2 19 225 52 NM_178595 peptidyl-tRNA hydrolase 1 homolog 19 187 53 NM_139291 cell division cycle 26 19 189 47 NM_025848 succinate dehydrogenase complex subunit D, 19 101 73 NM_153058 microtubule-associated protein RP/EB family, 19 139 24 NM_145742 DEAH Asp-Glu-Ala-His box polypeptide 35 19 141 13 NM_019793 tetraspanin 3 19 93 38 NM_028356 zinc finger and BTB domain containing 25 19 71 54 NM_146168 hypothetical protein LOC232023 19 52 63 NM_013571 kinase suppressor of ras 19 82 26 NM_026440 RNA guanine-7- methyltransferase 19 58 43 NM_029814 chromatin modifying protein 5 19 89 4 NM_172705 PHD finger protein 13 19 38 52 NM_028043 hypothetical protein LOC52846 19 61 17 NM_025512 zinc finger AN1-type domain 1 19 57 20 NM_001013026 transcription termination factor RNA polymerase 19 71 1 NM_028243 prolylcarboxypeptidase 19 3 60 NM_009321 tubulin cofactor a 19 46 9 NM_013784 phosphatidylinositol glycan anchor biosynthesis 19 23 31 NM_024189 YY1 associated factor 2 19 20 30 NM_181401 transmembrane protein 64 19 27 24 NM_145614 dihydrolipoamide S-acetyltransferase E2 19 32 18 NM_181066 hypothetical protein LOC231841 isoform 2 19 36 14 NM_007922 ELK1 member of ETS oncogene family 19 33 15 NM_138753 hexamethylene bis-acetamide inducible 1 19 10 38 NM_145409 CTF18 chromosome transmission fidelity factor 19 33 13 NM_133883 ecto ADP-ribosylhydrolase 19 39 6 NM_011895 solute carrier family 35 CMP-sialic acid 19 29 11 NM_026001 ribonuclease H2 subunit B 19 31 9 NM_011919 inhibitor of growth family member 1 19 16 23 NM_001025296 DNA fragmentation factor alpha subunit isoform 19 32 6 NM_028476 hypothetical protein LOC73242 19 25 13 NM_017381 zinc finger RAN-binding domain containing 2 19 31 7 NM_009500 vav 2 oncogene 19 8 30 NM_019745 programmed cell death 10 19 27 10 NM_001007589 hypothetical protein LOC433693 19 26 11 NM_016897 translocase of inner mitochondrial membrane 23 19 11 26 NM_011857 odd Oz/ten-m homolog 3 19 19 16 NM_145543 chloride channel CLIC-like 1 19 32 2 NM_027658 hexamthylene bis-acetamide inducible 2 19 14 19 NM_007753 carboxypeptidase A3 mast cell 19 13 19 NM_027250 hypothetical protein LOC69893 19 20 11 NM_178664 UDP-GlcNAc:betaGal 19 27 4 NM_133685 Rab31-like 19 13 17 NM_008825 6-phosphofructo-2-kinase/fructose-2 19 15 14 NM_026072 serologically defined colon cancer antigen 10 19 4 23 NM_177328 glutamate receptor metabotropic 7 19 11 16 NM_026626 EF-hand calcium binding domain 2 19 14 12 NM_001081133 kinesin family member 16B 19 2 24 NM_026348 integrin beta 3 binding protein 19 13 12 NM_001029876 hypothetical protein LOC382038 19 11 13 NM_198419 phosphatase and actin regulator 1 isoform 1 19 14 9 NM_018869 G protein-coupled receptor kinase 5 19 5 17 NM_178659 jumonji domain containing 4 19 13 9 NM_001008791 whirlin isoform 2 19 9 13 NM_010610 large conductance calcium-activated potassium 19 19 2 NM_007861 dihydrolipoamide dehydrogenase 19 8 13 NM_175481 glutamate receptor KA1 precursor 19 11 9 NM_011880 regulator of G protein signaling 7 19 10 10 NM_207010 MAM domain containing 19 14 6 NM_027988 NADPH oxidase organizer 1 19 2 17 NM_178793 collagen and calcium binding EGF domains 1 19 5 13 NM_177059 follistatin-like 4 19 4 14 NM_010113 epidermal growth factor 19 2 16 NM_025444 TATA box-binding protein-associated factor RNA 19 5 12 NM_183024 raver2 19 15 2 NM_172310 threonyl-tRNA synthetase-like 2 19 4 12 NM_023292 pseudouridine synthase 3 19 3 12 NM_016768 pre B-cell leukemia transcription factor 3 19 3 12 NM_001024614 hypothetical protein LOC75784 19 10 5 NM_023871 SET translocation 19 8 7 NM_172673 FERM domain containing 5 19 1 12 NM_030239 ATP-binding cassette subfamily G, member 3 19 3 8 NM_134097 topoisomerase 1-binding RING finger 19 3 8 NM_027296 tRNA nucleotidyl transferase CCA-adding, 1 19 1 9 NM_001113208 neural cell adhesion molecule 2 isoform a 19 8 2 NM_018786 huntington yeast partner C 19 4 5 NM_022416 serine/threonine kinase 32B 19 7 2 NM_178421 nanos homolog 1 19 5 3 NM_029933 B-cell CLL/lymphoma 9 19 4 4 NM_030710 SLAM family member 6 19 5 0 NM_008559 melanocortin 1 receptor 19 0 5 NM_029018 CD200 receptor 3 19 0 5 NM_028122 solute carrier family 14 urea transporter 19 2 2 NM_009603 cholinergic receptor nicotinic, epsilon 19 0 2 NM_194333 solute carrier family 23 nucleobase 19 0 0 NM_020270 secretory carrier membrane protein 5 18 427 55 NM_001113199 nascent polypeptide-associated complex alpha 18 91 250 NM_201352 glycerophosphodiester phosphodiesterase domain 18 254 4 NM_178098 testin 18 156 59 NM_172161 interleukin-1 receptor-associated kinase 2 18 184 6 NM_010876 neutrophil cytosolic factor 1 18 155 33 NM_145538 ubiquitin-conjugating enzyme variant Kua 18 117 68 NM_019488 solute carrier family 2 facilitated glucose 18 74 107 NM_009616 a disintegrin and metalloprotease domain 19 18 95 58 NM_010194 feline sarcoma oncogene 18 133 19 NM_001039534 phosphoseryl-tRNA kinase 18 110 35 NM_134052 acireductone dioxygenase 1 18 90 41 NM_009080 ribosomal protein L26 18 47 77 NM_175437 hypothetical protein LOC212167 18 116 5 NM_016750 H2A histone family member Z 18 60 37 NM_025485 ribosomal protein mitochondrial, S22 18 72 24 NM_001033251 G protein-coupled receptor 174 18 91 4 NM_053102 15 kDa selenoprotein precursor 18 68 24 NM_138668 Ufm1-specific protease 2 18 61 26 NM_198127 abl-interactor 2 18 72 14 NM_024478 GrpE-like 1 mitochondrial 18 60 26 NM_001081304 activating transcription factor 6 18 60 17 NM_028780 transmembrane 9 superfamily member 1 18 61 15 NM_178051 MTERF domain containing 2 18 57 19 NM_026123 unc-50 homolog 18 52 21 NM_027175 NADH dehydrogenase ubiquinone 1 alpha 18 54 18 NM_175528 hypothetical protein LOC243780 18 42 29 NM_025574 pre-Y homolog 18 51 18 NM_011279 ring finger protein 7 18 65 4 NM_025693 transmembrane protein 41a 18 52 15 NM_011804 cellular repressor of E1A-stimulated genes 1 18 48 15 NM_175558 zinc finger protein 446 18 24 38 NM_027464 hypothetical protein LOC70564 18 47 11 NM_023893 Ng23 protein 18 13 45 NM_133208 zinc finger protein 287 18 56 2 NM_134081 DnaJ homolog subfamily C, member 9 18 48 9 NM_026384 diacylglycerol O-acyltransferase 2 18 43 12 NM_028120 coiled-coil domain containing 123 18 46 9 NM_172598 WD repeat and HMG-box DNA binding protein 1 18 36 16 NM_025437 eukaryotic translation initiation factor 1A 18 37 13 NM_010760 mago-nashi homolog proliferation-associated 18 31 18 NM_177325 TSR1 20S rRNA accumulation 18 31 15 NM_009222 synaptosomal-associated protein 23 18 33 12 NM_026346 F-box protein 32 18 37 9 NM_016804 metaxin 2 18 26 19 NM_172509 potassium channel tetramerisation domain 18 4 40 NM_028029 dynamin binding protein 18 11 29 NM_058214 RecQ protein-like 4 18 15 25 NM_009359 testis expressed gene 9 18 29 10 NM_019920 mitogen-activated protein kinase kinase 1 18 22 17 NM_009214 spermine synthase 18 31 7 NM_011675 uridine-cytidine kinase 1 18 31 6 NM_028428 alpha 13 fucosyltransferase 18 9 28 NM_021377 SORCS receptor 1 18 30 7 NM_001024919 hypothetical protein LOC69556 18 18 18 NM_176987 hypothetical protein LOC319719 18 25 11 NM_176073 plasma glutamate carboxypeptidase 18 23 13 NM_001040395 hypothetical protein LOC68646 isoform 2 18 4 31 NM_009785 calcium channel voltage-dependent, alpha2/delta 18 28 6 NM_027678 zinc finger RAN-binding domain containing 3 18 18 15 NM_010264 nuclear receptor subfamily 6 group A, member 1 18 15 18 NM_172988 F-box and leucine-rich repeat protein 4 18 22 11 NM_172468 sorting nexin family member 30 18 26 7 NM_024217 CKLF-like MARVEL transmembrane domain containing 18 12 19 NM_007578 calcium channel voltage-dependent, P/Q type, 18 17 13 NM_177429 oral-facial-digital syndrome 1 gene homolog 18 17 13 NM_015829 solute carrier family 25 mitochondrial carrier 18 16 13 NM_153502 diabetes related ankyrin repeat protein 18 2 26 NM_023815 Nori-2 protein 18 10 19 NM_008981 protein tyrosine phosphatase receptor type, G 18 1 27 NM_053217 hypothetical protein LOC112419 18 4 24 NM_027394 ubiquitin-conjugating enzyme E2C binding 18 18 8 NM_001042527 Bloom syndrome protein homolog 18 25 1 NM_008606 matrix metallopeptidase 11 18 8 16 NM_001033312 F-box and leucine-rich repeat protein 18 18 3 20 NM_133721 integrin alpha 9 isoform a 18 19 3 NM_173738 hypothetical protein LOC233057 18 11 11 NM_172407 CDKN2A interacting protein 18 7 15 NM_028296 carbonic anhydrase 10 18 5 16 NM_009228 syntrophin acidic 1 18 10 11 NM_144533 nicotinamide nucleotide adenylyltransferase 3 18 9 12 NM_175275 centlein isoform 1 18 15 6 NM_008389 IAP promoted placental 18 14 7 NM_001080817 PR domain containing 10 18 7 13 NM_001033550 leucine rich repeat containing 8 family member 18 19 0 NM_029847 arylsulfatase K 18 5 13 NM_173760 histidine acid phosphatase domain containing 1 18 3 15 NM_152894 processing of precursors 1 homolog isoform 1 18 10 9 NM_177639 discs large homolog-associated protein 1 18 0 18 NM_175770 TAF7 RNA polymerase II TATA box binding protein 18 4 13 NM_033327 zinc finger protein 423 18 5 11 NM_133442 glutamate receptor interacting protein 1 isoform 18 3 13 NM_001004154 Ras-related GTP binding B 18 8 9 NM_010199 fibroblast growth factor 12 isoform b 18 4 11 NM_026366 N6-DNA methyltransferase A 18 9 7 NM_008129 glutamate-cysteine ligase modifier subunit 18 8 8 NM_026436 transmembrane protein 86A 18 8 7 NM_019671 neuroepithelial cell transforming gene 1 isoform 18 8 6 NM_026534 hypothetical protein LOC68053 18 3 9 NM_020295 limb region 1 18 5 7 NM_182807 TAFA2 protein 18 4 8 NM_172800 sidekick 2 18 4 8 NM_153288 neuropeptide B 18 3 9 NM_026483 M-phase phosphoprotein 10 U3 small nucleolar 18 8 3 NM_177645 hypothetical protein LOC68691 18 5 5 NM_175325 Bardet-Biedl syndrome 4 homolog 18 7 3 NM_001038015 glucosamine-6-phosphate deaminase 2 18 2 7 NM_007804 cut-like homeobox 2 18 1 8 NM_145356 zinc finger and BTB domain containing 7C 18 1 4 NM_001033159 zinc finger protein 597 18 2 2 NM_001111275 insulin-like growth factor 1 isoform 4 18 0 3 NM_001033333 hypothetical protein LOC237558 18 1 1 NM_010229 FMS-like tyrosine kinase 3 18 0 1 NM_011693 vascular cell adhesion molecule 1 17 1406 20 NM_026623 nudix nucleoside diphosphate linked moiety 17 739 50 NM_011404 solute carrier family 7 cationic amino acid 17 681 9 NM_145533 spermine oxidase 17 345 101 NM_009848 ectonucleoside triphosphate diphosphohydrolase 17 414 24 NM_001033531 kelch-like 32 17 101 95 NM_025402 hypothetical protein LOC66179 17 130 61 NM_025597 NADH dehydrogenase ubiquinone 1 beta 17 147 20 NM_025790 thioesterase superfamily member 2 17 142 18 NM_198299 hypothetical protein LOC102124 17 79 41 NM_130450 elongation of very long chain fatty acids-like 17 109 2 NM_010818 Cd200 antigen 17 39 72 NM_013902 FK506 binding protein 3 17 37 73 NM_153791 FLYWCH-type zinc finger 1 17 105 3 NM_027429 centromere protein L 17 17 88 NM_029609 hypothetical protein LOC76429 17 74 2 NM_027927 integrator complex subunit 12 17 31 39 NM_152810 cell division cycle 5-like 17 61 6 NM_025662 phosphatidylinositol glycan anchor biosynthesis 17 42 23 NM_177323 Rad50-interacting protein 1 17 26 34 NM_001033399 glucose-fructose oxidoreductase domain 17 36 23 NM_026975 bolA-like 1 17 46 9 NM_010832 male-specific lethal-3 homolog 1 17 37 18 NM_178750 synovial sarcoma translocation gene on 17 51 3 NM_028963 hypothetical protein LOC74477 17 11 36 NM_007561 bone morphogenic protein receptor type II 17 44 1 NM_173405 archaemetzincin-1 17 36 9 NM_177767 2-oxoglutarate and iron-dependent oxygenase 17 25 19 NM_172919 hypothetical protein LOC244721 17 24 20 NM_025785 F-box protein 25 17 27 16 NM_023554 nucleolar protein 7 17 34 9 NM_001033314 coiled-coil domain containing 61 17 32 9 NM_008921 DNA primase small subunit 49kDa 17 32 7 NM_001081059 coiled-coil domain containing 90A 17 23 14 NM_007520 BTB and CNC homology 1 17 31 5 NM_175313 RIKEN cDNA A130022J15 17 29 7 NM_010344 glutathione reductase 1 precursor 17 33 1 NM_007437 aldehyde dehydrogenase family 3 subfamily A2 17 11 22 NM_025443 partner of NOB1 17 8 24 NM_020614 TATA box binding protein Tbp-associated 17 22 9 NM_022989 ADP-ribosylation-like factor 6-interacting 17 26 4 NM_175265 hypothetical protein LOC77744 17 9 21 NM_001113419 schwannomin interacting protein 1 isoform a 17 14 14 NM_001103199 skint 6 isoform a 17 11 17 NM_178643 Fanconi anemia-associated protein 24 kDa 17 18 9 NM_009557 zinc finger protein 46 17 16 10 NM_139228 rhomboid veinlet-like 4 17 23 4 NM_010180 fibulin 1 17 0 26 NM_172872 KN motif and ankyrin repeat domains 4 17 19 6 NM_030245 SPT3-associated factor 42 17 19 5 NM_153415 protein-O-mannosyltransferase 2 17 9 15 NM_011855 odd Oz/ten-m homolog 1 17 8 16 NM_172448 ring finger protein 43 17 14 9 NM_029074 transmembrane protein 188 17 5 18 NM_024479 Williams-Beuren syndrome critical region protein 17 5 18 NM_009262 sparc/osteonectin cwcv and kazal-like domains 17 17 6 NM_023243 cyclin H 17 8 15 NM_008741 neuron specific gene family member 2 17 8 15 NM_001001447 zinc finger and SCAN domain containing 22 17 9 13 NM_001080941 regulator of sex-limitation 2 17 15 7 NM_001081071 lysocardiolipin acyltransferase 17 11 10 NM_030715 polymerase DNA directed eta (RAD 30 related) 17 2 19 NM_175548 limbic system-associated membrane protein 17 5 15 NM_133928 coiled-coil-helix-coiled-coil-helix domain 17 2 17 NM_206882 histone cluster 3 H2bb 17 9 10 NM_001013028 hypothetical protein LOC103266 17 1 17 NM_008364 interleukin 1 receptor accessory protein isoform 17 1 17 NM_007664 cadherin 2 17 5 12 NM_175188 membrane-associated ring finger C3HC4 1 17 12 6 NM_010188 Fc receptor IgG, low affinity III 17 17 0 NM_013812 CDK2 cyclin-dependent kinase 2-associated 17 8 9 NM_015812 regulator of G-protein signaling 6 17 1 15 NM_134114 SFT2 domain containing 1 17 12 4 NM_001101478 hypothetical protein LOC241944 17 13 2 NM_028048 solute carrier family 25 member 35 17 13 2 NM_139051 nuclear receptor subfamily 5 group A, member 1 17 2 12 NM_009154 semaphorin 5A 17 3 10 NM_001077398 LIM domain binding 2 isoform 2 17 11 2 NM_001009951 hypothetical protein LOC382010 17 2 10 NM_007400 a disintegrin and metalloprotease domain 12 17 3 9 NM_027616 hypothetical protein LOC70950 17 5 7 NM_001033464 EF-hand calcium binding domain 4B 17 1 10 NM_026142 hypothetical protein LOC67419 17 9 3 NM_019496 AMMECR1 protein 17 2 9 NM_178646 tigger transposable element derived 5 17 4 6 NM_025970 zinc finger and BTB domain containing 8 opposite 17 2 8 NM_001081027 potassium channel subfamily T, member 2 17 10 0 NM_177222 cancer susceptibility candidate 1 17 2 7 NM_001034873 kinase suppressor of ras 2 isoform 2 17 4 1 NM_172309 aryl hydrocarbon receptor nuclear 17 4 0 NM_033474 armadillo repeat gene deleted in 17 3 0 NM_133778 hypothetical protein LOC78408 17 2 1 NM_026740 solute carrier family 46 member 1 17 0 3 NM_031159 apolipoprotein B editing complex 1 17 0 3 NM_011303 dehydrogenase/reductase SDR family member 3 17 2 0 NM_198412 DnaJ Hsp40 homolog subfamily C, member 6 17 2 0 NM_012065 phosphodiesterase 6G cGMP-specific, rod, gamma 17 0 2 NM_013521 formyl peptide receptor 1 17 1 0 NM_007870 deoxyribonuclease 1-like 3 precursor 16 1788 7 NM_015774 ERO1-like 16 1589 18 NM_013674 interferon regulatory factor 4 16 127 326 NM_001081163 carbohydrate chondroitin synthase 1 16 319 13 NM_023595 deoxyuridine triphosphatase 16 296 14 NM_027168 HD domain containing 2 16 267 8 NM_008776 platelet-activating factor acetylhydrolase 16 265 3 NM_172450 hypothetical protein LOC207819 16 252 13 NM_145149 RAS guanyl releasing protein 4 16 222 21 NM_027117 kelch domain containing 2 16 220 7 NM_207267 hypothetical protein LOC399591 16 144 42 NM_007381 acyl-Coenzyme A dehydrogenase long-chain 16 174 9 NM_207667 fibroblast growth factor 14 isoform b 16 152 25 NM_025369 mitochondrial ribosomal protein S36 16 154 6 NM_152804 polo-like kinase 2 16 109 47 NM_023191 WD repeat domain 61 isoform a 16 58 92 NM_010479 heat shock 70kDa protein 1A 16 115 21 NM_203507 RWD domain containing 4A 16 72 63 NM_172284 DDX19 homolog 16 102 11 NM_016809 RNA binding motif protein 3 16 77 32 NM_175285 transmembrane protein 62 16 79 27 NM_198600 DNA polymerase sigma 16 80 24 NM_178186 histone cluster 1 H2ag 16 67 35 NM_019654 suppressor of cytokine signaling 5 16 87 7 NM_133933 ribophorin I 16 52 37 NM_029884 heparan-alpha-glucosaminide N-acetyltransferase 16 71 9 NM_001039173 docking protein 6 16 60 17 NM_031251 cystinosis nephropathic 16 68 7 NM_172398 aldo-keto reductase family 1 member B10 16 36 23 NM_182997 AMP-activated protein kinase beta 2 16 43 15 NM_029410 BCL2-like 12 proline rich 16 1 55 NM_020557 thymidylate kinase family LPS-inducible member 16 31 25 NM_011734 sialic acid acetylesterase 16 28 27 NM_001029982 Sec23 interacting protein 16 41 14 NM_025745 XTP3-transactivated protein B 16 43 11 NM_011753 zinc finger protein 26 16 18 36 NM_172851 contactin associated protein-like 5 16 42 9 NM_180588 receptor accessory protein 4 16 33 16 NM_133231 regulatory factor X-associated protein 16 30 18 NM_029935 N-acetylgalactosamine 4-sulfate 16 17 30 NM_033606 DEAQ RNA-dependent ATPase 16 37 10 NM_030121 ankyrin repeat and SOCS box-containing protein 16 36 11 NM_010332 endothelin receptor type A 16 39 8 NM_009031 retinoblastoma binding protein 7 16 38 7 NM_172394 nucleoporin 88 isoform 1 16 37 7 NM_175246 Smad nuclear interacting protein 1 16 2 41 NM_011025 oxytocin 16 9 34 NM_145822 CD3E antigen epsilon polypeptide associated 16 16 26 NM_173406 expressed sequence AI591476 16 5 36 NM_011549 transcription factor EB 16 36 5 NM_001081094 hypothetical protein LOC229937 16 10 27 NM_024178 asparagine-linked glycosylation 14 homolog 16 9 28 NM_010587 intersectin 1 isoform 1 16 30 7 NM_026654 TOE1 homolog 16 10 26 NM_019989 SH3-binding domain glutamic acid-rich protein 16 8 27 NM_146005 ankyrin 3 epithelial isoform b 16 4 30 NM_025729 mitogen-activated protein kinase kinase kinase 7 16 25 9 NM_025475 centrosomal protein 27 16 19 12 NM_007683 centromere protein C1 16 16 14 NM_027504 transcription factor MEL1 16 15 14 NM_016851 interferon regulatory factor 6 16 14 13 NM_145519 FERM RhoGEF and pleckstrin domain protein 2 16 17 9 NM_025280 antigenic determinant of rec-A protein 16 25 1 NM_011349 sema domain immunoglobulin domain Ig, short 16 11 14 NM_009964 crystallin alpha B 16 17 8 NM_001033654 coiled-coil domain containing 139 16 19 4 NM_001081258 kinesin family member 14 16 8 15 NM_025696 sortilin-related VPS10 domain containing 16 7 16 NM_172743 pleckstrin homology domain containing family A 16 14 9 NM_030075 kelch domain containing 8B 16 17 5 NM_008841 phosphatidylinositol 3-kinase regulatory 16 5 15 NM_027032 parkin co-regulated gene protein 16 14 6 NM_139306 alkaline ceramidase 2 16 4 14 NM_009867 cadherin 4 16 18 0 NM_152815 Wins2 protein 16 9 9 NM_007897 early B-cell factor 1 16 15 3 NM_026836 TAF11 RNA polymerase II TATA box binding 16 12 6 NM_026500 DEAD Asp-Glu-Ala-Asp box polypeptide 59 16 12 6 NM_001004293 amphoterin induced gene and ORF 16 11 7 NM_146253 zinc finger and BTB domain containing 6 16 2 15 NM_011794 bisphosphate 3'-nucleotidase 1 16 4 12 NM_008415 jerky 16 4 12 NM_178259 ATP-binding cassette transporter 16 7 9 NM_011766 zinc finger protein multitype 2 16 7 9 NM_198626 hypothetical protein LOC268880 16 14 2 NM_028056 hypothetical protein LOC72016 16 5 10 NM_001014996 centromere protein J 16 3 12 NM_201373 tripartite motif-containing 56 16 11 4 NM_009376 Tg737 protein 16 0 14 NM_178673 follistatin-like 5 16 9 5 NM_176841 coiled coil domain containing 88A 16 3 9 NM_133689 IIIG9 protein 16 2 9 NM_001111273 hypothetical protein LOC665860 16 5 6 NM_008744 netrin 1 16 4 7 NM_053271 regulating synaptic membrane exocytosis 2 16 2 9 NM_027617 spermatogenesis associated 1 16 4 6 NM_001081146 prickle-like 2 16 10 0 NM_010287 G protein-coupled receptor 83 16 0 9 NM_001112798 solute carrier family 8 sodium/calcium 16 7 3 NM_029286 hypothetical protein LOC73332 16 5 4 NM_001024950 zinc finger protein ZFP413 16 4 5 NM_029965 ring finger protein 170 16 2 7 NM_016976 glutamate receptor metabotropic 1 isoform alpha 16 5 3 NM_019480 estrogen receptor-binding fragment-associated 16 5 3 NM_001024626 hypothetical protein LOC408062 16 4 2 NM_146258 serologically defined colon cancer antigen 13 16 1 3 NM_010727 ligand of numb-protein X 1 16 0 3 NM_001081428 hypothetical protein LOC75906 16 0 2 NM_001029985 cysteine rich BMP regulator 2 chordin like 16 1 0 NM_013752 nibrin 15 59 3884 NM_010741 lymphocyte antigen 6 complex locus C 15 899 207 NM_011309 S100 calcium binding protein A1 15 441 25 NM_009856 CD83 antigen 15 156 12 NM_001101430 hypothetical protein LOC69666 isoform b 15 138 13 NM_145630 pyruvate dehydrogenase kinase isoenzyme 3 15 137 11 NM_025386 F-box protein 36 15 131 16 NM_001081210 mitochondrial ribosomal protein L44 15 67 80 NM_021422 heat shock protein DNAJ-like 4 15 113 12 NM_133196 cleavage stimulation factor 3' pre-RNA subunit 15 99 26 NM_026614 NADH dehydrogenase ubiquinone 1 alpha 15 115 9 NM_020045 histone cell cycle regulation defective 15 97 25 NM_172338 DnaJ Hsp40 homolog subfamily C, member 16 15 71 37 NM_013847 glycine C-acetyltransferase 15 24 71 NM_010169 coagulation factor II thrombin receptor 15 73 15 NM_172691 hypothetical protein LOC230088 15 32 53 NM_178611 leukocyte-associated Ig-like receptor 1 isoform 15 79 6 NM_024173 vacuolar H+ ATPase G1 15 77 7 NM_153134 FKSG27 15 75 8 NM_027338 vacuolar protein sorting 36 15 57 21 NM_001039061 kelch-like 15 isoform a 15 74 1 NM_013515 stomatin 15 66 9 NM_172429 survival motor neuron domain containing 1 15 56 17 NM_010851 myeloid differentiation primary response gene 15 60 6 NM_026178 monocyte to macrophage 15 43 22 NM_177240 hypothetical protein LOC320714 15 56 6 NM_011121 polo-like kinase 15 57 4 NM_027491 Ras-related GTP binding D 15 54 7 NM_028730 peroxisome biogenesis factor 26 15 50 10 NM_028710 Arylsulfatase G 15 48 11 NM_018773 src family associated phosphoprotein 2 15 51 9 NM_172625 hypothetical protein LOC225280 15 29 28 NM_030721 acyl-Coenzyme A oxidase 3 pristanoyl 15 33 24 NM_019437 riboflavin kinase 15 55 2 NM_146201 zinc finger protein 553 15 52 5 NM_011300 ribosomal protein S7 15 42 9 NM_138591 G elongation factor mitochondrial 1 15 18 31 NM_144857 hypothetical protein LOC224823 15 42 8 NM_021296 GrpE-like 2 mitochondrial 15 29 19 NM_025860 DEAD Asp-Glu-Ala-Asp box polypeptide 18 15 34 12 NM_201600 myosin Vb 15 37 9 NM_030145 LSM6 homolog U6 small nuclear RNA associated 15 37 9 NM_177462 zinc finger MYM-type 6 15 39 5 NM_207213 sorting nexin 25 15 1 41 NM_007592 carbonic anhydrase-like 15 30 11 NM_172711 GUF1 GTPase homolog 15 26 14 NM_001048250 hypothetical protein LOC75616 15 23 17 NM_011077 X-linked phosphate regulating endopeptidase 15 9 30 NM_153542 leucine rich repeat containing 20 15 26 9 NM_198421 ubiquitin specific protease 49 homolog 15 1 34 NM_001029933 zinc finger protein 114 15 9 26 NM_023115 protocadherin 15 15 3 31 NM_172746 HIRA interacting protein 3 15 7 27 NM_028372 hypothetical protein LOC72852 15 8 26 NM_011412 slit homolog 3 15 20 13 NM_033584 protocadherin gamma subfamily A 1 15 3 30 NM_011172 proline dehydrogenase 15 25 8 NM_172403 hypothetical protein LOC69944 15 3 28 NM_015732 axin2 15 28 2 NM_019678 Trk-fused 15 19 10 NM_029578 TDP-glucose 46-dehydratase 15 18 10 NM_025700 phosphoglucomutase 1 15 19 9 NM_178197 histone cluster 1 H2bh 15 10 18 NM_001001176 TAF9-like RNA polymerase II TATA box binding 15 25 3 NM_007623 chromobox homolog 2 15 9 18 NM_175163 zinc finger protein HIT-39 15 22 5 NM_011220 6-pyruvoyl-tetrahydropterin synthase 15 18 8 NM_021338 ribosomal protein L35a 15 9 17 NM_023140 glutaredoxin 3 15 19 6 NM_175383 beta-13-N-acetylglucosaminyltransferase bGnT-6 15 17 8 NM_025932 synapse associated protein 1 15 18 6 NM_175439 mitochondrial methionyl-tRNA synthetase 15 11 13 NM_031998 testis specific gene A14 15 24 0 NM_027156 DEAD Asp-Glu-Ala-Asp box polypeptide 51 15 15 8 NM_173392 zinc finger FYVE domain containing 16 15 14 9 NM_133193 interleukin 1 receptor-like 2 15 3 17 NM_001043322 formin 1 isoform 2 15 15 5 NM_001081007 zinc finger protein 382 15 14 6 NM_010232 flavin containing monooxygenase 5 15 4 15 NM_025286 solute carrier family 31 member 2 15 4 15 NM_080455 teashirt zinc finger family member 2 15 3 16 NM_153179 polyductin 15 15 4 NM_019425 glucosamine-phosphate N-acetyltransferase 1 15 8 11 NM_177649 hemicentin 2 15 14 5 NM_025495 centromere protein P 15 14 5 NM_145984 prolyl endopeptidase-like 15 3 15 NM_019697 potassium voltage-gated channel Shal-related 15 3 15 NM_207651 solute carrier family 14 urea transporter 15 17 1 NM_175374 mitochondrial translational release factor 15 15 3 NM_001013022 hypothetical protein LOC70113 15 7 9 NM_175089 NIMA never in mitosis gene a-related expressed 15 2 13 NM_009767 cysteine-rich hydrophobic domain 1 15 9 7 NM_028756 solute carrier family 35 member A5 15 7 9 NM_015756 shroom isoform 1 15 12 3 NM_146183 zinc finger protein 428 15 1 13 NM_001039094 neuronal growth regulator 1 isoform a 15 9 6 NM_029431 thioesterase superfamily member 4 15 4 9 NM_001033434 hypothetical protein LOC380730 15 10 4 NM_019972 sortilin 1 15 10 3 NM_175337 mutL homolog 3 15 1 11 NM_007496 AT motif binding factor 1 15 1 11 NM_175459 GLIS family zinc finger 3 15 1 11 NM_026611 ribonuclease T2B 15 0 11 NM_001083906 nuclear receptor subfamily 3 group C, member 2 15 5 6 NM_153556 postmeiotic segregation increased 1 15 5 6 NM_181400 WD repeat domain 47 15 5 6 NM_001081100 MORN repeat containing 1 15 3 8 NM_010284 growth hormone receptor isoform 1 precursor 15 7 4 NM_178201 histone cluster 1 H2bn 15 8 3 NM_009197 solute carrier family 16 member 2 15 8 3 NM_172637 HECT domain containing 2 15 4 6 NM_148950 Pbx/knotted 1 homeobox 2 15 2 8 NM_175276 formin homology 2 domain containing 3 15 4 5 NM_053273 tweety 2 15 3 5 NM_016925 Fanconi anemia complementation group A 15 4 3 NM_001081429 coiled-coil domain containing 15 15 3 4 NM_026319 coiled-coil domain containing 2 15 2 5 NM_033037 cysteine dioxygenase 1 cytosolic 15 2 5 NM_010308 guanine nucleotide binding protein alpha o 15 7 0 NM_001098222 basic helix-loop-helix domain containing class 15 7 0 NM_025513 exosome component 3 15 7 0 NM_011095 paired-Ig-like receptor B 15 2 4 NM_178883 SCY1-like 1 binding protein 1 15 2 4 NM_009194 solute carrier family 12 member 2 15 2 3 NM_146203 zinc finger protein 764 15 4 0 NM_007491 ADP-ribosyltransferase 5 precursor 15 3 0 NM_172412 glypican 2 cerebroglycan 15 2 1 NM_172258 solute carrier family 36 proton/amino acid 15 1 0 NM_029875 solute carrier family 35 member E3 14 1365 5 NM_177420 phosphoserine aminotransferase 1 14 681 23 NM_019755 proteolipid protein 2 14 466 13 NM_024220 NADH dehydrogenase ubiquinone 1 subcomplex 14 311 8 NM_023116 calcium channel voltage-dependent, beta 2 14 201 11 NM_025639 centromere protein M isoform 1 14 181 5 NM_146120 gelsolin 14 83 85 NM_013750 pleckstrin homology-like domain family A, 14 139 20 NM_025692 ubiquitin-activating enzyme 5 14 91 66 NM_009302 SWA-70 protein 14 124 19 NM_138952 receptor-interacting serine-threonine kinase 2 14 95 44 NM_031871 D11lgp1 14 124 9 NM_027276 CDC16 cell division cycle 16 homolog 14 120 8 NM_001033435 hypothetical protein LOC380732 14 114 0 NM_175093 tribbles homolog 3 14 95 10 NM_009295 syntaxin binding protein 1 isoform b 14 84 21 NM_153117 hypothetical protein LOC213673 14 84 21 NM_018772 brain protein I3 14 84 10 NM_011288 mitochondrial ribosomal protein L23 14 54 38 NM_183148 hypothetical protein LOC212632 14 43 48 NM_019861 cathepsin F 14 28 53 NM_030026 methylcrotonoyl-Coenzyme A carboxylase 2 beta 14 73 7 NM_001033865 ribosomal protein S27a 14 63 16 NM_025829 eukaryotic translation initiation factor 4E 14 34 44 NM_177101 hypothetical protein LOC320204 14 32 45 NM_021335 U2 small nuclear ribonucleoprotein B 14 42 32 NM_001082552 tripartite motif protein 21 14 48 24 NM_153806 acidic 82 kDa protein 14 32 39 NM_007708 citron 14 67 2 NM_025623 nipsnap homolog 3A 14 65 2 NM_198710 pantophysin isoform 2 14 51 14 NM_016871 translocase of outer mitochondrial membrane 40 14 55 9 NM_026464 WD repeat domain 55 14 47 16 NM_172779 DEAD/H Asp-Glu-Ala-Asp/His box polypeptide 14 46 17 NM_178743 anion exchanger Slc26a11 14 28 33 NM_029239 protein kinase D3 14 25 34 NM_053255 elaC homolog 1 14 57 1 NM_025511 hypothetical protein LOC66359 14 43 14 NM_011666 ubiquitin-activating enzyme 3 isoform 1 14 46 10 NM_028377 hypothetical protein LOC72873 14 36 20 NM_028439 hypothetical protein LOC73103 14 50 6 NM_181403 vacuolar protein sorting 37C 14 19 35 NM_201354 hypothetical protein LOC269037 14 46 6 NM_172780 solute carrier family 9 sodium/hydrogen 14 30 21 NM_029880 zinc binding alcohol dehydrogenase domain 14 14 32 NM_207264 hypothetical protein LOC399568 14 41 5 NM_153592 ER lipid raft associated 2 14 17 28 NM_030560 hypothetical protein LOC80744 14 38 5 NM_028077 hypothetical protein LOC72056 14 24 16 NM_026194 hypothetical protein LOC67490 14 28 9 NM_020584 telomeric repeat binding factor 2 interacting 14 17 18 NM_023160 putative N-acetyltransferase Camello 1 14 15 20 NM_025351 coiled-coil-helix-coiled-coil-helix domain 14 29 5 NM_008883 plexin A3 14 24 9 NM_021392 adaptor-related protein complex AP-4 mu 1 14 19 13 NM_178662 ataxia cerebellar, Cayman type homolog 14 20 11 NM_172371 solute carrier family 16 monocarboxylic acid 14 14 17 NM_177244 FAST kinase domains 1 14 18 12 NM_172475 FERM domain containing 4A 14 17 13 NM_028840 armadillo repeat-containing protein 14 18 11 NM_019460 Scm-like with four mbt domains 1 14 17 12 NM_029327 LYR motif containing 7 14 19 9 NM_153103 kinesin family member 1C 14 2 26 NM_026120 hypothetical protein LOC67383 14 10 19 NM_029773 speckle-type POZ protein-like 14 20 8 NM_011484 signal transducing adaptor molecule SH3 domain 14 20 6 NM_144839 ubiquitin-conjugating enzyme E2E 2 UBC4/5 14 8 18 NM_027869 polyribonucleotide nucleotidyltransferase 1 14 13 12 NM_170757 oocyte-testis gene 1 14 19 6 NM_001015039 zinc finger FYVE domain containing 28 14 12 13 NM_001012517 fucosyltransferase 10 isoform Fut10A 14 3 22 NM_174847 hypothetical protein LOC207781 14 14 10 NM_173780 Kruppel-like factor 8 14 5 19 NM_001033877 ADAM metallopeptidase with thrombospondin type 1 14 11 13 NM_028812 general transcription factor II E polypeptide 1 14 22 2 NM_134251 solute carrier family 12 member 8 isoform 1 14 12 11 NM_027992 transmembrane protein 106B 14 3 20 NM_175494 zinc finger protein 367 14 8 15 NM_178912 Fanconi anemia complementation group M 14 8 15 NM_181071 tetratricopeptide repeat ankyrin repeat and 14 7 16 NM_001081021 zinc finger protein 780B 14 4 18 NM_026576 ETAA16 protein 14 19 3 NM_024462 coiled-coil domain containing 23 isoform b 14 5 16 NM_022319 calsyntenin 2 14 4 17 NM_029967 ADAMTS-like 1 14 17 4 NM_145480 replication factor C activator 1 4 14 1 20 NM_008130 GLI-Kruppel family member GLI3 14 5 15 NM_015785 zona pellucida binding protein 14 3 17 NM_178767 transmembrane protein 195 14 11 9 NM_153561 nudix nucleoside diphosphate linked moiety 14 4 15 NM_011211 protein tyrosine phosphatase receptor type, D 14 9 9 NM_010099 ectodysplasin-A 14 15 3 NM_001033318 component of oligomeric golgi complex 7 14 4 13 NM_133207 potassium voltage-gated channel subfamily H 14 10 7 NM_008165 glutamate receptor ionotropic, AMPA1 alpha 1 14 3 12 NM_028392 protein phosphatase 2 formerly 2A regulatory 14 10 6 NM_027409 motile sperm domain containing 1 14 4 10 NM_172902 carboxypeptidase 4 cytosolic 14 10 5 NM_016718 ninjurin 2 14 4 9 NM_009786 calcyclin binding protein 14 1 12 NM_178631 RALY RNA binding protein-like 14 5 8 NM_172655 HECT C2 and WW domain containing E3 ubiquitin 14 5 8 NM_178110 tripartite motif-containing 62 14 12 1 NM_029849 hypothetical protein LOC77043 14 8 5 NM_023873 centrosomal protein 70 14 1 10 NM_145492 zinc finger protein 521 isoform 1 14 4 7 NM_175519 potassium channel tetramerisation domain 14 2 9 NM_026858 XRCC6 binding protein 1 14 9 2 NM_025657 leucine rich repeat containing 57 14 0 10 NM_001093775 myelin transcription factor 1-like isoform 1 14 7 4 NM_013675 spectrin beta 1 14 8 3 NM_145624 zinc finger protein 14 14 3 7 NM_001081035 neuron navigator 3 14 10 0 NM_025755 hypothetical protein LOC66768 14 7 3 NM_030201 stress 70 protein chaperone 14 4 5 NM_172869 FERM domain containing 3 14 2 7 NM_001042617 Ca<2+>dependent activator protein for secretion 14 1 8 NM_001025581 potassium voltage gated channel Shaw-related 14 8 1 NM_194336 macrophage activation 2 like 14 4 4 NM_001033308 basement membrane-induced protein 14 1 7 NM_153163 Ca2+-dependent activator for secretion protein 14 4 3 NM_146103 transmembrane protein 185B 14 2 5 NM_175213 hypothetical protein LOC75033 14 2 4 NM_011838 Ly6/neurotoxin 1 14 3 3 NM_016869 corin 14 1 5 NM_177078 adrenergic receptor kinase beta 2 isoform 1 14 1 5 NM_177373 PTPRF interacting protein alpha 2 14 0 6 NM_008066 gamma-aminobutyric acid GABA-A receptor 14 2 3 NM_001034865 NIMA never in mitosis gene a- related kinase 14 2 3 NM_008882 plexin A2 14 1 4 NM_175194 solute carrier family 25 mitochondrial carrier 14 0 4 NM_007731 collagen type XIII, alpha 1 14 0 4 NM_026805 SV2 related protein 14 0 3 NM_001081096 hypothetical protein LOC75811 14 0 3 NM_133485 PKC-potentiated PP1 inhibitory protein 14 1 1 NM_172623 triggering receptor expressed on myeloid 14 1 0 NM_010130 EGF-like module containing mucin-like, hormone 14 0 1 NM_010136 eomesodermin homolog 14 0 1 NM_145402 transmembrane protein 51 14 0 0 NM_026878 RAS-like family 11, member B 13 2543 37 NM_010705 galectin 3 13 1010 12 NM_001033236 hypothetical protein LOC207965 13 329 26 NM_008784 immunoglobulin CD79A binding protein 1 13 260 1 NM_009811 caspase 6 13 214 8 NM_199009 hypothetical protein LOC74349 13 186 14 NM_008079 galactosylceramidase 13 45 124 NM_011204 protein tyrosine phosphatase non-receptor type 13 141 20 NM_147153 vacuolar protein sorting 39 isoform 1 13 45 115 NM_001099332 immunoglobulin superfamily member 2 13 56 69 NM_030697 KN motif and ankyrin repeat domains 3 13 110 12 NM_133706 transmembrane protein 97 13 96 24 NM_025892 hypothetical protein LOC66994 13 96 8 NM_001081326 amylo-16-glucosidase, 13 41 60 NM_030711 endoplasmic reticulum aminopeptidase 1 13 67 28 NM_028260 IMP1 inner mitochondrial membrane 13 89 0 NM_009984 cathepsin L preproprotein 13 74 7 NM_001039483 putative membrane protein 13 52 28 NM_172500 nesprin-3 isoform beta 13 73 7 NM_023057 leucine zipper- and sterile alpha 13 74 4 NM_001037841 chemokine-like factor isoform 4 13 71 3 NM_016765 dimethylarginine dimethylaminohydrolase 2 13 61 10 NM_010128 epithelial membrane protein 1 13 50 19 NM_007672 cerebellar degeneration-related 2 13 30 28 NM_026179 abhydrolase domain containing 5 13 47 9 NM_026850 phosducin-like 3 13 55 2 NM_028303 PDZ domain containing 11 13 48 6 NM_030887 Jun dimerization protein 2 13 31 23 NM_023913 inositol-requiring 1 alpha 13 5 48 NM_172443 TBC1 domain family member 16 13 44 9 NM_172471 inter-alpha globulin inhibitor H5 13 23 27 NM_001045523 bromo adjacent homology domain containing 1 13 7 41 NM_019643 teratocarcinoma expressed serine rich 13 12 33 NM_001039586 glycerate kinase 13 24 19 NM_026647 zinc finger DHHC domain containing 21 13 28 14 NM_138670 3-mercaptopyruvate sulfurtransferase 13 41 1 NM_008306 N-deacetylase/N-sulfotransferase heparan 13 27 14 NM_011723 xanthine dehydrogenase 13 31 9 NM_025903 interferon-related developmental regulator 2 13 36 5 NM_025295 biotinidase 13 29 9 NM_133926 calcium/calmodulin-dependent protein kinase I 13 20 18 NM_177342 Tbp-associated factor 5 13 18 19 NM_181590 SHQ1 homolog 13 16 21 NM_008437 napsin A aspartic peptidase 13 19 17 NM_007978 factor 8-associated gene A 13 30 6 NM_010877 neutrophil cytosolic factor 2 13 23 11 NM_028434 hypothetical protein LOC73090 13 27 4 NM_001003910 Grp94 neighboring nucleotidase isoform 3 13 29 1 NM_145591 zinc finger-like protein 13 16 13 NM_178916 Rieske Fe-S domain containing 13 5 23 NM_027091 nucleoporin 35 13 12 16 NM_177730 inositol monophosphatase domain containing 1 13 9 19 NM_001081390 palladin 13 14 13 NM_026742 RIKEN cDNA 1110007M04 13 13 14 NM_007546 Bcl2-interacting killer 13 9 18 NM_001081006 enhancer trap locus 4 13 9 18 NM_147176 homer homolog 1 isoform L 13 5 21 NM_026725 dual specificity phosphatase 23 13 11 14 NM_001033145 hypothetical protein LOC68861 13 25 0 NM_172644 aspartyl-tRNA synthetase 2 mitochondrial 13 12 12 NM_020263 calcium channel voltage-dependent, alpha 13 11 13 NM_008234 helicase lymphoid specific 13 15 9 NM_011848 NIMA never in mitosis gene a-related expressed 13 7 17 NM_030198 GINS complex subunit 3 13 19 4 NM_013837 protein-tyrosine sulfotransferase 1 13 8 15 NM_177652 ryanodine receptor 3 13 11 10 NM_153597 tRNA splicing 2' phosphotransferase 1 13 2 19 NM_001110783 ankyrin 1 erythroid isoform 1 13 4 16 NM_001111271 staufen 2 isoform 1 13 2 18 NM_178681 diacylglycerol kinase beta 13 7 13 NM_026075 SFRS12-interacting protein 1 13 11 9 NM_001038696 RNA-binding region RNP1 RRM containing 3 13 9 10 NM_009384 T-cell lymphoma invasion and metastasis 1 13 3 14 NM_153135 netrin receptor Unc5h4 13 9 9 NM_207237 mannosidase alpha, class 1C, member 1 13 8 9 NM_053103 ectonucleoside triphosphate diphosphohydrolase 13 5 11 NM_031174 Down syndrome cell adhesion molecule 13 4 12 NM_022312 tenascin R 13 2 13 NM_008783 pre B-cell leukemia transcription factor 1 13 7 9 NM_001085440 Smith-Magenis syndrome chromosome region 13 5 9 NM_001008549 hypothetical protein LOC210104 13 5 9 NM_145599 transmembrane protein 34 13 13 2 NM_028932 ELL associated factor 1 13 11 4 NM_001077237 hypothetical protein LOC226499 isoform 2 13 1 13 NM_153588 MKL/myocardin-like 2 13 14 0 NM_178357 Kruppel-like factor 11 13 2 11 NM_009479 uroporphyrinogen III synthase 13 2 10 NM_007471 amyloid beta A4 precursor protein 13 3 9 NM_001081287 membrane protein palmitoylated 7 13 3 9 NM_182808 TAFA1 protein 13 1 11 NM_008989 purine rich element binding protein A 13 0 12 NM_026185 hypothetical protein LOC67477 13 5 7 NM_010725 LIM homeobox transcription factor 1 beta 13 3 9 NM_175750 plexin A4 13 11 1 NM_001081332 solute carrier family 9 sodium/hydrogen 13 2 9 NM_198111 A kinase PRKA anchor protein 6 13 9 3 NM_009180 sialyltransferase 7B 13 9 3 NM_007409 alcohol dehydrogenase 1 class I 13 5 6 NM_153078 EH domain binding protein 1 13 4 7 NM_023182 chymotrypsin-like 13 3 8 NM_009806 calcium/calmodulin-dependent serine protein 13 9 2 NM_027950 oxidative stress induced growth inhibitor 1 13 5 5 NM_026119 vitamin D receptor interacting protein 13 4 6 NM_013845 receptor tyrosine kinase-like orphan receptor 1 13 4 6 NM_207683 phosphatidylinositol 3-kinase C2 domain 13 4 6 NM_013846 receptor tyrosine kinase-like orphan receptor 2 13 8 2 NM_029842 jumonji domain containing 5 13 8 2 NM_033570 cyclin M4 13 4 5 NM_013596 melanocortin 5 receptor 13 3 6 NM_181470 LTV1 homolog 13 3 6 NM_028990 transmembrane protein 168 13 2 7 NM_172426 solute carrier family 24 13 5 3 NM_023294 HEC protein 13 1 7 NM_019588 phospholipase C epsilon 13 4 3 NM_001033543 interleukin 20 receptor beta precursor 13 3 4 NM_176930 neuronal cell adhesion molecule 13 2 5 NM_001033350 B-cell scaffold protein with ankyrin repeats 1 13 1 6 NM_145525 oxysterol binding protein-like 6 13 0 7 NM_010401 histidine ammonia lyase 13 3 3 NM_013871 mitogen-activated protein kinase 12 13 4 1 NM_001039934 microtubule-associated protein 2 isoform 1 13 1 3 NM_008115 glial cell line derived neurotrophic factor 13 0 4 NM_008449 kinesin family member 5C 13 1 2 NM_001033172 Rab11-family interacting protein 2 13 0 3 NM_027618 gonad specific ankyrin repeat protein isoform 2 13 0 3 NM_172570 tripartite motif protein 47 13 2 0 NM_009386 tight junction protein 1 13 1 0 NM_020002 REC8 homolog 13 0 1 NM_027482 hypothetical protein LOC70617 13 0 0 NM_008848 paired-Ig-like receptor A6 isoform a 12 1163 21 NM_008828 phosphoglycerate kinase 1 12 34 815 NM_009910 chemokine C-X-C motif receptor 3 12 451 23 NM_025379 cytochrome c oxidase subunit VIIb 12 250 9 NM_011020 heat shock protein 4 like 12 150 34 NM_021527 McKusick-Kaufman syndrome protein 12 39 136 NM_009037 reticulocalbin 1 12 136 19 NM_144808 solute carrier family 39 zinc transporter 12 108 25 NM_026193 adaptor-related protein complex AP-4 beta 1 12 57 75 NM_010849 myc proto-oncogene protein 12 103 19 NM_009083 ribosomal protein L30 12 67 55 NM_133918 elastin microfibril interfacer 1 12 111 6 NM_011520 syndecan 3 12 91 24 NM_028040 RNA pseudouridylate synthase domain containing 12 88 26 NM_175414 tetraspan NET-5 12 99 9 NM_028091 O-sialoglycoprotein endopeptidase-like 1 12 89 15 NM_025531 slowmo homolog 2 12 14 79 NM_138310 apolipoprotein B48 receptor 12 66 13 NM_007548 PR domain containing 1 with ZNF domain 12 29 45 NM_013522 FSHD region gene 1 12 2 66 NM_001033532 hypothetical protein LOC225289 12 46 19 NM_001033573 zinc finger DHHC domain containing 6 12 22 43 NM_001081352 hypothetical protein LOC218343 12 55 9 NM_152822 LAS1-like 12 32 30 NM_001040085 synaptotagmin-like 2 isoform 2 12 55 4 NM_133753 mitogen-inducible gene 6 protein 12 7 52 NM_175193 golgi integral membrane protein 4 12 20 37 NM_153083 thiamine triphosphatase 12 55 2 NM_026708 TLC domain containing 1 12 8 49 NM_178639 sideroflexin 5 12 39 15 NM_022882 lipin 2 12 40 13 NM_029100 selenoprotein N 1 12 24 26 NM_024201 coiled-coil domain containing 127 12 46 2 NM_178082 INSIG-2 membrane protein 12 3 44 NM_027890 sushi domain containing 2 12 30 17 NM_001025615 Ymer protein isoform 2 12 26 21 NM_194343 tripartite motif-containing 45 12 34 11 NM_030013 cytochrome P450 family 20, subfamily A, 12 27 18 NM_026879 chromatin modifying protein 2B 12 25 20 NM_030241 SET domain-containing protein 12 42 2 NM_016957 high mobility group nucleosomal binding domain 12 15 27 NM_009361 transcription factor Dp 1 12 14 28 NM_007991 fibrillarin 12 42 0 NM_019735 APAF1 interacting protein 12 31 10 NM_172656 amyotrophic lateral sclerosis 2 juvenile 12 36 5 NM_001043336 echinoderm microtubule associated protein like 1 12 19 20 NM_053198 sideroflexin 4 12 24 15 NM_172734 serine/threonine kinase 38 like 12 23 15 NM_153572 katanin p60 subunit A-like 1 12 27 10 NM_025315 SRB7 supressor of RNA polymerase B homolog 12 17 19 NM_146051 hypothetical protein LOC218734 isoform 1 12 13 23 NM_001010825 FIC domain containing 12 15 19 NM_023440 transmembrane protein 86B 12 26 8 NM_007829 Fas death domain-associated protein 12 8 26 NM_199316 KIAA1009 protein 12 22 10 NM_172814 low density lipoprotein-related protein 12 12 8 24 NM_010319 guanine nucleotide binding protein G protein 12 29 2 NM_001025395 Rous sarcoma oncogene isoform 2 12 18 12 NM_172822 SMP3 mannosyltransferase 12 22 8 NM_001039515 ADP-ribosylation factor-like 4 12 1 26 NM_145434 nuclear receptor subfamily 1 group D, member 1 12 14 13 NM_033269 cholinergic receptor muscarinic 3, cardiac 12 20 6 NM_001102563 hypothetical protein LOC69017 12 19 7 NM_026815 uroplakin 1A 12 20 5 NM_172490 DNA segment Chr 5, ERATO Doi 135, expressed 12 12 13 NM_029920 hypothetical protein LOC77521 isoform b 12 25 0 NM_023239 mage-g1 protein 12 2 22 NM_019637 phosphoserine/threonine/tyrosine interaction 12 9 15 NM_008171 glutamate receptor ionotropic, NMDA2B epsilon 12 11 11 NM_008983 protein tyrosine phosphatase receptor type, K 12 10 11 NM_178736 ELMO domain containing 2 12 14 7 NM_144912 RAD9 homolog B 12 11 9 NM_001085373 mutated in colorectal cancers isoform 1 12 15 5 NM_018747 A-kinase anchor protein 7 12 5 14 NM_010266 guanine deaminase 12 5 14 NM_139150 calcium response factor 12 3 16 NM_181412 zinc finger BED domain containing 4 12 10 9 NM_008965 prostaglandin E receptor 4 subtype EP4 12 12 7 NM_024184 anti-silencing function 1B 12 12 7 NM_026116 Bardet-Biedl syndrome 2 homolog 12 9 9 NM_013875 phosphodiesterase 7B 12 5 12 NM_029790 methyltransferase 5 domain containing 1 12 12 6 NM_153424 nephrocystin 4 12 9 9 NM_025938 ribonuclease P 14kDa subunit 12 9 9 NM_001113417 thyroid hormone receptor beta isoform 1 12 7 10 NM_007981 acyl-CoA synthetase long-chain family member 1 12 8 9 NM_001081397 myosin XVI 12 14 2 NM_153564 guanylate-binding protein 5 12 5 10 NM_144860 ubiquitin ligase mind bomb 12 7 9 NM_029270 Rho GTPase activating protein 24 isoform 1 12 8 8 NM_001081336 diacylglycerol kinase eta 12 8 8 NM_009929 procollagen type XVIII, alpha 1 isoform 2 12 5 9 NM_019978 doublecortin-like kinase 1 isoform 1 12 13 2 NM_026210 hypothetical protein LOC67510 12 11 4 NM_175024 neuritin 1-like 12 11 4 NM_133832 retinol dehydrogenase 10 12 3 11 NM_009782 calcium channel voltage-dependent, R type, 12 5 9 NM_001012310 mitochondrial hepatocellular 12 1 12 NM_001039154 cadherin 8 isoform 1 12 1 12 NM_001001152 zinc finger protein 458 12 2 10 NM_052977 adenosine deaminase RNA-specific, B2 12 0 12 NM_029163 ubiquitin specific peptidase 50 12 12 0 NM_016661 S-adenosylhomocysteine hydrolase 12 3 9 NM_176959 F-box and leucine-rich repeat protein 7 12 3 9 NM_198019 centrosomal protein 78kDa 12 1 10 NM_177355 phosphatidylinositol-specific phospholipase C X 12 4 7 NM_001081242 talin 2 12 2 9 NM_001081166 PHD finger protein 21B 12 3 8 NM_010060 dynein axonemal, heavy chain 11 12 10 1 NM_019874 DnaJ Hsp40 homolog subfamily B, member 5 12 7 4 NM_019632 N-ethylmaleimide sensitive fusion protein 12 5 5 NM_177034 amyloid beta A4 precursor protein binding 12 5 5 NM_172560 centrobin centrosomal BRCA2 interacting 12 5 5 NM_018819 brain protein 44-like 12 4 6 NM_178773 transmembrane protein 16D 12 2 8 NM_178804 slit homolog 2 precursor 12 0 9 NM_008905 protein tyrosine phosphatase receptor-type, F 12 8 2 NM_008609 matrix metallopeptidase 15 12 3 6 NM_198300 cytoplasmic polyadenylation element binding 12 4 4 NM_011708 von Willebrand factor 12 4 4 NM_027470 p21-activated protein kinase 4 12 3 5 NM_201365 hypothetical protein LOC381337 12 3 5 NM_011066 period homolog 2 12 3 5 NM_178886 low density lipoprotein receptor class A domain 12 1 7 NM_008878 serine or cysteine proteinase inhibitor clade 12 5 2 NM_001037707 zinc finger protein 27 12 3 4 NM_010095 early B-cell factor 2 12 2 5 NM_152915 delta/notch-like EGF-related receptor 12 5 1 NM_007397 activin receptor IIB 12 3 3 NM_008434 potassium voltage-gated channel subfamily Q, 12 1 5 NM_028875 X-ray repair complementing defective repair in 12 1 5 NM_178756 plasticity-related protein 3 12 4 1 NM_177270 cyclin-dependent kinase-like 2 CDC2-related 12 0 5 NM_016846 ral guanine nucleotide dissociation 12 2 2 NM_008253 high mobility group box 3 12 3 1 NM_008490 lecithin cholesterol acyltransferase 12 3 1 NM_144546 zinc finger protein 119 12 1 3 NM_028679 interleukin-1 receptor-associated kinase 3 12 1 3 NM_001098799 TOX high mobility group box family member 2 12 3 0 NM_172051 transmembrane and coiled coil domains 3 12 1 2 NM_001081435 F-box protein 47 12 0 2 NM_183221 FAT tumor suppressor homolog 4 12 1 0 NM_019982 seizure related 6 homolog like 12 1 0 NM_009690 CD5 antigen-like precursor 12 1 0 NM_010346 growth factor receptor bound protein 7 12 0 1 NM_026862 CD177 antigen 12 0 0 NM_134158 Cd300D antigen 12 641 1661 NM_011313 S100 calcium binding protein A6 calcyclin 12 567 4 NM_026819 dehydrogenase/reductase SDR family member 1 12 90 440 NM_053214 myosin IF 12 311 43 NM_007746 mitogen-activated protein kinase kinase kinase 12 261 17 NM_025661 ORM1-like 3 12 198 61 NM_146040 transcription factor RAM2 12 242 3 NM_008398 integrin alpha 7 12 182 11 NM_183408 phosphodiesterase 4A cAMP specific isoform 5 12 153 18 NM_008212 L-3-hydroxyacyl-Coenzyme A dehydrogenase 12 168 0 NM_001083880 hypothetical protein LOC67912 12 152 6 NM_008907 peptidylprolyl isomerase A 12 37 76 NM_145926 mannoside acetylglucosaminyltransferase 4 12 4 106 NM_145470 DEP domain containing 6 isoform a 12 79 31 NM_025975 dynein light chain Tctex-type 3 12 56 47 NM_013825 lymphocyte antigen 75 12 61 35 NM_001079901 replication initiator 1 12 63 20 NM_025901 polymerase RNA III (DNA directed) polypeptide 12 61 15 NM_175562 RAB39 member RAS oncogene family 12 58 18 NM_011966 proteasome prosome macropain subunit, alpha 12 48 26 NM_009820 runt related transcription factor 2 12 69 5 NM_008102 GTP cyclohydrolase 1 12 66 7 NM_029555 glutathione S-transferase kappa 1 12 60 10 NM_001010836 NFkB interacting protein 1 12 59 9 NM_199467 hypothetical protein LOC212377 12 53 13 NM_008995 peroxin 5 isoform 1 12 7 58 NM_001015046 GTPase activating RANGAP domain-like 4 12 61 3 NM_133749 RIKEN cDNA 2900064A13 12 38 21 NM_029160 sperm associated antigen 16 isoform 1 12 55 0 NM_001081176 polymerase RNA III (DNA directed) polypeptide 12 22 31 NM_201609 zinc finger protein 652 12 26 26 NM_001081201 dpy-19-like 4 12 32 17 NM_020561 acid sphingomyelinase-like phosphodiesterase 3a 12 17 31 NM_145974 Nedd4 binding protein 3 12 26 22 NM_009502 vinculin 12 18 26 NM_174868 hypothetical protein LOC215708 12 29 12 NM_025885 lung cancer metastasis-related protein 1 12 9 32 NM_177025 Cobl-like 1 12 37 4 NM_028836 chitobiase di-N-acetyl- 12 34 6 NM_024221 pyruvate dehydrogenase lipoamide beta 12 32 8 NM_027134 mitochondrial methionyl-tRNA formyltransferase 12 16 24 NM_146067 hypothetical protein LOC223978 12 26 12 NM_181072 myosin IE 12 28 9 NM_028505 hypothetical protein LOC73327 12 30 7 NM_178395 zinc finger DHHC domain containing 2 12 27 9 NM_001025594 zinc finger protein 297B isoform b 12 32 4 NM_016684 zinc finger protein 96 12 19 16 NM_207247 peptidoglycan recognition protein 3 12 25 9 NM_010395 histocompatibility 2 T region locus 10 12 30 4 NM_025968 leukotriene B4 12-hydroxydehydrogenase 12 10 24 NM_183287 hypothetical protein LOC70458 12 9 25 NM_001013379 hypothetical protein LOC234358 12 24 9 NM_175177 3-hydroxybutyrate dehydrogenase type 1 12 31 0 NM_016883 proteasome prosome macropain 26S subunit, 12 8 24 NM_053269 Rad51 homolog c 12 8 23 NM_010839 mature T-cell proliferation 1 isoform b 12 27 1 NM_025370 hypothetical protein LOC66129 12 23 5 NM_011877 protein tyrosine phosphatase non-receptor type 12 10 17 NM_024241 kinesin family member 24 12 1 26 NM_175380 glycerol-3-phosphate dehydrogenase 1-like 12 23 4 NM_023526 kappaB-Ras1 protein 12 16 9 NM_029420 GIY-YIG domain containing 2 12 14 11 NM_080843 suppressor of cytokine signalling 4 12 22 4 NM_024239 Stam binding protein 12 10 15 NM_153396 microtubule associated monoxygenase calponin 12 12 12 NM_172255 bromodomain and WD repeat domain containing 2 12 11 13 NM_172303 PHD zinc finger protein Jade1 12 22 1 NM_133687 CXXC finger 5 12 19 3 NM_029826 haloacid dehalogenase-like hydrolase domain 12 16 6 NM_015755 hormonally upregulated Neu-associated kinase 12 3 18 NM_177816 SH2 domain containing 4B 12 2 18 NM_016744 phosphodiesterase 1A calmodulin-dependent 12 9 11 NM_008803 phosphodiesterase 8A 12 16 4 NM_001081260 tankyrase 1 binding protein 1 12 12 8 NM_023465 catenin beta interacting protein 1 12 16 2 NM_026139 armadillo repeat containing X-linked 2 12 11 7 NM_001007570 solute carrier family 25 member 42 12 1 16 NM_025492 hypothetical protein LOC66330 12 4 12 NM_009346 TEA domain family member 1 12 3 12 NM_023737 L-specific multifunctional beta-oxdiation 12 3 12 NM_027770 procollagen type XXIV, alpha 1 12 9 7 NM_013692 Kruppel-like factor 10 12 15 0 NM_008297 heat shock factor 2 12 13 2 NM_172586 zinc finger protein 322a 12 4 10 NM_145553 hypothetical protein LOC230789 12 3 11 NM_172516 receptor interacting protein kinase 5 12 10 5 NM_018729 CD244 natural killer cell receptor 2B4 12 7 8 NM_001045540 hypothetical protein LOC620913 12 5 9 NM_009555 zinc finger protein 40 12 13 1 NM_009834 CCR4 carbon catabolite repression 4-like 12 3 10 NM_001081330 dynein axonemal, heavy chain 2 12 2 11 NM_177259 disabled homolog 1 isoform 2 12 9 5 NM_206856 transforming acidic coiled-coil containing 12 9 5 NM_027264 zinc finger protein 715 12 0 13 NM_010501 interferon-induced protein with 12 8 6 NM_001102471 cyclin M2 isoform b 12 8 6 NM_175642 brain-specific angiogenesis inhibitor 3 12 8 6 NM_144814 REST corepressor 3 12 7 7 NM_174875 autophagy-related 4A-like 12 13 0 NM_172716 polycomb group ring finger 3 12 4 9 NM_001081125 GLI-Kruppel family member GLI2 12 2 10 NM_177390 myosin ID 12 2 10 NM_018760 solute carrier family 4 anion exchanger 12 3 9 NM_007396 activin receptor IIA precursor 12 7 6 NM_012026 Rho-guanine nucleotide exchange factor 12 5 7 NM_053185 collagen type IV, alpha 6 12 12 0 NM_007506 ATP synthase H+ transporting, mitochondrial F0 12 9 3 NM_008615 malic enzyme 1 NADP+-dependent, cytosolic 12 4 7 NM_007431 alkaline phosphatase 2 liver precursor 12 2 9 NM_029022 secernin 3 12 3 8 NM_001008420 cadherin 12 12 7 4 NM_028711 solute carrier family 25 member 27 12 2 8 NM_172804 synaptotagmin XVI 12 5 4 NM_001081234 phosphatidylinositol glycan anchor biosynthesis 12 4 5 NM_025380 eukaryotic translation elongation factor 1 12 3 6 NM_145467 integrin beta-like 1 12 9 0 NM_028959 centrosomal protein 72 12 0 9 NM_011652 titin isoform N2-A 12 3 5 NM_010348 glutamate receptor ionotropic, kainate 1 12 3 5 NM_001033257 phosphatase and actin regulator 2 12 3 5 NM_001109985 C-terminal PDZ domain ligand of neuronal nitric 12 1 7 NM_001038607 potassium voltage-gated channel subfamily H, 12 8 0 NM_001077684 hypothetical protein LOC75051 12 2 5 NM_021879 pink-eyed dilution protein 12 2 5 NM_001033167 solute carrier family 22 member 23 12 1 6 NM_001033208 hypothetical protein LOC102371 12 7 0 NM_177643 zinc finger protein 281 12 4 2 NM_001004066 zinc finger protein 386 Kruppel-like isoform 12 0 6 NM_175442 hypothetical protein LOC213438 12 5 0 NM_153413 dedicator of cyto-kinesis 3 12 3 2 NM_010063 dynein cytoplasmic 1 intermediate chain 1 12 1 4 NM_001081064 PDZ domain containing 2 12 0 5 NM_133218 zinc finger protein 704 12 2 2 NM_011158 protein kinase cAMP dependent regulatory, type 12 2 2 NM_029044 leucine rich repeat containing 48 12 1 3 NM_001012325 zinc finger protein 708 isoform a 12 0 4 NM_199311 C-type lectin domain family 4 member a1 12 2 1 NM_031199 transforming growth factor alpha 12 2 1 NM_181390 musculoskeletal embryonic nuclear protein 1 12 2 1 NM_177774 serine-arginine repressor protein 12 0 3 NM_019958 regulator of G-protein signaling 17 12 1 0 NM_008999 RAB23 member RAS oncogene family 12 0 1 NM_011136 POU domain class 2, associating factor 1 12 0 1 NM_028728 NFAT activation molecule 1 protein 11 7979 94 NM_010370 granzyme A 11 541 6 NM_020590 gamma-aminobutyric acid GABA(A) 11 340 17 NM_013614 ornithine decarboxylase structural 1 11 291 23 NM_024175 ribosomal protein S23 11 282 2 NM_015817 phosphatidic acid phosphatase type 2c 11 22 227 NM_016696 glypican 1 11 220 9 NM_145478 proviral integration site 3 11 138 26 NM_007915 etoposide induced 2.4 11 157 5 NM_013754 insulin-like 6 11 153 4 NM_027106 Esau protein 11 106 0 NM_028336 transmembrane protein 107 isoform 2 11 82 21 NM_053267 selenoprotein M precursor 11 87 9 NM_145150 protein regulator of cytokinesis 1 11 79 16 NM_021498 DNA polymerase epsilon subunit 3 11 76 9 NM_027249 hypothetical protein LOC380712 11 68 13 NM_026172 24-dienoyl CoA reductase 1, mitochondrial 11 75 5 NM_028597 THO complex 3 11 11 66 NM_019833 hypothetical protein LOC56279 11 59 17 NM_025537 Ts translation elongation factor mitochondrial 11 66 9 NM_026832 cell growth regulator with ring finger domain 1 11 70 5 NM_134099 F-box protein 4 11 62 10 NM_133878 regulator of chromosome condensation 1 11 59 11 NM_026421 E-1 enzyme 11 62 7 NM_144517 TBC1 domain family member 19 11 28 41 NM_007706 suppressor of cytokine signaling 2 11 28 40 NM_023141 torsin family 3 member A 11 36 28 NM_027135 SEC24 related gene family member D 11 54 8 NM_001110242 hypothetical protein LOC208501 11 59 2 NM_178066 hypothetical protein LOC73827 11 34 26 NM_008722 nucleophosmin 1 11 28 31 NM_133710 CTD carboxy-terminal domain RNA polymerase II, 11 52 8 NM_023418 phosphoglycerate mutase 1 11 43 15 NM_173430 fukutin related protein 11 43 14 NM_025515 coiled-coil domain containing 90B 11 41 16 NM_001037916 coiled-coil domain containing 17 11 52 5 NM_021524 pre-B-cell colony-enhancing factor 1 11 48 7 NM_008251 high mobility group nucleosomal binding domain 11 32 22 NM_013863 Bcl2-associated athanogene 3 11 52 0 NM_001081054 glutaminyl-tRNA synthase 11 36 14 NM_021439 carbohydrate sulfotransferase 11 11 31 18 NM_025823 prenylcysteine oxidase 1 11 47 1 NM_013632 purine-nucleoside phosphorylase 11 14 34 NM_033476 transcription factor CP2 11 39 9 NM_026310 mitochondrial ribosomal protein L18 11 29 18 NM_001076681 hypothetical protein LOC66274 11 31 14 NM_011939 heat shock transcription factor 4 11 32 12 NM_018880 tripartite motif protein 3 11 37 8 NM_011863 3'-phosphoadenosine 5'-phosphosulfate synthase 11 38 6 NM_145131 pitrilysin metallepetidase 1 11 17 22 NM_001081419 disco interacting protein 2 homolog 11 29 9 NM_175318 SPT2 Suppressor of Ty, domain containing 1 11 18 18 NM_145460 oxidoreductase NAD-binding domain containing 1 11 29 7 NM_023217 pyroglutamyl-peptidase I 11 27 6 NM_025431 hypothetical protein LOC66225 11 26 7 NM_026437 hypothetical protein LOC67894 11 23 9 NM_025581 hypothetical protein LOC66468 11 23 9 NM_001033194 general transcription factor IIIC polypeptide 11 28 3 NM_025934 RIO kinase 2 11 10 20 NM_199025 zinc finger and BTB domain containing 26 11 8 22 NM_001024931 hexaribonucleotide binding protein 3 isoform 3 11 5 23 NM_013829 phospholipase C beta 4 11 27 1 NM_019783 leprecan 1 isoform 2 11 2 25 NM_026443 mitochondrial protein 18 kDa 11 11 15 NM_153559 quiescin Q6 sulfhydryl oxidase 2 11 13 12 NM_177376 myosin IIIB 11 22 3 NM_172501 NHL repeat containing 3 11 19 5 NM_025471 hypothetical protein LOC66291 11 17 7 NM_054089 nuclear receptor coactivator 6 interacting 11 15 9 NM_026268 dual specificity phosphatase 6 11 7 17 NM_172385 zinc finger protein 536 11 19 4 NM_031177 WD repeat domain 10 11 12 11 NM_001081112 ankyrin repeat domain 26 11 8 15 NM_028651 transmembrane and tetratricopeptide repeat 11 15 7 NM_021530 solute carrier family 4 anion exchanger 11 14 8 NM_013876 ring finger protein 11 11 4 17 NM_001080708 hypothetical protein LOC69553 11 4 16 NM_016697 glypican 3 11 15 5 NM_178267 hypothetical protein LOC622675 11 15 5 NM_023670 insulin-like growth factor 2 mRNA binding 11 11 9 NM_019551 Traf and Tnf receptor associated protein 11 18 1 NM_053081 Fanconi anemia complementation group G 11 17 2 NM_027164 leucine rich repeat containing 27 11 16 3 NM_001029856 ATPase family AAA domain containing 5 11 8 11 NM_178795 histidine acid phosphatase domain containing 2A 11 8 11 NM_172627 geranylgeranyltransferase type I 11 4 13 NM_133195 bruno-like 4 RNA binding protein 11 4 12 NM_153539 DBCCR1-like 11 2 14 NM_173447 Eph receptor B1 11 9 8 NM_026028 coiled-coil domain containing 77 11 0 16 NM_001024721 hypothetical protein LOC545384 11 8 9 NM_175386 lipoma HMGIC fusion partner 11 15 0 NM_181325 solute carrier family 25 mitochondrial carrier 11 15 0 NM_013533 G protein-coupled receptor 162 11 7 9 NM_177173 hypothetical protein LOC320492 11 13 2 NM_181854 hypothetical protein LOC101994 11 4 10 NM_017467 zinc finger protein 316 11 11 4 NM_181796 glutathione S-transferase pi 2 11 9 6 NM_016964 stromal antigen 3 11 7 8 NM_001031811 potassium voltage-gated channel subfamily H 11 10 4 NM_145841 sarcoglycan zeta 11 8 6 NM_177278 l3mbt-like 4 11 4 9 NM_008170 glutamate receptor ionotropic, NMDA2A epsilon 11 1 11 NM_013748 cytokine-dependent hematopoietic cell linker 11 9 4 NM_130880 OTU domain containing 7 11 5 7 NM_178789 transmembrane protein 117 11 4 8 NM_008032 AF4/FMR2 family member 2 11 12 0 NM_029198 hypothetical protein LOC75180 11 2 9 NM_001042752 neogenin isoform 2 11 9 3 NM_177076 F-box and leucine-rich repeat protein 13 11 4 7 NM_026642 tRNA methyltransferase 12 homolog 11 3 8 NM_001081385 protocadherin 11 X-linked 11 9 2 NM_145938 ribonuclease P 40kDa subunit 11 7 4 NM_173397 fat-inducing transcript 2 11 8 3 NM_008587 c-mer proto-oncogene tyrosine kinase 11 4 6 NM_146042 ring finger protein 144B 11 4 6 NM_001081414 glutamate receptor metabotropic 5 11 2 8 NM_172921 hypothetical protein LOC244853 11 0 9 NM_023689 sparc/osteonectin cwcv and kazal-like domains 11 7 3 NM_010607 potassium channel subfamily K, member 2 11 5 4 NM_019926 X-linked myotubular myopathy gene 1 11 3 6 NM_010636 Kruppel-like factor 12 11 3 6 NM_001080814 FAT tumor suppressor homolog 3 11 7 2 NM_001081388 RIMS binding protein 2 11 5 3 NM_029001 elongation of very long chain fatty acids-like 11 2 6 NM_017379 tubulin alpha 8 11 4 3 NM_010195 leucine rich repeat containing G protein coupled 11 3 4 NM_001085518 hypothetical protein LOC381417 11 2 5 NM_023275 ras homolog gene family member J 11 2 5 NM_001100395 otoferlin isoform 1 11 1 6 NM_181850 glutamate receptor metabotropic 3 11 5 1 NM_007801 cathepsin H preproprotein 11 5 1 NM_013514 erythrocyte protein band 4.9 11 4 2 NM_198422 progestin and adipoQ receptor family member III 11 4 2 NM_001039684 Meckel syndrome type 1 11 2 4 NM_175535 Rho GTPase activating protein 20 11 3 3 NM_001004761 G protein-coupled receptor 158 11 3 3 NM_183263 RNA methyltransferase like 1 11 0 6 NM_001081190 gamma-aminobutyric acid GABA receptor rho 3 11 4 1 NM_174850 MICAL-like 2 11 3 2 NM_175272 neuron navigator 2 isoform 1 11 2 3 NM_172565 kelch-like 11 11 0 5 NM_146249 hypothetical protein LOC240120 11 3 1 NM_175449 hypothetical protein LOC215900 11 1 3 NM_011060 peptidyl arginine deiminase type III 11 0 4 NM_173391 tryptophan hydroxylase 2 11 3 0 NM_009450 tubulin beta 2 11 2 1 NM_009108 nuclear receptor subfamily 1 group H, member 4 11 0 2 NM_145217 DIRAS family GTP-binding RAS-like 1 11 0 2 NM_001097979 H2b histone family member A 11 1 0 NM_175207 ankyrin repeat domain 9 11 1 0 NM_020051 achaete-scute complex homolog 3 11 1 0 NM_172264 choline dehydrogenase 11 1 0 NM_001009819 alpha 13-galactosyltransferase 2 11 0 1 NM_028238 Rab38 member of RAS oncogene family 10 1680 12 NM_019814 HIG1 domain family member 1A 10 313 8 NM_026467 ribosomal protein S27-like 10 185 18 NM_010362 glutathione S-transferase omega 1 10 146 9 NM_009818 catenin alpha 1 10 151 0 NM_144899 ADAMTS-like 4 10 99 26 NM_030693 ativating transcription factor 5 10 74 32 NM_198645 coiled-coil domain containing 58 10 94 5 NM_028883 hypothetical protein LOC74347 10 91 6 NM_010806 myeloid/lymphoid or mixed lineage-leukemia 10 74 22 NM_008797 pyruvate carboxylase 10 42 53 NM_146119 hypothetical protein LOC227737 10 80 3 NM_018854 intraflagellar transport protein IFT20 10 37 43 NM_007891 E2F transcription factor 1 10 60 18 NM_145497 cDNA sequence BC016495 10 63 10 NM_028060 solute carrier family 35 member F2 10 57 16 NM_153484 thyrotroph embryonic factor isoform 2 10 36 37 NM_145583 FGF receptor activating protein 1 10 60 9 NM_001113374 molybdopterin synthase isoform Mocs2B 10 18 43 NM_172266 lysophosphatidylglycerol acyltransferase 1 10 52 8 NM_030116 mitochondrial ribosomal protein L9 10 55 4 NM_027400 lectin mannose-binding, 1 10 58 0 NM_001081162 solute carrier family 4 sodium bicarbonate 10 48 9 NM_025909 OMA1 homolog zinc metallopeptidase 10 10 48 NM_026102 dishevelled associated activator of 10 50 8 NM_178926 vimentin-type IF-associated coiled-coil protein 10 31 22 NM_145442 MAP3K12 binding inhibitory protein 1 10 41 10 NM_172282 transmembrane and coiled-coil domains 3 10 48 3 NM_024194 leucine rich repeat containing 40 10 47 3 NM_025686 RNA polymerase III transcription initiation 10 22 27 NM_001081212 insulin receptor substrate 2 10 13 36 NM_027195 castor homolog 1 zinc finger 10 38 10 NM_172687 coenzyme Q3 homolog methyltransferase 10 45 3 NM_178603 mitochondrial ribosomal protein L50 10 38 9 NM_144549 tribbles homolog 1 10 33 12 NM_172767 loss of heterozygosity 11, chromosomal region 10 37 9 NM_054087 solute carrier family 19 thiamine transporter 10 38 8 NM_029610 LYR motif containing 1 10 38 7 NM_019965 DnaJ Hsp40 homolog subfamily B, member 12 10 5 39 NM_028757 nebulette 10 32 10 NM_054048 REST corepressor 2 10 37 6 NM_026281 transmembrane 7 superfamily member 3 10 40 1 NM_009810 caspase 3 10 40 1 NM_025856 hypothetical protein LOC66938 10 23 17 NM_001033198 ankrin repeat domain 50 10 30 9 NM_009579 solute carrier family 30 zinc transporter 10 33 6 NM_026184 endoplasmic oxidoreductase 1 beta 10 25 14 NM_008222 holocytochrome c synthetase 10 13 26 NM_010617 kinesin family member 13A 10 19 17 NM_025716 SPRY domain containing 4 10 27 9 NM_010360 glutathione S-transferase mu 5 10 10 26 NM_001110195 enoyl Coenzyme A hydratase domain containing 1 10 24 10 NM_027017 hypothetical protein LOC69277 10 22 12 NM_139139 DnaJ Hsp40 homolog subfamily C, member 17 10 32 1 NM_022029 neurogranin 10 11 22 NM_026112 zinc finger protein 606 isoform 1 10 30 1 NM_181391 coiled-coil-helix-coiled-coil-helix domain 10 13 18 NM_026073 RAB member of RAS oncogene family-like 5 10 23 8 NM_001099637 centrosomal protein 170 10 22 9 NM_026409 DEAD Asp-Glu-Ala-Asp box polypeptide 55 10 29 1 NM_010952 ornithine decarboxylase antizyme 2 10 20 9 NM_008565 minichromosome maintenance complex component 4 10 25 5 NM_010109 ephrin A5 isoform 2 10 13 16 NM_011599 transducin-like enhancer protein 1 10 9 20 NM_026577 ADP-ribosylation factor-like 13B 10 4 24 NM_178891 HMT1 hnRNP methyltransferase-like 6 10 1 26 NM_001005422 hypothetical protein LOC380842 10 4 21 NM_172920 dpy-19-like 1 10 1 22 NM_175657 histone cluster 1 H4m 10 20 2 NM_178610 HIV-1 Rev binding protein 2 10 19 3 NM_012057 interferon regulatory factor 5 10 16 6 NM_138650 diacylglycerol kinase gamma 10 8 14 NM_010394 histocompatibility 2 Q region locus 7 10 20 1 NM_001044718 zinc finger protein 41 10 20 1 NM_007754 carboxypeptidase D 10 10 11 NM_172562 transcriptional adaptor 2 ADA2 homolog 10 7 14 NM_019501 prenyl diphosphate synthase subunit 1 10 7 14 NM_153063 zinc finger protein 472 10 2 18 NM_008782 paired box gene 5 10 15 5 NM_178922 hypermethylated in cancer 2 10 5 14 NM_010852 myelin basic protein expression factor 2 10 13 7 NM_010142 Eph receptor B2 10 11 9 NM_023363 hypothetical protein LOC67607 10 3 16 NM_001033669 F-box and WD-40 domain protein 10 10 9 10 NM_021466 TATA box binding protein Tbp-associated 10 11 8 NM_011366 sorbin and SH3 domain containing 3 10 1 16 NM_026818 cartilage intermediate layer protein 2 10 8 9 NM_011217 protein tyrosine phosphatase receptor type, R 10 4 12 NM_001012623 regulating synaptic membrane exocytosis 1 10 4 12 NM_053105 kelch-like 1 10 12 5 NM_139303 kinesin family member 18A 10 1 15 NM_001109043 zinc finger protein 185 isoform b 10 5 10 NM_172474 tRNA-yW synthesizing protein 3 homolog 10 2 13 NM_173446 transmembrane protein 28 10 9 7 NM_001077499 sodium channel voltage-gated, type VIII, alpha 10 2 12 NM_175387 RNA binding motif protein 9 isoform 2 10 7 8 NM_001044308 calcium channel voltage-dependent, alpha 1I 10 5 9 NM_178675 solute carrier family 35 member F1 10 4 9 NM_001081153 unc13 homolog 3 10 5 8 NM_001025074 neurotrophic tyrosine kinase receptor, type 2 10 2 10 NM_001081299 cadherin 18 10 2 10 NM_134087 hypothetical protein LOC105732 10 1 11 NM_023727 hypothetical protein LOC74023 10 9 4 NM_025681 limb expression 1 10 8 5 NM_053099 SET binding protein 1 10 8 5 NM_009623 adenylate cyclase 8 10 5 7 NM_172442 deltex 4 homolog 10 2 9 NM_178256 RalBP1 associated Eps domain containing protein 10 1 10 NM_198610 immunoglobin superfamily member 21 10 9 3 NM_177123 KPL2 protein 10 4 7 NM_172263 phosphodiesterase 8B 10 11 0 NM_015772 sal-like 2 10 2 9 NM_174853 disrupted in schizophrenia 1 isoform 2 10 2 9 NM_001033872 small trans-membrane and glycosylated protein 10 3 8 NM_016972 solute carrier family 7 cationic amino acid 10 1 9 NM_001098233 purine-rich element binding protein G isoform b 10 8 3 NM_010531 interleukin 18 binding protein 10 4 6 NM_001033148 hypothetical protein LOC69479 10 0 9 NM_019413 roundabout homolog 1 10 8 2 NM_001081277 adenylate kinase 5 10 7 3 NM_178589 tumor necrosis factor receptor superfamily 10 5 4 NM_175484 coronin actin binding protein, 2B 10 2 7 NM_031183 trans-acting transcription factor 6 10 2 7 NM_011878 T-cell lymphoma invasion and metastasis 2 10 1 8 NM_001024717 galactose-3-O-sulfotransferase 3 10 1 8 NM_001112796 bicaudal D homolog 1 isoform 1 10 5 3 NM_026408 synuclein alpha interacting protein 10 4 4 NM_173784 dendritic cell-derived ubiquitin-like protein 10 1 7 NM_021483 peroxisomal biogenesis factor 5-like 10 4 3 NM_029648 hypothetical protein LOC76539 10 4 3 NM_145839 RasGEF domain family member 1B isoform 1 10 2 5 NM_145506 erythrocyte protein band 4.1-like 5 isoform 1 10 1 6 NM_181277 procollagen type XIV, alpha 1 10 0 7 NM_146016 hypothetical protein LOC237711 10 0 7 NM_001113545 LIM domain and actin binding 1 isoform a 10 7 0 NM_027478 hypothetical protein LOC70612 10 7 0 NM_029408 IQ motif containing D 10 4 2 NM_011748 zinc finger protein 14 10 2 4 NM_027294 CKLF-like MARVEL transmembrane domain containing 10 2 4 NM_001081328 chondroitin sulfate synthase 3 10 5 0 NM_032002 neuregulin 4 10 3 2 NM_009770 B-cell translocation gene 3 10 1 4 NM_010016 decay accelerating factor 1 10 1 4 NM_198957 hypothetical protein LOC77604 10 2 2 NM_080555 phosphatidic acid phosphatase type 2B 10 1 3 NM_001003948 hypothetical protein LOC98496 10 1 3 NM_174876 interphotoreceptor matrix proteoglycan 2 10 3 0 NM_008148 glycoprotein 5 platelet 10 2 1 NM_027924 platelet-derived growth factor D polypeptide 10 1 2 NM_013869 tumor necrosis factor receptor superfamily 10 1 2 NM_010140 Eph receptor A3 10 1 2 NM_009390 tolloid-like 10 2 0 NM_012040 pregnancy upregulated non-ubiquitously expressed 10 2 0 NM_018821 suppressor of cytokine signaling 6 10 1 1 NM_138628 muscle specific protein 10 1 1 NM_173014 lysophosphatidylcholine acyltransferase 2 10 0 2 NM_133358 zinc finger protein 617 10 0 2 NM_053216 hypothetical protein LOC112418 10 0 2 NM_029772 cation channel sperm associated 3 10 1 0 NM_178199 histone cluster 1 H2bl 10 0 1 NM_010271 glycerol-3-phosphate dehydrogenase 1 soluble 10 0 1 NM_001033170 hypothetical protein LOC73813 10 0 0 NM_001081687 hypothetical protein LOC381484 10 0 0 NM_183313 hypothetical protein LOC330602 9 403 9 NM_010259 guanylate nucleotide binding protein 1 9 322 7 NM_025439 transmembrane protein 9 9 281 41 NM_007450 solute carrier family 25 mitochondrial carrier 9 7 191 NM_028841 tetraspanin 17 9 113 72 NM_175493 G protein-coupled receptor 68 9 153 26 NM_026635 family with sequence similarity 96 member A 9 144 21 NM_177388 solute carrier family 41 member 2 9 129 22 NM_145535 syndecan binding protein syntenin 2 9 142 4 NM_001101433 hypothetical protein LOC71918 9 54 90 NM_175088 MyoD family inhibitor domain containing protein 9 117 24 NM_023326 brain expressed myelocytomatosis oncogene 9 114 23 NM_021494 Rab6 interacting protein 1 9 115 10 NM_026892 eukaryotic translation initiation factor 1B 9 62 61 NM_001045513 Ras association RalGDS/AF-6 and pleckstrin 9 89 22 NM_025964 hypothetical protein LOC67099 9 103 8 NM_025951 phosphatidylinositol 4-kinase type 2 beta 9 101 7 NM_177564 short-chain dehydrogenase/reductase 9 104 1 NM_026592 hypothetical protein LOC68170 9 100 4 NM_178661 cAMP responsive element binding protein 3-like 9 96 6 NM_026565 apolipoprotein O-like 9 91 5 NM_001013377 hypothetical protein LOC230098 9 76 20 NM_175036 leptin receptor overlapping transcript 9 89 1 NM_026412 TRAF4 associated factor 1 homolog 9 80 9 NM_026791 F-box and WD-40 domain protein 9 9 15 71 NM_025404 ADP-ribosylation factor-like 4D 9 52 27 NM_001001986 hypothetical protein LOC329540 9 75 3 NM_025935 TBC1 domain family member 7 9 48 29 NM_080428 F-box and WD-40 domain protein 7 archipelago 9 60 14 NM_009551 zinc finger AN1-type domain 5 9 67 8 NM_028117 dermatan-4-sulfotransferase-1 9 60 8 NM_197986 transmembrane protein 140 9 61 6 NM_017466 lipopolysaccharide inducible C-C chemokine 9 67 0 NM_001043228 terminal deoxynucleotidyltransferase isoform 2 9 60 6 NM_011218 protein tyrosine phosphatase receptor type, S 9 65 1 NM_027009 replication factor C activator 1 3 9 54 10 NM_175002 hypothetical protein LOC216829 9 45 18 NM_001033468 G protein-coupled receptor 114 9 48 11 NM_021308 piwi like homolog 2 9 53 4 NM_023122 glycoprotein m6b 9 13 41 NM_001081151 giant axonal neuropathy 9 47 6 NM_133704 SEC22 vesicle trafficking protein homolog A 9 43 9 NM_017470 dynein axonemal, light chain 4 9 44 6 NM_011075 ATP-binding cassette sub-family B MDR/TAP, 9 23 26 NM_029447 neurolysin metallopeptidase M3 family 9 46 1 NM_027289 5'-nucleotidase domain containing 2 9 46 1 NM_013917 pituitary tumor-transforming 1 9 41 3 NM_029271 mitochondrial ribosomal protein L32 9 41 2 NM_029770 unc-5 homolog B 9 36 6 NM_198326 p47 protein 9 37 2 NM_012019 apoptosis-inducing factor 9 11 27 NM_026377 hypothetical protein LOC67788 9 34 4 NM_019543 Down syndrome critical region protein c 9 19 18 NM_177884 hypothetical protein LOC330361 9 18 19 NM_026670 zinc finger MYM domain containing 1 9 16 20 NM_001113478 ferric-chelate reductase 1 9 30 6 NM_172285 phospholipase C gamma 2 9 7 28 NM_016723 ubiquitin carboxyl-terminal esterase L3 9 30 5 NM_025391 Saccharomyces cerevisiae Nip7p homolog 9 10 25 NM_008737 neuropilin 1 9 25 9 NM_001080926 low density lipoprotein receptor-related protein 9 30 3 NM_019768 mortality factor 4 like 2 9 25 7 NM_015753 zinc finger homeobox 1b isoform 2 9 20 10 NM_134082 FERMRhoGEF Arhgef and pleckstrin domain 9 15 15 NM_010889 nebulin 9 22 9 NM_025747 hypothetical protein LOC66756 9 4 25 NM_026640 hypothetical protein LOC107373 9 11 17 NM_173030 UDP-N-acetyl-alpha-D-galactosamine:polypeptide 9 14 12 NM_022999 proline-rich Gla G-carboxyglutamic acid 9 22 5 NM_146074 transcription factor B1 mitochondrial 9 20 6 NM_028058 FUN14 domain containing 1 9 16 9 NM_023472 ankyrin repeat family A RFXANK-like, 2 9 5 18 NM_181394 anaphase promoting complex subunit 13 9 13 10 NM_001081075 hypothetical protein LOC70567 9 17 6 NM_178723 zinc finger protein 385B isoform 1 9 9 14 NM_007530 B-cell receptor-associated protein 29 9 16 7 NM_153059 transmembrane protein 5 9 5 17 NM_133235 KH domain-containing RNA-binding, signal 9 22 1 NM_177699 formin homology 2 domain containing 1 9 12 10 NM_025410 Eso3 protein 9 19 2 NM_001033759 transmembrane protein 2 9 9 12 NM_026276 aminoadipate-semialdehyde 9 4 16 NM_177889 zinc finger protein 82 9 10 10 NM_001081223 retinoblastoma binding protein 8 9 9 11 NM_133746 hypothetical protein LOC72691 9 16 4 NM_133435 nicotinamide nucleotide adenylyltransferase 1 9 8 12 NM_173022 hypothetical protein LOC270802 9 15 5 NM_054099 hypothetical protein LOC117171 9 4 15 NM_145934 signal transducing adaptor family member 2 9 17 2 NM_145381 lactamase beta 2 9 17 2 NM_011081 phosphatidylinositol glycan class A 9 9 10 NM_148939 lymphocyte antigen 6 complex G5B 9 8 11 NM_001033324 zinc finger and BTB domain containing 16 9 2 16 NM_001024720 hemicentin 1 9 15 3 NM_027530 RUN and FYVE domain containing 3 9 7 11 NM_013787 S-phase kinase-associated protein 2 isoform a 9 13 5 NM_177449 leucine rich repeat containing 29 9 12 6 NM_001008501 zinc finger protein 760 9 14 3 NM_019992 signal transducing adaptor family member 1 9 4 12 NM_025999 ring finger protein 141 9 12 5 NM_001005788 zinc finger protein 69 9 1 15 NM_018887 cytochrome P450 family 39, subfamily a, 9 5 10 NM_198090 heterogeneous nuclear ribonucleoprotein A3 9 15 0 NM_025945 polymerase RNA III (DNA directed) polypeptide 9 8 8 NM_001012451 ankyrin repeat domain 6 9 3 11 NM_173426 hypothetical protein LOC242297 9 13 1 NM_028538 hypothetical protein LOC73430 9 4 9 NM_001099633 dynein axonemal, heavy chain 9 9 12 2 NM_009936 procollagen type IX, alpha 3 9 2 11 NM_173431 Rpgrip1-like 9 10 4 NM_153391 WD repeat domain 19 9 9 5 NM_027745 coiled-coil domain containing 57 9 5 8 NM_025863 mouse RING finger 1 9 5 8 NM_001098528 potassium voltage gated channel Shab-related 9 5 8 NM_177644 RAS protein activator like 2 9 5 8 NM_175606 HOP homeobox 9 13 0 NM_175324 acyl-Coenzyme A dehydrogenase family member 11 9 13 0 NM_144786 gamma-glutamyltransferase-like 3 9 9 4 NM_026655 hypothetical protein LOC68277 9 5 7 NM_007738 procollagen type VII, alpha 1 9 4 8 NM_194335 hypothetical protein LOC71254 9 2 9 NM_018873 Snap-25-interacting protein 9 10 2 NM_020594 zinc finger CCCH type containing 8 9 0 11 NM_001039239 hypothetical protein LOC630579 9 8 4 NM_001013024 ubiquitin specific protease 13 isopeptidase 9 5 6 NM_027061 zona pellucida binding protein 2 isoform 1 9 4 7 NM_030731 tripartite motif protein 23 9 4 7 NM_181595 protein phosphatase 1 regulatory inhibitor 9 3 8 NM_172823 leishmanolysin-like metallopeptidase M8 9 7 4 NM_001013369 prefoldin 4 isoform 2 9 1 9 NM_052976 oligophrenin 1 9 1 9 NM_008767 solute carrier family 22 organic cation 9 0 9 NM_181040 ATP synthase mitochondrial F1 complex assembly 9 0 9 NM_001005858 similar to interferon-induced protein with 9 0 9 NM_175418 myosin binding protein C slow type 9 4 5 NM_008792 proprotein convertase subtilisin/kexin type 2 9 3 6 NM_024474 EMI domain containing 2 9 2 7 NM_001024918 regulatory factor X 4 isoform 1 9 2 7 NM_172752 sorbin and SH3 domain containing 2 9 2 7 NM_183180 tetraspanin 18 9 1 8 NM_026886 hypothetical protein LOC68955 9 2 6 NM_001038610 dachshund 1 isoform 2 9 3 5 NM_001025576 hypothetical protein LOC545428 9 3 5 NM_026345 MANSC domain containing 1 9 5 2 NM_199016 ectonucleotide pyrophosphatase/phosphodiesterase 9 2 5 NM_130457 contactin associated protein-like 4 9 2 5 NM_028052 synaptoporin 9 1 6 NM_007424 aggrecan 9 0 7 NM_001081358 leucine rich repeat containing 7 9 0 7 NM_172496 cordon-bleu protein 9 5 1 NM_172775 plexin B1 9 4 2 NM_172710 hypothetical protein LOC231238 9 2 4 NM_080285 cortactin binding protein 2 9 2 4 NM_001113209 nuclear factor I/B isoform 1 9 2 4 NM_028806 phosphatase and actin regulator 3 isoform 1 9 2 4 NM_011641 transformation related protein 63 9 3 3 NM_028657 hypothetical protein LOC73822 9 3 3 NM_011061 peptidyl arginine deiminase type IV 9 1 5 NM_008329 interferon activated gene 204 9 3 2 NM_008650 methylmalonyl-Coenzyme A mutase 9 3 2 NM_010404 huntingtin-associated protein 1 9 2 3 NM_175420 hypothetical protein LOC109280 9 2 3 NM_172440 syntaxin binding protein 5-like isoform xb 9 2 3 NM_023051 calsyntenin 1 9 2 3 NM_007940 epoxide hydrolase 2 cytoplasmic 9 0 5 NM_001001186 zinc finger protein 456 9 0 5 NM_011934 estrogen related receptor beta 9 0 5 NM_153131 netrin receptor Unc5h1 9 2 2 NM_015764 Greb1 protein 9 2 2 NM_011299 ribosomal protein S6 kinase polypeptide 2 9 2 2 NM_145123 cartilage acidic protein 1 9 2 2 NM_011515 vesicle-associated membrane protein 7 9 1 3 NM_009622 adenylate cyclase 1 9 1 3 NM_016678 reversion-inducing-cysteine-rich protein with 9 1 3 NM_001012305 solute carrier family 39 zinc transporter 9 0 4 NM_031397 bicaudal C homolog 1 9 3 0 NM_030211 potassium channel tetramerisation domain 9 2 1 NM_027544 gametogenetin binding protein 1 9 2 1 NM_026251 protein associated with topoisomerase II homolog 9 1 2 NM_148935 forkhead box N4 9 0 3 NM_153596 transmembrane protein 17 9 1 1 NM_010631 kinesin family member C3 9 0 2 NM_008926 protein kinase cGMP-dependent, type II 9 0 2 NM_023709 calpain 9 nCL-4 9 0 2 NM_001079847 G protein-coupled receptor 64 isoform 3 9 0 2 NM_030022 galectin-related inter-fiber protein 9 0 1 NM_145490 hypothetical protein LOC224893 9 0 1 NM_172835 pellino 3 9 0 1 NM_021921 mitogen-activated protein kinase 8 interacting 9 0 1 NM_010186 Fc receptor IgG, high affinity I 9 0 0 NM_172850 ankyrin repeat and MYND domain containing 1 9 0 0 NM_001081254 predicted gene EG545136 8 395 4 NM_025779 coiled-coil domain containing 109B 8 367 11 NM_019980 LPS-induced TN factor 8 348 18 NM_134076 abhydrolase domain containing 4 8 9 283 NM_023056 LR8 protein 8 218 12 NM_013870 smoothelin 8 155 14 NM_008638 methylenetetrahydrofolate dehydrogenase NAD+ 8 140 3 NM_007749 cytochrome c oxidase subunit VIIc 8 111 11 NM_026362 hypothetical protein LOC67759 8 99 20 NM_001048054 dual specificity phosphatase 16 isoform B1 8 81 32 NM_009058 ral guanine nucleotide dissociation stimulator 8 102 8 NM_173347 PRUNEM1 8 86 11 NM_033080 nudix nucleoside diphosphate linked moiety 8 59 36 NM_010137 endothelial PAS domain protein 1 8 47 44 NM_007467 amyloid precursor-like protein 1 8 19 71 NM_026578 nucleolar protein family A member 1 8 57 29 NM_009884 CCAAT/enhancer binding protein gamma 8 76 9 NM_007504 ATPase Ca++ transporting, fast twitch 1 8 84 0 NM_018861 solute carrier family 1 glutamate/neutral amino 8 75 6 NM_029519 RAP2A member of RAS oncogene family 8 65 16 NM_001033328 cDNA sequence BC023829 8 71 1 NM_177601 transmembrane protein 60 8 58 11 NM_025522 retinal short-chain dehydrogenase/reductase 4 8 56 13 NM_031863 centromere protein Q 8 66 2 NM_025329 Tctex1 domain containing 2 8 54 8 NM_024434 leucine aminopeptidase 3 8 51 10 NM_146116 tubulin beta 2c 8 44 16 NM_026126 FUN14 domain containing 2 8 54 5 NM_133764 ATPase H+ transporting, V0 subunit 8 11 47 NM_026149 NudC domain containing 1 isoform 1 8 53 5 NM_001042674 RNA binding protein gene with multiple splicing 8 28 23 NM_146206 two pore segment channel 2 8 43 6 NM_009655 activated leukocyte cell adhesion molecule 8 47 1 NM_013463 alpha-galactosidase A 8 23 22 NM_144535 hypothetical protein LOC74385 8 28 15 NM_027868 solute carrier family 41 member 3 isoform 1 8 18 25 NM_026572 glycine cleavage system protein H aminomethyl 8 32 10 NM_172288 nucleoporin 133 8 33 7 NM_194269 MORN repeat containing 2 8 37 2 NM_001002896 beaded filament structural protein 2 phakinin 8 33 5 NM_011226 RAB19 member RAS oncogene family 8 18 19 NM_026121 BCL2-associated athanogene 4 8 24 13 NM_018883 calcium/calmodulin-dependent protein kinase 8 16 20 NM_178724 hypothetical protein LOC241547 8 11 25 NM_175524 hypothetical protein LOC243407 8 22 13 NM_001035123 SET domain containing 6 8 32 2 NM_001113211 transmembrane protein 194 isoform 1 8 28 6 NM_133840 ATP/GTP-binding protein 8 20 13 NM_001033451 zinc finger protein 408 8 27 7 NM_019660 c-myc binding protein 8 24 9 NM_001033419 CEA-related cell adhesion molecule 16 8 5 26 NM_007975 coagulation factor II thrombin receptor-like 8 14 17 NM_017397 DEAD Asp-Glu-Ala-Asp box polypeptide 20 8 30 1 NM_027266 RNA guanine-9- methyltransferase domain 8 27 4 NM_030132 hypothetical protein LOC78581 8 3 27 NM_001081445 neural cell adhesion molecule 1 isoform 1 8 19 10 NM_178375 zinc finger SWIM domain containing 3 8 12 18 NM_001081368 TBCC domain containing 1 8 9 21 NM_029330 fucose-1-phosphate guanylyltransferase 8 20 9 NM_011163 eukaryotic translation initiation factor 2-alpha 8 25 4 NM_001113559 SRY sex determining region Y-box 5 isoform b 8 28 0 NM_145946 Fanconi anemia complementation group I 8 23 5 NM_026992 zinc finger CSL-type containing 3 8 23 3 NM_001015681 hypothetical protein LOC230259 isoform 2 8 20 5 NM_026159 all-trans-1314-dihydroretinol saturase 8 13 11 NM_025651 asteroid homolog 1 8 19 5 NM_026314 dyslexia susceptibility 1 candidate 1 homolog 8 3 21 NM_001081411 sodium channel associated protein 1 8 24 0 NM_026865 hypothetical protein LOC73635 8 15 9 NM_009758 bone morphogenetic protein receptor type 1A 8 16 8 NM_178668 2'-phosphodiesterase 8 4 18 NM_153122 5-oxoprolinase ATP-hydrolysing 8 10 11 NM_012010 eukaryotic translation initiation factor 2 8 1 20 NM_175677 tripartite motif protein TRIM5 8 13 8 NM_001081036 predicted gene EG668668 8 20 0 NM_026758 M phase phosphoprotein 6 8 1 19 NM_145142 carbohydrate sulfotransferase 10 8 8 12 NM_028349 spindle assembly 6 8 15 5 NM_009171 serine hydroxymethyltransferase 1 soluble 8 15 5 NM_001103171 myosin XV isoform 3 8 14 6 NM_025997 hypothetical protein LOC67148 8 14 5 NM_019716 origin recognition complex subunit 6-like 8 9 9 NM_001081413 unc-13 homolog B 8 14 4 NM_199302 leucine rich repeat and sterile alpha motif 8 5 12 NM_030705 mesoderm development candidate 1 8 4 13 NM_007854 solute carrier family 29 nucleoside 8 16 1 NM_024195 cytochrome b5 reductase 4 8 7 10 NM_172805 potassium voltage-gated channel subfamily H, 8 8 9 NM_001081431 zinc finger protein 498 8 5 11 NM_145568 lysine-rich coiled-coil 1 8 11 6 NM_178848 sirtuin 5 silent mating type information 8 5 10 NM_001104646 hypothetical protein LOC105351 8 3 12 NM_177724 hypothetical protein LOC240945 8 9 7 NM_173739 UDP-N-acetyl-alpha-D-galactosamine:polypeptide 8 5 9 NM_001110843 calcium channel voltage-dependent, alpha2/delta 8 4 10 NM_133791 WW C2 and coiled-coil domain containing 2 8 4 10 NM_001083587 tensin 3 8 2 12 NM_028934 hypothetical protein LOC74430 8 2 11 NM_021325 CD200 receptor 1 8 9 5 NM_138593 La ribonucleoprotein domain family member 7 8 7 7 NM_175473 Fras1 protein 8 13 0 NM_001081110 CD8 antigen alpha chain 8 10 3 NM_022816 acyl-CoA thioesterase 10 8 7 6 NM_207541 zinc finger protein 81 8 8 5 NM_026665 translokin 8 8 5 NM_026531 interferon stimulated exonuclease gene 20-like 8 3 9 NM_028228 PIN2/TRF1-interacting protein 8 9 3 NM_009090 polymerase RNA II (DNA directed) polypeptide 8 9 3 NM_001081263 solute carrier family 44 member 5 8 2 9 NM_175501 a disintegrin-like and metalloprotease 8 3 8 NM_182716 neurofascin 8 10 1 NM_207238 F-box only protein 27 8 9 2 NM_009624 adenylate cyclase 9 8 7 4 NM_010575 integrin alpha 2b 8 5 5 NM_053195 solute carrier family 24 8 3 7 NM_001081977 ring finger protein 144 8 1 9 NM_001039347 potassium voltage-gated channel Shal-related 8 1 9 NM_172987 Na+/K+ transporting ATPase interacting 3 8 8 2 NM_183321 hypothetical protein LOC333193 8 4 5 NM_001037997 fer fms/fps related protein kinase testis 8 4 5 NM_146035 mannoside acetylglucosaminyltransferase 2 8 4 5 NM_007977 coagulation factor VIII 8 3 6 NM_013760 DnaJ Hsp40 homolog subfamily B, member 9 8 3 6 NM_172124 galactosylgalactosylxylosylprotein 8 2 7 NM_028310 hypothetical protein LOC72650 8 2 7 NM_013476 androgen receptor 8 1 8 NM_198649 actin binding LIM protein family member 3 8 1 8 NM_025408 phytoceramidase alkaline 8 5 3 NM_147221 GLIS family zinc finger 1 8 4 4 NM_139300 myosin light polypeptide kinase 8 4 4 NM_134042 aldehyde dehydrogenase family 6 subfamily A1 8 4 4 NM_019790 transmembrane protein with EGF-like and two 8 2 6 NM_001034874 hypothetical protein LOC380702 8 3 5 NM_178705 leucine zipper protein 2 8 3 5 NM_009484 tetratricopeptide repeat protein 8 1 7 NM_001081024 SET domain bifurcated 2 8 1 7 NM_001081017 hypothetical protein LOC217843 8 8 0 NM_153162 thioredoxin reductase 3 8 7 1 NM_011398 solute carrier family 25 mitochondrial carrier 8 7 1 NM_030215 Werner helicase interacting protein 1 8 5 2 NM_007461 amyloid beta A4 precursor protein-binding 8 3 4 NM_183029 insulin-like growth factor 2 mRNA binding 8 3 4 NM_177167 protein phosphatase 1E PP2C domain containing 8 2 5 NM_009250 serine or cysteine proteinase inhibitor clade 8 2 5 NM_008480 laminin alpha 1 precursor 8 2 5 NM_177698 pleckstrin and Sec7 domain containing 3 isoform 8 2 5 NM_007739 procollagen type VIII, alpha 1 8 0 7 NM_007547 signal-regulatory protein alpha 8 0 7 NM_016668 betaine-homocysteine methyltransferase 8 7 0 NM_145826 interleukin 17 receptor E isoform 1 8 5 1 NM_008642 microsomal triglyceride transfer protein 8 4 2 NM_175560 hypothetical protein LOC269997 8 2 4 NM_172858 p21 CDKN1A-activated kinase 7 8 1 5 NM_033603 amnionless 8 1 5 NM_008137 guanine nucleotide binding protein alpha 14 8 1 5 NM_153800 Rho GTPase activating protein 22 8 1 5 NM_011579 T-cell specific GTPase 8 4 1 NM_001040699 myotubularin related protein 7 8 3 2 NM_144921 Na+/K+ -ATPase alpha 3 subunit 8 1 4 NM_001034907 zinc finger CCCH-type containing 12B 8 0 5 NM_011139 POU domain class 2, transcription factor 3 8 0 5 NM_008489 lipopolysaccharide-binding protein 8 4 0 NM_011054 phosphodiesterase 1C isoform a 8 2 2 NM_009900 chloride channel 2 8 3 1 NM_025332 GTP-binding protein 8 8 1 3 NM_013813 erythrocyte protein band 4.1-like 3 8 1 3 NM_029394 sorting nexing 24 8 1 3 NM_001033347 hypothetical protein LOC241589 8 1 3 NM_001081665 coiled-coil domain containing 129 8 0 4 NM_009841 CD14 antigen 8 0 4 NM_001033304 hypothetical protein LOC229722 8 0 4 NM_008664 myomesin 2 8 0 4 NM_015760 NADPH oxidase 4 8 3 0 NM_008089 GATA binding protein 1 8 2 1 NM_001042418 calcium-binding tyrosine-phosphorylation 8 2 1 NM_146052 leucine rich repeat containing 3B 8 2 1 NM_013705 zinc finger protein 30 8 1 2 NM_201529 LIM domain only 7 8 1 2 NM_183094 X-linked lymphocyte-regulated 4C 8 0 3 NM_133823 methylmalonic aciduria type A 8 2 0 NM_175667 ankyrin repeat domain protein 5 8 1 1 NM_011376 single-minded homolog 1 8 1 1 NM_026290 hypothetical protein LOC67645 8 1 1 NM_207685 ELAV-like 2 isoform 1 8 0 2 NM_172966 SH3 domain containing ring finger 2 8 0 2 NM_001102446 aminolevulinic acid synthase 2 erythroid 8 1 0 NM_172286 hypothetical protein LOC234797 8 1 0 NM_175259 transmembrane protein 58 8 1 0 NM_178615 RGM domain family member B 8 1 0 NM_033567 cat eye syndrome chromosome region candidate 6 8 0 1 NM_025357 small muscle protein X-linked 8 0 1 NM_007807 cytochrome b-245 beta polypeptide 8 0 1 NM_198114 diacylglycerol lipase alpha 8 0 1 NM_145968 T-cell activation Rho GTPase-activating protein 8 0 0 NM_172668 low density lipoprotein receptor-related protein 8 0 0 NM_198414 progestin and adipoQ receptor family member IX 8 0 0 NM_001013773 hypothetical protein LOC381680 8 0 0 NM_147218 ATP-binding cassette sub-family A ABC1, 7 5661 3819 NM_026820 interferon induced transmembrane protein 1 7 952 0 NM_019779 cytochrome P450 family 11, subfamily a, 7 431 1 NM_001002897 ATG9 autophagy related 9 homolog B 7 213 175 NM_198100 ProSAPiP2 protein 7 102 109 NM_010890 neural precursor cell expressed developmentally 7 185 20 NM_145491 ras homolog gene family member Q 7 175 14 NM_178396 carbonic anyhydrase 12 7 167 6 NM_026519 transmembrane protein 85 7 128 26 NM_001024837 adenosine deaminase RNA-specific, B1 isoform 2 7 134 2 NM_009920 cornichon homolog 2 7 130 6 NM_025449 nicolin 1 7 83 42 NM_011322 sodium channel voltage-gated, type I, beta 7 108 16 NM_010070 docking protein 1 7 2 103 NM_018805 D-glycosaminyl 3-O-sulfotransferase-3B 7 99 6 NM_028411 transmembrane protein 138 7 72 31 NM_175367 stonin 2 7 102 1 NM_028000 phosphatidic acid phosphatase type 2 domain 7 94 8 NM_181579 premature ovarian failure 1B 7 86 3 NM_021513 THAP domain containing 11 7 14 69 NM_010478 heat shock 70kDa protein 1B 7 11 71 NM_133500 netrin G2 isoform a 7 79 0 NM_183405 cytochrome c oxidase subunit VIb polypeptide 2 7 2 68 NM_177715 potassium channel tetramerization domain 7 58 9 NM_011197 prostaglandin F2 receptor negative regulator 7 53 9 NM_009226 small nuclear ribonucleoprotein D1 7 52 8 NM_001042541 A-kinase anchor protein 1 7 26 32 NM_025377 hypothetical protein LOC66140 7 29 28 NM_173402 regulator of G-protein signalling 12 7 28 28 NM_027472 hypothetical protein LOC70591 7 53 2 NM_001083903 suprabasin isoform 2 7 29 26 NM_012058 signal recognition particle 9 7 37 17 NM_025591 hypothetical protein LOC66488 7 27 26 NM_033079 hypothetical protein LOC110958 7 47 5 NM_007633 cyclin E1 7 50 2 NM_145496 dihydroxyacetone kinase 2 homolog 7 39 11 NM_027025 adenosine A3 receptor isoform 2 7 38 9 NM_026536 ATP synthase H+ transporting, mitochondrial F0 7 13 34 NM_080445 UDP-Gal:betaGal beta 13-galactosyltransferase, 7 33 13 NM_025826 acyl-Coenzyme A dehydrogenase short/branched 7 8 39 NM_007525 BRCA1 associated RING domain 1 7 29 17 NM_011656 tuftelin 1 7 33 12 NM_011862 protein kinase C and casein kinase substrate in 7 5 39 NM_025697 hypothetical protein LOC66674 7 41 3 NM_019537 Down syndrome critical region protein 2 7 40 4 NM_019998 alpha-13-mannosyltransferase ALG2 7 41 0 NM_008185 glutathione S-transferase theta 1 7 22 17 NM_028049 F-box protein 22 7 22 16 NM_001029936 sperm antigen with calponin homology and 7 36 1 NM_022030 synaptic vesicle glycoprotein 2 a 7 33 3 NM_011268 regulator of G-protein signaling 9 7 22 14 NM_197989 hypothetical protein LOC69109 7 34 1 NM_026951 peroxisomal biogenesis factor 11c 7 16 19 NM_019670 diaphanous homolog 3 7 9 26 NM_146257 solute carrier family 29 nucleoside 7 15 19 NM_183165 pyridine nucleotide-disulphide oxidoreductase 7 23 10 NM_026221 PTPRF interacting protein binding protein 1 7 14 19 NM_013778 aldo-keto reductase family 1 member C13 7 17 15 NM_008157 G protein-coupled receptor 19 7 23 9 NM_008326 immunity-related GTPase family M 7 7 25 NM_008252 high mobility group box 2 7 28 3 NM_026068 mediator of RNA polymerase II transcription 7 26 5 NM_176963 galactose mutarotase 7 29 1 NM_008021 forkhead box M1 7 1 28 NM_172903 mannosidase 2 alpha 2 7 14 14 NM_010633 U2AF homology motif UHM kinase 1 7 14 13 NM_008982 protein tyrosine phosphatase receptor type, J 7 20 7 NM_019968 ADP-ribosylation factor-like 10 7 16 10 NM_173378 tumor protein p53 binding protein 2 7 15 11 NM_026040 serum response factor binding protein 1 7 23 4 NM_013546 heme binding protein 1 7 16 9 NM_008857 protein kinase C iota 7 13 12 NM_008069 gamma-aminobutyric acid GABA-A receptor 7 19 4 NM_018775 TBC1 domain family member 8 7 4 18 NM_001025559 SRY sex determining region Y-box 6 isoform 2 7 11 11 NM_009855 CD80 antigen precursor 7 18 4 NM_011015 origin recognition complex subunit 1 isoform A 7 17 5 NM_170779 WW C2 and coiled-coil domain containing 1 7 7 15 NM_028128 replication factor C 5 7 20 1 NM_026465 hypothetical protein LOC67939 7 20 1 NM_010148 epsin 2 7 11 10 NM_026047 hypothetical protein LOC72486 7 8 13 NM_013835 TROVE domain family member 2 7 19 1 NM_010413 histone deacetylase 6 7 10 10 NM_134092 MDM2 Binding protein 7 16 4 NM_008249 transcription factor B2 mitochondrial 7 0 20 NM_001033322 guanylate cyclase 1 soluble, alpha 2 7 14 6 NM_177561 ubiquitin specific peptidase 46 7 15 4 NM_011133 DNA polymerase epsilon subunit 2 7 7 12 NM_018789 forkhead box O4 7 14 5 NM_008844 phosphatidylinositol-4-phosphate 5-kinase type 7 5 13 NM_021374 regulator of G-protein signaling 20 7 4 14 NM_025921 hypothetical protein LOC67028 7 3 15 NM_178200 histone cluster 1 H2bm 7 17 1 NM_001012401 heat shock protein alpha-crystallin-related, 7 13 5 NM_028922 phosphatidic acid phosphatase type 2 domain 7 7 10 NM_001112722 Rho guanine nucleotide exchange factor GEF 7 13 4 NM_080558 sperm specific antigen 2 7 13 4 NM_173390 NHS-like 1 7 13 4 NM_031403 debranching enzyme homolog 1 7 2 14 NM_173746 hypothetical protein LOC208820 7 15 1 NM_139140 spermatogenesis associated serine-rich 2 7 13 3 NM_181542 schlafen 10 7 13 3 NM_020570 X-ray repair complementing defective repair in 7 3 12 NM_033605 dachshund 2 7 1 14 NM_177372 DNA replication helicase 2 homolog 7 5 9 NM_027192 tubulin tyrosine ligase 7 5 9 NM_025905 tetratricopeptide repeat domain 23 7 8 7 NM_008613 meiosis-specific nuclear structural protein 1 7 3 10 NM_001008232 development and differentiation enhancing 7 11 3 NM_145425 hypothetical protein LOC216560 7 10 4 NM_027885 single-strand selective monofunctional uracil 7 10 4 NM_010692 ladybird homeobox homolog 2 7 7 7 NM_010825 homeobox protein Meis2 7 7 7 NM_008280 lipase hepatic 7 5 8 NM_027838 SUMO/sentrin specific peptidase 8 7 5 8 NM_172870 basonuclin 2 7 4 9 NM_011539 thromboxane A synthase 1 platelet 7 4 9 NM_009472 unc-5 homolog C 7 11 2 NM_153582 CKLF-like MARVEL transmembrane domain containing 7 12 1 NM_001033302 hypothetical protein LOC229599 7 2 10 NM_010243 fucosyltransferase 9 7 10 3 NM_007885 solute carrier family 26 sulfate transporter 7 4 8 NM_009723 plasma membrane calcium ATPase 2 isoform 1 7 12 0 NM_026772 CDC42 effector protein Rho GTPase binding 2 7 3 9 NM_001040459 shroom family member 4 7 2 9 NM_172964 Rho GTPase activating protein 28 7 10 2 NM_178630 carboxypeptidase 3 cytosolic 7 1 10 NM_178678 leucine-rich repeat transmembrane neuronal 3 7 1 10 NM_030699 netrin G1 isoform a 7 8 4 NM_030172 hypothetical protein LOC78767 7 7 5 NM_133669 retinitis pigmentosa 2 homolog 7 5 6 NM_001083934 myomesin 1 isoform 2 7 5 6 NM_152923 potassium voltage-gated channel subfamily Q, 7 5 6 NM_198037 cache domain containing 1 7 2 9 NM_010597 potassium voltage-gated channel shaker-related 7 3 8 NM_001081208 heparan sulfate glucosamine 7 3 8 NM_177353 solute carrier family 9 member 7 7 3 8 NM_181404 KN motif and ankyrin repeat domains 1 7 10 1 NM_027309 LysM putative peptidoglycan-binding, domain 7 1 9 NM_007729 procollagen type XI, alpha 1 7 1 9 NM_011760 zinc finger protein 54 7 5 5 NM_013512 erythrocyte protein band 4.1-like 4a 7 10 0 NM_009764 breast cancer 1 7 9 1 NM_175465 SEC14 and spectrin domains 1 7 9 1 NM_033524 sprouty-related protein 1 with EVH-1 domain 7 8 2 NM_019455 prostaglandin D2 synthase 2 hematopoietic 7 4 5 NM_029347 hypothetical protein LOC75578 isoform b 7 3 6 NM_025730 leucine-rich repeat kinase 2 7 3 6 NM_001039522 Leo1 Paf1/RNA polymerase II complex component, 7 1 8 NM_011243 retinoic acid receptor beta 7 1 8 NM_175643 a disintegrin-like and metalloprotease 7 0 9 NM_008751 neurexophilin 1 7 7 2 NM_178728 N-acyl phosphatidylethanolamine phospholipase D 7 7 2 NM_177111 coiled-coil domain containing 66 7 7 2 NM_029344 acylphosphatase 2 muscle type 7 4 4 NM_023128 paralemmin 7 2 6 NM_011995 piccolo isoform 1 7 2 6 NM_172477 DENN/MADD domain containing 2A 7 3 5 NM_001045533 membrane-associated ring finger C3HC4 4 7 3 5 NM_008483 laminin beta 2 7 1 7 NM_010200 fibroblast growth factor 13 7 1 7 NM_001034858 armadillo repeat containing 2 7 0 8 NM_009640 angiopoietin 1 7 8 0 NM_144895 spastic paraplegia 20 spartin Troyer syndrome 7 8 0 NM_173186 TBC1 domain family member 24 7 8 0 NM_007655 CD79A antigen immunoglobulin-associated alpha 7 5 2 NM_133700 K+ channel tetramerization protein 7 4 3 NM_001025373 hypothetical protein LOC74670 7 4 3 NM_010103 EGF-like repeats and discoidin I-like domains 3 7 4 3 NM_053070 carbonic anhydrase 7 7 3 4 NM_172154 ligand dependent nuclear receptor corepressor 7 3 4 NM_028848 spermatogenesis associated 17 7 2 5 NM_172378 hypothetical protein LOC210463 7 2 5 NM_028499 hypothetical protein LOC73314 7 2 5 NM_025555 hypothetical protein LOC66421 7 2 5 NM_009865 cadherin 10 7 1 6 NM_023878 claudin 10 isoform a 7 0 7 NM_022017 transient receptor potential cation channel 7 0 7 NM_001033165 hypothetical protein LOC72429 7 0 7 NM_009152 semaphorin 3A 7 0 7 NM_001111143 prochymosin 7 0 7 NM_001001187 hypothetical protein LOC408068 7 2 4 NM_021889 synaptotagmin IX 7 2 4 NM_026496 transcription factor CP2-like 3 7 2 4 NM_183289 transcription elongation regulator 1-like 7 3 3 NM_008426 potassium inwardly-rectifying channel subfamily 7 1 5 NM_025850 fibronectin type 3 and ankyrin repeat domains 1 7 1 5 NM_001077354 hypothetical protein LOC245555 7 1 5 NM_009506 vascular endothelial growth factor C 7 0 6 NM_025282 myocyte enhancer factor 2C 7 5 0 NM_030890 NG5 protein 7 4 1 NM_172467 zinc finger CCCH-type antiviral 1-like 7 3 2 NM_025447 dimethyladenosine transferase 7 3 2 NM_008935 prominin 1 7 3 2 NM_001081421 UDP-N-acetyl-alpha-D-galactosamine:polypeptide 7 3 2 NM_029494 RAB30 member RAS oncogene family 7 2 3 NM_001033253 pleckstrin homology domain containing family G 7 2 3 NM_025419 hypothetical protein LOC66202 7 1 4 NM_011162 mitogen-activated protein kinase 8 interacting 7 1 4 NM_024244 hypothetical protein LOC71721 7 0 5 NM_173029 adenylate cyclase 10 7 0 5 NM_011410 schlafen 4 7 0 5 NM_173370 CDP-diacylglycerol synthase 1 7 4 0 NM_152823 unc-5 homolog C C. elegans-like 7 4 0 NM_203345 leukocyte tyrosine kinase isoform D 7 2 2 NM_175506 a disintegrin-like and metalloprotease 7 2 2 NM_172706 hypothetical protein LOC231014 7 2 2 NM_177092 methionine-R-sulfoxide reductase B3 7 2 2 NM_144853 cysteine and tyrosine-rich protein 1 7 3 1 NM_001024910 septin 10 isoform 1 7 1 3 NM_029620 procollagen C-endopeptidase enhancer 2 7 1 3 NM_001081327 heparan sulfate D-glucosaminyl 7 1 3 NM_197996 tetraspanin 15 7 1 3 NM_001031772 lin-28 homolog b 7 3 0 NM_178702 Rap GTPase interactor 7 3 0 NM_198191 phosphatidylinositol-4-phosphate 5-kinase-like 7 3 0 NM_020014 glial cell line derived neurotrophic factor 7 2 1 NM_011059 peptidyl arginine deiminase type I 7 2 1 NM_011576 tissue factor pathway inhibitor 7 2 1 NM_018795 ATP-binding cassette sub-family C, member 6 7 1 2 NM_053152 killer cell lectin-like receptor subfamily A 7 1 2 NM_172537 sema domain transmembrane domain TM, and 7 0 3 NM_013753 paladin 7 0 3 NM_001002268 G protein-coupled receptor 126 7 0 3 NM_010407 hemopoietic cell kinase isoform p59Hck 7 0 3 NM_030127 HtrA serine peptidase 3 isoform a precursor 7 2 0 NM_001081437 fibulin 2 isoform b 7 1 1 NM_010077 dopamine receptor 2 7 1 1 NM_021424 poliovirus receptor-related 1 7 1 1 NM_013866 zinc finger protein 385 7 0 2 NM_008509 lipoprotein lipase 7 0 2 NM_176973 podocalyxin-like 2 7 0 2 NM_024264 cytochrome P450 family 27, subfamily a, 7 1 0 NM_183216 stearoyl-CoA desaturase 4 7 1 0 NM_021511 RRS1 ribosome biogenesis regulator homolog 7 1 0 NM_009139 chemokine C-C motif ligand 6 7 1 0 NM_001004363 NUAK family SNF1-like kinase, 1 7 0 1 NM_001039104 transient receptor potential cation channel 7 0 1 NM_007960 ets variant gene 1 7 0 1 NM_001113388 sodium-dependent glucose transporter 1 isoform 7 0 1 NM_001012330 zinc finger protein 238 isoform 1 7 0 1 NM_178874 transmembrane and coiled-coil domains 2 7 0 1 NM_145636 interleukin 27 7 0 1 NM_144559 Fc receptor IgG, low affinity IV 7 0 0 NM_175347 sarcalumenin 7 0 0 NM_207000 H2A histone family member Y2 7 0 0 NM_001110778 a disintegrin and metallopeptidase domain 11 7 0 0 NM_001013774 hypothetical protein LOC381686 7 0 0 NM_133903 spondin 2 extracellular matrix protein 6 323 6 NM_008303 heat shock protein 1 chaperonin 10 6 253 4 NM_010406 hemolytic complement 6 133 69 NM_029631 abhydrolase domain containing 14b 6 166 4 NM_027154 transmembrane BAX inhibitor motif containing 1 6 156 9 NM_026029 glyoxalase domain containing 4 6 104 31 NM_008563 minichromosome maintenance deficient 3 6 97 9 NM_027404 BCL2-associated athanogene 5 6 90 13 NM_025922 inosine triphosphatase 6 20 80 NM_026580 OTU domain ubiquitin aldehyde binding 2 6 59 38 NM_019718 ADP-ribosylation factor-like 3 6 80 11 NM_133255 hook homolog 2 6 85 2 NM_008964 prostaglandin E receptor 2 subtype EP2 6 73 13 NM_146254 WD repeat domain 78 6 81 5 NM_007951 enhancer of rudimentary homolog 6 73 3 NM_001033329 Cdc42 guanine nucleotide exchange factor GEF 6 32 39 NM_138953 elongation factor RNA polymerase II 2 6 50 16 NM_026667 hypothetical protein LOC68303 6 61 3 NM_178856 DNA replication complex GINS protein PSF2 6 59 5 NM_010477 heat shock protein 1 chaperonin 6 42 10 NM_133930 cysteine-rich with EGF-like domains 1 6 12 40 NM_008149 glycerol-3-phosphate acyltransferase 6 42 9 NM_146104 anterior pharynx defective 1a homolog 6 45 5 NM_001081396 WD repeat domain 67 6 47 2 NM_010620 kinesin family member 15 6 31 16 NM_010212 four and a half LIM domains 2 6 15 31 NM_001004364 development and differentiation enhancing factor 6 36 9 NM_008209 histocompatibility-2 complex class 1-like 6 27 18 NM_025866 cell division cycle associated 7 6 39 6 NM_026393 NmrA-like family domain containing 1 6 15 29 NM_011370 cytoplasmic FMR1 interacting protein 1 6 36 8 NM_023040 growth factor erv1 S. cerevisiae-like 6 27 16 NM_010615 kinesin family member 11 6 19 19 NM_172607 nicotinate phosphoribosyltransferase domain 6 33 5 NM_028017 N-ethylmaleimide sensitive fusion protein 6 31 6 NM_172574 PQ loop repeat containing 6 33 0 NM_019984 transglutaminase 1 K polypeptide 6 24 9 NM_001001309 integrin alpha 8 6 20 12 NM_008874 phospholipase C beta 3 6 27 6 NM_026779 molybdenum cofactor sulfurase 6 26 6 NM_009940 demethyl-Q 7 6 29 2 NM_026503 hypothetical protein LOC68002 6 30 0 NM_024169 FK506 binding protein 11 6 28 2 NM_008994 peroxin 2 6 28 2 NM_010957 8-oxoguanine DNA-glycosylase 1 6 11 19 NM_201368 X Kell blood group precursor related family 6 15 14 NM_145916 zinc finger protein 7 6 13 16 NM_175332 hypothetical protein LOC103551 6 3 26 NM_001037099 calcium channel voltage-dependent, beta 4 6 22 7 NM_026633 hypothetical protein LOC68241 6 19 9 NM_011207 protein tyrosine phosphatase non-receptor type 6 18 9 NM_134131 tumor necrosis factor alpha-induced protein 8 6 17 10 NM_007646 CD38 antigen 6 7 21 NM_001033168 hypothetical protein LOC73449 6 14 13 NM_001039390 cAMP-dependent protein kinase inhibitor gamma 6 26 1 NM_175215 LysM putative peptidoglycan-binding, domain 6 22 5 NM_138744 synovial sarcoma X breakpoint 2 interacting 6 19 7 NM_178638 transmembrane protein 108 6 9 17 NM_001040399 La ribonucleoprotein domain family member 2 6 24 1 NM_019641 stathmin 1 6 24 1 NM_028626 methylmalonyl CoA epimerase 6 7 17 NM_023697 alcohol dehydrogenase PAN2 6 22 2 NM_021398 solute carrier family 43 member 3 6 22 2 NM_020486 basal cell adhesion molecule 6 22 0 NM_001033244 Fanconi anemia complementation group D2 6 5 16 NM_172865 mannosidase endo-alpha 6 13 9 NM_009516 wee 1 homolog 6 20 1 NM_028242 HIV TAT specific factor 1 6 5 15 NM_207530 oxysterol binding protein-like 1 6 13 8 NM_026082 dedicator of cytokinesis 7 6 20 0 NM_030016 coiled-coil domain containing 76 6 19 1 NM_016747 synapse-associated protein 102 6 7 13 NM_177225 sterile alpha motif domain containing 12 6 2 17 NM_008312 5-hydroxytryptamine serotonin receptor 2C 6 18 1 NM_177616 hypothetical protein LOC216516 6 18 1 NM_026798 hypothetical protein LOC68642 6 1 18 NM_008172 glutamate receptor ionotropic, NMDA2D epsilon 6 16 3 NM_033521 lysosomal-associated protein transmembrane 4B 6 4 14 NM_001039700 polycystic kidney disease 1 like 3 isoform a 6 4 14 NM_146108 3-hydroxyisobutyryl-Coenzyme A hydrolase 6 18 0 NM_028270 aldehyde dehydrogenase 1 family member B1 6 14 4 NM_008972 prothymosin alpha 6 12 6 NM_007999 flap structure specific endonuclease 1 6 17 0 NM_022654 leucine-rich and death domain containing 6 16 1 NM_019631 transmembrane protein 45a 6 7 10 NM_146179 zinc finger protein 418 6 7 10 NM_029891 NF-kappaB repressing factor 6 7 10 NM_172522 MEGF11 protein 6 13 4 NM_134111 ELL associated factor 2 isoform a 6 12 5 NM_016681 CHK2 checkpoint homolog 6 9 8 NM_139146 special AT-rich sequence binding protein 2 6 16 0 NM_029025 transmembrane protein 81 6 7 9 NM_174857 MAM domain containing 2 6 14 2 NM_028059 zinc finger protein 654 6 5 10 NM_029150 Nyd-sp12 protein isoform 2 6 1 14 NM_001043354 RAR-related orphan receptor beta isoform 1 6 7 9 NM_001013608 stretch responsive protein 278 6 8 8 NM_130449 collectin sub-family member 12 6 14 1 NM_009943 cytochrome c oxidase subunit VI a, polypeptide 6 11 4 NM_177546 phosphate cytidylyltransferase 1 choline, beta 6 5 9 NM_183167 hypothetical protein LOC233168 6 5 9 NM_001038609 microtubule-associated protein tau isoform a 6 4 9 NM_026825 leucine rich repeat containing 16 6 3 10 NM_144531 kazrin isoform 1 6 2 11 NM_177352 glycerol kinase 5 putative 6 8 6 NM_009558 zinc finger protein 51 6 2 10 NM_021323 ubiquitin specific peptidase 29 6 7 6 NM_001033345 hypothetical protein LOC241112 6 7 6 NM_153082 rab and DnaJ domain containing 6 8 5 NM_145555 hypothetical protein LOC230822 6 4 8 NM_153417 transient receptor potential cation channel 6 2 9 NM_001033633 solute carrier family 2 facilitated glucose 6 10 2 NM_054052 UDP-GlcNAc:betaGal 6 7 5 NM_012054 acyloxyacyl hydrolase 6 7 5 NM_032610 spectrin beta 4 6 5 6 NM_023792 pantothenate kinase 1 beta isoform 2 6 4 7 NM_021442 myelodysplasia syndrome 1 protein homolog 6 4 7 NM_009065 Ras-like without CAAX 2 6 2 9 NM_001033409 leucine-rich repeat-containing G protein-coupled 6 1 9 NM_001025584 potassium inwardly-rectifying channel J6 isoform 6 7 4 NM_153777 leucine rich repeat containing 56 6 8 3 NM_027100 RWD domain containing 2A 6 3 7 NM_030676 nuclear receptor subfamily 5 group A, member 2 6 3 7 NM_027864 UDP-N-acetyl-alpha-D-galactosamine:polypeptide 6 2 8 NM_011597 tight junction protein 2 6 2 8 NM_001005863 mitochondrial tumor suppressor 1 isoform 1 6 1 9 NM_008858 protein kinase C mu 6 1 9 NM_001081556 transmembrane protein 16C 6 7 3 NM_010336 endothelial differentiation lysophosphatidic 6 7 3 NM_007936 Eph receptor A4 6 4 5 NM_207255 zinc finger protein 532 6 3 6 NM_175013 phosphoglucomutase 5 6 3 6 NM_019465 cytotoxic and regulatory T cell molecule 6 3 6 NM_001033043 ring finger protein 17 6 2 7 NM_001014399 ABI gene family member 3 NESH binding protein 6 2 7 NM_007733 procollagen type XIX, alpha 1 6 2 7 NM_018852 sodium channel voltage-gated, type IX, alpha 6 2 7 NM_175110 hypothetical protein LOC66662 6 1 8 NM_207649 Down syndrome critical region gene 1-like 1 6 1 8 NM_146230 acetyl-Coenzyme A acyltransferase 1B 6 7 2 NM_011849 NIMA never in mitosis gene a-related expressed 6 5 3 NM_008634 microtubule-associated protein 1 B 6 5 3 NM_010408 hyperpolarization-activated cyclic 6 2 6 NM_028231 potassium large conductance calcium-activated 6 2 6 NM_001013385 glutamate receptor metabotropic 4 6 2 6 NM_011935 estrogen-related receptor gamma 6 3 5 NM_175032 hypothetical protein LOC270049 6 1 7 NM_153534 adenylate cyclase 2 6 1 7 NM_001080781 hypothetical protein LOC66501 isoform 2 6 7 1 NM_028097 transmembrane protein 68 6 2 5 NM_001113180 glutamate receptor ionotropic, AMPA 4 isoform 2 6 2 5 NM_010863 myosin IB 6 1 6 NM_028748 membrane progestin receptor gamma 6 1 6 NM_139138 EGF-like module containing mucin-like, hormone 6 0 7 NM_001110555 H2b histone family member 6 7 0 NM_027279 RIKEN cDNA 2810422O20 6 2 4 NM_172788 SH3 multiple domains 4 6 2 4 NM_028199 plexin domain containing 1 6 2 4 NM_001081348 HECT C2 and WW domain containing E3 ubiquitin 6 2 4 NM_011866 phosphodiesterase 10A 6 2 4 NM_028784 coagulation factor XIII A1 subunit 6 2 4 NM_013484 complement component 2 6 3 3 NM_001097644 cyclin Y-like 1 6 3 3 NM_001081088 low density lipoprotein receptor-related protein 6 3 3 NM_183191 phospholipase C eta 1 6 1 5 NM_027113 WD repeat domain 5B 6 1 5 NM_025685 procollagen type XXVII, alpha 1 6 1 5 NM_026527 ChaC cation transport regulator-like 2 6 1 5 NM_009932 procollagen type IV, alpha 2 6 0 6 NM_001033988 nuclear receptor coactivator 4 6 4 1 NM_001029868 PDZ domain containing 4 6 4 1 NM_021883 tropomodulin 1 6 3 2 NM_008949 proteasome prosome macropain 26S subunit, 6 3 2 NM_001111142 hypothetical protein LOC224813 6 3 2 NM_027725 WD repeat domain 69 6 3 2 NM_001007577 TFS2-M domain-containing protein 1 6 2 3 NM_001033281 PR domain containing 6 6 2 3 NM_175461 hypothetical protein LOC226610 6 2 3 NM_178663 hypothetical protein LOC209645 6 2 3 NM_028493 Rho-related BTB domain containing 3 6 2 3 NM_001081446 IQ motif containing K 6 2 3 NM_009948 carnitine palmitoyltransferase 1b muscle 6 2 3 NM_001113246 chimerin chimaerin 1 isoform 3 6 1 4 NM_029646 hypothetical protein LOC76527 6 1 4 NM_175006 POU domain class 6, transcription factor 2 6 1 4 NM_172913 TOX high mobility group box family member 3 6 1 4 NM_028747 hypothetical protein LOC74088 6 1 4 NM_001111314 neuronal guanine nucleotide exchange factor 6 0 5 NM_178642 transmembrane protein 16A 6 0 5 NM_030708 zinc finger homeodomain 4 6 4 0 NM_029988 phosphatidylinositol glycan anchor biosynthesis 6 4 0 NM_183315 cortexin 1 6 4 0 NM_145819 myeloid zinc finger 1 6 2 2 NM_175007 amphiphysin 6 2 2 NM_152814 zinc finger protein 566 6 2 2 NM_022814 polydom precursor 6 3 1 NM_025714 outer dense fiber of sperm tails 2-like 6 3 1 NM_183016 Cdc42 binding protein kinase beta 6 3 1 NM_001039557 hypothetical protein LOC629499 6 1 3 NM_025760 protein tyrosine phosphatase-like A domain 6 1 3 NM_001039137 short coiled-coil protein isoform a 6 1 3 NM_009866 cadherin 11 6 0 4 NM_145067 guanylate cyclase 2c 6 0 4 NM_011037 paired box gene 2 6 0 4 NM_001079690 solute carrier family 12 member 1 isoform F 6 0 4 NM_026328 regenerating islet-derived family member 4 6 3 0 NM_026458 ATP-binding cassette sub-family A ABC1, 6 3 0 NM_145613 C1q and tumor necrosis factor related protein 5 6 2 1 NM_031870 mutS homolog 4 6 2 1 NM_007556 bone morphogenetic protein 6 6 2 1 NM_008528 B-cell linker 6 2 1 NM_146102 actin filament associated protein 1-like 2 6 1 2 NM_146037 potassium channel subfamily K, member 13 6 1 2 NM_173068 synaptotagmin VII gamma isoform 6 1 2 NM_025807 solute carrier family 16 monocarboxylic acid 6 1 2 NM_145629 plastin 3 precursor 6 1 2 NM_181546 synaptotagmin XIV 6 1 2 NM_001033485 hypothetical protein LOC407789 6 0 3 NM_080465 small conductance calcium-activated potassium 6 0 3 NM_177407 calcium/calmodulin-dependent protein kinase II 6 0 3 NM_080438 glycine receptor alpha 3 subunit 6 0 3 NM_175138 dynein axonemal, intermediate chain 1 6 2 0 NM_013922 zinc finger protein 354C 6 2 0 NM_177822 hypothetical protein LOC328783 6 1 1 NM_026233 hypothetical protein LOC67555 6 1 1 NM_001077202 heparan sulfate 6-O-sulfotransferase 2 isoform 6 1 1 NM_134253 BCL2/adenovirus E1B 19kD interacting protein 6 1 1 NM_027102 endothelial cell-specific adhesion molecule 6 1 1 NM_012031 sperm associated antigen 1 6 0 2 NM_001101605 hypothetical protein LOC667373 isoform 2 6 0 2 NM_011792 beta-site APP cleaving enzyme 1 6 0 2 NM_016879 keratin complex 2 basic gene 18 6 0 2 NM_172539 astacin-like metalloendopeptidase 6 1 0 NM_030691 immunoglobulin superfamily member 6 6 0 1 NM_008227 hyperpolarization-activated cyclic 6 0 1 NM_001099275 tektin 5 6 0 1 NM_021544 voltage-gated sodium channel type V alpha 6 0 1 NM_177769 ELMO domain containing 1 6 0 1 NM_001025103 EF-hand calcium binding domain 4A 6 0 1 NM_183126 hypothetical protein LOC77883 6 0 0 NM_001048005 testes development-related NYD-SP22 isoform 1 6 0 0 NM_022413 transient receptor potential cation channel 6 0 0 NM_133211 toll-like receptor 7 6 0 0 NM_011178 proteinase 3 6 0 0 NM_030175 hypothetical protein LOC78772 5 6117 7 NM_009375 thyroglobulin 5 667 41 NM_008354 interleukin 12 receptor beta 2 5 324 2 NM_011454 serine or cysteine proteinase inhibitor clade 5 241 46 NM_080448 SLIT-ROBO Rho GTPase activating protein 3 5 206 1 NM_001101486 hypothetical protein LOC245884 5 183 2 NM_013538 cell division cycle associated 3 5 158 1 NM_016695 membrane protein palmitoylated 2 MAGUK p55 5 96 4 NM_025859 ADP-ribosylation factor-like 1 5 95 4 NM_011712 WW domain binding protein 5 5 71 21 NM_053254 transducin-like enhancer protein 6 5 72 12 NM_008197 H1 histone family member 0 5 74 7 NM_029766 denticleless homolog 5 70 9 NM_025460 transmembrane protein 126A 5 63 14 NM_054096 Toll-interleukin 1 receptor domain-containing 5 73 2 NM_026225 component of oligomeric golgi complex 6 5 70 4 NM_026883 hypothetical protein LOC68948 5 62 9 NM_001113379 leucine rich repeat containing 32 5 62 4 NM_025624 proteasome maturation protein 5 31 26 NM_181075 hypothetical protein LOC330173 5 36 21 NM_026517 ribosomal protein L22 like 1 5 51 2 NM_019647 ribosomal protein L21 5 34 13 NM_024168 tRNA splicing endonuclease 34 5 40 8 NM_021474 epidermal growth factor-containing fibulin-like 5 36 11 NM_024446 nudix nucleoside diphosphate linked moiety 5 26 18 NM_010093 E2F transcription factor 3 5 40 4 NM_201364 hypothetical protein LOC381306 5 16 26 NM_178732 zinc finger protein 324 5 16 26 NM_021288 thymidylate synthase 5 14 28 NM_031376 phosphoinositide-3-kinase adaptor protein 1 5 38 5 NM_025478 isochorismatase domain containing 1 5 28 13 NM_177030 dedicator of cytokinesis 6 5 1 37 NM_001082553 RAB27b member RAS oncogene family 5 16 22 NM_010638 Kruppel-like factor 9 5 36 2 NM_013662 sema domain transmembrane domain TM, and 5 32 5 NM_011972 polymerase DNA directed iota 5 27 9 NM_027269 hypothetical protein LOC109065 5 26 10 NM_028170 hypothetical protein LOC72254 5 30 6 NM_198012 tripartite motif containing 68 5 4 31 NM_026620 family with sequence similarity 98 member B 5 31 4 NM_153537 pleckstrin homology-like domain family B, 5 4 30 NM_026673 apolipoprotein O 5 27 8 NM_025820 crooked neck-like 1 protein 5 34 0 NM_198021 D10Ertd802e protein 5 4 28 NM_001081083 armadillo repeat containing 3 5 22 10 NM_145595 carbonic reductase 4 5 24 8 NM_029485 TATA-binding protein-like factor-interacting 5 8 24 NM_001039129 heterogeneous nuclear ribonucleoprotein A1 5 29 2 NM_178252 sorting nexin 26 5 28 3 NM_025642 2610039C10Rik protein 5 22 9 NM_027181 protein peptidyl-prolyl cis/trans isomerase 5 19 10 NM_199310 coiled-coil domain containing 32 5 28 1 NM_018882 G protein-coupled receptor 56 5 19 9 NM_177869 hypothetical protein LOC330050 5 25 2 NM_133732 hypothetical protein LOC70984 5 12 14 NM_024452 leucine zipper protein 1 5 22 4 NM_008145 gonadotropin-releasing hormone 1 precursor 5 13 11 NM_009256 serine or cysteine proteinase inhibitor clade 5 11 12 NM_011774 solute carrier family 30 zinc transporter 5 0 23 NM_007986 fibroblast activation protein 5 20 2 NM_001033258 hypothetical protein LOC215821 5 18 4 NM_011175 legumain 5 1 21 NM_178870 heparan sulfate glucosamine 5 9 13 NM_001033533 coiled-coil domain containing 102A 5 15 7 NM_010353 germ cell-specific gene 2 5 14 8 NM_028772 dimethylglycine dehydrogenase precursor 5 13 9 NM_019429 protease serine, 16 thymus 5 20 1 NM_023628 annexin A9 5 2 19 NM_026514 CDC42 effector protein Rho GTPase binding 3 5 17 4 NM_010248 growth factor receptor bound protein 5 14 7 NM_172122 ciliary rootlet coiled-coil rootletin 5 2 18 NM_172617 zinc finger protein 523 5 14 6 NM_178683 DEP domain containing 1B 5 14 6 NM_022021 Cdk5 and Abl enzyme substrate 1 5 18 0 NM_001024928 zinc finger protein 667 5 18 0 NM_010588 jagged 2 5 18 0 NM_001081220 G protein-coupled receptor 179 5 17 1 NM_173416 hypothetical protein LOC238037 5 17 1 NM_175451 cytoskeleton-associated protein 4 5 9 9 NM_144919 histone deacetylase 11 5 15 3 NM_181048 hypothetical protein LOC319266 5 5 12 NM_001110849 hypothetical protein LOC72446 5 5 12 NM_145584 spondin 1 f-spondin extracellular matrix 5 11 7 NM_153076 crystallin gamma N 5 11 7 NM_008721 neural proliferation differentiation and 5 14 3 NM_178791 hypothetical protein LOC320736 5 5 11 NM_175650 ATPase type 13A5 5 4 12 NM_019393 exosome component 9 5 3 13 NM_001033450 myeloid cell nuclear differentiation antigen 5 3 13 NM_001085555 t-complex protein 11 isoform 2 5 5 10 NM_027724 cancer antigen 1 5 5 10 NM_028450 PTB domain adaptor protein CED-6 5 2 13 NM_177001 hypothetical protein LOC319792 5 1 14 NM_177367 gemin 4 5 7 9 NM_001099288 Rho GTPase-activating protein RICH2 isoform 1 5 7 9 NM_007889 dishevelled 3 5 13 2 NM_001001297 threonine synthase-like 1 isoform b 5 13 2 NM_052994 sparc/osteonectin cwcv and kazal-like domains 5 14 0 NM_016720 neuraminidase 3 5 14 0 NM_028611 hypothetical protein LOC73694 5 14 0 NM_173763 cysteine conjugate-beta lyase 2 5 14 0 NM_022724 suppressor of variegation 3-9 homologue 2 5 3 10 NM_011123 proteolipid protein 1 5 3 10 NM_177834 carboxypeptidase B 5 1 11 NM_001039209 hypothetical protein LOC195531 5 1 11 NM_172643 zinc finger and BTB domain containing 41 5 9 4 NM_175260 myosin heavy chain 10 non-muscle 5 0 12 NM_054056 PRKC apoptosis, WT1, regulator 5 5 7 NM_146234 transmembrane protein 32 5 4 8 NM_025740 coiled-coil domain containing 104 5 2 9 NM_001077713 ACN9 homolog 5 7 5 NM_019388 CD86 antigen 5 2 9 NM_001085549 hypothetical protein LOC666048 5 3 8 NM_016886 glutamate receptor ionotropic, AMPA3 precursor 5 10 1 NM_011846 matrix metallopeptidase 17 5 10 1 NM_029977 DNA polymerase theta 5 10 1 NM_173394 toll-like receptor adaptor molecule 2 5 1 9 NM_194464 MRV integration site 1 isoform b 5 1 9 NM_026321 transmembrane protein 157 5 0 10 NM_178691 HIV-induced protein-7-like protease 5 7 4 NM_001039000 kinesin family member 5A 5 7 4 NM_175937 cytoplasmic polyadenylation element binding 5 7 4 NM_144874 COX15 homolog 5 8 3 NM_001081150 LON peptidase N-terminal domain and ring finger 5 5 5 NM_175173 WD repeat domain 27 5 3 7 NM_011169 prolactin receptor 5 3 7 NM_018830 N-acylsphingosine amidohydrolase 2 5 3 7 NM_001032727 Golgi-localized syntaphilin-related protein 5 1 9 NM_016782 contactin associated protein 1 5 8 2 NM_010549 interleukin 11 receptor alpha chain 1 5 0 9 NM_019457 leucine rich repeat containing 6 testis 5 7 3 NM_025479 hypothetical protein LOC66308 5 5 4 NM_033602 pellino 2 5 4 5 NM_199055 carbohydrate N-acetylgalactosamine 4-0 5 3 6 NM_009313 tachykinin receptor 1 5 3 6 NM_001081432 protein tyrosine phosphatase receptor type, Q 5 1 8 NM_020052 Cegp1 protein 5 1 8 NM_134071 ankyrin repeat domain 32 5 1 8 NM_001081141 gamma-aminobutyric acid GABA B receptor 2 5 0 9 NM_001101488 GSG1-like 5 8 1 NM_027123 FAST kinase domains 3 5 5 3 NM_026835 MS4A6D protein 5 5 3 NM_153457 reticulon 1 isoform RTN1-A 5 2 6 NM_001040611 paternally expressed 10 isoform RF1 5 3 5 NM_013661 semaphorin 5B 5 3 5 NM_177640 hypothetical protein LOC225995 5 1 7 NM_172632 mitogen-activated protein kinase 4 5 0 8 NM_001045542 hypothetical protein LOC624860 5 0 8 NM_008665 myelin transcription factor 1 5 5 2 NM_011620 troponin T3 skeletal, fast 5 5 2 NM_019967 deleted in bladder cancer chromosome region 5 4 3 NM_026672 glutathione S-transferase mu 7 5 4 3 NM_175751 zinc finger protein 608 5 3 4 NM_030137 CSA-conditional T cell activation-dependent 5 3 4 NM_007583 calcium channel voltage-dependent, gamma 5 3 4 NM_018798 ubiquilin 2 5 3 4 NM_028408 cornichon homolog 3 5 2 5 NM_001081499 TBC1 domain family member 8B 5 2 5 NM_001040397 hypothetical protein LOC78749 5 2 5 NM_181577 coiled-coil domain containing 85A 5 2 5 NM_001004182 hypothetical protein LOC434008 5 2 5 NM_029911 potassium channel subfamily K, member 10 5 1 6 NM_013523 follicle stimulating hormone receptor precursor 5 1 6 NM_009512 solute carrier family 27 fatty acid 5 0 7 NM_023438 transmembrane protein 132E 5 0 7 NM_028882 semaphorin 3D 5 0 7 NM_001083945 radial spokehead-like 2B 5 0 7 NM_001111304 TBC1 domain family member 9 isoform 1 5 0 7 NM_029092 RNA guanine-9- methyltransferase domain 5 7 0 NM_199022 rai-like protein RaLP 5 7 0 NM_007745 cortistatin 5 5 1 NM_010153 v-erb-b2 erythroblastic leukemia viral oncogene 5 4 2 NM_172977 general transcription factor IIIC polypeptide 5 2 4 NM_001038701 gamma-aminobutyric acid GABA A receptor beta 5 2 4 NM_030179 CAP-GLY domain containing linker protein family 5 2 4 NM_001081249 versican 5 2 4 NM_148958 oxysterol-binding protein-like protein 10 5 3 3 NM_207650 dystrobrevin alpha isoform 1 5 3 3 NM_010084 a disintegrin and metallopeptidase domain 18 5 3 3 NM_010789 Meis homeobox 1 5 3 3 NM_001085376 pappalysin 2 5 3 3 NM_029398 transmembrane protein 14A 5 3 3 NM_183112 hypothetical protein LOC75641 5 3 3 NM_177756 glycosyltransferase 25 domain containing 2 5 3 3 NM_001112813 calcium channel voltage-dependent, T type, 5 1 5 NM_025705 discoidin CUB and LCCL domain containing 1 5 1 5 NM_008192 guanylate cyclase 2e 5 1 5 NM_001081376 chromodomain helicase DNA binding protein 5 5 1 5 NM_205820 toll-like receptor 13 5 1 5 NM_144807 choline phosphotransferase 1 5 1 5 NM_172815 R-spondin 2 homolog 5 1 5 NM_197945 ProSAPiP1 protein 5 1 5 NM_133733 adipocyte-specific adhesion molecule 5 0 6 NM_028921 tubulin tyrosine ligase-like family member 11 5 0 6 NM_001081286 FAT tumor suppressor homolog 1 5 5 0 NM_007836 growth arrest and DNA-damage-inducible 45 alpha 5 4 1 NM_153802 zinc finger protein 128 5 4 1 NM_028627 pleckstrin and Sec7 domain containing homolog 5 4 1 NM_053244 KISS1 receptor 5 4 1 NM_177203 hypothetical protein LOC320604 5 3 2 NM_027153 pirin 5 3 2 NM_011348 semaphorin 3E 5 3 2 NM_007755 cytoplasmic polyadenylation element binding 5 2 3 NM_009369 transforming growth factor beta induced 5 2 3 NM_198884 beta-14-N-acetyl-galactosaminyl transferase 3 5 2 3 NM_029761 docking protein 5 5 2 3 NM_010745 lymphocyte antigen 86 5 2 3 NM_144552 syntaxin binding protein 6 amisyn 5 1 4 NM_033264 cyclic AMP-regulated phosphoprotein 21 isoform 5 1 4 NM_007416 adrenergic receptor alpha 1b 5 1 4 NM_007734 procollagen type IV, alpha 3 5 1 4 NM_021415 calcium channel alpha13.2 subunit 5 1 4 NM_001083628 cDNA sequence AK220484 5 1 4 NM_001039250 hypothetical protein LOC638695 5 1 4 NM_027547 PR domain containing 5 5 1 4 NM_007825 cytochrome P450 family 7, subfamily b, 5 1 4 NM_183427 glycine receptor alpha 2 subunit 5 0 5 NM_175513 zinc finger protein 804A 5 0 5 NM_199024 nucleolar protein 4 5 4 0 NM_177097 hypothetical protein LOC320197 5 4 0 NM_010874 N-acetyltransferase 2 arylamine 5 4 0 NM_001080935 hypothetical protein LOC68127 5 2 2 NM_001014900 zinc finger MYND domain containing 12 5 2 2 NM_001033443 cyclin-dependent kinase-like 4 5 2 2 NM_011890 sarcoglycan beta dystrophin-associated 5 2 2 NM_176922 integrin alpha 11 5 2 2 NM_001082960 integrin alpha M isoform 1 precursor 5 2 2 NM_031258 chordin-like 1 2 5 2 2 NM_011286 rabphilin 3A 5 2 2 NM_001033874 hypothetical protein LOC68870 5 2 2 NM_030052 cytochrome c oxidase subunit VIIb2 5 3 1 NM_011353 small EDRK-rich factor 1 5 3 1 NM_145484 zinc finger protein 758 5 1 3 NM_001033259 coiled-coil domain containing 109A 5 1 3 NM_028940 retinaldehyde binding protein 1-like 1 5 1 3 NM_012008 DEAD Asp-Glu-Ala-Asp box polypeptide 3 5 1 3 NM_008988 putative neuronal cell adhesion molecule 5 1 3 NM_022723 signal peptide CUB domain, EGF-like 1 5 1 3 NM_007697 cell adhesion molecule with homology to L1CAM 5 1 3 NM_001081072 solute carrier family 27 fatty acid 5 1 3 NM_177378 ring finger protein 150 5 1 3 NM_175217 monocyte-to-macrophage differentiation factor 2 5 1 3 NM_008429 potassium inwardly-rectifying channel subfamily 5 0 4 NM_028072 sulfatase 2 5 0 4 NM_172864 WD repeat domain 63 5 3 0 NM_008771 purinergic receptor P2X1 5 3 0 NM_025677 hypothetical protein LOC66637 5 3 0 NM_010255 guanidinoacetate methyltransferase 5 3 0 NM_026505 BMP and activin membrane-bound inhibitor 5 2 1 NM_054041 anthrax toxin receptor 1 5 2 1 NM_029797 GAJ protein 5 2 1 NM_172853 cadherin 7 type 2 5 2 1 NM_008285 histamine receptor H 1 5 2 1 NM_008869 cytosolic phospholipase A2 group IVA 5 2 1 NM_173379 leprecan-like 1 5 2 1 NM_025815 copine VIII isoform 1 5 2 1 NM_133187 hypothetical protein LOC68659 5 1 2 NM_172862 Fras1 related extracellular matrix protein 2 5 1 2 NM_146578 olfactory receptor 1033 5 1 2 NM_175126 zinc finger CCHC domain containing 3 5 1 2 NM_177845 cytosolic phospholipase A2 epsilon 5 1 2 NM_025949 ribosomal protein S6 kinase polypeptide 6 5 1 2 NM_001013826 dual specificity phosphatase and pro isomerase 5 1 2 NM_001012322 secretin receptor 5 0 3 NM_019724 matrix metallopeptidase 16 5 0 3 NM_148943 ubiquitin specific peptidase 9 Y chromosome 5 0 3 NM_011852 2'-5' oligoadenylate synthetase 1G 5 0 3 NM_177787 hypothetical protein LOC277898 5 0 3 NM_008625 mannose receptor C type 1 5 0 3 NM_008417 potassium voltage-gated channel shaker-related 5 0 3 NM_011245 RAS protein-specific guanine 5 0 3 NM_010141 Eph receptor A7 5 0 3 NM_008039 formyl peptide receptor related sequence 2 5 0 3 NM_001004150 alpha 14-galactosyltransferase 5 2 0 NM_009449 tubulin alpha 7 5 2 0 NM_145549 EF-hand calcium binding domain 7 5 1 1 NM_177793 hypothetical protein LOC327747 5 1 1 NM_134096 TAFA5 protein 5 1 1 NM_001038624 resistance to inhibitors of cholinesterase 3 5 1 1 NM_013607 myosin heavy polypeptide 11, smooth muscle 5 1 1 NM_010025 doublecortin isoform c 5 1 1 NM_024124 histone deacetylase 9 5 1 1 NM_008357 interleukin 15 5 1 1 NM_177304 ectonucleotide pyrophosphatase/phosphodiesterase 5 0 2 NM_001077636 phosphatidylinositol glycan class W 5 0 2 NM_001035532 A kinase PRKA anchor protein 2 isoform 2 5 0 2 NM_177888 zinc finger protein 78 isoform 2 5 0 2 NM_145986 hypothetical protein LOC213956 5 0 2 NM_010252 gamma-aminobutyric acid A receptor gamma 1 5 0 2 NM_181588 carboxymethylenebutenolidase-like 5 0 2 NM_019804 UDP-Gal:betaGlcNAc beta 5 0 2 NM_001081642 X-linked lymphocyte-regulated 4A 5 0 2 NM_033571 FK506 binding protein 6 5 1 0 NM_013879 calcium binding protein 1 5 1 0 NM_008153 chemokine-like receptor 1 5 1 0 NM_028948 coiled-coil domain containing 11 5 1 0 NM_178045 Ras association RalGDS/AF-6 domain family 4 5 1 0 NM_001033425 zinc finger and SCAN domains 10 5 1 0 NM_025330 dehydrogenase/reductase SDR family member 10 5 1 0 NM_025350 carboxypeptidase A1 5 0 1 NM_030727 prestin 5 0 1 NM_010570 insulin receptor substrate 1 5 0 1 NM_001099634 myoferlin 5 0 1 NM_029415 sodium-dependent organic anion transporter 5 0 1 NM_182841 hypothetical protein LOC231503 5 0 1 NM_001029877 neuro-oncological ventral antigen 2 5 0 1 NM_172628 SH3 domain and tetratricopeptide repeats 2 5 0 1 NM_011428 synaptosomal-associated protein 25 5 0 1 NM_001034909 H2-GS14-2 antigen 5 0 1 NM_028351 R-spondin 3 5 0 1 NM_027810 Bardet-Biedl syndrome 7 5 0 1 NM_011786 arachidonate lipoxygenase 3 5 0 0 NM_133990 interleukin 13 receptor alpha 1 5 0 0 NM_207666 EGF-like-domain multiple 9 5 0 0 NM_009710 ADP-ribosyltransferase 1 5 0 0 NM_198625 hypothetical protein LOC244654 5 0 0 NM_178730 transmembrane protease serine 11f 5 0 0 NM_145547 zinc finger protein 189 5 0 0 NM_001081688 transmembrane protease serine 9 5 0 0 NM_026716 syncollin 5 0 0 NM_008184 glutathione S-transferase mu 6 5 0 0 NM_173372 glutamate receptor metabotropic 6 5 0 0 NM_022563 discoidin domain receptor family member 2 5 0 0 NM_026316 aldehyde dehydrogenase 3 family member B1 4 1060 6 NM_009657 aldolase 3 C isoform 4 498 10 NM_025415 CDC28 protein kinase regulatory subunit 2 4 415 30 NM_008037 fos-like antigen 2 4 295 39 NM_008353 interleukin 12 receptor beta 1 4 288 3 NM_024461 hypothetical protein LOC67704 4 273 5 NM_134066 aldo-keto reductase family 1 member C18 4 153 44 NM_001004138 potassium channel subfamily K, member 7 isoform 4 179 9 NM_025539 nudix nucleoside diphosphate linked moiety 4 179 2 NM_011623 topoisomerase DNA II alpha 4 148 13 NM_024250 PHD finger protein 10 4 123 35 NM_133234 Bcl-2 binding component 3 4 155 1 NM_178076 mcf.2 transforming sequence-like 4 74 73 NM_010019 death-associated kinase 2 4 94 43 NM_013733 chromatin assembly factor 1 subunit A p150 4 120 10 NM_009270 squalene epoxidase 4 128 0 NM_011073 perforin 1 4 123 5 NM_001040435 transforming acidic coiled-coil containing 4 99 19 NM_001033305 NADH dehydrogenase ubiquinone 1 beta 4 115 2 NM_178608 receptor accessory protein 1 4 97 19 NM_178058 apoptosis-inducing factor AIF-like 4 86 28 NM_007421 adenylosuccinate synthetase 1 4 101 11 NM_001081356 hypothetical protein LOC67048 4 91 16 NM_016918 nudix nucleoside diphosphate linked moiety 4 66 34 NM_026921 HESB like domain containing 2 4 91 5 NM_016692 inner centromere protein 4 89 3 NM_146028 SH3 and cysteine rich domain 2 4 44 40 NM_021302 serine/threonine kinase 32C 4 79 5 NM_173006 paraoxonase 3 4 83 0 NM_144795 pyrroline-5-carboxylate reductase 1 4 63 19 NM_197943 RUN and TBC1 domain containing 1 4 75 0 NM_080726 rad and gem related GTP binding protein 2 4 68 6 NM_028341 hypothetical protein LOC72747 4 39 34 NM_001081367 potassium channel tetramerisation domain 4 54 14 NM_008723 nucleoplasmin 3 4 51 16 NM_025748 adenosine deaminase tRNA-specific 2, TAD2 4 51 16 NM_144797 meteorin glial cell differentiation 4 63 3 NM_013901 solute carrier family 39 zinc transporter 4 60 5 NM_178118 DIX domain containing 1 4 33 29 NM_001005424 hypothetical protein LOC381353 4 42 17 NM_009685 amyloid beta A4 precursor protein-binding 4 54 2 NM_023680 tumor necrosis factor receptor superfamily 4 37 18 NM_153166 copine V 4 18 34 NM_001082974 neuralized-like 2 4 31 21 NM_019922 cartilage associated protein 4 47 5 NM_145502 ER lipid raft associated 1 4 51 1 NM_145972 hypothetical protein LOC212547 4 51 1 NM_026163 plakophilin 2 4 50 1 NM_153805 protein kinase N3 4 20 29 NM_172480 5-methyltetrahydrofolate-homocysteine 4 45 0 NM_026981 DTW domain containing 1 4 42 1 NM_007792 cysteine and glycine-rich protein 2 4 23 19 NM_009185 Scl/Tal1 interrupting locus 4 9 32 NM_028778 NUAK family SNF1-like kinase, 2 4 34 6 NM_026610 NADH dehydrogenase 1 beta subcomplex 4 4 36 4 NM_001024726 zinc finger proten 607 4 37 2 NM_021099 c-kit 4 3 33 NM_021334 integrin alpha X 4 26 9 NM_175655 histone cluster 1 H4f 4 5 29 NM_173386 hypothetical protein LOC214763 4 18 16 NM_001025312 DNA cross-link repair 1B PSO2 homolog isoform 4 0 34 NM_153142 solute carrier family 35 member E4 4 30 4 NM_026764 glutathione S-transferase mu 4 4 32 1 NM_028106 zinc finger BED domain containing 3 4 23 10 NM_007932 endoglin 4 28 3 NM_021886 centromere protein H 4 4 26 NM_172491 hypothetical protein LOC211135 4 27 4 NM_001025388 hypothetical protein LOC433182 4 22 9 NM_001101502 zinc finger protein 703 isoform 1 4 29 1 NM_001024954 pre-B-cell leukemia homeobox 4 4 20 9 NM_030690 ankycorbin 4 19 9 NM_173429 zinc finger protein 775 4 4 24 NM_144916 transmembrane protein 150 4 27 1 NM_001081181 hypothetical protein LOC68115 4 27 0 NM_138594 hypothetical protein LOC28040 4 17 9 NM_033074 threonyl-tRNA synthetase 4 22 5 NM_146089 coiled-coil domain containing 5 4 24 2 NM_183142 asparagine-linked glycosylation 11 homolog 4 14 10 NM_146191 leucine-rich repeat kinase 1 4 18 6 NM_011967 proteasome prosome macropain subunit, alpha 4 11 12 NM_026502 hypothetical protein LOC68001 4 18 5 NM_028003 RNA polymerase II associated protein 3 4 0 23 NM_177773 hypothetical protein LOC271508 4 22 1 NM_133210 SERTA domain containing 3 4 4 18 NM_013710 FYVE RhoGEF and PH domain containing 2 4 1 21 NM_007639 CD1d1 antigen 4 16 6 NM_016672 dopa decarboxylase 4 16 6 NM_001004435 phosphoinositide-3-kinase regulatory subunit 6 4 13 9 NM_001081243 filamin A interacting protein 1 4 19 2 NM_029458 HORMA domain containing 2 4 1 20 NM_019484 RNA and export factor binding protein 2 4 0 21 NM_001085409 dudulin 2 4 11 9 NM_177054 cancer susceptibility candidate 4 isoform 1 4 1 19 NM_001080707 G protein-coupled receptor 155 4 13 7 NM_010345 growth factor receptor bound protein 10 4 19 0 NM_025851 hypothetical protein LOC66931 4 18 1 NM_025281 Ly1 antibody reactive clone 4 16 3 NM_023066 aspartyl beta-hydroxylase isoform 1 4 0 19 NM_001013771 hypothetical protein LOC381260 4 3 15 NM_133825 hypothetical protein LOC52392 4 10 9 NM_027062 complement component 8 gamma polypeptide 4 8 10 NM_007945 epidermal growth factor receptor pathway 4 13 5 NM_175028 ADNP homeobox 2 4 17 0 NM_001081347 Rho-related BTB domain containing 1 4 15 2 NM_011234 RAD51 homolog 4 13 4 NM_001033541 hypothetical protein B130007I08 4 3 13 NM_001081238 partner and localizer of BRCA2 4 14 2 NM_001085497 solute carrier family 25 member 43 4 5 10 NM_025541 ASF1 anti-silencing function 1 homolog A 4 4 11 NM_001111145 hypothetical protein LOC208080 4 2 13 NM_001037221 sterile alpha motif domain containing 4 isoform 4 0 15 NM_177393 voltage gated channel like 1 4 0 15 NM_029532 U11/U12 snRNP 35K 4 15 0 NM_177102 transmembrane protein 91 4 15 0 NM_176996 smoothened homolog 4 5 9 NM_007495 astrotactin 1 4 13 2 NM_001030274 NADH dehydrogenase ubiquinone Fe-S protein 5 4 8 7 NM_029068 sorting nexin 16 4 13 1 NM_028890 hypothetical protein LOC74359 4 2 11 NM_033552 solute carrier family 4 sodium bicarbonate 4 1 12 NM_029128 queuine tRNA-ribosyltransferase domain 4 9 5 NM_001008498 WD repeat domain 34 4 0 13 NM_011758 zinc finger protein 39 4 5 8 NM_008719 neuronal PAS domain protein 2 4 5 8 NM_001105252 transmembrane channel-like 5 isoform a 4 11 2 NM_029835 hypothetical protein LOC77011 4 2 10 NM_172778 amine oxidase flavin-containing 4 10 3 NM_145950 oxidative stress induced growth inhibitor family 4 7 6 NM_018779 phosphodiesterase 3A cGMP inhibited 4 8 5 NM_175507 transmembrane protein 20 4 11 1 NM_011933 2-4-dienoyl-Coenzyme A reductase 2 peroxisomal 4 11 1 NM_181848 optineurin 4 11 1 NM_175554 claspin 4 11 1 NM_201610 nei like 2 4 2 9 NM_029238 solute carrier family 35 member F4 4 1 10 NM_153409 cysteine-serine-rich nuclear protein 3 4 8 4 NM_001029912 zinc finger SWIM domain containing 5 4 8 4 NM_027920 membrane-associated ring finger C3HC4 8 4 8 4 NM_133987 solute carrier family 6 neurotransmitter 4 7 5 NM_027860 hypothetical protein LOC71675 4 4 7 NM_028472 crossveinless 2 4 4 7 NM_026728 enoyl Coenzyme A hydratase domain containing 2 4 2 9 NM_001081342 G protein-coupled receptor 133 4 2 9 NM_026479 zinc finger CCHC domain containing 10 4 10 1 NM_010635 Kruppel-like factor 1 erythroid 4 1 9 NM_175172 hypothetical protein LOC71653 isoform 2 4 1 9 NM_008331 interferon-induced protein with 4 9 2 NM_001033210 hypothetical protein LOC102502 4 9 2 NM_178875 hypothetical protein LOC71508 4 9 2 NM_010442 heme oxygenase decycling 1 4 7 4 NM_013898 translocase of inner mitochondrial membrane 8 4 5 5 NM_058212 D4 zinc and double PHD fingers, family 3 4 4 6 NM_148413 myosin IIIA 4 3 7 NM_053072 FYVE RhoGEF and PH domain containing 6 4 2 8 NM_025496 CMT1A duplicated region transcript 4 4 2 8 NM_177914 diacylglycerol kinase kappa 4 10 0 NM_001104530 mediator complex subunit 7 4 1 9 NM_008070 gamma-aminobutyric acid GABA-A receptor 4 1 9 NM_178195 histone cluster 1 H2bf 4 0 9 NM_178213 histone cluster 2 H2ab 4 7 3 NM_178202 histone cluster 1 H2bp 4 7 3 NM_178887 fibrinogen C domain containing 1 4 5 4 NM_133762 leucine zipper protein 5 4 5 4 NM_028307 tudor and KH domain containing protein 4 4 5 NM_030180 ubiquitin specific protease 54 4 3 6 NM_007488 aryl hydrocarbon receptor nuclear translocator 4 2 7 NM_027934 ring finger protein 180 4 2 7 NM_015743 nuclear receptor subfamily 4 group A, member 3 4 2 7 NM_144882 hypothetical protein LOC67198 4 2 7 NM_173008 hypothetical protein LOC269855 4 1 8 NM_013657 semaphorin 3C 4 9 0 NM_138949 zinc finger protein 286 4 7 2 NM_178192 histone cluster 1 H4a 4 7 2 NM_026613 coiled-coil domain containing 34 4 8 1 NM_025961 L-arginine:glycine amidinotransferase 4 2 6 NM_175314 a disintegrin-like and metalloprotease 4 2 6 NM_148938 solute carrier family 1 glial high affinity 4 3 5 NM_177751 connector enhancer of kinase suppressor of Ras 4 3 5 NM_177052 kinesin family member 6 4 3 5 NM_178725 leucine rich repeat containing 4C 4 1 7 NM_001081053 integrin alpha 10 4 1 7 NM_008150 glypican 4 4 1 7 NM_145469 NIPA-like domain containing 2 4 1 7 NM_001001979 MEGF10 protein 4 0 8 NM_011904 tolloid-like 2 4 4 3 NM_015744 ectonucleotide pyrophosphatase/phosphodiesterase 4 3 4 NM_025421 acylphosphatase 1 erythrocyte common type 4 2 5 NM_001081295 hypothetical protein LOC622434 4 2 5 NM_001111026 acute myelogenous leukemia 1 translocation 1 4 2 5 NM_207228 testis specific 10 4 2 5 NM_019971 platelet-derived growth factor C polypeptide 4 2 5 NM_183096 tetratricopeptide repeat domain 29 4 2 5 NM_026731 protein phosphatase 1 regulatory inhibitor 4 1 6 NM_032004 testis-specific serine kinase 6 4 1 6 NM_019445 formin 2 4 1 6 NM_027897 rhophilin Rho GTPase binding protein 2 4 0 7 NM_177243 solute carrier family 26 member 9 4 0 7 NM_001081975 microfibrillar-associated protein 1B 4 5 1 NM_027280 naked cuticle 1 homolog 4 5 1 NM_013724 Nik related kinase 4 5 1 NM_011988 solute carrier family 27 member 3 4 4 2 NM_172855 UDP-N-acetyl-alpha-D-galactosamine:polypeptide 4 2 4 NM_001040682 calmin isoform b 4 2 4 NM_175485 protogenin 4 2 4 NM_178714 leucine rich repeat and fibronectin type III 4 2 4 NM_207205 immunoglobulin superfamily member 3 4 2 4 NM_172466 a disintegrin-like and metalloprotease 4 2 4 NM_133365 dynein axonemal, heavy chain 5 4 2 4 NM_015748 slit homolog 1 4 2 4 NM_172613 type V P-type ATPase isoform 4 4 3 3 NM_001085521 hypothetical protein LOC433485 4 3 3 NM_146261 hypothetical protein LOC245622 4 3 3 NM_030728 hypothetical protein 12H19.01.T7 4 3 3 NM_009667 AMP deaminase 3 4 1 5 NM_026167 kelch-like 13 4 1 5 NM_172430 sphingosine kinase type 1-interacting protein 4 1 5 NM_018766 neurotensin receptor 1 4 1 5 NM_009931 collagen type IV, alpha 1 4 1 5 NM_147219 ATP-binding cassette sub-family A ABC1, 4 1 5 NM_153793 RELT-like 2 4 0 6 NM_015802 deleted in liver cancer 1 4 0 6 NM_172294 sulfatase 1 4 0 6 NM_001081174 hypothetical protein LOC76166 4 0 6 NM_023047 dihydropyrimidinase-like 5 4 0 6 NM_172868 paralemmin 2 4 5 0 NM_013560 heat shock protein 1 4 5 0 NM_009759 BMX non-receptor tyrosine kinase 4 5 0 NM_007962 myelin protein zero-like 2 4 4 1 NM_029912 transmembrane protein 116 4 4 1 NM_172392 zinc finger protein 759 4 4 1 NM_148953 ankyrin repeat and SOCS box-containing 16 4 3 2 NM_133816 SH3-domain binding protein 4 4 3 2 NM_013461 adrenergic receptor alpha 1a 4 3 2 NM_026915 lysozyme-like 4 4 3 2 NM_001042607 receptor-like tyrosine kinase isoform 2 4 3 2 NM_177856 hypothetical protein LOC329659 4 3 2 NM_173021 phosphorylase kinase alpha 1 isoform 2 4 3 2 NM_001033365 hypothetical protein LOC268816 4 3 2 NM_029760 nucleotide binding protein-like 4 3 2 NM_020606 parvin alpha 4 3 2 NM_001081051 hypothetical protein LOC210108 4 2 3 NM_001110205 activin A receptor type 1 4 2 3 NM_207243 mucin 19 4 2 3 NM_172563 hepatic leukemia factor 4 2 3 NM_010608 potassium channel subfamily K, member 3 4 2 3 NM_133737 LanC bacterial lantibiotic synthetase component 4 1 4 NM_011642 transformation related protein 73 4 1 4 NM_011216 protein tyrosine phosphatase receptor type, O 4 1 4 NM_009205 solute carrier family 3 member 1 4 0 5 NM_030706 tripartite motif protein 2 4 4 0 NM_030189 hypothetical protein LOC78806 4 4 0 NM_001029890 mex3 homolog A 4 4 0 NM_008773 purinergic receptor P2Y G-protein coupled 2 4 2 2 NM_026788 methylenetetrahydrofolate dehydrogenase NADP+ 4 2 2 NM_008247 phosphatidic acid phosphatase 2a isoform 1 4 2 2 NM_145562 RIKEN cDNA 9130213B05 4 2 2 NM_207222 LIM domain only 3 4 2 2 NM_028854 TBC1 domain family member 21 4 2 2 NM_029928 protein tyrosine phosphatase receptor type, B 4 2 2 NM_001033789 hypothetical protein LOC545253 4 3 1 NM_178655 ankyrin 2 brain isoform 2 4 3 1 NM_198112 osteocrin 4 1 3 NM_181728 ADP-ribosyltransferase 3 4 1 3 NM_001080979 TEA domain family member 4 isoform b 4 1 3 NM_007727 contactin 1 4 1 3 NM_026021 melanin concentrating hormone receptor 4 1 3 NM_010002 cytochrome P450 family 2, subfamily c, 4 0 4 NM_178759 T-cell immunoglobulin and mucin domain 4 0 4 NM_138955 ATP-binding cassette sub-family G WHITE, 4 0 4 NM_018744 sema domain transmembrane domain TM, and 4 0 4 NM_177465 uromodulin-like 1 4 0 4 NM_001081284 hypothetical LOC620779 4 0 4 NM_007993 fibrillin 1 4 0 4 NM_177033 von Willebrand factor C domain containing 2 4 0 4 NM_001039114 acyl-CoA synthetase bubblegum family member 2 4 3 0 NM_001033290 G protein-coupled receptor 55 4 3 0 NM_146125 inositol 14,5-trisphosphate 3-kinase A 4 3 0 NM_001033441 expressed sequence AU045404 4 2 1 NM_001081187 HtrA serine peptidase 4 4 2 1 NM_032005 T-box 19 4 2 1 NM_029095 hedgehog acyltransferase-like 4 2 1 NM_028813 vitrin 4 2 1 NM_177863 Fras1 related extracellular matrix protein 1 4 2 1 NM_013458 adducin 2 beta 4 1 2 NM_001038651 hypothetical protein LOC629016 4 1 2 NM_001038698 ELAV-like 4 isoform b 4 1 2 NM_181547 nitric oxide synthase trafficker 4 1 2 NM_177379 Rho GTPase-activating protein 4 1 2 NM_016919 collagen type V, alpha 3 4 1 2 NM_145155 WAS protein family member 3 4 0 3 NM_001081393 armadillo repeat containing 4 4 0 3 NM_001112739 Shaw-related voltage-gated potassium channel 4 0 3 NM_183300 zinc finger FYVE domain containing 9 4 0 3 NM_008522 lactotransferrin 4 2 0 NM_213614 septin 5 4 2 0 NM_022420 G protein-coupled receptor family C, group 5, 4 2 0 NM_175678 G protein-coupled receptor for asthma 4 1 1 NM_175327 hypothetical protein LOC102941 4 1 1 NM_153458 olfactomedin 3 isoform A 4 1 1 NM_018867 carboxypeptidase X 2 M14 family 4 1 1 NM_030684 tripartite motif protein 34 4 1 1 NM_010484 solute carrier family 6 member 4 4 1 1 NM_029974 DC-STAMP domain containing 1 4 1 1 NM_007608 carbonic anhydrase 5a mitochondrial 4 1 1 NM_001042670 mitochondrial transcription termination 4 1 1 NM_153512 potassium voltage-gated channel subfamily G, 4 1 1 NM_033354 SEC16 homolog B 4 1 1 NM_015773 sperm associated antigen 6 4 1 1 NM_177794 transmembrane protein 26 4 1 1 NM_019483 MAD homolog 9 4 1 1 NM_011867 pendrin 4 1 1 NM_001024712 hypothetical protein LOC544988 4 1 1 NM_030249 CTTNBP2 N-terminal like 4 1 1 NM_207277 hypothetical protein LOC403174 4 1 1 NM_172930 hypothetical protein LOC245386 4 0 2 NM_011465 spectrin alpha 1 4 0 2 NM_001033296 sel-1 suppressor of lin-12-like 2 4 0 2 NM_172802 fascin homolog 2 actin-bundling protein, 4 0 2 NM_021287 spectrin beta 3 4 0 2 NM_001081124 MAP7 domain containing 2 4 0 2 NM_009738 butyrylcholinesterase 4 0 2 NM_010237 fyn-related kinase 4 0 2 NM_177757 kinesin family member 26B 4 0 2 NM_175522 leucine rich repeat and fibronectin type III 4 0 2 NM_001110513 early B-cell factor 4 4 0 2 NM_001037743 hypothetical protein LOC70846 4 1 0 NM_177697 von Willebrand factor A domain containing 3A 4 1 0 NM_177351 hypothetical protein LOC235386 4 1 0 NM_011898 sprouty homolog 4 4 1 0 NM_025271 actin-like 7b 4 1 0 NM_198634 tigger transposable element derived 3 4 1 0 NM_009801 carbonic anhydrase 2 4 1 0 NM_001005608 integrin beta 4 isoform 1 4 1 0 NM_001034097 tumor necrosis factor ligand superfamily 4 1 0 NM_171824 piggyBac transposable element derived 5 4 1 0 NM_011940 interferon activated gene 202B 4 1 0 NM_023158 chemokine C-X-C motif ligand 16 4 0 1 NM_001004139 zinc finger protein 619 4 0 1 NM_008482 laminin B1 subunit 1 4 0 1 NM_001111015 synapsin II isoform IIa 4 0 1 NM_019481 solute carrier family 13 sodium/sulphate 4 0 1 NM_008742 neurotrophin 3 4 0 1 NM_172523 solute carrier family 18 vesicular monoamine 4 0 1 NM_010870 baculoviral IAP repeat-containing 1e 4 0 1 NM_001005420 hypothetical protein LOC241289 4 0 1 NM_029267 bol boule-like isoform 1 4 0 0 NM_028980 HEAT-like repeat-containing protein 4 0 0 NM_001040696 NLR family pyrin domain containing 1B 4 0 0 NM_008752 neurexophilin 2 4 0 0 NM_172133 centaurin alpha 2 4 0 0 NM_199028 hypothetical protein LOC331623 4 0 0 NM_021022 ATP-binding cassette sub-family B, member 11 4 0 0 NM_031198 transcription factor EC 4 0 0 NM_053260 protease serine, 29 4 0 0 NM_001081209 PR domain containing 14 4 0 0 NM_011068 peroxisomal biogenesis factor 11a 4 0 0 NM_017370 haptoglobin 4 0 0 NM_054045 histone cluster 2 H3c2 4 0 0 NM_001025431 BTB/POZ domain containing protein 3 isoform 2 4 0 0 NM_001038499 arylsulfatase I 4 0 0 NM_001034856 hypothetical protein LOC194735 4 1051 238 NM_024253 natural killer cell group 7 sequence 4 857 1 NM_012055 asparagine synthetase 4 428 3 NM_001081171 laminin alpha 5 4 405 0 NM_030060 basic leucine zipper transcription factor 4 353 4 NM_010555 interleukin 1 receptor type II 4 72 268 NM_011311 S100 calcium binding protein A4 4 314 15 NM_010683 laminin gamma 1 4 324 2 NM_010318 guanine nucleotide binding protein G protein 4 187 75 NM_011491 stanniocalcin 2 4 226 17 NM_144818 non-SMC condensin I complex subunit H 4 229 9 NM_026559 thioredoxin domain containing 17 4 208 9 NM_008496 lectin galactose binding, soluble 7 4 183 9 NM_007659 cell division cycle 2 homolog A 4 176 7 NM_001081337 signal-induced proliferation-associated 1 like 4 159 21 NM_013820 hexokinase 2 4 103 48 NM_008812 peptidyl arginine deiminase type II 4 25 126 NM_022026 aquaporin 9 4 127 15 NM_010430 hypermethylated in cancer 1 isoform 1 4 29 96 NM_008344 insulin-like growth factor binding protein 6 4 111 13 NM_173401 F-box protein 44 4 120 2 NM_172875 arginine decarboxylase 4 117 0 NM_025464 hypothetical protein LOC66279 4 104 4 NM_001080969 interphase cyctoplasmic foci protein 45 4 94 3 NM_001010930 mitochondrial ribosomal protein S33 isoform 2 4 95 0 NM_019753 cadherin 17 4 95 0 NM_019761 NTF2-related export protein 1 4 87 7 NM_009609 actin gamma, cytoplasmic 1 4 69 25 NM_144907 sestrin 2 4 74 18 NM_025799 fucosidase alpha-L- 2, plasma 4 87 0 NM_007532 branched chain aminotransferase 1 cytosolic 4 86 1 NM_207203 hypothetical protein LOC73072 4 76 1 NM_023790 D3Mm3e protein 4 68 6 NM_007584 discoidin domain receptor family member 1 4 62 4 NM_026282 spindle pole body component 24 homolog 4 62 3 NM_198417 hypothetical protein LOC112415 4 42 22 NM_001001932 early endosome antigen 1 4 11 52 NM_011076 ATP-binding cassette sub-family B MDR/TAP, 4 1 61 NM_029381 testis expressed gene 22 4 54 9 NM_144917 RNA binding motif and ELMO/CED-12 domain 1 4 55 5 NM_007602 calpain 5 4 52 8 NM_001080769 UHRF1 ICBP90 binding protein 1 4 57 1 NM_011281 RAR-related orphan receptor gamma 4 54 1 NM_028905 hypothetical protein LOC74387 4 39 11 NM_013471 annexin A4 4 44 5 NM_138600 aldehyde dehydrogenase family 7 member A1 4 48 0 NM_029564 Tax1 human T-cell leukemia virus type I 4 47 1 NM_134125 thyroid hormone receptor interactor 10 4 0 47 NM_009864 cadherin 1 4 15 32 NM_009073 rod outer segment membrane protein 1 4 15 31 NM_027968 F-box protein 30 4 22 24 NM_010117 rhomboid family 1 4 40 5 NM_011495 polo-like kinase 4 4 29 12 NM_018864 inositol myo-1(or 4)-monophosphatase 1 4 38 3 NM_027973 myeloid leukemia factor 1 interacting protein 4 31 7 NM_144515 zinc finger protein 52 4 10 27 NM_001035122 golgi membrane protein 1 4 1 35 NM_010357 glutathione S-transferase alpha 4 4 33 2 NM_011173 protein S alpha 4 0 35 NM_025891 SWI/SNF related matrix associated, actin 4 30 3 NM_207708 synaptogyrin 1 isoform 1a 4 4 28 NM_013691 thrombospondin 3 4 32 0 NM_026674 anterior pharynx defective 1c homolog 4 13 19 NM_028457 hypothetical protein LOC73172 4 3 28 NM_172671 G protein-coupled receptor 48 4 24 8 NM_025998 Na+/K+ transporting ATPase interacting 1 4 14 17 NM_008455 kallikrein B plasma 1 4 28 2 NM_177857 DENN/MADD domain containing 2C 4 28 2 NM_175384 cell division cycle associated 2 4 29 1 NM_026752 zinc finger FYVE domain containing 21 4 4 26 NM_015736 UDP-N-acetyl-alpha-D-galactosamine:polypeptide 4 17 12 NM_145609 hypothetical protein LOC78100 4 2 26 NM_009824 core-binding factor runt domain, alpha subunit 4 10 19 NM_144512 solute carrier family 6 neurotransmitter 4 12 16 NM_007880 dead ringer homolog 1 4 27 1 NM_001081114 CLIP-170-related protein 4 24 4 NM_011696 voltage-dependent anion channel 3 4 12 15 NM_178309 BRCA1 interacting protein C-terminal helicase 1 4 25 2 NM_008017 structural maintenance of chromosomes 2-like 1 4 26 0 NM_183275 hypothetical protein LOC68550 4 24 2 NM_173866 glutamic pyruvate transaminase alanine 4 20 5 NM_001042652 nucleolar and spindle associated protein 1 4 22 3 NM_023794 ets variant gene 5 4 4 19 NM_001004365 ARP3 actin-related protein 3 homolog B 4 19 4 NM_172449 peripheral benzodiazepine receptor-associated 4 19 3 NM_027078 IKK interacting protein isoform 2 4 11 11 NM_009800 carbonic anhydrase 11 4 18 4 NM_178619 hypothetical protein LOC69773 4 8 14 NM_172621 chloride intracellular channel 5 4 18 3 NM_175407 sine oculis-binding protein homolog 4 7 14 NM_177565 zinc finger protein 3 4 5 15 NM_007595 calcium/calmodulin-dependent protein kinase II 4 4 16 NM_001110252 hepsin isoform 1 4 11 9 NM_213616 plasma membrane calcium ATPase 4 4 19 0 NM_029115 hypothetical protein LOC74895 4 12 8 NM_008895 pro-opiomelanocortin-alpha 4 18 1 NM_026558 hypothetical protein LOC68099 4 9 10 NM_153783 peroxisomal N1-acetyl-spermine/spermidine 4 15 4 NM_001005475 IQ motif and Sec7 domain 2 isoform 2 4 7 12 NM_011143 POU domain class 4, transcription factor 1 4 5 13 NM_177572 hypothetical protein LOC194237 4 13 6 NM_024262 hypothetical protein LOC74133 4 13 6 NM_177140 hypothetical protein LOC320351 4 12 7 NM_176916 phospholipase D family member 5 4 10 9 NM_026250 zinc finger H2C2 domain containing 4 17 1 NM_025392 BRCA2 and CDKN1A interacting protein 4 17 1 NM_011352 semaphorin 7A 4 15 3 NM_013709 Sh3 domain YSC-like 1 4 0 18 NM_026280 matrix-remodelling associated 7 4 12 6 NM_028295 protein disulfide isomerase associated 5 4 10 8 NM_028352 phosphoglucomutase 3 4 15 2 NM_011227 RAB20 member RAS oncogene family 4 12 5 NM_133836 interleukin 15 receptor alpha chain isoform 2 4 3 13 NM_027334 methyltransferase like 7A1 4 3 12 NM_173023 cation channel sperm-associated, beta 4 9 7 NM_178378 IQ motif containing G 4 15 0 NM_026734 transmembrane protein 126B 4 7 9 NM_021388 exotoses multiple-like 2 4 13 2 NM_027165 cyclin-dependent kinase 3 4 2 12 NM_016743 nel-like 2 homolog 4 3 11 NM_008396 integrin alpha 2 4 8 7 NM_028804 coiled-coil domain containing 3 4 8 7 NM_178748 EGF-like fibronectin type III and laminin G 4 8 7 NM_009109 ryanodine receptor 1 skeletal muscle 4 14 0 NM_001044384 tissue inhibitor of metalloproteinase 1 4 14 0 NM_010660 keratin complex 1 acidic, gene 10 4 13 1 NM_011747 zinc finger protein 13 4 4 9 NM_023887 glucosaminyl N-acetyl transferase 2 isoform B 4 11 3 NM_026024 ubiquitin-conjugating enzyme E2T putative 4 2 11 NM_028456 RWD domain containing 3 4 10 4 NM_001033219 solute carrier family 45 member 4 4 1 12 NM_015734 procollagen type V, alpha 1 4 13 0 NM_028832 transcription termination factor-like protein 4 13 0 NM_010149 erythropoietin receptor 4 4 9 NM_010417 hephaestin isoform 1 4 9 4 NM_011882 ribonuclease L 2' 5'-oligoisoadenylate 4 7 6 NM_133724 cappuccino 4 5 7 NM_172461 NIMA never in mitosis gene a-related expressed 4 11 1 NM_028787 solute carrier family 35 member F5 4 3 9 NM_011351 sema domain transmembrane domain TM, and 4 10 2 NM_027533 tetraspan 2 4 8 4 NM_027212 mediator complex subunit 30 4 7 5 NM_026189 endonuclease/exonuclease/phosphatase family 4 3 8 NM_008733 nebulin-related anchoring protein isoform S 4 3 8 NM_028491 hypothetical protein LOC73287 4 10 1 NM_001042421 kinetochore associated 1 4 9 2 NM_018825 SH2B adaptor protein 2 4 0 10 NM_001083959 sporulation protein meiosis-specific, SPO11 4 8 3 NM_001001335 pleckstrin homology domain containing family A 4 5 5 NM_026010 hypothetical protein LOC67164 4 5 5 NM_007567 bassoon protein 4 3 7 NM_009535 viral oncogene yes homolog 4 2 8 NM_001081052 Nance-Horan syndrome 4 10 0 NM_027903 dihydrodiol dehydrogenase dimeric 4 10 0 NM_001013758 hypothetical protein LOC237403 4 1 9 NM_145707 oocyte specific homeobox 3 4 9 1 NM_153762 ring finger protein 26 4 8 2 NM_011634 TRAF-interacting protein 4 8 2 NM_011058 platelet derived growth factor receptor alpha 4 5 4 NM_028430 peptidylprolyl isomerase cyclophilin-like 6 4 5 4 NM_028035 sorting nexin 10 4 5 4 NM_025520 LSM5 homolog U6 small nuclear RNA associated 4 5 4 NM_177595 mohawk 4 4 5 NM_021416 hypothetical protein LOC58227 4 4 5 NM_008716 Notch gene homolog 3 4 4 5 NM_001012765 adenylate cyclase 5 4 4 5 NM_001013381 radical S-adenosyl methionine domain containing 4 2 7 NM_001080820 HEF-like protein isoform 2 4 1 8 NM_177256 peroxiredoxin 5 related sequence 1 protein 4 9 0 NM_175521 RIKEN cDNA 6430598A04 gene 4 9 0 NM_001033548 hypothetical protein LOC436022 4 8 1 NM_023249 yippee-like 1 4 4 4 NM_199146 hypothetical protein LOC209387 4 4 4 NM_001037918 lipoyltransferase 1 4 4 4 NM_009307 synaptotagmin II 4 2 6 NM_029602 hypothetical protein LOC76416 4 2 6 NM_016984 transient receptor potential cation channel 4 2 6 NM_008310 5-hydroxytryptamine serotonin receptor 1F 4 3 5 NM_009428 transient receptor potential cation channel 4 3 5 NM_201641 UDP glycosyltransferase 1 family polypeptide 4 3 5 NM_013927 cyclic nucleotide gated channel beta 3 4 1 7 NM_010778 CD46 antigen complement regulatory protein 4 1 7 NM_021362 pregnancy-associated plasma protein A 4 1 7 NM_008067 gamma-aminobutyric acid GABA-A receptor 4 0 8 NM_153116 GTP-binding protein 10 4 0 8 NM_033314 solute carrier organic anion transporter family 4 8 0 NM_001081297 predicted gene EG622339 4 8 0 NM_001007578 armadillo repeat containing X-linked 6 4 7 1 NM_153394 G protein-coupled receptor 156 4 7 1 NM_172647 F11 receptor 4 7 1 NM_001047604 tetratricopeptide repeat domain 21B 4 7 1 NM_178676 ectonucleoside triphosphate diphosphohydrolase 4 5 2 NM_133804 heat shock 70kDa protein 5 binding protein 1 4 5 2 NM_011324 sodium channel nonvoltage-gated, type I, alpha 4 5 2 NM_145940 WD repeat domain phosphoinositide interacting 4 5 2 NM_025565 spindle pole body component 25 4 4 3 NM_001081317 AN1 ubiquitin-like, homolog 4 3 4 NM_177235 hypothetical protein LOC320705 4 3 4 NM_153399 synaptic nuclear envelope 1 isoform 1 4 3 4 NM_007378 ATP-binding cassette sub-family A, member 4 4 2 5 NM_177233 TAFA4 protein 4 2 5 NM_009199 solute carrier family 1 neuronal/epithelial 4 2 5 NM_144796 sushi domain containing 4 4 2 5 NM_019789 calsenilin presenilin-binding protein, EF hand 4 1 6 NM_022316 SPARC related modular calcium binding 1 4 1 6 NM_011355 SFFV proviral integration 1 4 0 7 NM_020492 glycine receptor alpha 1 subunit 4 0 7 NM_001033191 ARD1 homolog B 4 5 1 NM_145443 L-2-hydroxyglutarate dehydrogenase 4 5 1 NM_198615 ring finger and KH domain containing 1 4 5 1 NM_138313 Bcl2 modifying factor 4 4 2 NM_001083120 enabled homolog isoform 3 4 2 4 NM_053251 proline rich protein MP4 4 2 4 NM_001048176 ceramide kinase-like 4 2 4 NM_001044720 ATP-binding cassette sub-family C, member 9 4 2 4 NM_011741 zonadhesin 4 2 4 NM_172867 zinc finger protein 462 4 2 4 NM_023233 tripartite motif protein 13 4 2 4 NM_133214 hypothetical protein LOC170748 4 2 4 NM_172441 shroom family member 2 4 2 4 NM_032397 potassium intermediate/small conductance 4 3 3 NM_145616 leucine rich repeat containing 49 4 3 3 NM_001110013 transmembrane and tetratricopeptide repeat 4 3 3 NM_145394 solute carrier family 44 member 3 4 3 3 NM_028724 Ras and Rab interactor 2 4 1 5 NM_007666 cadherin 6 4 1 5 NM_001081306 protein tyrosine phosphatase receptor type Z, 4 1 5 NM_026138 hypothetical protein LOC67412 4 1 5 NM_022315 SPARC related modular calcium binding 2 4 1 5 NM_001001488 ATPase class I, type 8B, member 1 4 1 5 NM_029946 CAP-binding protein complex interacting protein 4 1 5 NM_152818 oxysterol binding protein 2 4 0 6 NM_001033479 hypothetical protein LOC385263 4 0 6 NM_008542 MAD homolog 6 4 0 6 NM_001085499 hypothetical protein LOC209005 4 0 6 NM_183281 hypothetical protein LOC69457 4 4 1 NM_030181 V-set and immunoglobulin domain containing 1 4 4 1 NM_144548 interleukin 23 receptor 4 4 1 NM_173016 hypothetical protein LOC270097 4 4 1 NM_001039368 polymerase RNA II (DNA directed) polypeptide K 4 3 2 NM_032003 ectonucleotide pyrophosphatase/phosphodiesterase 4 3 2 NM_172884 hypothetical protein LOC243219 4 3 2 NM_025465 hypothetical protein LOC66282 4 3 2 NM_001039484 potassium inwardly-rectifying channel J10 4 3 2 NM_134005 ectonucleotide pyrophosphatase/phosphodiesterase 4 3 2 NM_021493 Rho GTPase activating protein 23 4 2 3 NM_175166 hypothetical protein LOC71395 4 2 3 NM_178797 male sterility domain containing 1 4 2 3 NM_009980 C-terminal binding protein 2 4 2 3 NM_008875 phospholipase D1 4 2 3 NM_010612 kinase insert domain protein receptor 4 2 3 NM_170599 immunoglobulin superfamily member 11 4 2 3 NM_133239 crumbs homolog 1 4 2 3 NM_009022 aldehyde dehydrogenase family 1 subfamily A2 4 2 3 NM_008048 insulin-like growth factor binding protein 7 4 2 3 NM_001081084 cubilin intrinsic factor-cobalamin receptor 4 1 4 NM_027937 CASK interacting protein 1 4 1 4 NM_175466 zinc finger protein 770 4 1 4 NM_001110202 tripartite motif protein 9 isoform b 4 1 4 NM_001085509 myomesin family member 3 4 1 4 NM_016710 nucleosome binding protein 1 4 1 4 NM_145515 MAP/microtubule affinity-regulating kinase 1 4 1 4 NM_007463 SPEG complex locus isoform 1 4 1 4 NM_001082962 small nuclear ribonucleoprotein N 4 1 4 NM_173383 dead end 4 0 5 NM_022016 interphotoreceptor matrix proteoglycan 1 4 0 5 NM_010846 myxovirus influenza virus resistance 1 4 0 5 NM_177346 G protein-coupled receptor 149 4 0 5 NM_178617 N-terminal EF-hand calcium binding protein 1 4 0 5 NM_133190 voltage-dependent calcium channel gamma-8 4 0 5 NM_018732 sodium channel voltage-gated, type III, alpha 4 0 5 NM_001083806 glutamate receptor ionotropic, AMPA 2 isoform 4 0 5 NM_001004173 sphingosine-1-phosphate phosphotase 2 4 4 0 NM_001025307 syntaxin 3 isoform B 4 4 0 NM_016899 RAB25 member RAS oncogene family 4 3 1 NM_013494 carboxypeptidase E 4 3 1 NM_198668 hypothetical protein LOC381798 4 3 1 NM_013622 opioid receptor delta 1 4 3 1 NM_175515 PDZ domain containing 6 4 3 1 NM_183182 hypothetical protein LOC242602 4 2 2 NM_001037712 potassium voltage-gated channel subfamily H 4 2 2 NM_001109040 kinesin family member 21A isoform 1 4 2 2 NM_007702 cell death-inducing DNA fragmentation factor 4 2 2 NM_018761 catenin cadherin associated protein 4 2 2 NM_146142 tudor domain containing 7 4 2 2 NM_173777 olfactomedin 2 4 2 2 NM_001024136 ankyrin repeat and sterile alpha motif domain 4 2 2 NM_146244 ribosomal protein S6 kinase-like 1 4 2 2 NM_001033598 acyl-CoA synthetase long-chain family member 6 4 2 2 NM_001081173 leucine-rich repeats and calponin homology CH 4 2 2 NM_173754 ubiquitin specific protease 43 4 2 2 NM_008431 TRAAK 4 1 3 NM_023653 wingless-related MMTV integration site 2 4 1 3 NM_172731 FYVE RhoGEF and PH domain containing 5 4 1 3 NM_009340 t-complex protein 10a 4 1 3 NM_022317 solute carrier family 28 sodium-coupled 4 1 3 NM_020333 solute carrier family 12 member 5 4 1 3 NM_175467 serine palmitoyltransferase long chain base 4 1 3 NM_172838 solute carrier family 16 monocarboxylic acid 4 1 3 NM_027251 hypothetical protein LOC69894 4 1 3 NM_011127 paired related homeobox 1 isoform a 4 1 3 NM_008779 contactin 3 4 1 3 NM_019535 SH3-domain GRB2-like 2 4 1 3 NM_054066 phospholipase C zeta 1 4 1 3 NM_023277 junction adhesion molecule 3 4 1 3 NM_030565 cDNA sequence BC004044 4 1 3 NM_001013799 hypothetical protein LOC433294 4 0 4 NM_016853 src homology three SH3 and cysteine rich 4 0 4 NM_011536 T-box 4 isoform a 4 0 4 NM_146054 pleckstrin homology domain containing family C 4 0 4 NM_001081189 uracil phosphoribosyltransferase FUR1 homolog 4 0 4 NM_001080963 phosphatidic acid phosphatase type 2 domain 4 0 4 NM_199018 START domain containing 8 4 0 4 NM_021436 transmembrane protein with EGF-like and two 4 0 4 NM_172610 metallophosphoesterase domain containing 1 4 3 0 NM_177431 a disintegrin-like and metalloprotease with 4 3 0 NM_177580 BAI1-associated protein 2-like 2 4 3 0 NM_172839 cyclin J 4 3 0 NM_001033040 hypothetical protein LOC233899 4 3 0 NM_010139 Eph receptor A2 4 3 0 NM_008718 neuronal PAS domain protein 1 4 2 1 NM_178624 F-box and leucine-rich repeat protein 2 4 2 1 NM_080440 solute carrier family 8 sodium/calcium 4 2 1 NM_001033243 coiled-coil domain containing 114 4 2 1 NM_172589 lipoma HMGIC fusion partner-like 2 4 2 1 NM_172497 EF hand domain family member B 4 2 1 NM_020253 neurexin II 4 2 1 NM_172256 dynein cytoplasmic 2 light intermediate chain 1 4 2 1 NM_019737 UDP-Gal:betaGlcNAc beta 4 2 1 NM_009542 zinc finger protein 101 4 2 1 NM_001110020 hypothetical protein LOC628596 4 2 1 NM_172836 hypothetical protein LOC240613 4 1 2 NM_177878 hypothetical protein LOC330216 4 1 2 NM_001033445 hypothetical protein LOC381126 4 1 2 NM_175319 hypothetical protein LOC101744 4 1 2 NM_008804 phosphodiesterase 9A 4 1 2 NM_001038602 MARVEL membrane-associating domain containing 4 1 2 NM_134252 transient receptor potential cation channel 4 1 2 NM_028798 cysteine-rich C-terminal 1 4 1 2 NM_013867 breast cancer anti-estrogen resistance 3 4 1 2 NM_026599 cingulin-like 1 4 1 2 NM_009323 T-box 15 4 1 2 NM_016762 matrilin 2 4 1 2 NM_001081331 hypothetical protein LOC71007 4 1 2 NM_008006 fibroblast growth factor 2 4 1 2 NM_177195 testis flippase 4 1 2 NM_026085 MAWD binding protein homolog 2 4 0 3 NM_198192 G protein-coupled receptor 103 4 0 3 NM_030888 collagenous repeat-containing 4 0 3 NM_153319 angiomotin 4 0 3 NM_032394 myosin VIIb 4 0 3 NM_172718 small G protein signaling modulator 1 4 0 3 NM_007735 procollagen type IV, alpha 4 4 0 3 NM_008626 mannose receptor C type 2 4 0 3 NM_001098404 pregnane X receptor isoform 2 4 0 3 NM_008985 protein tyrosine phosphatase receptor type, N 4 0 3 NM_177084 solute carrier family 9 sodium/hydrogen 4 0 3 NM_172948 mannoside acetylglucosaminyltransferase 5 4 0 3 NM_134437 interleukin 17 receptor D 4 0 3 NM_021458 frizzled 3 4 0 3 NM_007568 betacellulin epidermal growth factor family 4 2 0 NM_008809 platelet derived growth factor receptor beta 4 2 0 NM_172817 zinc finger protein 647 4 2 0 NM_001033632 interferon induced transmembrane protein 6 4 2 0 NM_001045518 hypothetical protein LOC208994 4 2 0 NM_024445 translin-associated factor X Tsnax interacting 4 2 0 NM_177236 plasma membrane calcium ATPase 3 4 2 0 NM_022004 FXYD domain-containing ion transport regulator 4 2 0 NM_007882 desmocollin 3 4 2 0 NM_026562 cyclin N-terminal domain containing 1 4 1 1 NM_175516 leucine rich repeat and Ig domain containing 2 4 1 1 NM_175198 prospero homeobox 2 4 1 1 NM_008315 5-hydroxytryptamine serotonin receptor 7 4 1 1 NM_009135 sodium channel voltage-gated, type VII, alpha 4 1 1 NM_001031621 ATP-binding cassette sub-family A ABC1, 4 1 1 NM_177763 lipoma HMGIC fusion partner-like 4 4 1 1 NM_010100 ectodysplasin A receptor precursor 4 1 1 NM_015739 gastrulation brain homeobox 1 4 1 1 NM_172564 tensin 4 4 1 1 NM_007392 actin alpha 2, smooth muscle, aorta 4 1 1 NM_009399 tumor necrosis factor receptor superfamily 4 1 1 NM_029019 START domain containing protein 6 4 1 1 NM_020043 neighbor of Punc e11 protein 4 1 1 NM_026086 N-acetylneuraminic acid phosphatase 4 1 1 NM_001033493 G protein-coupled receptor 111 4 1 1 NM_008411 CUB and zona pellucida-like domains 1 4 1 1 NM_019665 ADP-ribosylation factor-like 6 4 0 2 NM_176942 gamma-aminobutyric acid GABA-A receptor 4 0 2 NM_010681 laminin alpha 4 4 0 2 NM_010157 estrogen receptor beta isoform 2 4 0 2 NM_145532 mal T-cell differentiation protein-like 4 0 2 NM_172861 solute carrier family 7 member 14 4 0 2 NM_173861 CKT2 protein 4 0 2 NM_144909 glucokinase regulatory protein 4 0 2 NM_010158 KH domain containing RNA binding, signal 4 0 2 NM_027952 t-complex 11 protein 4 0 2 NM_023480 fumarylacetoacetate hydrolase domain containing 4 0 2 NM_177290 integrin beta 8 4 0 2 NM_173007 tetraspanin 12 4 0 2 NM_001033288 hypothetical protein LOC226866 4 0 2 NM_027667 Rho GTPase activating protein 19 4 0 2 NM_029413 microrchidia 4 4 0 2 NM_009814 calsequestrin 2 4 0 2 NM_001081129 contactin associated protein-like 3 4 0 2 NM_027963 WD40-repeat protein upregulated in HCC 4 0 2 NM_134159 interleukin 17 receptor C 4 0 2 NM_007555 bone morphogenetic protein 5 4 0 2 NM_001037744 translocase of inner mitochondrial membrane 8 4 0 2 NM_031872 taste receptor type 1, member 3 4 0 2 NM_008756 occludin 4 0 2 NM_013586 lysyl oxidase-like 3 4 0 2 NM_008261 hepatic nuclear factor 4 alpha 4 0 2 NM_175326 hypothetical protein LOC102871 4 0 2 NM_173047 carbonyl reductase 3 4 0 2 NM_177887 hypothetical protein LOC330460 4 1 0 NM_001013373 transmembrane protease serine 13 4 1 0 NM_010305 guanine nucleotide binding protein alpha 4 1 0 NM_021550 C1GALT1-specific chaperone 1 4 1 0 NM_028788 hypothetical protein LOC74152 4 1 0 NM_177867 spermatogenesis associated 21 4 1 0 NM_030716 Kv channel-interacting protein 2 isoform b 4 1 0 NM_030141 hypothetical protein LOC78625 4 1 0 NM_001037740 hypothetical protein LOC320609 isoform b 4 1 0 NM_001008547 hypothetical protein LOC69282 4 1 0 NM_199066 synovial sarcoma X member B, breakpoint 9 4 1 0 NM_007643 CD36 antigen 4 1 0 NM_007558 bone morphogenetic protein 8a 4 1 0 NM_172053 a disintegrin-like and metalloprotease 4 1 0 NM_008788 procollagen C-proteinase enhancer protein 4 1 0 NM_207212 WT1-interacting protein 4 1 0 NM_153600 tetratricopeptide repeat domain 26 4 1 0 NM_178165 Fc receptor-like 1 4 1 0 NM_172770 tetratricopeptide repeat domain 12 4 1 0 NM_145495 Ras and Rab interactor 1 4 1 0 NM_008695 nidogen 2 4 1 0 NM_033373 keratin 23 4 1 0 NM_001013751 envelope glycoprotein syncytin-A 4 1 0 NM_024440 Der1-like domain family member 3 4 1 0 NM_028179 HAI-2 related small protein 4 0 1 NM_001081268 hypothetical protein LOC330657 4 0 1 NM_023729 ankyrin repeat SAM and basic leucine zipper 4 0 1 NM_172782 nuclear transport factor 2-like export factor 2 4 0 1 NM_009132 scinderin 4 0 1 NM_008904 peroxisome proliferative activated receptor 4 0 1 NM_174848 hypothetical protein LOC224273 4 0 1 NM_021790 centromere protein K isoform 1 4 0 1 NM_020604 junctophilin 1 4 0 1 NM_001103368 vomeronasal receptor Vmn2r80 4 0 1 NM_022434 cytochrome P450 family 4, subfamily f, 4 0 1 NM_175651 canopy 1 homolog 4 0 1 NM_011999 C-type lectin domain family 4 member a2 4 0 1 NM_180958 coiled-coil domain containing 79 4 0 1 NM_009618 a disintegrin and metalloprotease domain 2 4 0 1 NM_053115 acyl-Coenzyme A oxidase 2 branched chain 4 0 1 NM_021382 tachykinin receptor 3 4 0 1 NM_145579 Myb protein P42POP 4 0 1 NM_133882 complement component 8 beta subunit 4 0 1 NM_001081473 zinc finger X-linked, duplicated B 4 0 1 NM_009116 paired related homeobox 2 4 0 1 NM_019453 Mediterranean fever 4 0 1 NM_007820 cytochrome P450 family 3, subfamily a, 4 0 1 NM_145365 cAMP responsive element binding protein 3-like 4 0 1 NM_007694 chromogranin B 4 0 1 NM_009676 aldehyde oxidase 1 4 0 1 NM_001001322 a disintegrin-like and metalloprotease 4 0 0 NM_201367 G protein-coupled receptor 176 4 0 0 NM_054088 adiponutrin 4 0 0 NM_146148 complement component 8 alpha polypeptide 4 0 0 NM_010018 D-amino acid oxidase 1 4 0 0 NM_183185 zinc finger protein 300 4 0 0 NM_023814 T-box18 4 0 0 NM_172486 KRAB-zinc finger protein 4 0 0 NM_172812 5-hydroxytryptamine serotonin receptor 2 A 4 0 0 NM_001081137 hypothetical protein LOC69983 4 0 0 NM_007737 procollagen type V, alpha 2 4 0 0 NM_012009 SH2 domain protein 1B 4 0 0 NM_176846 exophilin 5 4 0 0 NM_079835 butyrophilin-like 2 4 0 0 NM_183175 C1q and tumor necrosis factor related protein 9 4 0 0 NM_009751 beaded filament structural protein in lens-CP94 4 0 0 NM_001081120 hypothetical protein LOC69627 4 0 0 NM_010474 heparan sulfate glucosamine 4 0 0 NM_008555 mannan-binding lectin serine protease 1 4 0 0 NM_008059 G0/G1 switch gene 2 4 0 0 NM_010658 v-maf musculoaponeurotic fibrosarcoma oncogene 4 0 0 NM_008278 hydroxyprostaglandin dehydrogenase 15 NAD 4 0 0 NM_138655 transmembrane channel-like gene family 2 4 0 0 NM_001007463 sperm associated antigen 8 4 0 0 NM_009033 RNA binding motif protein X chromosome 4 0 0 NM_199317 PHD finger protein 16 4 0 0 NM_026793 myc target in myeloid cells 1 4 0 0 NM_021412 matrix metallopeptidase 19 4 0 0 NM_008424 potassium voltage-gated channel Isk-related 4 0 0 NM_146101 hyaluronic acid binding protein 2 4 0 0 NM_001007573 hypothetical protein LOC215090 4 0 0 NM_029102 glycosyltransferase 8 domain containing 2 4 0 0 NM_001034902 hypothetical protein LOC545861 4 0 0 NM_007909 ephrin A2 4 0 0 NM_007773 crystallin beta B2 4 0 0 NM_007678 CCAAT/enhancer binding protein alpha 4 0 0 NM_199062 hypothetical protein LOC331188 4 0 0 NM_001110009 apolipoprotein C-I precursor 4 0 0 NM_027857 aspartoacylase-3 4 0 0 NM_177060 hypothetical protein LOC320040 3 1202 81 NM_011498 basic helix-loop-helix domain containing class 3 397 3 NM_001081365 hypothetical protein LOC66060 3 289 74 NM_021542 potassium channel subfamily K, member 5 3 140 186 NM_019507 T-box 21 3 16 224 NM_013599 matrix metallopeptidase 9 3 180 58 NM_028064 solute carrier family 39 member 4 3 215 0 NM_011170 prion protein 3 190 11 NM_198862 neuroligin 2 3 191 0 NM_182927 sprouty-related EVH1 domain containing 3 3 188 3 NM_010065 dynamin 3 155 12 NM_023503 inhibitor of growth family member 2 3 148 2 NM_019681 frequenin homolog 3 145 0 NM_013874 D4 zinc and double PHD fingers family 1 3 140 1 NM_008012 aldo-keto reductase family 1 member B8 3 71 63 NM_007609 caspase 11 3 31 98 NM_178788 dCMP deaminase 3 120 5 NM_016920 ATPase H+ transporting, lysosomal V0 subunit a 3 112 5 NM_021396 programmed cell death 1 ligand 2 3 81 27 NM_007484 ras homolog gene family member C 3 88 5 NM_027419 hypothetical protein LOC70419 3 81 5 NM_013897 translocase of inner mitochondrial membrane 8 3 72 11 NM_198000 hypothetical protein LOC73598 3 83 0 NM_009760 BCL2/adenovirus E1B interacting protein 1 NIP3 3 79 3 NM_028986 GDNF-inducible zinc finger protein 1 3 81 0 NM_009860 cell division cycle 25 homolog C 3 75 1 NM_026524 MID1 interacting G12-like protein 3 59 13 NM_023523 peroxisomal trans 2-enoyl CoA reductase 3 65 4 NM_001083341 O-acyltransferase membrane bound domain 3 55 11 NM_148933 solute carrier organic anion transporter family 3 63 0 NM_019791 melanoma antigen family D 1 3 59 4 NM_020567 geminin 3 8 53 NM_153804 pleckstrin homology domain containing family G 3 36 25 NM_020028 endothelial differentiation lysophosphatidic 3 58 2 NM_007984 fascin homolog 1 actin bundling protein 3 59 0 NM_007634 cyclin F 3 43 16 NM_019403 ring finger protein 5 3 39 18 NM_133221 sodium/calcium exchanger protein 3 1 53 NM_001081389 NLR family pyrin domain containing 6 3 50 1 NM_146238 gem nuclear organelle associated protein 8 3 19 30 NM_001081226 hypothetical protein LOC69549 3 48 1 NM_011057 platelet derived growth factor B polypeptide 3 38 11 NM_024257 haloacid dehalogenase-like hydrolase domain 3 46 1 NM_028109 TPX2 microtubule-associated protein homolog 3 46 1 NM_017407 sperm associated antigen 5 3 46 0 NM_026473 tubulin beta 6 3 37 9 NM_172748 F-box and leucine-rich repeat protein 19 3 36 5 NM_007736 collagen type IV, alpha 5 3 25 15 NM_145820 VEPH isoform A 3 38 1 NM_139305 carbonic anhydrase 9 3 0 38 NM_146198 sodium/glucose cotransporter KST1 3 37 1 NM_181589 cytoskeleton associated protein 2-like 3 36 2 NM_011347 selectin platelet 3 31 6 NM_029153 secretory carrier membrane protein 1 3 37 0 NM_019549 pleckstrin 3 29 7 NM_177340 synaptopodin isoform A 3 8 27 NM_177292 WSC domain containing 2 3 18 16 NM_010476 hydroxysteroid 17-beta dehydrogenase 7 3 32 2 NM_008446 kinesin family member 4 3 0 34 NM_172893 poly ADP-ribose polymerase family member 12 3 33 0 NM_009599 acetylcholinesterase 3 19 13 NM_028140 major facilitator superfamily domain containing 3 23 9 NM_008993 peroxisomal membrane protein 2 3 28 3 NM_024290 tumor necrosis factor receptor superfamily 3 12 19 NM_153092 nucleoporin like 2 3 24 7 NM_153104 phosphatase orphan 1 3 7 24 NM_001033380 hypothetical protein LOC319622 3 13 16 NM_026632 replication protein A3 3 28 0 NM_198605 hypothetical protein LOC219114 3 26 2 NM_021360 neuralized homolog 3 10 18 NM_024198 glutathione peroxidase 7 3 26 1 NM_134471 kinesin family member 2C 3 13 12 NM_172437 pseudouridylate synthase 7 homolog S. 3 24 1 NM_027411 coiled-coil domain containing 99 3 23 2 NM_144805 transmembrane protein 40 3 12 12 NM_007404 a disintegrin and metalloprotease domain 9 3 18 6 NM_031843 dipeptidylpeptidase 7 3 18 6 NM_028390 anillin 3 1 23 NM_029440 hypothetical protein LOC381693 3 24 0 NM_010655 karyopherin importin alpha 2 3 23 0 NM_177307 cytochrome P450 family 2, subfamily E, 3 23 0 NM_177364 SH3 and PX domains 2B 3 22 0 NM_175563 proline rich 11 3 20 1 NM_008713 nitric oxide synthase 3 endothelial cell 3 9 11 NM_008088 growth arrest specific 7 isoform a 3 0 20 NM_007721 chemokine C-C motif receptor 10 3 2 17 NM_028484 hypothetical protein LOC73261 3 9 10 NM_178872 haprin 3 16 3 NM_031184 GLIS family zinc finger 2 3 14 5 NM_001081956 Talia 3 13 6 NM_026176 phosducin-like 3 3 15 NM_001033189 hypothetical protein LOC97130 3 17 1 NM_017465 sulfotransferase family cytosolic, 2B, member 3 10 8 NM_134041 hypothetical protein LOC104732 3 16 1 NM_178444 vascular endothelial statin isoform 1 precursor 3 8 9 NM_178896 DCN1 defective in cullin neddylation 1, domain 3 11 6 NM_030244 immediate early response 5-like 3 12 5 NM_010279 glial cell line derived neurotrophic factor 3 14 2 NM_026057 zinc finger protein 422 3 13 3 NM_001081230 microtubule-associated protein 9 3 4 11 NM_199251 potassium channel subfamily K, member 12 3 4 11 NM_008194 glycerol kinase isoform 1 3 2 13 NM_001033128 Bardet-Biedl syndrome 1 homolog 3 0 15 NM_023270 ring finger protein 128 3 7 9 NM_198628 hypothetical protein LOC279029 3 7 9 NM_001103168 GATA like protein-1 3 8 8 NM_029434 Leber congenital amaurosis 5 isoform a 3 14 1 NM_009601 cholinergic receptor nicotinic, beta 3 14 1 NM_053246 docking protein 4 3 14 1 NM_018859 aldo-keto reductase family 1 member E1 3 5 9 NM_010736 lymphotoxin B receptor 3 8 7 NM_011039 paired box 7 3 14 0 NM_001004140 cytoskeleton associated protein 2 3 14 0 NM_008830 ATP-binding cassette sub-family B MDR/TAP, 3 13 1 NM_019468 glucose-6-phosphate dehydrogenase 2 3 4 9 NM_009883 CCAAT/enhancer binding protein beta 3 8 6 NM_009765 breast cancer 2 3 7 7 NM_001033795 zinc finger CCHC domain containing 16 3 12 1 NM_001003911 a disintegrin-like and metalloprotease 3 12 1 NM_153544 hypothetical protein LOC217216 3 10 3 NM_010288 gap junction protein alpha 1 3 1 11 NM_008418 potassium voltage-gated channel shaker-related 3 8 5 NM_013539 splA/ryanodine receptor domain and SOCS box 3 12 0 NM_008986 polymerase I and transcript release factor 3 3 9 NM_026840 platelet-derived growth factor receptor-like 3 3 9 NM_001081155 Rap1 GTPase-activating protein 3 10 2 NM_175398 hypothetical protein LOC109050 3 10 2 NM_026023 NudC domain containing 2 3 1 10 NM_080467 ATPase H+ transporting, lysosomal V0 subunit A 3 1 10 NM_009839 chaperonin subunit 6b zeta 3 9 3 NM_024251 hypothetical protein LOC72103 3 9 3 NM_026219 ubiquinol-cytochrome c reductase binding 3 8 4 NM_028053 transmembrane protein 38B 3 8 4 NM_011957 cAMP responsive element binding protein 3-like 3 7 5 NM_001112661 similar to hepatitis B virus X interacting 3 4 7 NM_001042592 arrestin domain containing 4 isoform 1 3 2 9 NM_009962 G protein-coupled receptor 44 3 3 8 NM_174988 cadherin 22 3 10 1 NM_001081160 MAM domain containing 3 9 2 NM_145517 ORM1-like 1 3 8 3 NM_177861 transmembrane protein 67 3 4 6 NM_001004184 solute carrier family 28 sodium-coupled 3 3 7 NM_009464 uncoupling protein 3 mitochondrial proton 3 10 0 NM_010599 potassium voltage-gated channel shaker-related 3 1 9 NM_011980 zinc finger protein 146 3 9 1 NM_175247 zinc finger protein 28 3 9 1 NM_020275 tumor necrosis factor receptor superfamily 3 9 1 NM_030562 leucine rich repeat and fibronectin type III 3 8 2 NM_026005 hypothetical protein LOC67157 3 5 4 NM_011762 zinc finger protein 59 3 3 6 NM_010207 fibroblast growth factor receptor 2 isoform 3 3 6 NM_010816 MORC 3 2 7 NM_182930 pleckstrin homology domain containing family A 3 2 7 NM_001033223 lin 7 homolog a isoform 2 3 1 8 NM_172530 src homology 2 domain-containing transforming 3 9 0 NM_178609 E2F transcription factor 7 3 9 0 NM_177226 zinc finger protein 629 3 7 2 NM_027902 type II transmembrane serine protease 6 3 8 1 NM_153403 eukaryotic translation initiation factor 2C 1 3 8 1 NM_001081346 rhotekin 2 3 8 1 NM_001033311 hypothetical protein LOC231668 3 4 4 NM_175162 storkhead box 2 isoform 2 3 4 4 NM_028135 transmembrane protein 163 3 2 6 NM_001077403 neuropilin 2 isoform 1 precursor 3 2 6 NM_175561 pecanex-like 2 isoform 2 3 2 6 NM_013584 leukemia inhibitory factor receptor isoform 1 3 2 6 NM_177606 pleckstrin homology domain containing family H 3 2 6 NM_031396 cyclin M1 3 3 5 NM_007511 ATPase Cu++ transporting, beta polypeptide 3 3 5 NM_144865 receptor accessory protein 2 3 3 5 NM_001008427 hypothetical protein LOC434179 3 1 7 NM_146039 WD repeat domain 60 3 8 0 NM_027975 hypothetical protein LOC71878 3 8 0 NM_175283 steroid 5 alpha-reductase 1 3 8 0 NM_138595 glycine decarboxylase 3 7 1 NM_007691 checkpoint kinase 1 homolog 3 4 3 NM_009350 adenosine deaminase domain containing 1 testis 3 4 3 NM_011899 signal recognition particle 54a 3 4 3 NM_011040 paired box gene 8 3 4 3 NM_001082414 SH3 domain protein D19 3 4 3 NM_001081298 latrophilin 2 3 4 3 NM_027552 kynureninase L-kynurenine hydrolase 3 3 4 NM_008532 tumor-associated calcium signal transducer 1 3 3 4 NM_207655 epidermal growth factor receptor isoform 1 3 2 5 NM_207232 protein tyrosine phosphatase domain containing 1 3 2 5 NM_008712 nitric oxide synthase 1 neuronal 3 2 5 NM_007575 class II transactivator 3 2 5 NM_008591 met proto-oncogene 3 2 5 NM_027001 hypothetical protein LOC69239 3 1 6 NM_172737 hypothetical protein LOC232813 3 1 6 NM_011845 midline 2 3 1 6 NM_153579 synaptic vesicle glycoprotein 2 b 3 0 7 NM_010096 early B-cell factor 3 isoform 3 3 0 7 NM_026887 adaptor-related protein complex 1 sigma 2 3 5 1 NM_025451 calcium/calmodulin-dependent protein kinase II 3 5 1 NM_008077 glutamic acid decarboxylase 1 3 5 1 NM_172932 neuroligin 3 3 4 2 NM_027496 hypothetical protein LOC67434 isoform 2 3 2 4 NM_175369 coiled-coil domain containing 122 3 2 4 NM_028880 leucine-rich repeat transmembrane neuronal 1 3 2 4 NM_008420 potassium voltage gated channel Shab-related 3 2 4 NM_145947 solute carrier family 26 member 7 3 2 4 NM_011147 protein phosphatase with EF hand calcium-binding 3 3 3 NM_177005 glycosyltransferase 1 domain containing 1 3 3 3 NM_029916 serine threonine kinase 31 3 3 3 NM_138674 polycystic kidney and hepatic disease 1-like 1 3 3 3 NM_153177 Piwi/Argonaute family protein meIF2C4 3 3 3 NM_130867 X kin of IRRE like 1 3 1 5 NM_172603 PHD finger protein 11 3 1 5 NM_027564 hypothetical protein LOC70821 3 1 5 NM_134109 immunoglobulin-like domain containing receptor 3 1 5 NM_153507 copine II 3 1 5 NM_001033453 protein phosphatase 2C magnesium dependent, 3 0 6 NM_026701 MAWD binding protein homolog 1 3 0 6 NM_198627 V-set and transmembrane domain containing 3 0 6 NM_153124 sialyltransferase 8E isoform middle 3 0 6 NM_011575 trefoil factor 3 intestinal 3 5 0 NM_025319 hypothetical protein LOC66050 3 5 0 NM_009355 testicular serine protease 1 3 5 0 NM_001042653 Opa interacting protein 5 3 5 0 NM_032541 hepcidin antimicrobial peptide 3 4 1 NM_023879 retinitis pigmentosa GTPase regulator 3 4 1 NM_176965 EF-hand calcium binding domain 5 3 4 1 NM_010917 nidogen 1 3 4 1 NM_001001602 disabled homolog 2 interacting protein isoform 3 4 1 NM_144828 protein phosphatase 1 regulatory inhibitor 3 3 2 NM_173740 monoamine oxidase A 3 3 2 NM_013592 matrilin 4 3 3 2 NM_011148 serine/threonine protein phosphatase with 3 3 2 NM_001080549 highly divergent homeobox 3 3 2 NM_021356 growth factor receptor bound protein 3 3 2 NM_028749 N-acetylneuraminate pyruvate lyase 3 2 3 NM_010795 mannoside acetylglucosaminyltransferase 3 3 2 3 NM_007730 procollagen type XII, alpha 1 3 2 3 NM_145489 hypothetical protein LOC224833 3 2 3 NM_001034864 Tes-like protein 3 2 3 NM_008313 serotonin 5-HT4 receptor 3 2 3 NM_173749 regeneration associated muscle protease 3 2 3 NM_008968 prostaglandin I2 prostacyclin synthase 3 1 4 NM_025489 DnaJ Hsp40 homolog subfamily C, member 5 3 1 4 NM_029361 WNK lysine deficient protein kinase 2 3 1 4 NM_008304 syndecan 2 3 1 4 NM_028021 myosin heavy polypeptide 14 3 1 4 NM_001081185 filamin C gamma 3 1 4 NM_001042503 tripartite motif-containing 71 3 1 4 NM_025789 radial spokehead-like 2A 3 1 4 NM_152813 phospholipase C delta 3 3 1 4 NM_177350 gliomedin 3 0 5 NM_001033354 IQ motif and Sec7 domain 3 3 0 5 NM_080466 potassium intermediate/small conductance 3 0 5 NM_175165 transformation related protein 63 regulated 3 0 5 NM_198612 glycosyltransferase 8 domain containing 4 3 0 5 NM_027182 thyroid hormone receptor interactor 13 3 0 5 NM_013627 paired box gene 6 3 0 5 NM_019500 claudin 14 3 0 5 NM_028967 basic leucine zipper transcription factor 3 0 5 NM_025376 hypothetical protein LOC66139 3 4 0 NM_153803 galactosidase beta 1-like 2 3 4 0 NM_172967 hypothetical protein LOC269033 3 4 0 NM_177752 essential meiotic endonuclease 1 homolog 1 3 4 0 NM_172289 proton/amino acid transporter 4 3 4 0 NM_008861 polycystic kidney disease 2 3 2 2 NM_145136 myocardin isoform A 3 2 2 NM_011510 ATP-binding cassette sub-family C CFTR/MRP, 3 2 2 NM_177164 hypothetical protein LOC320460 3 2 2 NM_015798 F-box protein 15 3 2 2 NM_001081172 FERM and PDZ domain containing 1 3 2 2 NM_145548 cytochrome P450 family 2, subfamily j, 3 2 2 NM_001033289 solute carrier family 9 sodium/hydrogen 3 2 2 NM_177674 hypothetical protein LOC544678 3 2 2 NM_178143 AMP-activated protein kinase alpha 2 catalytic 3 2 2 NM_011325 sodium channel nonvoltage-gated 1 beta 3 2 2 NM_009988 coxsackievirus and adenovirus receptor isoform 3 2 2 NM_007934 glutamyl aminopeptidase 3 3 1 NM_001037927 WD repeat domain 93 3 3 1 NM_010950 numb-like 3 3 1 NM_001109658 pre-acrosome localization protein 1 isoform 2 3 3 1 NM_025993 MIS12 homolog 3 1 3 NM_177331 Gen homolog 1 endonuclease 3 1 3 NM_001081361 MOCO sulphurase C-terminal domain containing 1 3 1 3 NM_030021 hypothetical protein LOC77996 3 1 3 NM_145447 feline leukemia virus subgroup C cellular 3 1 3 NM_027627 hypothetical protein LOC70967 3 1 3 NM_021716 fidgetin 3 1 3 NM_146015 epidermal growth factor-containing fibulin-like 3 1 3 NM_148931 solute carrier family 6 neurotransmitter 3 1 3 NM_183033 zinc finger protein 516 3 1 3 NM_133659 avian erythroblastosis virus E-26 v-ets 3 1 3 NM_010211 four and a half LIM domains 1 isoform 3 3 1 3 NM_001035228 ST3 beta-galactoside alpha-23-sialyltransferase 3 1 3 NM_181395 peroxidasin 3 1 3 NM_198618 disks large-associated protein 3 3 1 3 NM_001008231 dishevelled associated activator of 3 0 4 NM_008867 phospholipase A2 receptor 1 3 0 4 NM_183294 cyclin-dependent kinase-like 1 CDC2-related 3 0 4 NM_033652 LIM homeobox transcription factor 1 alpha 3 0 4 NM_013598 kit ligand 3 0 4 NM_009534 yes-associated protein 1 3 0 4 NM_172682 hypothetical protein LOC229488 3 0 4 NM_027660 tektin 3 3 0 4 NM_177628 hypothetical protein LOC219148 3 0 4 NM_026188 hypothetical protein LOC67483 3 0 4 NM_001080933 ankyrin-repeat and fibronectin type III domain 3 0 4 NM_001037865 collagen type XXVIII, alpha 1 3 0 4 NM_001025382 hypothetical protein LOC574403 3 0 4 NM_172890 gamma-aminobutyric acid GABA-A transporter 4 3 0 4 NM_001077514 excitatory amino acid transporter 2 isoform 1 3 0 4 NM_001025372 adenylate cyclase activating polypeptide 1 3 0 4 NM_029170 hypothetical protein LOC75106 3 3 0 NM_173376 RNA binding motif protein X-linked 2 3 3 0 NM_019683 ankyrin repeat domain 49 3 3 0 NM_001013376 ribonuclease P/MRP 38 subunit 3 3 0 NM_198651 hypothetical protein LOC381218 3 3 0 NM_008204 histocompatibility 2 M region locus 2 3 3 0 NM_175236 Fe-containing alcohol dehydrogenase 1 3 2 1 NM_019969 pleiomorphic adenoma gene 1 3 2 1 NM_001081139 ankyrin repeat domain 35 3 2 1 NM_153553 neuronal PAS domain protein 4 3 2 1 NM_009330 transcription factor 2 3 2 1 NM_172298 teashirt zinc finger family member 3 3 2 1 NM_001033535 tumor necrosis factor alpha-induced protein 3 2 1 NM_028125 zinc finger and BTB domain containing 46 3 2 1 NM_021509 monooxygenase DBH-like 1 3 2 1 NM_145608 cDNA sequence BC021891 3 1 2 NM_021050 cystic fibrosis transmembrane conductance 3 1 2 NM_001018019 glutaredoxin cysteine-rich 1 protein 3 1 2 NM_175514 hypothetical protein LOC241520 3 1 2 NM_019741 solute carrier family 2 facilitated glucose 3 1 2 NM_001111141 hypothetical protein LOC244666 3 1 2 NM_173422 collectin sub-family member 10 3 1 2 NM_172794 zinc finger protein 454 3 1 2 NM_054044 G protein-coupled receptor 124 3 1 2 NM_177192 hypothetical protein LOC320560 3 1 2 NM_053106 leiomodin 1 smooth muscle 3 1 2 NM_020259 Hedgehog-interacting protein precursor 3 1 2 NM_031186 N-deacetylase/N-sulfotransferase heparan 3 1 2 NM_001030317 syntaxin-binding protein 3B 3 1 2 NM_133199 sodium channel voltage-gated, type IV, alpha 3 1 2 NM_194268 one cut domain family member 2 3 1 2 NM_001039364 myelin-associated oligodendrocytic basic protein 3 1 2 NM_029296 hypothetical protein LOC75462 3 0 3 NM_001080809 carbamoyl-phosphate synthetase 1 3 0 3 NM_008092 GATA binding protein 4 3 0 3 NM_011516 synaptonemal complex protein 1 3 0 3 NM_145141 Fc receptor homolog expressed in B cells 3 0 3 NM_011674 UDP galactosyltransferase 8A 3 0 3 NM_194357 antimicrobial peptide RYA3 3 0 3 NM_013723 podocalyxin-like 3 0 3 NM_001003824 potassium voltage-gated channel KQT-like protein 3 0 3 NM_177750 FERM and PDZ domain containing 3 3 0 3 NM_145920 Ellis van Creveld syndrome 2 homolog 3 0 3 NM_030206 cytoglobin 3 0 3 NM_007390 cholinergic receptor nicotinic, alpha 7 3 2 0 NM_007423 alpha fetoprotein 3 2 0 NM_010098 opsin encephalopsin 3 2 0 NM_009762 SET and MYND domain containing 1 3 2 0 NM_001098170 protocadherin 10 isoform 1 3 2 0 NM_146235 excision repair cross-complementing rodent 3 2 0 NM_001007580 hypothetical protein LOC333564 3 2 0 NM_178928 actin filament associated protein 1-like 1 3 2 0 NM_144838 small glutamine-rich tetratricopeptide repeat 3 2 0 NM_008829 progesterone receptor 3 2 0 NM_019564 HtrA serine peptidase 1 3 2 0 NM_001112744 Rho guanine nucleotide exchange factor GEF 16 3 1 1 NM_144785 solute carrier family 22 organic anion 3 1 1 NM_173384 SRY-box containing gene 30 3 1 1 NM_194263 T-box 20 isoform a 3 1 1 NM_008081 beta-14-N-acetyl-galactosaminyl transferase 2 3 1 1 NM_139232 FYVE RhoGEF and PH domain containing 4 isoform 3 1 1 NM_019412 periaxin isoform S 3 1 1 NM_011643 transient receptor potential cation channel 3 1 1 NM_178594 V-set domain containing T cell activation 3 1 1 NM_172463 sushi nidogen and EGF-like domains 1 3 1 1 NM_001081060 solute carrier family 9 sodium/hydrogen 3 1 1 NM_177200 SV2 related protein homolog rat-like 3 1 1 NM_199065 SLIT and NTRK-like family member 1 3 1 1 NM_011087 paired-Ig-like receptor A1 3 1 1 NM_008516 leucine rich repeat protein 1 neuronal 3 1 1 NM_010710 LIM homeobox protein 2 3 1 1 NM_183141 leucine rich repeat and fibronectin type III 3 1 1 NM_010059 disrupted meiotic cDNA 1 homolog 3 1 1 NM_145634 polymeric immunoglobulin receptor 3 precursor 3 1 1 NM_009705 arginase type II 3 1 1 NM_001081169 hypothetical protein LOC104816 3 0 2 NM_138649 synaptotagmin XVII 3 0 2 NM_001012324 extracellular matrix protein 2 3 0 2 NM_001048204 zinc finger protein 455 3 0 2 NM_177960 isopentenyl-diphosphate delta isomerase isoform 3 0 2 NM_019810 solute carrier family 5 sodium/glucose 3 0 2 NM_001093750 patched domain containing 1 3 0 2 NM_148946 solute carrier family 8 sodium/calcium 3 0 2 NM_024414 syntaxin 1B 3 0 2 NM_133364 proline rich membrane anchor 1 precursor 3 0 2 NM_015795 F-box protein 16 3 0 2 NM_133197 mcf.2 transforming 3 0 2 NM_172527 MTH2 protein 3 0 2 NM_027171 hypothetical protein LOC69697 3 0 2 NM_028220 WD repeat domain 17 3 0 2 NM_011700 villin-like 3 0 2 NM_018803 synaptotagmin X 3 0 2 NM_022411 solute carrier family 13 sodium-dependent 3 0 2 NM_019799 Rhesus blood group-associated C glycoprotein 3 0 2 NM_194055 RNA binding motif protein 35A 3 0 2 NM_145572 glycogen synthase 2 3 0 2 NM_178382 fibronectin leucine rich transmembrane protein 3 0 2 NM_008005 fibroblast growth factor 18 3 0 2 NM_183171 fasciculation and elongation protein zeta 1 3 0 2 NM_010171 coagulation factor III 3 0 2 NM_207663 desmuslin isoform M 3 0 2 NM_177129 contactin 2 3 0 2 NM_025746 hypothetical protein LOC66755 3 0 2 NM_025619 hypothetical protein LOC227736 3 0 2 NM_028055 hypothetical protein LOC72014 3 0 2 NM_010701 leukocyte cell derived chemotaxin 1 3 1 0 NM_001113323 galactosidase beta 1 like 3 3 1 0 NM_009020 recombination activating gene 2 3 1 0 NM_001097621 kinesin family member 26A 3 1 0 NM_021489 coagulation factor XII Hageman factor 3 1 0 NM_001007576 guanylate cyclase 2f 3 1 0 NM_175316 solute carrier organic anion transporter family 3 1 0 NM_007782 colony stimulating factor 3 receptor 3 1 0 NM_016663 synaptotagmin III 3 1 0 NM_027582 hypothetical protein LOC70861 3 1 0 NM_009446 tubulin alpha 1a 3 1 0 NM_134160 mucolipin 3 3 1 0 NM_021715 carbohydrate N-acetylglucosamino 3 1 0 NM_026094 ATPase class I, type 8B, member 3 3 1 0 NM_001081386 cadherin 19 type 2 3 1 0 NM_011595 tissue inhibitor of metalloproteinase 3 3 1 0 NM_182995 CP110 protein 3 1 0 NM_026743 tetraspanin 11 3 1 0 NM_008360 interleukin 18 3 1 0 NM_019467 allograft inflammatory factor 1 3 1 0 NM_145364 aldo-keto reductase family 1 member D1 3 1 0 NM_001003817 v-erb-b2 erythroblastic leukemia viral oncogene 3 1 0 NM_011448 SRY-box containing gene 9 3 1 0 NM_080470 SMC structural maintenace of chromosomes 3 1 0 NM_178703 solute carrier family 6 neurotransmitter 3 1 0 NM_028030 RNA binding protein with multiple splicing 2 3 1 0 NM_181422 polycystic kidney disease 2-like 1 3 1 0 NM_001009546 N-acetylated alpha-linked acidic 3 1 0 NM_009951 insulin-like growth factor 2 mRNA binding 3 1 0 NM_198962 hypocretin orexin receptor 2 3 1 0 NM_172825 G protein-coupled receptor 128 3 1 0 NM_001033442 hypothetical protein LOC381059 3 1 0 NM_175178 apoptosis-inducing factor like 3 1 0 NM_054094 acyl-CoA synthetase medium-chain family member 3 0 1 NM_001081679 Riken cDNA F930017I19 3 0 1 NM_027571 purinergic receptor P2Y12 3 0 1 NM_173417 potassium voltage-gated channel 3 0 1 NM_010233 fibronectin 1 3 0 1 NM_001029867 UDP glucuronosyltransferase 2 family 3 0 1 NM_053079 solute carrier family 15 oligopeptide 3 0 1 NM_021359 integrin beta 6 3 0 1 NM_023245 palmdelphin 3 0 1 NM_177578 hypothetical protein LOC195564 isoform b 3 0 1 NM_001034899 hypothetical protein LOC545391 3 0 1 NM_027918 hypothetical protein LOC71775 3 0 1 NM_011481 src-related kinase lacking C-terminal regulatory 3 0 1 NM_021491 sphingomyelin phosphodiesterase 3 neutral 3 0 1 NM_145219 leucine-rich repeat LGI family member 3 3 0 1 NM_009693 apolipoprotein B precursor 3 0 1 NM_027759 fibrous sheath-interacting protein 1 3 0 1 NM_177028 hypothetical protein LOC319888 3 0 1 NM_019645 plakophilin 1 3 0 1 NM_009641 angiopoietin 4 3 0 1 NM_177850 bactericidal permeablility increasing protein 3 0 1 NM_001013793 hypothetical protein LOC433100 3 0 1 NM_009663 arachidonate 5-lipoxygenase activating protein 3 0 1 NM_009324 T-box 2 3 0 1 NM_010820 multiple PDZ domain protein 3 0 1 NM_177704 synaptotagmin-like 5 3 0 1 NM_030556 solute carrier family 19 sodium/hydrogen 3 0 1 NM_001029988 FAT tumor suppressor homolog 2 3 0 1 NM_010197 fibroblast growth factor 1 3 0 1 NM_146050 oncoprotein induced transcript 1 3 0 1 NM_023476 tubulointerstitial nephritis antigen-like 3 0 1 NM_019784 testis expressed gene 21 3 0 1 NM_133184 solute carrier family 5 member 4a 3 0 1 NM_023557 choline transporter-like protein 4 3 0 1 NM_001039181 natriuretic peptide receptor 3 isoform b 3 0 1 NM_146106 lysophospholipase-like 1 3 0 1 NM_010732 leucine rich repeat protein 2 neuronal 3 0 1 NM_013905 hairy/enhancer-of-split related with YRPW 3 0 1 NM_178747 gulonolactone L- oxidase 3 0 1 NM_018881 flavin-containing monooxygenase 2 3 0 1 NM_001081253 F-box protein 43 3 0 1 NM_021456 carboxylesterase 1 3 0 1 NM_175425 C1q and tumor necrosis factor related protein 7 3 0 1 NM_013483 butyrophilin subfamily 1, member A1 3 0 1 NM_175235 bruno-like 6 RNA binding protein 3 0 1 NM_001081063 hypothetical protein LOC71037 3 0 1 NM_207204 ninein-like 3 0 1 NM_009868 cadherin 5 3 0 0 NM_001013753 protocadherin 17 3 0 0 NM_019397 EGF-like-domain multiple 6 3 0 0 NM_031880 tyrosine kinase non-receptor, 1 3 0 0 NM_133995 ureidopropionase beta 3 0 0 NM_028066 coagulation factor XI 3 0 0 NM_001007460 zinc finger DHHC domain containing 23 3 0 0 NM_177690 NACHT leucine rich repeat and PYD containing 2 3 0 0 NM_009731 aldo-keto reductase family 1 member B7 3 0 0 NM_010258 GATA binding protein 6 3 0 0 NM_001013769 regulator of sex limited protein 1 3 0 0 NM_020565 sulfotransferase family 3A member 1 3 0 0 NM_028104 PKC-dependent PP1 inhibitory protein subunit 14 3 0 0 NM_011402 solute carrier family 34 sodium phosphate 3 0 0 NM_033614 phosphodiesterase 6C cGMP specific, cone, alpha 3 0 0 NM_029981 ADAMTS-like 2 3 0 0 NM_001003915 solute carrier family 5 sodium/glucose 3 0 0 NM_013547 homogentisate 1 2-dioxygenase 3 0 0 NM_030025 hypothetical protein LOC78016 3 0 0 NM_009918 cyclic nucleotide gated channel alpha 3 3 0 0 NM_172050 CD300e antigen 3 0 0 NM_001079869 homeo box B3 3 0 0 NM_153397 a disintegrin and metallopeptidase domain 32 3 0 0 NM_029784 hypothetical protein LOC76886 3 0 0 NM_001024478 hypothetical protein LOC68764 3 0 0 NM_010604 potassium inwardly-rectifying channel J16 3 0 0 NM_028942 solute carrier organic anion transporter family 3 0 0 NM_053248 solute carrier family 5 sodium iodide 3 0 0 NM_029612 SLAM family member 9 3 0 0 NM_009776 serine or cysteine proteinase inhibitor clade 3 0 0 NM_009130 secretogranin III 3 0 0 NM_008262 one cut domain family member 1 3 0 0 NM_130858 neurexophilin 3 3 0 0 NM_054095 neuronal calcium-binding protein 2 3 0 0 NM_001039056 potassium inwardly-rectifying channel J15 3 0 0 NM_133871 interferon-induced protein 44 3 0 0 NM_017371 hemopexin 3 0 0 NM_010381 histocompatibility 2 class II antigen E alpha 3 0 0 NM_001033241 hypothetical protein LOC211208 3 0 0 NM_001033488 hypothetical protein LOC432628 3 0 0 NM_010267 ganglioside-induced 3 0 0 NM_008003 fibroblast growth factor 15 3 0 0 NM_017468 enamelin 3 0 0 NM_177866 channel sperm associated 4 3 0 0 NM_199200 hypothetical protein LOC217219 3 0 0 NM_172581 hypothetical protein LOC217705 3 0 0 NM_027420 hypothetical protein LOC70420 2 27314 161 NM_139198 placenta-specific 8 2 1461 17 NM_007796 cytotoxic T lymphocyte-associated protein 2 2 13 931 NM_001099217 lymphocyte antigen 6 complex locus C2 2 879 3 NM_009150 selenium binding protein 1 2 724 0 NM_008156 glycosylphosphatidylinositol specific 2 122 360 NM_015789 dickkopf-like 1 2 381 1 NM_008501 leukemia inhibitory factor isoform a 2 301 15 NM_011733 cold shock domain protein A short isoform 2 219 27 NM_007403 a disintegrin and metallopeptidase domain 8 2 144 20 NM_029005 mixed lineage kinase domain-like 2 156 5 NM_013565 integrin alpha 3 2 155 2 NM_009846 CD24a antigen 2 150 1 NM_010058 dystrophia myotonica-containing WD repeat motif 2 140 3 NM_027954 synaptonemal complex central element protein 2 2 139 0 NM_054055 solute carrier family 13 sodium-dependent 2 137 2 NM_007498 activating transcription factor 3 2 126 10 NM_146006 lanosterol synthase 2 124 12 NM_009023 receptor-associated protein of the synapse 2 127 5 NM_009106 rhotekin isoform 1 2 125 2 NM_178727 hypothetical protein LOC242484 2 117 5 NM_152803 heparanase 2 95 16 NM_207298 cerebral endothelial cell adhesion molecule 1 2 96 7 NM_015811 regulator of G-protein signaling 1 2 98 4 NM_010265 glucosaminyl N-acetyl transferase 1 core 2 2 89 12 NM_172049 transmembrane protein 18 2 96 5 NM_001029873 unc-13 homolog A 2 73 22 NM_053169 tripartite motif protein 16 2 94 1 NM_009773 budding uninhibited by benzimidazoles 1 homolog 2 88 2 NM_029601 hypothetical protein LOC76411 2 84 0 NM_001099664 neuropeptide W preproprotein 2 83 0 NM_171826 claudin domain containing 1 2 62 14 NM_133994 glutathione S-transferase theta 3 2 67 0 NM_028027 RAC/CDC42 exchange factor 2 66 1 NM_011497 serine/threonine protein kinase 6 2 66 0 NM_011896 sprouty homolog 1 2 61 3 NM_010927 nitric oxide synthase 2 inducible, macrophage 2 12 52 NM_001025577 avian musculoaponeurotic fibrosarcoma v-maf 2 31 31 NM_010837 microtubule-associated protein 6 isoform 1 2 16 43 NM_009807 caspase 1 2 33 26 NM_013524 fucosyltransferase 7 2 58 0 NM_023284 NUF2R protein 2 57 0 NM_025429 serine or cysteine proteinase inhibitor clade 2 2 55 NM_001081079 opioid growth factor receptor-like 1 2 48 8 NM_029798 FLYWCH family member 2 2 5 49 NM_008013 fibrinogen-like protein 2 2 47 6 NM_025445 ADP-ribosylation factor GTPase activating 2 48 1 NM_198675 hypothetical protein LOC382137 2 47 0 NM_025778 apoptosis regulator BCL-G 2 38 9 NM_011636 phospholipid scramblase 1 2 8 39 NM_007557 bone morphogenetic protein 7 2 43 1 NM_013882 G two S phase expressed protein 1 2 41 3 NM_013643 protein tyrosine phosphatase non-receptor type 2 39 5 NM_001013817 SP140 nuclear body protein family member 2 43 0 NM_010285 growth hormone releasing hormone 2 2 39 NM_010872 baculoviral IAP repeat-containing 1b 2 40 0 NM_013603 metallothionein 3 2 39 1 NM_018865 WNT1 inducible signaling pathway protein 1 2 33 5 NM_030717 lactamase beta 2 30 8 NM_144539 SLAM family member 7 2 22 16 NM_027881 oxysterol-binding protein-like protein 3 2 25 12 NM_028680 huntingtin-interacting protein-1 protein 2 1 34 NM_028543 RIKEN cDNA 1700065O13 2 9 26 NM_007778 colony stimulating factor 1 isoform 1 precursor 2 29 6 NM_009504 vitamin D receptor 2 33 1 NM_029341 calcyphosine-like 2 33 1 NM_178877 Na+/H+ exchanger domain containing 2 2 25 9 NM_172769 sterol-C5-desaturase fungal ERG3 2 30 4 NM_182782 kelch-like 25 2 32 1 NM_134028 tubulin gamma 2 2 31 2 NM_001081023 calcium channel voltage-dependent, L type, 2 30 3 NM_021606 NIMA never in mitosis gene a-related expressed 2 29 4 NM_027191 nucleoporin 37 2 32 0 NM_021788 sin3 associated polypeptide 2 32 0 NM_026560 cell division cycle associated 8 2 32 0 NM_181444 G protein-coupled receptor family C, group 5, 2 32 0 NM_172633 cerebellin 2 precursor protein 2 30 2 NM_028888 hypothetical protein LOC74356 2 18 13 NM_028398 alanine-glyoxylate aminotransferase 2-like 2 2 31 0 NM_001085378 RIKEN cDNA 0610038P03 2 31 0 NM_183103 testis serine protease 6 2 24 7 NM_023223 cell division cycle 20 homolog 2 29 1 NM_009291 stimulated by retinoic acid gene 6 2 27 3 NM_175443 ethanolamine kinase 2 2 10 20 NM_029686 polycystin 1-like 2 2 16 13 NM_025277 guanine nucleotide binding protein G protein 2 29 0 NM_009748 blocked early in transport 1 homolog 2 27 2 NM_153068 EH-domain containing 2 2 9 20 NM_026837 transmembrane protein 53 2 9 20 NM_010067 tRNA aspartic acid methyltransferase 1 2 28 0 NM_001039562 ankyrin repeat domain 37 2 27 1 NM_011519 syndecan 1 2 9 17 NM_053161 mitochondrial ribosomal protein L27 2 23 3 NM_011961 procollagen lysine 2-oxoglutarate 5-dioxygenase 2 16 9 NM_028479 MRG-binding protein 2 24 1 NM_145418 hypothetical protein LOC215751 2 15 9 NM_172507 SH3 domain binding glutamic acid-rich protein 2 19 5 NM_033622 tumor necrosis factor ligand superfamily 2 18 6 NM_016965 NCK-associated protein 1 2 2 22 NM_001024135 kelch repeat and BTB POZ domain containing 2 7 17 NM_019819 dual specificity phosphatase 14 2 22 2 NM_027744 hypothetical protein LOC71275 2 13 10 NM_009712 arylsulfatase B 2 0 23 NM_021301 solute carrier family 15 H+/peptide 2 19 3 NM_133888 sphingomyelin phosphodiesterase acid-like 3B 2 11 11 NM_001080780 ret proto-oncogene isoform c 2 18 4 NM_028900 Golgi coiled coil protein 1 2 17 5 NM_025638 glycerophosphodiester phosphodiesterase domain 2 16 6 NM_001003815 erythrocyte protein band 4.1-like 1 isoform b 2 22 0 NM_018769 deafness autosomal dominant 5 protein 2 22 0 NM_019928 kallikrein 4 prostase enamel matrix, 2 19 2 NM_011832 insulin receptor-related receptor 2 20 1 NM_001039556 RAD54 homolog B 2 20 1 NM_029338 hypothetical protein LOC75564 2 18 3 NM_010164 eyes absent 1 2 1 20 NM_011663 U2 small nuclear ribonucleoprotein auxiliary 2 0 21 NM_146146 leptin receptor isoform 1 2 15 6 NM_172715 1-acylglycerol-3-phosphate O-acyltransferase 9 2 20 0 NM_013703 very low density lipoprotein receptor 2 20 0 NM_133924 sorting nexin family member 21 2 19 1 NM_029331 hypothetical protein LOC75541 2 3 17 NM_001001326 suppression of tumorigenicity 5 isoform 1 2 1 19 NM_008727 natriuretic peptide receptor 1 2 19 0 NM_033270 E2F transcription factor 6 2 19 0 NM_201607 phosphodiesterase 4C cAMP specific 2 18 1 NM_172499 major facilitator superfamily domain containing 2 1 18 NM_172791 phospholipase A2 group III 2 7 12 NM_008629 Musashi homolog 1 2 14 5 NM_153529 neuritin 1 2 4 14 NM_145890 grainyhead like 1 2 12 7 NM_008796 phosphatidylcholine transfer protein 2 12 7 NM_016797 syntaxin 7 2 17 1 NM_023179 ATPase H+ transporting, V1 subunit G isoform 2 2 17 1 NM_025660 RIB43A domain with coiled-coils 1 2 17 1 NM_016863 FK506 binding protein 1b 2 16 2 NM_026247 glycosyltransferase 28 domain containing 1 2 7 11 NM_022565 N-deacetylase/N-sulfotransferase heparin 2 12 6 NM_020282 NADPH dehydrogenase quinone 2 2 11 7 NM_001037742 hypothetical protein LOC68736 isoform 1 2 3 14 NM_173770 hypothetical protein LOC240479 2 16 1 NM_172844 flavin containing monooxygenase 9 2 11 6 NM_007514 solute carrier family 7 cationic amino acid 2 12 5 NM_001081364 Rho GTPase activating protein 21 2 12 5 NM_199042 THAP domain containing apoptosis associated 2 10 7 NM_019813 drebrin 1 2 16 0 NM_146162 transmembrane protein 119 2 0 16 NM_008872 plasminogen activator tissue 2 15 1 NM_178644 out at first 2 12 4 NM_019775 carboxypeptidase B2 plasma 2 0 15 NM_027728 enkurin 2 14 1 NM_009561 zinc finger protein 61 2 13 2 NM_001110315 kinesin family member 1A isoform b 2 13 2 NM_001003955 RAB11 family interacting protein 5 class I 2 0 14 NM_026535 visceral adipose-specific SERPIN 2 14 0 NM_145577 hypothetical protein LOC232855 2 13 1 NM_024495 carbonic anhydrase 13 2 13 1 NM_178412 hypothetical protein LOC229688 2 11 3 NM_001033331 growth arrest-specific 2 like 3 2 11 3 NM_001033484 IQ motif containing GTPase activating protein 3 2 11 3 NM_145924 centromere protein I 2 3 10 NM_198861 hypothetical protein LOC192976 2 10 4 NM_145857 caspase recruitment domain family member 15 2 7 7 NM_001093764 myeloid-associated differentiation marker 2 13 0 NM_010807 MARCKS-like 1 2 13 0 NM_013613 nuclear receptor subfamily 4 group A, member 2 2 13 0 NM_009970 colony stimulating factor 2 receptor alpha 2 13 0 NM_001033449 amyotrophic lateral sclerosis 2 juvenile 2 13 0 NM_030152 nucleolar protein 3 2 11 2 NM_177178 LMBR1 domain containing 2 2 11 2 NM_023844 junction adhesion molecule 2 2 12 1 NM_028131 centromere protein N 2 1 11 NM_008380 inhibin beta A 2 0 12 NM_011823 G protein-coupled receptor 34 2 12 0 NM_021351 crystallin beta A4 2 12 0 NM_144560 GAS2-related protein isoform beta 2 12 0 NM_181416 Rho GTPase activating protein 11A 2 2 9 NM_007552 Bmi1 polycomb ring finger oncogene 2 2 9 NM_030167 hypothetical protein LOC78755 2 1 10 NM_178888 GTPase activating RANGAP domain-like 3 2 0 11 NM_001081235 meningioma 1 2 7 5 NM_178929 Kazal-type serine peptidase inhibitor domain 1 2 3 8 NM_011780 a disintegrin and metallopeptidase domain 23 2 10 1 NM_144520 SEC14-like 2 2 10 1 NM_016691 chloride channel 5 2 10 1 NM_025962 methylmalonic aciduria cblC type with 2 0 10 NM_153801 steroid 5 alpha-reductase 2-like 2 2 7 4 NM_025833 BAI1-associated protein 2-like 1 2 8 3 NM_015783 ISG15 ubiquitin-like modifier 2 8 3 NM_175029 APG4 autophagy 4 homolog C 2 3 7 NM_172951 syntrophin gamma 2 2 2 8 NM_009367 transforming growth factor beta 2 2 10 0 NM_145953 cystathionase 2 10 0 NM_007709 Cbp/p300-interacting transactivator with 2 10 0 NM_010118 early growth response 2 2 10 0 NM_145611 ankyrin repeat domain 25 2 10 0 NM_001081963 hypothetical protein LOC240185 2 10 0 NM_009208 solute carrier family 4 anion exchanger 2 10 0 NM_013900 antigen p97 melanoma associated identified by 2 1 9 NM_001034870 serine or cysteine peptidase inhibitor clade 2 9 1 NM_001081062 cyclin O 2 8 2 NM_207031 transmembrane protein 16g 2 8 2 NM_134102 phospholipase A1 member A 2 8 2 NM_178914 spermatogenesis associated 7 2 7 3 NM_008078 glutamic acid decarboxylase 2 2 5 4 NM_011282 Ros1 proto-oncogene 2 5 4 NM_028889 EF hand domain containing 1 2 5 4 NM_007892 E2F transcription factor 5 2 3 6 NM_028533 hypothetical protein LOC73410 2 9 0 NM_025979 microtubule associated serine/threonine 2 9 0 NM_183000 amiloride-sensitive cation channel 3 2 9 0 NM_029661 hypothetical protein LOC76573 2 0 9 NM_010819 C-type lectin superfamily member 8 2 7 2 NM_030209 LCCL domain containing cysteine-rich secretory 2 8 1 NM_007906 eukaryotic translation elongation factor 1 alpha 2 8 1 NM_153574 family with sequence similarity 13 member A1 2 8 1 NM_011176 suppression of tumorigenicity 14 colon 2 8 1 NM_019723 solute carrier family 22 organic cation 2 8 1 NM_145976 TIFA-related protein TIFAB 2 8 1 NM_181681 plasticity-related protein 2 2 4 4 NM_001080776 coxsackie adenovirus receptor-like 2 2 6 NM_153054 solute carrier family 18 member 1 2 2 6 NM_028953 transmembrane channel-like gene family 1 2 2 6 NM_013589 latent transforming growth factor beta binding 2 2 6 NM_028226 RNA binding motif protein 12B 2 2 6 NM_018763 carbohydrate sulfotransferase 2 2 3 5 NM_178240 tripartite motif protein 50 2 3 5 NM_026158 isochorismatase domain containing 2 2 1 7 NM_011800 cadherin 20 2 1 7 NM_010929 Notch gene homolog 4 2 1 7 NM_001103367 retinoic acid induced 2 2 1 7 NM_007485 ras homolog D 2 0 8 NM_172296 doublesex and mab-3 related transcription factor 2 8 0 NM_025768 GH regulated TBC protein 1 2 8 0 NM_009354 telomerase reverse transcriptase 2 8 0 NM_028444 protein kinase C delta binding protein 2 7 1 NM_148941 elongation of very long chain fatty acids-like 2 7 1 NM_028284 Bardet-Biedl syndrome 5 2 5 2 NM_029741 protein tyrosine phosphatase receptor type, f 2 5 2 NM_182993 solute carrier family 17 sodium-dependent 2 5 2 NM_028078 immunoglobulin superfamily member 5 2 5 2 NM_009597 amiloride-sensitive cation channel 2 neuronal 2 4 3 NM_153543 aldehyde dehydrogenase 1 family member L2 2 4 3 NM_009644 aryl-hydrocarbon receptor repressor 2 4 3 NM_001033500 WD repeat domain 72 2 4 3 NM_080643 cask-interacting protein 2 2 4 3 NM_053149 hemogen 2 3 4 NM_008937 prospero-related homeobox 1 2 3 4 NM_010146 laforin 2 3 4 NM_029280 methyltransferase like 5 2 3 4 NM_008319 intercellular adhesion molecule 5 2 3 4 NM_198656 cadherin-like 26 2 2 5 NM_018733 sodium channel voltage-gated, type I, alpha 2 2 5 NM_027452 leucine rich repeat and fibronectin type III 2 2 5 NM_011864 3'-phosphoadenosine 5'-phosphosulfate synthase 2 2 5 NM_174991 brain-specific angiogenesis inhibitor 1 2 1 6 NM_001024618 xin actin-binding repeat containing 2 isoform 1 2 1 6 NM_181407 malic enzyme 3 NADP+-dependent, 2 0 7 NM_001083916 hypothetical protein LOC69073 2 0 7 NM_031379 transketolase-like 1 2 0 7 NM_153578 non-imprinted in Prader-Willi/Angelman syndrome 2 7 0 NM_027695 3-oxoacyl-ACP synthase mitochondrial 2 7 0 NM_015799 transferrin receptor 2 2 7 0 NM_010101 endothelial differentiation sphingolipid 2 5 1 NM_133351 prostasin 2 4 2 NM_013648 reticulon 2 isoform B 2 4 2 NM_015754 retinoblastoma binding protein 9 2 4 2 NM_029681 Williams-Beuren syndrome chromosome region 28 2 4 2 NM_023755 transcription repressor CRTR-1 2 4 2 NM_023718 solute carrier organic anion transporter family 2 4 2 NM_008961 phosphotriesterase related 2 4 2 NM_030165 chondroitin sulfate GalNAcT-2 2 2 4 NM_172961 4-aminobutyrate aminotransferase 2 2 4 NM_009167 src homology 2 domain-containing transforming 2 2 4 NM_001013023 mitochondrial transcription termination factor 2 3 3 NM_013886 hepatoma-derived growth factor related protein 2 3 3 NM_001109973 MyoD family inhibitor 2 3 3 NM_010441 high mobility group AT-hook 2 2 3 3 NM_029212 coiled-coil domain containing 33 2 3 3 NM_173449 hypothetical protein LOC110332 2 1 5 NM_177604 specifically androgen-regulated protein 2 1 5 NM_133902 serine dehydratase-like 2 1 5 NM_172694 multiple EGF-like-domains 9 2 1 5 NM_019634 tetraspanin 7 2 1 5 NM_001081252 UDP-glucose:glycoprotein glucosyltransferase 2 2 1 5 NM_027220 protease serine, 32 2 1 5 NM_008881 plexin A1 2 0 6 NM_153095 MAS-related GPR member A1 2 0 6 NM_198967 transmembrane and tetratricopeptide repeat 2 5 0 NM_199222 lectin mannose-binding, 1 like 2 5 0 NM_001025779 cell division cycle 6 homolog isoform b 2 5 0 NM_011718 wingless related MMTV integration site 10b 2 5 0 NM_145223 Alstrom syndrome 1 2 5 0 NM_181853 tripartite motif-containing 66 2 5 0 NM_029249 hypothetical protein LOC75317 2 5 0 NM_175381 hypothetical protein LOC108899 2 5 0 NM_145503 leucine zipper putative tumor suppressor 2 2 4 1 NM_183311 transmembrane protein 145 2 4 1 NM_008423 potassium voltage-gated channel Shal-related 2 3 2 NM_010181 fibrillin 2 2 3 2 NM_001002008 hypothetical protein LOC381066 2 3 2 NM_172728 cAMP responsive element binding protein 5 2 3 2 NM_177838 RIKEN cDNA A230106N23 2 3 2 NM_028984 hypothetical protein LOC74528 2 3 2 NM_026146 epidermal growth factor receptor pathway 2 3 2 NM_153412 pleckstrin homology-like domain family B, 2 3 2 NM_001034060 RUN and FYVE domain containing 4 2 3 2 NM_174998 hippocalcin-like 4 2 3 2 NM_001085448 catenin delta 1 isoform 2 2 2 3 NM_172470 WD repeat domain 35 2 2 3 NM_001101510 sushi domain containing 5 2 2 3 NM_153782 hypothetical protein LOC208659 2 2 3 NM_175128 hypothetical protein LOC68281 2 2 3 NM_001080925 Rap guanine nucleotide exchange factor 2 2 3 NM_173781 RAB6B member RAS oncogene family 2 2 3 NM_009928 procollagen type XV 2 2 3 NM_183023 regulating synaptic membrane exocytosis 4 2 2 3 NM_023048 ankyrin repeat and SOCS box-containing protein 2 2 3 NM_029425 phosphatidic acid phosphatase type 2d 2 2 3 NM_008863 cAMP-dependent protein kinase inhibitor beta 2 2 3 NM_010111 ephrin B2 2 2 3 NM_007560 bone morphogenetic protein receptor type 1B 2 2 3 NM_001013770 hypothetical protein LOC381236 2 2 3 NM_177213 ATP-binding cassette transporter sub-family A 2 1 4 NM_025712 hypothetical protein LOC66696 2 1 4 NM_021496 poliovirus receptor-related 3 isoform beta 2 1 4 NM_009200 solute carrier family 1 high affinity 2 1 4 NM_001025371 serine incorporator 4 2 0 5 NM_178214 histone cluster 2 H2be 2 0 5 NM_153087 histamine H4 receptor 2 0 5 NM_178028 galanin-like peptide precursor 2 0 5 NM_001033250 LEM domain containing 1 2 0 5 NM_021403 hypothetical protein LOC58212 2 0 5 NM_177577 doublecortin domain containing 2 2 0 5 NM_001045527 heat shock transcription factor family member 5 2 0 5 NM_007979 coagulation factor IX 2 0 5 NM_001013745 zinc finger protein 57 2 4 0 NM_153133 retinol dehydrogenase 9 2 4 0 NM_133217 beta-carotene 9' 10'-dioxygenase 2 2 4 0 NM_023716 tubulin beta 2 4 0 NM_001025573 hypothetical protein LOC243753 2 2 2 NM_001033339 matrix metallopeptidase 25 2 2 2 NM_029779 coiled-coil domain containing 116 2 2 2 NM_021307 zinc finger protein 112 2 2 2 NM_013920 hepatocyte nuclear factor 4 gamma 2 2 2 NM_153151 acetyl-Coenzyme A acetyltransferase 3 2 2 2 NM_007549 B lymphoid kinase 2 2 2 NM_173414 LanC lantibiotic synthetase component C-like 3 2 2 2 NM_007616 caveolin caveolae protein 1 2 2 2 NM_001081354 mastermind-like domain containing 1 2 2 2 NM_028034 tudor domain containing 12 isoform 2 2 2 2 NM_011887 sodium channel voltage-gated, type XI, alpha 2 2 2 NM_007426 angiopoietin 2 2 3 1 NM_144518 hypothetical protein LOC67254 2 3 1 NM_010774 methyl-CpG binding domain protein 4 2 3 1 NM_146156 PDLIM1 interacting kinase 1 like 2 3 1 NM_007545 harakiri 2 3 1 NM_009891 choline acetyltransferase 2 3 1 NM_013628 proprotein convertase subtilisin/kexin type 1 2 3 1 NM_144532 calcium binding protein 4 2 3 1 NM_183046 M-phase phosphoprotein 1 2 3 1 NM_010452 homeobox A3 2 3 1 NM_001081219 myosin IA 2 3 1 NM_144935 lipid phosphate phosphatase-related protein type 2 3 1 NM_207245 hypothetical protein LOC240066 2 1 3 NM_001081198 transmembrane protein 182 2 1 3 NM_007762 corticotropin releasing hormone receptor 1 2 1 3 NM_172583 transmembrane protein 63c 2 1 3 NM_026648 leucine rich repeat containing 50 2 1 3 NM_001081224 proline rich 16 2 1 3 NM_028735 tetratricopeptide repeat domain 21A 2 1 3 NM_009134 sodium channel voltage-gated, type X, alpha 2 1 3 NM_001081157 leiomodin 3 fetal 2 1 3 NM_008362 interleukin 1 receptor type I 2 1 3 NM_011812 fibulin 5 2 1 3 NM_029617 cancer susceptibility candidate 5 2 1 3 NM_183187 downregulated in renal cell carcinoma 2 1 3 NM_001099299 adherens junction associated protein 1 2 0 4 NM_001081038 BTB POZ domain containing 16 2 0 4 NM_011221 purine rich element binding protein B 2 0 4 NM_130890 calpain 8 2 0 4 NM_001037709 RUN and SH3 domain containing 2 2 0 4 NM_011983 homer homolog 2 2 0 4 NM_011098 paired-like homeodomain transcription factor 2 2 0 4 NM_172152 solute carrier family 24 2 0 4 NM_008908 peptidylprolyl isomerase C 2 0 4 NM_015826 doublesex and mab-3 related transcription factor 2 3 0 NM_201371 protein arginine N-methyltransferase 8 2 3 0 NM_008537 alpha-methylacyl-CoA racemase 2 3 0 NM_027649 spermatogenesis associated serine-rich 1 2 3 0 NM_028821 axonemal dynein light chain 1 2 3 0 NM_009992 cytochrome P450 family 1, subfamily a, 2 3 0 NM_011547 transcription factor AP-2 alpha 2 3 0 NM_008873 plasminogen activator urokinase 2 3 0 NM_080728 myosin heavy polypeptide 7, cardiac muscle, 2 3 0 NM_138304 calmodulin-like 4 isoform a 2 3 0 NM_145827 NLR family pyrin domain containing 3 2 2 1 NM_001081403 kelch-like 14 2 2 1 NM_153098 CD109 antigen 2 2 1 NM_177545 vang van gogh-like 1 2 2 1 NM_011360 sarcoglycan epsilon 2 2 1 NM_020278 leucine-rich repeat LGI family member 1 2 2 1 NM_001038613 olfactomedin 1 isoform c 2 2 1 NM_031163 collagen type II, alpha 1 isoform 1 precursor 2 2 1 NM_183088 hypothetical protein LOC71970 2 2 1 NM_001033267 glutamine rich 2 2 2 1 NM_025530 cutC copper transporter homolog isoform 2 2 2 1 NM_172462 zinc finger protein 11 2 2 1 NM_175168 PTK7 protein tyrosine kinase 7 2 2 1 NM_008900 POU domain class 3, transcription factor 3 2 2 1 NM_133192 neuropeptide FF receptor 2 2 2 1 NM_008471 keratin 19 2 2 1 NM_021896 guanylate cyclase 1 soluble, alpha 3 2 2 1 NM_172899 dermokine beta 2 2 1 NM_001042714 hypothetical protein LOC271144 2 2 1 NM_145692 hypothetical protein LOC69312 isoform 2 2 2 1 NM_175382 hypothetical protein LOC108900 2 1 2 NM_001113418 peroxisome proliferator activated receptor 2 1 2 NM_011079 phosphorylase kinase gamma 1 2 1 2 NM_009181 ST8 alpha-N-acetyl-neuraminide 2 1 2 NM_001004149 zinc finger protein 366 2 1 2 NM_173731 3-hydroxymethyl-3-methylglutaryl-Coenzyme A 2 1 2 NM_009348 tectorin beta 2 1 2 NM_198423 BAH domain and coiled-coil containing 1 2 1 2 NM_013737 phospholipase A2 group VII 2 1 2 NM_172481 NLR family pyrin domain containing 4B 2 1 2 NM_183297 neurexophilin 4 2 1 2 NM_177653 hypothetical protein LOC228592 2 1 2 NM_170673 copine-like protein 2 1 2 NM_001037809 cadherin 3 isoform a 2 1 2 NM_178779 ring finger protein 152 2 1 2 NM_030725 synaptotagmin XIII 2 1 2 NM_177230 hypothetical protein LOC320696 2 1 2 NM_139226 one cut domain family member 3 2 1 2 NM_009221 synuclein alpha 2 1 2 NM_146076 solute carrier family 26 member 8 2 1 2 NM_177718 hypothetical protein LOC239796 2 1 2 NM_011648 thyroid stimulating hormone receptor isoform 1 2 1 2 NM_001004366 signal peptide CUB domain, EGF-like 3 2 1 2 NM_145100 Ly6/Plaur domain containing 1 2 1 2 NM_001024707 low density lipoprotein receptor-related protein 2 1 2 NM_001081142 potassium voltage-gated channel subfamily Q, 2 1 2 NM_020605 junctophilin 3 2 1 2 NM_010514 insulin-like growth factor 2 2 1 2 NM_027407 islet cell autoantigen 1 69kDa-like 2 1 2 NM_022722 dihydropyrimidinase 2 1 2 NM_197988 RIKEN cDNA 1190005I06 2 1 2 NM_015814 dickkopf homolog 3 2 0 3 NM_029809 hypothetical protein LOC381845 2 0 3 NM_198106 solute carrier family 9 isoform 10 2 0 3 NM_012038 visinin-like 1 2 0 3 NM_013669 synaptosomal-associated protein 91 2 0 3 NM_011582 thrombospondin 4 2 0 3 NM_027211 annexin A13 2 0 3 NM_009521 wingless-related MMTV integration site 3 2 0 3 NM_012035 transient receptor potential cation channel 2 0 3 NM_029987 retinal pigment epithelium 65 2 0 3 NM_080844 serine or cysteine proteinase inhibitor clade 2 0 3 NM_019950 carbohydrate N-acetylglucosamine 6-O 2 0 3 NM_010203 fibroblast growth factor 5 2 0 3 NM_013930 aminoadipate-semialdehyde synthase precursor 2 0 3 NM_178749 serine/threonine kinase 32A 2 0 3 NM_001033542 solute carrier family 47 member 2 2 0 3 NM_009374 transglutaminase 3 E polypeptide 2 0 3 NM_177723 V-set and immunoglobulin domain containing 8 2 0 3 NM_057173 LIM domain only 1 2 0 3 NM_001013762 hypothetical protein LOC240549 2 0 3 NM_001081658 dystrotelin 2 0 3 NM_001109988 neuronal protein 3.1 2 0 3 NM_026972 CD209b antigen isoform a 2 2 0 NM_019563 Cbp/p300-interacting transactivator with 2 2 0 NM_001001796 paired related homeobox protein-like 1 2 2 0 NM_019759 dermatopontin 2 2 0 NM_177746 diacylglycerol O-acyltransferase 2-like 4 2 2 0 NM_010280 glial cell line derived neurotrophic factor 2 2 0 NM_010024 dopachrome tautomerase 2 2 0 NM_019546 proline dehydrogenase oxidase 2 2 2 0 NM_080435 adenylate cyclase 4 2 2 0 NM_133675 androgen down regulated in mouse prostate 2 2 0 NM_030713 zinc finger protein 202 2 2 0 NM_001024927 Pitpnm family member 3 isoform 1 2 2 0 NM_028789 unkempt-like 2 2 0 NM_001005854 hypothetical protein LOC208166 2 2 0 NM_011773 solute carrier family 30 zinc transporter 2 2 0 NM_146246 retinitis pigmentosa 1 homolog human-like 1 2 2 0 NM_008653 myosin binding protein C cardiac 2 2 0 NM_175641 latent transforming growth factor beta binding 2 2 0 NM_007781 colony stimulating factor 2 receptor beta 2, 2 2 0 NM_007759 cellular retinoic acid binding protein II 2 2 0 NM_019696 carboxypeptidase X 1 M14 family 2 2 0 NM_020504 claudin 13 2 2 0 NM_172616 hypothetical protein LOC224171 2 2 0 NM_001013814 aminomethyltransferase 2 1 1 NM_029554 hypothetical protein LOC76261 2 1 1 NM_207246 RAS guanyl releasing protein 3 2 1 1 NM_172994 protein phosphatase 2 formerly 2A regulatory 2 1 1 NM_010251 gamma-aminobutyric acid GABA-A receptor 2 1 1 NM_026821 hypothetical protein LOC52829 2 1 1 NM_199257 transmembrane phosphatase with tensin homology 2 1 1 NM_008909 periplakin 2 1 1 NM_173451 arylsulfatase J 2 1 1 NM_013415 Na+/K+ -ATPase beta 2 subunit 2 1 1 NM_138683 thrombospondin type 1 domain containing 2 1 1 NM_009619 a disintegrin and metalloprotease domain 3 2 1 1 NM_008623 myelin protein zero 2 1 1 NM_024291 kyphoscoliosis 2 1 1 NM_139152 ankyrin repeat and SOCS box-containing 18 2 1 1 NM_008973 pleiotrophin 2 1 1 NM_010403 hydroxyacid oxidase 1 liver 2 1 1 NM_145459 zinc finger protein 503 2 1 1 NM_177790 zinc finger protein 385C 2 1 1 NM_009524 wingless-related MMTV integration site 5A 2 1 1 NM_022311 t-complex-associated testis expressed 2 2 1 1 NM_001039475 solute carrier organic anion transporter family 2 1 1 NM_194344 SH3 domain and tetratricopeptide repeats 1 2 1 1 NM_001083342 patched domain containing 2 2 1 1 NM_008808 platelet derived growth factor alpha 2 1 1 NM_011023 orthodenticle 1 2 1 1 NM_001029836 nephronectin isoform b 2 1 1 NM_010427 hepatocyte growth factor 2 1 1 NM_017469 guanylate cyclase 1 soluble, beta 3 2 1 1 NM_175495 G protein-coupled receptor 150 2 1 1 NM_175681 glucagon-like peptide 2 receptor 2 1 1 NM_008007 fibroblast growth factor 3 2 1 1 NM_007976 coagulation factor V 2 1 1 NM_001034893 hypothetical protein LOC435970 2 1 1 NM_148944 cholinergic receptor nicotinic, beta 2 1 1 NM_009827 cholecystokinin A receptor 2 1 1 NM_029256 coiled-coil domain containing 83 2 1 1 NM_013803 G protein-coupled receptor family C, group 2, 2 1 1 NM_145575 caldesmon 1 2 1 1 NM_001044750 barrier-to-autointegration factor-like 2 1 1 NM_134130 abhydrolase domain containing 3 2 0 2 NM_018800 synaptotagmin 6 2 0 2 NM_001008419 aldehyde oxidase 3-like 1 2 0 2 NM_080855 zinc finger CCHC domain containing 14 2 0 2 NM_001013784 hypothetical protein LOC432582 2 0 2 NM_001080553 germ cell-specific gene 1 isoform b 2 0 2 NM_010298 glycine receptor beta subunit 2 0 2 NM_175417 hypothetical protein LOC109254 2 0 2 NM_019415 solute carrier family 12 member 3 2 0 2 NM_177828 hypothetical protein LOC328967 2 0 2 NM_010808 matrix metalloproteinase 24 2 0 2 NM_198030 alcohol dehydrogenase PAN1B-like 2 0 2 NM_028137 hypothetical protein LOC66665 2 0 2 NM_172604 scavenger receptor class A member 3 2 0 2 NM_026053 gem nuclear organelle associated protein 6 2 0 2 NM_001048175 a disintegrin and metallopeptidase domain 28 2 0 2 NM_001033233 transmembrane protease serine 11a 2 0 2 NM_013485 complement component 9 2 0 2 NM_001081227 hypothetical protein LOC381310 2 0 2 NM_013800 BarH-like homeobox 2 2 0 2 NM_028141 zinc finger protein 661 2 0 2 NM_001081281 tripartite motif-containing 55 2 0 2 NM_144804 DEP domain containing 7 2 0 2 NM_009468 dihydropyrimidinase-like 3 2 0 2 NM_001099785 hypothetical protein LOC73852 isoform a 2 0 2 NM_172506 brother of CDO 2 0 2 NM_021470 ring finger protein 32 2 0 2 NM_172274 coiled-coil and C2 domain containing 2A 2 0 2 NM_177694 transmembrane protein 16E 2 0 2 NM_001033180 hypothetical protein LOC77352 2 0 2 NM_199473 collagen type VIII, alpha 2 2 0 2 NM_027495 transmembrane protein 144 2 0 2 NM_177335 hypothetical protein LOC216393 2 0 2 NM_023617 aldehyde oxidase 3 2 0 2 NM_172909 CD163 molecule-like 1 2 0 2 NM_011391 solute carrier family 16 member 7 2 0 2 NM_145134 splA/ryanodine receptor domain and SOCS box 2 0 2 NM_009749 brain expressed X-linked 2 2 0 2 NM_029692 uridine phosphorylase 2 2 0 2 NM_026132 thioredoxin domain containing 8 2 0 2 NM_016711 tropomodulin 2 2 0 2 NM_178628 atlastin 2 0 2 NM_030687 solute carrier organic anion transporter family 2 0 2 NM_153170 tramdorin 1 2 0 2 NM_011310 S100 calcium binding protein A3 2 0 2 NM_008966 prostaglandin F receptor 2 0 2 NM_025834 protein Z vitamin K-dependent plasma 2 0 2 NM_010791 mesenchyme homeobox 1 2 0 2 NM_033073 keratin 7 2 0 2 NM_001102409 kininogen 2 isoform 2 2 0 2 NM_031367 histocompatibility 28 2 0 2 NM_023630 general transcription factor IIA 1-like 2 0 2 NM_001013756 transcription factor CP2-like 4 2 0 2 NM_016719 growth factor receptor bound protein 14 2 0 2 NM_001024138 G protein-coupled receptor 139 2 0 2 NM_001033411 hypothetical protein LOC329554 2 0 2 NM_008125 gap junction protein beta 2 2 0 2 NM_013526 growth differentiation factor 6 2 0 2 NM_019423 elongation of very long chain fatty acids-like 2 0 2 NM_001033344 dual specificity phosphatase 27 putative 2 0 2 NM_001100183 cytochrome P450 family 4, subfamily a, 2 0 2 NM_024412 chloride channel Ka 2 0 2 NM_007686 complement component factor i 2 0 2 NM_001005477 BarH-like 2 2 0 2 NM_029007 expressed sequence AW125753 2 0 2 NM_009620 a disintegrin and metallopeptidase domain 4 2 0 2 NM_176921 hypothetical protein LOC319477 2 1 0 NM_027930 DUF729 domain containing 1 2 1 0 NM_001045526 hypothetical protein LOC327957 2 1 0 NM_001017983 FAD-dependent oxidoreductase domain containing 2 1 0 NM_001110780 synapsin I isoform b 2 1 0 NM_007758 complement receptor 2 2 1 0 NM_001039676 solute carrier family 39 zinc transporter 2 1 0 NM_028872 hypothetical protein LOC67313 2 1 0 NM_177772 bactericidal/permeability-increasing 2 1 0 NM_010461 homeo box B8 2 1 0 NM_008593 forkhead box D2 2 1 0 NM_177312 hypothetical protein LOC321008 2 1 0 NM_001101572 vomeronasal receptor Vmn2r82 2 1 0 NM_009574 zinc finger protein of the cerebellum 2 2 1 0 NM_001037634 placenta-specific 1-like 2 1 0 NM_013467 aldehyde dehydrogenase family 1 subfamily A1 2 1 0 NM_024475 ubiquitin-like domain containing CTD phosphatase 2 1 0 NM_010455 homeobox A7 2 1 0 NM_011395 solute carrier family 22 organic cation 2 1 0 NM_145837 interleukin 17D 2 1 0 NM_001081425 RNA binding motif protein 24 2 1 0 NM_053110 glycoprotein transmembrane nmb 2 1 0 NM_001081144 zinc finger protein 518B 2 1 0 NM_009107 retinoid X receptor gamma 2 1 0 NM_033039 oncomodulin 2 1 0 NM_008287 heat-responsive protein 12 2 1 0 NM_027602 NOL1/NOP2/Sun domain family member 7 2 1 0 NM_019454 delta-like 4 2 1 0 NM_176999 ATPase class V, type 10B 2 1 0 NM_001033444 calpain 13 2 1 0 NM_212452 relaxin/insulin-like family peptide receptor 1 2 1 0 NM_175122 RAB39B member RAS oncogene family 2 1 0 NM_009173 seven in absentia 1B 2 1 0 NM_008791 Purkinje cell protein 4 2 1 0 NM_021286 seizure related gene 6 2 1 0 NM_028913 zinc finger protein 819 2 1 0 NM_001033249 zinc finger protein 583 2 1 0 NM_011979 vanin 3 2 1 0 NM_177781 transient receptor potential cation channel 2 1 0 NM_145561 transmembrane protease serine 11d precursor 2 1 0 NM_031382 testis expressed gene 16 2 1 0 NM_031374 testis expressed gene 15 2 1 0 NM_177707 SH3 and cysteine rich domain 3 2 1 0 NM_027641 sperm flagellar 1 2 1 0 NM_011196 prostaglandin E receptor 3 subtype EP3 2 1 0 NM_013641 prostaglandin E receptor 1 subtype EP1 2 1 0 NM_011987 phospholipase A2 group X 2 1 0 NM_001033768 hypothetical protein LOC241593 2 1 0 NM_147093 olfactory receptor 558 2 1 0 NM_181409 myotubularin related protein 11 2 1 0 NM_001113326 macrophage scavenger receptor 1 isoform b 2 1 0 NM_030257 LysM putative peptidoglycan-binding, domain 2 1 0 NM_016923 lymphocyte antigen 96 2 1 0 NM_145922 potassium voltage gated channel Shaw-related 2 1 0 NM_001081131 dehydrogenase E1 and transketolase domain 2 1 0 NM_001013013 dehydrogenase/reductase SDR family member 7C 2 1 0 NM_001004455 cystin 1 2 1 0 NM_007819 cytochrome P450 family 3, subfamily a, 2 1 0 NM_001001446 cytochrome P450 family 2, subfamily c, 2 1 0 NM_001033001 hypothetical protein LOC436230 2 1 0 NM_029639 placenta expressed transcript 1 2 1 0 NM_133893 2'-5' oligoadenylate synthetase 1D 2 1 0 NM_007528 B-cell CLL/lymphoma 6 member B 2 0 1 NM_177726 transglutaminase 6 2 0 1 NM_009638 cysteine-rich secretory protein 1 2 0 1 NM_133222 EGF latrophilin seven transmembrane domain 2 0 1 NM_183113 hypothetical protein LOC75721 2 0 1 NM_133892 L-amino acid oxidase 1 2 0 1 NM_177735 transmembrane protein 130 2 0 1 NM_001001985 N-acetyltransferase 8-like 2 0 1 NM_080468 relaxin/insulin-like family peptide receptor 2 2 0 1 NM_020265 dickkopf homolog 2 2 0 1 NM_138647 longevity assurance homolog 1 2 0 1 NM_008008 fibroblast growth factor 7 2 0 1 NM_001034881 hypothetical protein LOC432870 2 0 1 NM_172447 hypothetical protein LOC207686 2 0 1 NM_009329 zinc finger protein 354A 2 0 1 NM_172863 zinc finger protein 697 2 0 1 NM_010097 SPARC-like 1 mast9 hevin 2 0 1 NM_011041 paired box 9 2 0 1 NM_008484 laminin beta 3 2 0 1 NM_012011 eukaryotic translation initiation factor 2 2 0 1 NM_183177 zinc finger protein 811 2 0 1 NM_001034863 transmembrane protein 136 2 0 1 NM_019911 tryptophan 23-dioxygenase 2 0 1 NM_153154 transcription factor AP-2 delta 2 0 1 NM_023125 kininogen 1 isoform 2 2 0 1 NM_012043 immunoglobulin superfamily containing 2 0 1 NM_007662 cadherin 15 2 0 1 NM_177268 ankyrin repeat domain 16 2 0 1 NM_021423 SH3/ankyrin domain gene 3 2 0 1 NM_027268 secernin 1 2 0 1 NM_007540 brain derived neurotrophic factor isoform 1 2 0 1 NM_201374 hypothetical protein LOC384619 2 0 1 NM_001011732 X Kell blood group precursor related family 2 0 1 NM_001109743 hypothetical protein LOC639628 2 0 1 NM_001004148 solute carrier family 13 sodium-dependent 2 0 1 NM_008604 membrane metallo endopeptidase 2 0 1 NM_177139 LY6/PLAUR domain containing 6 2 0 1 NM_144945 leucine-rich repeat LGI family member 2 2 0 1 NM_012056 FK506 binding protein 9 2 0 1 NM_026333 hypothetical protein LOC67715 2 0 1 NM_009322 T-box brain gene 1 2 0 1 NM_172469 chloride intracellular channel 6 2 0 1 NM_001001177 hypothetical protein LOC407788 2 0 1 NM_010904 neurofilament heavy polypeptide 2 0 1 NM_001033149 tetratricopeptide repeat domain 9 2 0 1 NM_182959 vesicular glutamate transporter-3 2 0 1 NM_183179 potassium channel subfamily V, member 2 2 0 1 NM_153392 hypothetical protein LOC230603 2 0 1 NM_146086 phosphodiesterase 6A cGMP-specific, rod, alpha 2 0 1 NM_001081076 guanylate cyclase 2g 2 0 1 NM_134050 RAB15 member RAS oncogene family 2 0 1 NM_172810 guanylate cyclase 1 soluble, beta 2 2 0 1 NM_007740 collagen type IX, alpha 1 2 0 1 NM_022025 solute carrier family 5 choline transporter 2 0 1 NM_031877 WASP family 1 2 0 1 NM_020518 cortical thymocyte receptor X. laevis CTX 2 0 1 NM_016982 pre-B lymphocyte gene 1 2 0 1 NM_001104642 vomeronasal 2 receptor27 2 0 1 NM_001102582 vomeronasal receptor Vmn2r18 2 0 1 NM_178924 uroplakin 1B 2 0 1 NM_001007572 transient receptor potential cation channel 2 0 1 NM_025452 beta-casein-like protein 2 0 1 NM_153520 transmembrane protein 10 2 0 1 NM_019675 stathmin-like 4 2 0 1 NM_001045531 testes development-related NYD-SP20 2 0 1 NM_001005343 trans-acting transcription factor 9 2 0 1 NM_021291 solute carrier family 7 cationic amino acid 2 0 1 NM_023219 solute carrier family 5 member 4b 2 0 1 NM_011403 solute carrier family 4 anion exchanger 2 0 1 NM_145977 solute carrier family 45 member 3 2 0 1 NM_175034 solute carrier family 24 member 5 precursor 2 0 1 NM_144813 solute carrier family 24 2 0 1 NM_013665 short stature homeobox 2 2 0 1 NM_017400 SH3-domain GRB2-like 3 2 0 1 NM_133194 sex comb on midleg-like 2 2 0 1 NM_020599 retinaldehyde binding protein 1 2 0 1 NM_133229 ripply3 homolog 2 0 1 NM_021375 Rhesus blood group-associated B glycoprotein 2 0 1 NM_153390 small testis-specific peroxisomal protein 2 0 1 NM_139270 parathyroid hormone receptor 2 2 0 1 NM_008958 patched homolog 2 2 0 1 NM_175640 perilipin 2 0 1 NM_001113360 phospholipase C eta 2 isoform b 2 0 1 NM_001081456 phospholipase C delta 4 isoform 1 2 0 1 NM_001007584 hypothetical protein LOC432589 2 0 1 NM_144854 hypothetical protein LOC224419 2 0 1 NM_173415 nyctalopin 2 0 1 NM_010903 nuclear factor erythroid derived 2, like 3 2 0 1 NM_173772 sialidase 4 2 0 1 NM_007863 Mpp3 membrane protein palmitoylated 3 2 0 1 NM_153127 elastin microfibril interfacer 3 2 0 1 NM_001033461 leucine rich repeat containing 43 2 0 1 NM_028977 leucine rich repeat containing 17 2 0 1 NM_027340 lipase family member N 2 0 1 NM_008499 LIM homeobox protein 5 2 0 1 NM_026645 IQ motif containing F3 2 0 1 NM_026489 HORMA domain containing 1 2 0 1 NM_009327 HNF1 homeobox A 2 0 1 NM_011824 gremlin 1 2 0 1 NM_012014 G protein-regulated inducer of neurite outgrowth 2 0 1 NM_001110337 G protein-coupled receptor family C, group 5, 2 0 1 NM_001104529 G protein-coupled receptor 35 2 0 1 NM_013530 guanine nucleotide-binding protein beta-3 2 0 1 NM_008121 gap junction membrane channel protein alpha 5 2 0 1 NM_177408 gamma-aminobutyric acid GABA-A receptor 2 0 1 NM_008011 fibroblast growth factor receptor 4 2 0 1 NM_133754 filamin binding LIM protein 1 2 0 1 NM_198674 hypothetical protein LOC382109 2 0 1 NM_001018002 developmental pluripotency associated 4 isoform 2 0 1 NM_007876 dipeptidase 1 renal 2 0 1 NM_001101588 cytochrome P450 family 4, subfamily f, 2 0 1 NM_145499 cytochrome P450 family 2, subfamily c, 2 0 1 NM_021352 crystallin beta B3 2 0 1 NM_170597 cellular repressor of E1A-stimulated genes 2 2 0 1 NM_144537 carboxypeptidase A5 2 0 1 NM_145126 chitinase 3-like 4 2 0 1 NM_133974 CUB domain-containing protein 1 2 0 1 NM_053094 CD163 antigen 2 0 1 NM_133189 voltage-dependent calcium channel gamma-7 2 0 1 NM_130452 gamma-butyrobetaine dioxygenase 2 0 1 NM_133690 ATPase Na+/K+ transporting, beta 4 2 0 1 NM_027027 ankyrin repeat and SOCS box-containing protein 2 0 1 NM_009650 A-kinase anchor protein 3 2 0 1 NM_001033454 hypothetical protein LOC381524 2 0 1 NM_178656 hypothetical protein LOC193003 2 0 1 NM_001033394 hypothetical protein LOC320587 2 0 1 NM_177880 hypothetical protein LOC330228 2 0 1 NM_001081025 hypothetical protein LOC320214 2 0 1 NM_027637 hypothetical protein LOC70988 2 0 1 NM_177676 hypothetical protein LOC231045 2 0 1 NM_029107 hypothetical protein LOC74855 2 0 1 NM_029747 hypothetical protein LOC76797 2 0 1 NM_008046 follistatin 2 0 0 NM_028838 leucine rich repeat containing 2 2 0 0 NM_029084 SLAM family member 8 2 0 0 NM_007911 ephrin B3 2 0 0 NM_019510 transient receptor potential cation channel 2 0 0 NM_009921 cathelicidin antimicrobial peptide 2 0 0 NM_146381 olfactory receptor 1284 2 0 0 NM_008352 interleukin 12b 2 0 0 NM_145509 hypothetical protein LOC226421 2 0 0 NM_001033805 hypothetical protein LOC619301 2 0 0 NM_009528 wingless-related MMTV integration site 7B 2 0 0 NM_008706 NADPH dehydrogenase quinone 1 2 0 0 NM_010801 myeloid leukemia factor 1 isoform b 2 0 0 NM_145526 purinergic receptor P2X3 2 0 0 NM_028386 aspartate beta-hydroxylase domain containing 2 2 0 0 NM_172614 transmembrane protein 44 2 0 0 NM_174993 fragile X mental retardation 1 neighbor 2 0 0 NM_173181 hypothetical protein LOC67306 2 0 0 NM_020495 solute carrier organic anion transporter family 2 0 0 NM_001034883 hypothetical protein LOC432982 2 0 0 NM_172831 hypothetical protein LOC240216 2 0 0 NM_021387 V-set and transmembrane domain containing 2B 2 0 0 NM_008849 pituitary specific transcription factor 1 2 0 0 NM_028089 cytochrome P450 family 2, subfamily c, 2 0 0 NM_139001 chondroitin sulfate proteoglycan 4 2 0 0 NM_010770 matrilin 3 2 0 0 NM_016770 folate hydrolase 2 0 0 NM_133363 myozenin 3 2 0 0 NM_021492 adaptor-related protein complex 3 beta 2 2 0 0 NM_016975 gap junction membrane channel protein alpha 3 2 0 0 NM_138582 G7c protein 2 0 0 NM_133894 UDP glucuronosyltransferase 2 family 2 0 0 NM_001039048 tripartite motif-containing 63 2 0 0 NM_008407 inter-alpha trypsin inhibitor heavy chain 3 2 0 0 NM_008263 homeobox A10 2 0 0 NM_181748 G protein-coupled receptor 120 2 0 0 NM_177664 plasticity related gene 1 2 0 0 NM_001100187 cytochrome P450 family 4, subfamily f, 2 0 0 NM_008599 chemokine C-X-C motif ligand 9 2 0 0 NM_009904 calmegin 2 0 0 NM_177809 hypothetical protein LOC328258 2 0 0 NM_008877 plasminogen 2 0 0 NM_001030297 transmembrane protease serine 11c 2 0 0 NM_028478 Ras association RalGDS/AF-6 domain family 6 2 0 0 NM_144946 neuropilin- and tolloid-like protein 1 2 0 0 NM_029112 MORN repeat containing 3 2 0 0 NM_177598 F-box and WD-40 domain protein 13 2 0 0 NM_011783 anterior gradient 2 2 0 0 NM_028550 hypothetical protein LOC73481 2 0 0 NM_027077 hypothetical protein LOC69428 2 0 0 NM_001099298 sodium channel voltage-gated, type II, alpha 1 2 0 0 NM_172786 interleukin 20 receptor alpha 2 0 0 NM_021292 Ellis van Creveld gene homolog 2 0 0 NM_021885 tubby 2 0 0 NM_001081156 hypothetical protein LOC69539 2 0 0 NM_176844 cholinergic receptor nicotinic, alpha 2 0 0 NM_175333 solute carrier family 25 member 41 2 0 0 NM_026713 monoacylglycerol O-acyltransferase 1 2 0 0 NM_053199 immunoglobulin superfamily member 4B 2 0 0 NM_010656 sarcospan 2 0 0 NM_010011 cytochrome P450 family 4, subfamily a, 2 0 0 NM_001033226 calreticulin 4 2 0 0 NM_009747 bradykinin receptor beta 2 2 0 0 NM_001029984 Fc receptor-like B 2 0 0 NM_145143 membrane protein palmitoylated 4 2 0 0 NM_177843 hypothetical protein LOC329436 2 0 0 NM_010712 LIM homeobox protein 4 2 0 0 NM_031389 NLR family pyrin domain containing 4C 2 0 0 NM_172515 hypothetical protein LOC213234 2 0 0 NM_183168 pyrimidinergic receptor P2Y G-protein coupled, 2 0 0 NM_001001334 hypothetical protein LOC381350 2 0 0 NM_201362 coiled-coil domain containing 68 2 0 0 NM_001001885 transmembrane protein 151A 2 0 0 NM_011419 jumonji AT rich interactive domain 1D Rbp2 2 0 0 NM_133983 CD276 antigen 2 0 0 NM_001081329 zinc finger with KRAB and SCAN domains 2 2 0 0 NM_029281 zinc finger protein 820 2 0 0 NM_009556 zinc finger protein 42 2 0 0 NM_019940 zinc finger protein 111 2 0 0 NM_027961 WAP four-disulfide core domain 3 2 0 0 NM_029066 WBP2 N-terminal like 2 0 0 NM_001105185 vomeronasal receptor Vmn2r72 2 0 0 NM_001104625 vomeronasal receptor Vmn2r14 2 0 0 NM_176847 Usher syndrome 1G homolog 2 0 0 NM_013702 Unc4.1 homeobox 2 0 0 NM_009467 UDP glucuronosyltransferase 2 family 2 0 0 NM_028094 UDP glucuronosyltransferase 2 family 2 0 0 NM_053184 UDP glucuronosyltransferase 2 family 2 0 0 NM_030219 tripartite motif-containing 42 2 0 0 NM_146077 tripartite motif-containing 31 2 0 0 NM_144914 transmembrane protein 184a 2 0 0 NM_009356 testicular serine protease 2 2 0 0 NM_009335 transcription factor AP-2 gamma 2 0 0 NM_001082976 membrane targeting tandem C2 domain containing 2 0 0 NM_016771 sulfotransferase family 1D member 1 2 0 0 NM_028734 six transmembrane epithelial antigen of prostate 2 0 0 NM_178740 SLIT and NTRK-like family member 4 2 0 0 NM_001101038 sialic acid binding Ig-like lectin 15 2 0 0 NM_009170 sonic hedgehog 2 0 0 NM_177271 sterile alpha motif domain containing 5 2 0 0 NM_178280 sal-like protein 3 2 0 0 NM_009102 retinal pigment epithelium derived rhodopsin 2 0 0 NM_011269 Rhesus blood group-associated A glycoprotein 2 0 0 NM_001013386 RAS-like family 10, member B 2 0 0 NM_008962 prostaglandin D receptor 2 0 0 NM_011963 pregnancy specific glycoprotein 18 2 0 0 NM_011164 prolactin 2 0 0 NM_001039678 parahox cluster neighbor 2 0 0 NM_198604 pleckstrin homology domain containing family G 2 0 0 NM_133226 PDZ domain containing 3 2 0 0 NM_146437 olfactory receptor 996 2 0 0 NM_146563 olfactory receptor 18 2 0 0 NM_146888 olfactory receptor 1297 2 0 0 NM_145210 2'-5' oligoadenylate synthetase 1E 2 0 0 NM_008730 neuronal pentraxin 1 2 0 0 NM_001004142 NLR family pyrin domain containing 1A 2 0 0 NM_001002894 NLR family pyrin domain containing 14 2 0 0 NM_033217 nerve growth factor receptor TNFR superfamily 2 0 0 NM_008639 melatonin receptor 1A 2 0 0 NM_010769 matrilin 1 cartilage matrix protein 1 2 0 0 NM_001033346 leucine rich repeat containing 55 2 0 0 NM_027941 leucine rich repeat containing 34 2 0 0 NM_001029878 LON peptidase N-terminal domain and ring finger 2 0 0 NM_023903 lipase family member M 2 0 0 NM_010713 LIM homeobox protein 8 2 0 0 NM_010702 leukocyte cell-derived chemotaxin 2 2 0 0 NM_177356 lysosomal-associated membrane protein 3 2 0 0 NM_213730 keratin 39 2 0 0 NM_177155 killer cell lectin-like receptor family I member 2 0 0 NM_011177 kallikrein related-peptidase 6 2 0 0 NM_172898 kin of IRRE-like 2 2 0 0 NM_010475 hydroxysteroid 17-beta dehydrogenase 1 2 0 0 NM_030677 glutathione peroxidase 2 2 0 0 NM_175470 G protein-coupled receptor 61 2 0 0 NM_010317 guanine nucleotide binding protein G protein 2 0 0 NM_001033774 hypothetical protein LOC381544 2 0 0 NM_027227 glyoxalase domain containing 5 2 0 0 NM_001013759 growth arrest-specific 2 like 2 2 0 0 NM_008056 frizzled 6 2 0 0 NM_001081416 fibronectin type III domain containing 1 2 0 0 NM_153118 formin binding protein 1-like isoform 2 2 0 0 NM_015793 F-box and WD-40 domain protein 14 2 0 0 NM_178035 fatty acid desaturase domain family member 6 2 0 0 NM_133660 esterase 22 2 0 0 NM_177706 hypothetical protein LOC237300 2 0 0 NM_007883 desmoglein 2 2 0 0 NM_175525 hypothetical protein LOC243612 2 0 0 NM_177380 cytochrome P450 family 3, subfamily a, 2 0 0 NM_001045525 cytochrome b5 domain containing 1 2 0 0 NM_007784 casein alpha 2 0 0 NM_023695 crystallin beta B1 2 0 0 NM_013496 cellular retinoic acid binding protein I 2 0 0 NM_007756 complexin 1 2 0 0 NM_178373 cell death-inducing DFFA-like effector c 2 0 0 NM_021369 cholinergic receptor nicotinic, alpha 2 0 0 NM_009889 glycoprotein hormones alpha subunit 2 0 0 NM_133654 CD34 antigen isoform 2 2 0 0 NM_153518 coiled-coil domain containing 65 2 0 0 NM_177779 coiled-coil domain containing 42 2 0 0 NM_172914 coiled-coil domain containing 113 2 0 0 NM_139301 cation channel of sperm 1 2 0 0 NM_145368 hypothetical protein LOC209186 2 0 0 NM_007529 brevican isoform 1 2 0 0 NM_173375 hypothetical protein LOC208164 2 0 0 NM_177631 hypothetical protein LOC223927 2 0 0 NM_024204 ankyrin repeat domain 22 2 0 0 NM_001024139 a disintegrin-like and metalloprotease 2 0 0 NM_145745 a disintegrin and metallopeptidase domain 34 2 0 0 NM_012006 acyl-CoA thioesterase 1 2 0 0 NM_172547 hypothetical protein LOC215772 2 0 0 NM_173778 hypothetical protein LOC244885 2 0 0 NM_001081121 hypothetical protein LOC70989 2 0 0 NM_027239 hypothetical protein LOC69864 2 0 0 NM_026099 hypothetical protein LOC67343 2 0 0 NM_028156 hypothetical protein LOC72215 2 0 0 NM_177597 membrane-associated ring finger C3HC4 11 2 0 0 NM_026690 hypothetical protein LOC68352 2 0 0 NM_011038 paired box 4 1 2483 7 NM_011340 serine or cysteine proteinase inhibitor clade 1 1620 19 NM_145158 elastin microfibril interfacer 2 1 1100 185 NM_008519 leukotriene B4 receptor 1 1 931 5 NM_133662 immediate early response 3 1 904 1 NM_053095 interleukin 24 1 448 9 NM_133720 cysteinyl leukotriene receptor 2 1 299 38 NM_008337 interferon gamma 1 283 1 NM_134133 putative small membrane protein NID67 1 257 2 NM_009368 transforming growth factor beta 3 1 206 6 NM_009401 tumor necrosis factor receptor superfamily 1 114 88 NM_146064 acyl-CoA:cholesterol acyltransferase 2 1 200 0 NM_025325 3-hydroxyanthranilate 34-dioxygenase 1 195 1 NM_011031 procollagen-proline 2-oxoglutarate 1 169 2 NM_053091 cytochrome c oxidase subunit IV isoform 2 1 5 163 NM_010553 interleukin 18 receptor accessory protein 1 162 0 NM_134090 KDEL Lys-Asp-Glu-Leu endoplasmic reticulum 1 161 1 NM_001012273 baculoviral IAP repeat-containing 5 isoform 3 1 2 146 NM_009915 chemokine C-C motif receptor 2 1 137 0 NM_019976 proline/serine-rich coiled-coil 1 1 124 2 NM_177741 protein phosphatase 1 regulatory inhibitor 1 103 22 NM_012025 Rac GTPase-activating protein 1 1 53 70 NM_030712 chemokine C-X-C motif receptor 6 1 116 6 NM_011267 regulator of G-protein signaling 16 1 112 0 NM_027979 chitinase 1 chitotriosidase 1 87 15 NM_028038 DEAD Asp-Glu-Ala-Asp box polypeptide 28 1 90 5 NM_015766 Epstein-Barr virus induced gene 3 protein 1 91 0 NM_019877 coatomer protein complex subunit zeta 2 1 89 0 NM_016753 latexin 1 3 84 NM_133643 EDAR ectodysplasin-A receptor-associated death 1 86 1 NM_134250 hepatitis A virus cellular receptor 2 1 86 1 NM_011976 semaphorin 4G 1 41 44 NM_008967 prostaglandin I receptor IP 1 84 1 NM_153143 potassium channel tetramerisation domain 1 80 0 NM_008902 placental protein 11 related 1 80 0 NM_009477 uridine phosphorylase 1 1 77 0 NM_007413 adenosine A2b receptor 1 73 0 NM_022032 PERP TP53 apoptosis effector 1 71 0 NM_001025250 vascular endothelial growth factor A isoform 1 1 70 0 NM_001111305 obscurin-like 1 isoform 1 1 67 2 NM_010590 ajuba 1 59 8 NM_010371 granzyme C preproprotein 1 66 0 NM_009647 adenylate kinase 3 alpha-like 1 1 61 3 NM_027208 3-hydroxybutyrate dehydrogenase type 2 1 4 59 NM_016685 cartilage oligomeric matrix protein 1 60 0 NM_001039677 solute carrier family 30 zinc transporter 1 59 1 NM_009127 stearoyl-Coenzyme A desaturase 1 1 58 0 NM_007630 cyclin B2 1 25 33 NM_015790 icos ligand 1 48 4 NM_011871 protein kinase interferon inducible double 1 25 27 NM_019418 tumor necrosis factor ligand superfamily member 1 52 0 NM_144558 basic immunoglobulin-like variable motif 1 40 11 NM_011146 peroxisome proliferator activated receptor 1 0 50 NM_016958 keratin 14 1 47 0 NM_175665 histone cluster 1 H2bk 1 31 16 NM_020034 histone cluster 1 H1b 1 25 19 NM_022409 zinc finger protein 296 1 4 36 NM_018734 guanylate nucleotide binding protein 4 1 16 24 NM_028725 RIKEN cDNA 4632417N05 1 39 0 NM_001033954 calcitonin isoform Cgrp preproprotein 1 1 37 NM_010730 annexin A1 1 23 15 NM_001079908 fibroblast growth factor receptor 1 isoform 2 1 14 24 NM_027172 hypothetical protein LOC69698 1 37 1 NM_181754 G protein-coupled receptor 141 1 34 2 NM_194355 Spir-1 protein isoform 1 1 36 0 NM_016913 porcupine homolog isoform Mporc-a 1 3 32 NM_025980 Notch-regulated ankyrin repeat protein 1 33 1 NM_010222 FK506 binding protein 7 1 33 1 NM_001024698 carboxypeptidase A2 pancreatic 1 23 11 NM_007710 creatine kinase muscle 1 22 12 NM_033144 septin 8 1 32 1 NM_019499 MAD2 mitotic arrest deficient homolog-like 1 1 32 1 NM_177776 smoothelin-like 2 1 31 2 NM_027159 coiled-coil domain containing 115 1 0 32 NM_008527 killer cell lectin-like receptor subfamily B 1 5 26 NM_016922 galactose-3-O-sulfotransferase 1 1 26 6 NM_001005847 aspartylglucosaminidase 1 31 0 NM_133213 X-prolyl aminopeptidase aminopeptidase P 2 1 29 2 NM_008135 solute carrier family 6 member 9 1 29 1 NM_023805 N system amino acids transporter NAT-1 1 27 3 NM_176808 multiple coagulation factor deficiency 2 1 27 3 NM_009944 cytochrome c oxidase subunit VIIa 1 1 11 17 NM_021476 cysteinyl leukotriene receptor 1 1 25 3 NM_024245 kinesin family member 23 1 23 5 NM_178695 transmembrane gamma-carboxyglutamic acid protein 1 20 7 NM_026312 hypothetical protein LOC67683 1 27 0 NM_144850 Rap1 guanine-nucleotide-exchange factor directly 1 27 0 NM_013552 hyaluronan mediated motility receptor RHAMM 1 26 1 NM_172301 cyclin B1 1 17 9 NM_029580 TRM5 tRNA methyltransferase 5 homolog 1 25 2 NM_001024602 hypothetical protein LOC217882 1 25 1 NM_027290 minichromosome maintenance complex component 10 1 19 6 NM_008743 nth endonuclease III-like 1 1 25 0 NM_013884 chondroitin sulfate proteoglycan 5 1 15 9 NM_009849 ectonucleoside triphosphate diphosphohydrolase 1 22 3 NM_001111079 ubiquitin-like containing PHD and RING finger 1 19 5 NM_177261 kinase non-catalytic C-lobe domain KIND 1 17 7 NM_009545 polycomb group ring finger 2 1 24 0 NM_011937 glucosamine-6-phosphate deaminase 1 1 24 0 NM_183254 hypothetical protein LOC66337 1 0 24 NM_030707 macrophage scavenger receptor 2 1 8 16 NM_145073 histone cluster 1 H3g 1 19 4 NM_019699 fatty acid desaturase 2 1 20 3 NM_010790 maternal embryonic leucine zipper kinase 1 16 7 NM_027480 ankyrin repeat domain 24 1 22 1 NM_009969 colony stimulating factor 2 1 20 2 NM_010094 left right determination factor 1 1 20 2 NM_177897 beta-14-N-acetyl-galactosaminyl transferase 4 1 19 2 NM_138672 stabilin 1 1 20 1 NM_153785 cyclin-dependent kinase-like 3 1 20 1 NM_019771 destrin 1 18 3 NM_033041 hairy and enhancer of split 7 1 0 21 NM_008505 LIM domain only 2 1 15 6 NM_011698 lin 7 homolog b 1 20 0 NM_175660 histone cluster 1 H2ab 1 18 2 NM_026739 hypothetical protein LOC68283 1 14 6 NM_173433 jumonji domain containing 2D 1 19 0 NM_019949 ubiquitin-conjugating enzyme E2L 6 1 2 17 NM_144936 transmembrane protein 45b 1 17 2 NM_015770 nonagouti 1 7 12 NM_146187 free fatty acid receptor 2 1 14 5 NM_177813 hypothetical protein LOC328354 1 2 16 NM_033149 UDP-Gal:betaGlcNAc beta 1 16 2 NM_007671 cyclin-dependent kinase inhibitor 2C 1 8 10 NM_009005 RAB7 member RAS oncogene family 1 12 6 NM_019676 phospholipase C delta 1 1 4 13 NM_177811 zinc finger protein 459 1 17 0 NM_175406 ATPase H+ transporting, V0 subunit D isoform 2 1 0 17 NM_146010 tetraspanin 8 1 16 1 NM_175174 kelch-like 5 1 14 3 NM_172259 myosin light polypeptide 6B 1 9 8 NM_013464 aryl-hydrocarbon receptor 1 16 0 NM_016773 nucleobindin 2 1 16 0 NM_001033039 kelch domain containing 9 1 16 0 NM_178879 hypothetical protein LOC97440 1 15 1 NM_019471 matrix metallopeptidase 10 1 14 2 NM_020560 mitochondrial ribosomal protein S31 1 14 2 NM_001081363 centromere protein F 1 13 3 NM_001033465 hypothetical protein LOC381933 1 0 15 NM_020622 cytokine-like protein 2-21 1 15 0 NM_007728 coagulation factor C homolog Limulus 1 15 0 NM_007808 cytochrome c somatic 1 14 1 NM_198654 NSL1 MIND kinetochore complex component 1 5 9 NM_025969 hypothetical protein LOC67105 1 0 14 NM_008370 interleukin 5 receptor alpha 1 14 0 NM_001042580 Cd63 antigen 1 14 0 NM_001013783 hypothetical protein LOC432552 1 14 0 NM_008608 matrix metalloproteinase 14 membrane-inserted 1 12 2 NM_016868 hypoxia inducible factor 3 alpha subunit 1 12 2 NM_146208 putative DNA glycosylase 1 12 2 NM_177743 hypothetical protein LOC245050 1 11 3 NM_011542 transcription elongation factor A SII 3 1 11 3 NM_148922 transformed mouse 3T3 cell double minute 1 1 1 12 NM_027455 glutaminyl-peptide cyclotransferase glutaminyl 1 13 0 NM_001005342 yippee-like 4 1 11 2 NM_010329 podoplanin 1 11 2 NM_019552 ATP-binding cassette sub-family B, member 10 1 12 1 NM_010756 v-maf musculoaponeurotic fibrosarcoma oncogene 1 12 1 NM_017377 UDP-Gal:betaGlcNAc beta 14- 1 12 1 NM_008990 poliovirus receptor-related 2 1 12 1 NM_145586 transmembrane protein 159 1 12 1 NM_009013 RAD51 associated protein 1 1 2 10 NM_033320 D-glucuronyl C5-epimerase 1 12 0 NM_146202 zinc finger protein 768 1 2 9 NM_153533 C1 domain-containing phosphatase and tensin-like 1 2 9 NM_175930 guanine nucleotide exchange factor for Rap1 1 10 2 NM_026380 regulator of G-protein signalling 8 1 10 2 NM_011369 Shc SH2-domain binding protein 1 1 9 3 NM_001033254 p21 CDKN1A-activated kinase 6 1 8 4 NM_153528 GRAM domain containing 1C 1 7 5 NM_029004 RasGEF domain family member 1C 1 11 0 NM_010215 interleukin 4 induced 1 1 11 0 NM_010292 glucokinase 1 11 0 NM_026864 RAS-like family 11 member A 1 10 1 NM_146025 sterile alpha motif domain containing 14 isoform 1 9 2 NM_012012 exonuclease 1 1 8 3 NM_001005421 adhesion molecule interacts with CXADR antigen 1 8 3 NM_001081275 hypothetical protein LOC75472 1 5 5 NM_009527 wingless-related MMTV integration site 7A 1 4 6 NM_019447 hepatocyte growth factor activator 1 10 0 NM_027356 Ufm1-specific protease 1 1 10 0 NM_010892 NIMA never in mitosis gene a-related expressed 1 10 0 NM_177657 hypothetical protein LOC228846 1 10 0 NM_008827 placental growth factor 1 1 9 NM_001033321 hypothetical protein LOC234740 1 1 9 NM_009662 arachidonate 5-lipoxygenase 1 9 1 NM_207624 angiotensin I converting enzyme 1 9 1 NM_172781 kelch-like 4 1 9 1 NM_001081407 phospholipase B1 1 9 1 NM_016907 Kunitz-type protease inhibitor 1 precursor 1 8 2 NM_029688 sulfiredoxin 1 homolog 1 7 3 NM_146215 hypothetical protein LOC234728 1 7 3 NM_172532 aldhehyde dehydrogenase family 5 subfamily A1 1 7 3 NM_133784 WW domain containing transcription regulator 1 1 5 4 NM_001081161 hypothetical protein LOC269233 1 4 5 NM_053245 aryl hydrocarbon receptor-interacting 1 4 5 NM_026829 5 10-methenyltetrahydrofolate synthetase 1 9 0 NM_183089 defective in sister chromatid cohesion homolog 1 9 0 NM_133353 oocyte secreted protein 1 1 7 2 NM_001039657 metallothionein-like 5 testis-specific isoform 1 7 2 NM_007534 B-cell leukemia/lymphoma 2 related protein A1b 1 7 2 NM_199017 hypothetical protein LOC234912 1 8 1 NM_011789 adenomatosis polyposis coli 2 1 8 1 NM_029360 transmembrane 4 superfamily member 5 1 8 1 NM_009406 troponin I cardiac 1 8 1 NM_001017419 stromal protein associated with thymii and lymph 1 5 3 NM_145508 dual-specificity tyrosine-Y-phosphorylation 1 4 4 NM_027600 hypothetical protein LOC70909 1 4 4 NM_080437 cadherin EGF LAG seven-pass G-type receptor 3 1 4 4 NM_145852 A-kinase anchoring protein-associated sperm 1 4 4 NM_010311 guanine nucleotide binding protein alpha z 1 2 6 NM_007579 calcium channel voltage-dependent, N type, 1 1 7 NM_175214 kinesin family member 27 1 1 7 NM_021792 interferon inducible GTPase 1 1 8 0 NM_025564 mago-nashi homolog 1 8 0 NM_177250 leucine rich repeat and Ig domain containing 4 1 8 0 NM_010375 granzyme G 1 8 0 NM_198249 hypothetical protein LOC268739 1 7 1 NM_133664 ladinin 1 7 1 NM_183174 homeodomain leucine zipper-encoding 1 7 1 NM_001048179 chemokine C-C motif ligand 27 isoform b 1 7 1 NM_001042779 semaphorin 3B 1 7 1 NM_207161 putative c-Myc-responsive 1 5 2 NM_001081349 solute carrier family 43 member 1 isoform 1 1 5 2 NM_009292 stimulated by retinoic acid gene 8 1 5 2 NM_001003916 hepatocellular carcinoma-associated antigen 127 1 5 2 NM_032418 dystrophia myotonica-protein kinase 1 4 3 NM_001001792 zinc finger protein 239 1 4 3 NM_001081217 zinc finger protein 174 1 4 3 NM_144783 Wilms tumor 1 1 4 3 NM_130893 scratch homolog 1 zinc finger protein 1 4 3 NM_144883 hypothetical protein LOC227545 1 3 4 NM_177391 hypothetical protein LOC338368 1 3 4 NM_013831 proline-serine-threonine phosphatase-interacting 1 3 4 NM_012033 tubulointerstitial nephritis antigen 1 2 5 NM_181988 RAS-like estrogen-regulated, growth-inhibitor 1 2 5 NM_012028 ST6 1 1 6 NM_031384 testis expressed gene 11 1 1 6 NM_207583 BMP/retinoic acid-inducible neural-specific 1 0 7 NM_029879 R7 binding protein 1 0 7 NM_080436 retinol dehydrogenase 1 all trans 1 0 7 NM_009063 regulator of G-protein signaling 5 1 7 0 NM_019578 exostoses multiple-like 1 1 7 0 NM_028927 transketolase-like 2 1 7 0 NM_198425 EP300 interacting inhibitor of differentiation 1 7 0 NM_009791 calmodulin binding protein 1 1 5 1 NM_175340 NHL repeat containing 1 1 5 1 NM_028760 centrosomal protein 55 1 5 1 NM_008422 potassium voltage gated channel Shaw-related 1 5 1 NM_001002786 hypothetical protein LOC442827 1 4 2 NM_010628 kinesin family member 9 1 4 2 NM_178417 hypothetical protein LOC237775 1 4 2 NM_177647 arginine-rich mutated in early stage 1 2 4 NM_028943 sphingomyelin synthase 2 1 3 3 NM_172857 vexonuclease 3'-5' domain-like 1 1 3 3 NM_028721 nephrocystin 3 isoform a 1 3 3 NM_023055 solute carrier family 9 isoform 3 regulator 2 1 3 3 NM_001034857 hypothetical protein LOC208111 1 1 5 NM_177696 glycerophosphodiester phosphodiesterase domain 1 1 5 NM_009610 actin gamma 2, smooth muscle, enteric 1 0 6 NM_001111058 CD33 antigen isoform 1 1 0 6 NM_181323 hypothetical protein LOC231293 1 0 6 NM_013903 matrix metalloproteinase 20 enamelysin 1 0 6 NM_013777 aldo-keto reductase family 1 member C12 1 0 6 NM_018884 PDZ domain containing RING finger 3 1 0 6 NM_029305 hypothetical protein LOC75480 1 5 0 NM_001008502 Bardet-Biedl syndrome 12 1 5 0 NM_178885 hypothetical protein LOC98870 1 5 0 NM_146466 olfactory receptor 165 1 5 0 NM_022986 interleukin-1 receptor-associated kinase 1 1 5 0 NM_021358 5-hydroxytryptamine serotonin receptor 6 1 5 0 NM_008124 gap junction protein beta 1, 32kDa 1 5 0 NM_007878 dopamine receptor 4 1 5 0 NM_029714 hypothetical protein LOC76718 1 4 1 NM_009871 cyclin-dependent kinase 5 regulatory subunit 1 4 1 NM_011102 protein kinase C gamma 1 4 1 NM_001004178 hypothetical protein LOC433752 1 4 1 NM_021451 phorbol-12-myristate-13-acetate-induced protein 1 4 1 NM_016927 polycystic kidney disease 2-like 2 1 4 1 NM_130861 solute carrier organic anion transporter family 1 4 1 NM_025393 S100 calcium binding protein A14 1 4 1 NM_026018 membrane-associated protein 17 1 4 1 NM_172690 hypothetical protein LOC230085 1 3 2 NM_011973 MAPK/MAK/MRK overlapping kinase 1 3 2 NM_001001495 RIKEN cDNA 9030611K07 1 3 2 NM_212485 keratin 73 1 2 3 NM_001082483 EFR3 homolog B 1 2 3 NM_172923 hypothetical protein LOC244886 1 2 3 NM_011254 retinol binding protein 1 cellular 1 2 3 NM_011537 T-box 5 1 2 3 NM_010281 gamma-glutamyl hydrolase 1 2 3 NM_008272 homeobox C9 1 2 3 NM_016885 endomucin 1 2 3 NM_001034878 dynein axonemal, intermediate chain 2 1 2 3 NM_181419 zinc finger-like protein 1 1 4 NM_008238 forkhead box N1 1 1 4 NM_028903 scavenger receptor class A member 5 1 1 4 NM_011613 tumor necrosis factor ligand superfamily 1 1 4 NM_001111330 similar to macrophage migration inhibitory 1 1 4 NM_153581 glycoprotein m6a 1 1 4 NM_009953 corticotropin releasing hormone receptor 2 1 0 5 NM_008864 chorionic somatomammotropin hormone 1 1 0 5 NM_176980 ankyrin and armadillo repeat containing 1 0 5 NM_026317 hypothetical protein LOC67690 1 0 5 NM_175086 angiotensin II receptor type 1b 1 4 0 NM_029247 hypothetical protein LOC75311 1 4 0 NM_001111280 hypothetical protein LOC666465 1 4 0 NM_001113350 X Kell blood group precursor-related family 1 4 0 NM_146071 mucin 20 1 4 0 NM_008691 neurofilament 3 medium 1 4 0 NM_020498 lymphocyte antigen 6M 1 4 0 NM_177091 fibronectin type III domain containing 7 1 4 0 NM_019686 calcium and integrin binding family member 2 1 4 0 NM_011912 ventral anterior homeobox containing gene 2 1 4 0 NM_021332 glucagon-like peptide 1 receptor 1 4 0 NM_033615 a disintegrin and metallopeptidase domain 33 1 3 1 NM_019513 carbonic anhydrase 5b mitochondrial 1 3 1 NM_153679 carnitine palmitoyltransferase 1c 1 3 1 NM_013926 chromobox homolog 8 1 3 1 NM_025676 minichromosome maintenance deficient 8 1 3 1 NM_018831 DNA cross-link repair 1A PSO2 homolog 1 3 1 NM_175370 amyotrophic lateral sclerosis 2 juvenile 1 3 1 NM_008781 paired box 3 1 3 1 NM_008685 nuclear factor erythroid derived 2 1 3 1 NM_172841 solute carrier organic anion transporter family 1 3 1 NM_031259 nuclear RNA export factor 2 1 3 1 NM_016693 mitogen-activated protein kinase kinase kinase 1 3 1 NM_011611 tumor necrosis factor receptor superfamily 1 3 1 NM_001003920 BR serine/threonine kinase 1 1 3 1 NM_029141 hypothetical protein LOC75010 1 2 2 NM_173421 hypothetical protein LOC239368 1 2 2 NM_029858 stonin 1 1 2 2 NM_021409 par-6 partitioning defective 6 homolog beta 1 2 2 NM_008978 protein tyrosine phosphatase non-receptor type 1 2 2 NM_178086 fatty acid 2-hydroxylase 1 2 2 NM_009309 brachyury 1 2 2 NM_145949 indoleamine-pyrrole 23 dioxygenase-like 1 1 2 2 NM_008226 hyperpolarization-activated cyclic 1 2 2 NM_010078 dystrophin related protein 2 1 2 2 NM_172727 hypothetical protein LOC231946 1 1 3 NM_178711 phospholipid scramblase 4 1 1 3 NM_016707 B-cell CLL/lymphoma 11A zinc finger protein 1 1 3 NM_173868 suppression of tumorigenicity 18 1 1 3 NM_028938 leucine rich repeat containing 44 1 1 3 NM_054072 protocadherin alpha 1 1 1 3 NM_172818 hypothetical protein LOC239591 1 1 3 NM_028266 collagen type XVI, alpha 1 1 1 3 NM_001040689 R-spondin family member 4 isoform 1 1 1 3 NM_001008702 disabled homolog 2 isoform b 1 1 3 NM_001033209 xylulokinase homolog H. influenzae 1 1 3 NM_001104639 vomeronasal receptor Vmn2r24 1 1 3 NM_017394 solute carrier family 7 cationic amino acid 1 1 3 NM_028894 ring finger protein 127 1 1 3 NM_177600 coiled-coil domain containing 73 1 1 3 NM_019430 voltage-dependent calcium channel gamma-3 1 1 3 NM_144953 hypothetical protein LOC67080 1 0 4 NM_172904 fibronectin type III and SPRY domain containing 1 0 4 NM_001081408 agmatine ureohydrolase agmatinase 1 0 4 NM_025749 zinc finger protein 474 1 0 4 NM_031176 tenascin XB 1 0 4 NM_013611 nodal 1 3 0 NM_001081655 dapper homolog 3 1 3 0 NM_207130 ATP-binding cassette transporter sub-family A 1 3 0 NM_001033820 zinc fingr protein 551 1 3 0 NM_021318 four and a half LIM domains 5 1 3 0 NM_025689 coiled-coil domain containing 51 1 3 0 NM_027699 hypothetical protein LOC71156 1 3 0 NM_028523 discoidin CUB and LCCL domain containing 2 1 3 0 NM_008057 frizzled 7 1 3 0 NM_001033227 solute carrier family 5 sodium/glucose 1 3 0 NM_010932 prepronociceptin 1 3 0 NM_175031 serine/threonine kinase 36 1 3 0 NM_025664 sorting nexin 9 1 3 0 NM_009257 serine or cysteine proteinase inhibitor clade 1 3 0 NM_144556 leucine-rich repeat LGI family member 4 1 3 0 NM_001033780 hypothetical protein LOC433638 1 3 0 NM_008190 guanylate cyclase activator 2a guanylin 1 3 0 NM_153784 coiled-coil domain containing 64B 1 3 0 NM_009711 artemin 1 3 0 NM_145144 ionized calcium binding adapter molecule 2 1 3 0 NM_010495 inhibitor of DNA binding 1 1 2 1 NM_013838 transient receptor potential cation channel 1 2 1 NM_010010 cytochrome P450 family 46, subfamily a, 1 2 1 NM_178786 hypothetical protein LOC320640 1 2 1 NM_198958 NADPH oxidase 3 1 2 1 NM_173419 deleted in lymphocytic leukemia 7 1 2 1 NM_145523 grancalcin 1 2 1 NM_001081178 G protein-coupled receptor 116 1 2 1 NM_177395 mitogen-activated protein kinase kinase kinase 1 2 1 NM_177607 hypothetical protein LOC214106 1 2 1 NM_001083618 tubulin tyrosine ligase like family 9 isoform 1 1 2 1 NM_001033334 capucin 1 2 1 NM_198642 hypothetical protein LOC271221 1 2 1 NM_026449 UDP-N-acetyl-alpha-D-galactosamine:polypeptide 1 2 1 NM_181420 fructosamine 3-kinase-related protein 1 2 1 NM_009347 tectorin alpha 1 2 1 NM_172287 spir-2 protein 1 2 1 NM_178855 protease serine, 7 enterokinase isoform 2 1 2 1 NM_183015 cyclin B3 1 2 1 NM_173395 hypothetical protein LOC227358 1 2 1 NM_178899 hypothetical protein LOC101202 1 2 1 NM_013633 POU domain class 5, transcription factor 1 1 1 2 NM_175540 ectodysplasin A2 isoform receptor 1 1 2 NM_016867 GIPC PDZ domain containing family member 2 1 1 2 NM_029467 testicular cell adhesion molecule 1 1 1 2 NM_001017427 RAS and EF hand domain containing 1 1 2 NM_181753 opsin 5 1 1 2 NM_172895 hypothetical protein LOC243822 1 1 2 NM_178591 neuregulin 1 1 1 2 NM_145099 transient receptor potential cation channel 1 1 2 NM_013757 synaptotagmin-like 4 1 1 2 NM_054084 calcitonin-related polypeptide beta 1 1 2 NM_007963 ecotropic viral integration site 1 1 1 2 NM_153171 regulator of G-protein signaling 13 1 1 2 NM_028176 cytidine deaminase 1 1 2 NM_025727 kelch-like 10 1 1 2 NM_008083 growth associated protein 43 1 1 2 NM_007810 cytochrome P450 family 19, subfamily a, 1 1 2 NM_025508 guanosine monophosphate reductase 1 1 2 NM_001013616 tripartite motif protein 6 1 1 2 NM_028707 pleckstrin and Sec7 domain containing 2 1 1 2 NM_009575 zinc finger protein of the cerebellum 3 1 1 2 NM_001104591 vomeronasal receptor Vmn2r120 1 1 2 NM_178680 cardiomyopathy associated 4 1 1 2 NM_001083119 protein tyrosine phosphatase receptor type, U 1 1 2 NM_172420 protein phosphatase 1 regulatory inhibitor 1 1 2 NM_001037127 skeletal muscle receptor tyrosine kinase isoform 1 1 2 NM_008208 histocompatibility 2 T region locus 3 1 1 2 NM_052823 FXYD domain-containing ion transport regulator 2 1 1 2 NM_028916 EF-hand domain C-terminal containing 2 1 1 2 NM_018827 cytokine receptor-like factor 1 1 1 2 NM_030703 carboxypeptidase N polypeptide 1 1 1 2 NM_029984 hypothetical protein LOC77803 1 0 3 NM_010468 homeo box D3 1 0 3 NM_176952 hypothetical protein LOC319582 1 0 3 NM_026604 hypothetical protein LOC68187 1 0 3 NM_008939 protease serine, 12 neurotrypsin motopsin 1 0 3 NM_016970 killer cell lectin-like receptor subfamily G 1 0 3 NM_008778 p21 CDKN1A-activated kinase 3 1 0 3 NM_001039495 coiled-coil domain containing 108 1 0 3 NM_139310 otoancorin 1 0 3 NM_031867 sweet taste receptor T1r 1 0 3 NM_198029 kindlin-1 1 0 3 NM_001045524 hypothetical protein LOC234915 1 0 3 NM_178920 MAL2 proteolipid protein 1 0 3 NM_019538 placental specific protein 1 1 0 3 NM_177820 apolipoprotein L 10b 1 0 3 NM_001105180 vomeronasal receptor Vmn2r65 1 0 3 NM_022982 reticulon 4 receptor 1 0 3 NM_145403 transmembrane protease serine 4 1 0 3 NM_001039071 LIM domain binding 3 isoform b 1 0 3 NM_001099738 hypothetical protein LOC246738 isoform 1 1 0 3 NM_007877 dopamine receptor 3 1 0 3 NM_009417 thyroid peroxidase 1 0 3 NM_008953 parotid secretory protein 1 0 3 NM_011836 laminin gamma 3 1 0 3 NM_001024474 DIRAS family GTP-binding RAS-like 2 1 0 3 NM_007606 carbonic anhydrase 3 1 0 3 NM_178768 hypothetical protein LOC319776 1 0 3 NM_001110505 amylase 1 salivary precursor 1 0 3 NM_007436 aldehyde dehydrogenase family 3 subfamily A1 1 0 3 NM_029326 hypothetical protein LOC75528 1 2 0 NM_172963 hypothetical protein LOC68617 isoform 2 1 2 0 NM_172878 hypothetical protein LOC242800 1 2 0 NM_007855 twist homolog 2 1 2 0 NM_025290 radial spoke head 1 homolog 1 2 0 NM_001081387 CCCTC-binding factor zinc finger protein-like 1 2 0 NM_008885 peripheral myelin protein 1 2 0 NM_011356 frizzled-related protein 1 2 0 NM_029953 hypothetical protein LOC77669 1 2 0 NM_026183 solute carrier family 47 member 1 1 2 0 NM_177765 tubulin tyrosine ligase-like family member 13 1 2 0 NM_001081099 hypothetical protein LOC69885 1 2 0 NM_001044697 zinc finger protein 2 1 2 0 NM_011141 POU domain class 3, transcription factor 1 1 2 0 NM_013717 B9 protein 1 2 0 NM_009519 wingless-related MMTV integration site 11 1 2 0 NM_019576 thrombospondin type I, domain 1 1 2 0 NM_016908 synaptotagmin V 1 2 0 NM_029269 secreted phosphoprotein 2 1 2 0 NM_023663 receptor-interacting serine-threonine kinase 4 1 2 0 NM_028300 PIH1 domain containing 2 1 2 0 NM_024435 neurotensin 1 2 0 NM_130456 nephrosis 2 homolog podocin 1 2 0 NM_019544 mesogenin 1 1 2 0 NM_011950 mitogen-activated protein kinase 13 1 2 0 NM_133712 kallikrein related-peptidase 10 1 2 0 NM_018746 inter alpha-trypsin inhibitor heavy chain 4 1 2 0 NM_008010 fibroblast growth factor receptor 3 1 2 0 NM_024208 enoyl Coenzyme A hydratase domain containing 3 1 2 0 NM_007802 cathepsin K 1 2 0 NM_013491 chloride channel 1 1 2 0 NM_027152 CD164 sialomucin-like 2 1 2 0 NM_009779 complement component 3a receptor 1 1 2 0 NM_182783 hypothetical protein LOC230766 1 2 0 NM_144903 aldolase 2 B isoform 1 2 0 NM_153509 hypothetical protein LOC209743 1 2 0 NM_175692 hypothetical protein LOC319317 1 2 0 NM_016875 Y box protein 2 1 1 1 NM_021349 tumor necrosis factor receptor superfamily 1 1 1 NM_153145 ATP-binding cassette sub-family A ABC1, 1 1 1 NM_021459 ISL1 transcription factor LIM/homeodomain 1 1 1 NM_009538 pleiomorphic adenoma gene-like 1 1 1 1 NM_024246 transmembrane protein 79 1 1 1 NM_001081123 hypothetical protein LOC75404 1 1 1 NM_007402 a disintegrin and metalloprotease domain 7 1 1 1 NM_033477 G4 protein 1 1 1 NM_008795 PCTAIRE-motif protein kinase 3 1 1 1 NM_029061 coiled-coil domain containing 7 1 1 1 NM_001081047 connector enhancer of kinase suppressor of Ras 1 1 1 NM_175488 coiled-coil domain containing 38 1 1 1 NM_001024619 tsukushi 1 1 1 NM_172510 major facilitator superfamily domain containing 1 1 1 NM_027011 keratin 5 1 1 1 NM_007603 calpain 6 1 1 1 NM_153540 glycosyltransferase 1 1 1 NM_134164 synaptotagmin XII 1 1 1 NM_026253 leucine rich repeat containing 18 1 1 1 NM_010296 GLI-Kruppel family member GLI1 1 1 1 NM_008216 hyaluronan synthase 2 1 1 1 NM_016911 sushi-repeat-containing protein X-chromosome 1 1 1 NM_001037928 hypothetical protein LOC626870 1 1 1 NM_019459 nephrosis 1 homolog nephrin 1 1 1 NM_175512 NADP-dependent retinol dehydrogenase/reductase 1 1 1 NM_001083125 LIM homeobox protein 6 isoform 2 1 1 1 NM_021877 hairless protein 1 1 1 NM_172912 ATP-binding cassette sub-family C CFTR/MRP, 1 1 1 NM_016673 ciliary neurotrophic factor receptor 1 1 1 NM_020274 5-hydroxytryptamine serotonin receptor 3B 1 1 1 NM_011782 a disintegrin-like and metalloprotease 1 1 1 NM_008430 potassium channel subfamily K, member 1 1 1 1 NM_175628 alpha-2-macroglobulin precursor 1 1 1 NM_015767 tocopherol alpha transfer protein 1 1 1 NM_172399 hypothetical protein LOC68169 1 1 1 NM_027893 poliovirus receptor-related 4 1 1 1 NM_178067 myosin binding protein C fast-type 1 1 1 NM_009581 zona pellucida 3 receptor 1 1 1 NM_001104543 vomeronasal receptor Vmn2r94 1 1 1 NM_029553 tetratricopeptide repeat domain 8 isoform 1 1 1 1 NM_177371 tumor necrosis factor ligand superfamily 1 1 1 NM_009396 tumor necrosis factor alpha-induced protein 2 1 1 1 NM_145463 transmembrane protein 46 1 1 1 NM_016928 toll-like receptor 5 1 1 1 NM_009312 tachykinin 2 preproprotein 1 1 1 NM_013682 brachyury 2 1 1 1 NM_173403 solute carrier family 10 sodium/bile acid 1 1 1 NM_021882 silver 1 1 1 NM_198024 RAN binding protein 3-like 1 1 1 NM_054077 proline arginine-rich end leucine-rich repeat 1 1 1 NM_145378 phospholipase A2 group IVB 1 1 1 NM_001081147 oxytocin receptor 1 1 1 NM_001099303 hypothetical protein LOC545667 1 1 1 NM_175290 NALP kappa 1 1 1 NM_029844 melanocortin 2 receptor accessory protein 1 1 1 NM_029696 malate dehydrogenase 1B NAD soluble 1 1 1 NM_001081078 lactase 1 1 1 NM_001081202 LINE-1 type transposase domain containing 1 1 1 1 NM_175199 heat shock protein 12A 1 1 1 NM_001034872 hypothetical protein LOC332942 1 1 1 NM_001009950 hypothetical protein LOC234788 1 1 1 NM_001033266 hypothetical protein LOC217071 1 1 1 NM_001033349 hypothetical protein LOC242037 1 1 1 NM_019521 growth arrest specific 6 1 1 1 NM_008001 FYVE RhoGEF and PH domain containing 1 1 1 1 NM_001037168 hypothetical protein LOC545925 1 1 1 NM_010104 endothelin 1 1 1 1 NM_022983 endothelial differentiation lysophosphatidic 1 1 1 NM_145395 Numb-interacting protein 1 1 1 1 NM_170593 dispatched homolog 2 1 1 1 NM_007857 desert hedgehog 1 1 1 NM_010029 DEAD Asp-Glu-Ala-Asp box polypeptide 4 1 1 1 NM_001033875 chymotrypsin C caldecrin 1 1 1 NM_009420 cysteine-rich secretory protein 2 1 1 1 NM_198415 creatine kinase mitochondrial 2 1 1 1 NM_007663 cadherin 16 1 1 1 NM_027987 CD300 antigen like family member G 1 1 1 NM_009755 bone morphogenetic protein 1 1 1 1 NM_173031 hypothetical protein LOC271887 1 1 1 NM_023631 aldehyde oxidase 4 1 1 1 NM_144547 anti-Mullerian hormone type 2 receptor 1 1 1 NM_178713 aldehyde dehydrogenase 8 family member A1 1 1 1 NM_013460 adrenergic receptor alpha 1d 1 1 1 NM_007401 a disintegrin and metallopeptidase domain 5 1 1 1 NM_001080709 hypothetical protein LOC74854 1 1 1 NM_177894 hypothetical protein LOC330577 1 0 2 NM_027026 leucine rich repeat containing 46 1 0 2 NM_024285 blood vessel epicardial substance 1 0 2 NM_001104563 vomeronasal receptor Vmn2r101 1 0 2 NM_011854 2'-5' oligoadenylate synthetase-like 2 1 0 2 NM_027562 C-type lectin domain family 2 member g 1 0 2 NM_019938 polyamine modulated factor 1 binding protein 1 1 0 2 NM_013873 sulfotransferase family 4A member 1 1 0 2 NM_009996 cytochrome P450 family 24, subfamily a, 1 0 2 NM_018781 early growth response 3 1 0 2 NM_007419 adrenergic receptor beta 1 1 0 2 NM_010856 myosin heavy polypeptide 6, cardiac muscle, 1 0 2 NM_172846 dynein axonemal, heavy chain 14 1 0 2 NM_028426 hypothetical protein LOC73061 1 0 2 NM_011449 sperm autoantigenic protein 17 1 0 2 NM_029597 hypothetical protein LOC76405 1 0 2 NM_007588 calcitonin receptor isoform a precursor 1 0 2 NM_001033301 FH2 domain containing 1 1 0 2 NM_001104926 cytochrome P450 family 2, subfamily j, 1 0 2 NM_011067 period homolog 3 1 0 2 NM_023537 RAB3B member RAS oncogene family 1 0 2 NM_010720 lipase endothelial 1 0 2 NM_172925 kelch repeat and BTB POZ domain containing 1 1 0 2 NM_177049 junctophilin 4 isoform a 1 0 2 NM_009780 complement component 4B 1 0 2 NM_146213 hypothetical protein LOC234677 1 0 2 NM_139142 solute carrier family 6 neurotransmitter 1 0 2 NM_011978 solute carrier family 27 fatty acid 1 0 2 NM_026945 alcohol dehydrogenase 6A class V 1 0 2 NM_175303 sal-like 4 isoform a 1 0 2 NM_018874 pancreatic lipase related protein 1 1 0 2 NM_177161 collagen prolyl 4-hydroxylase alpha 3 1 0 2 NM_001033184 hypothetical protein LOC78459 1 0 2 NM_001102615 kinesin family member 19A 1 0 2 NM_001081310 hypothetical protein LOC625286 1 0 2 NM_201361 hypothetical protein LOC381110 1 0 2 NM_013500 hyaluronan and proteoglycan link protein 1 1 0 2 NM_144929 retbindin 1 0 2 NM_001081126 G protein-coupled receptor 161 1 0 2 NM_010003 cytochrome P450 family 2, subfamily c, 1 0 2 NM_008533 CD180 antigen 1 0 2 NM_001004153 cationic amino acid transporter 5 1 0 2 NM_011915 Wnt inhibitory factor 1 1 0 2 NM_053123 SWI/SNF related matrix associated, actin 1 0 2 NM_008530 lymphocyte antigen 6 complex locus F 1 0 2 NM_198886 zinc finger and BTB domain containing 12 1 0 2 NM_001105061 vomeronasal receptor Vmn2r64 1 0 2 NM_198166 urotensin 2 domain containing protein 1 0 2 NM_010020 solute carrier family 6 neurotransmitter 1 0 2 NM_009209 solute carrier family 6 member 2 1 0 2 NM_001013780 solute carrier family 25 member 34 1 0 2 NM_173051 serine or cysteine proteinase inhibitor clade 1 0 2 NM_027997 serine or cysteine proteinase inhibitor clade 1 0 2 NM_011328 secretin 1 0 2 NM_011326 sodium channel nonvoltage-gated 1 gamma 1 0 2 NM_172896 NLR family pyrin domain containing 4A 1 0 2 NM_008624 muscle and microspikes RAS 1 0 2 NM_177448 monoacylglycerol O-acyltransferase 2 1 0 2 NM_010762 myelin and lymphocyte protein T-cell 1 0 2 NM_010714 LIM homeobox protein 9 isoform b 1 0 2 NM_177749 killer cell immunoglobulin-like receptor three 1 0 2 NM_177791 potassium channel tetramerisation domain 1 0 2 NM_175462 potassium channel subfamily T, member 1 1 0 2 NM_008309 5-hydroxytryptamine serotonin receptor 1D 1 0 2 NM_001077353 glutathione S-transferase alpha 3 1 0 2 NM_177157 GTP cyclohydrolase I feedback regulator 1 0 2 NM_001099688 F-box protein 39 1 0 2 NM_198657 hypothetical protein LOC381438 1 0 2 NM_027299 sphingolipid delta 4 desaturase/C-4 hydroxylase 1 0 2 NM_177775 chr3 synaptotagmin 1 0 2 NM_001033471 hypothetical protein LOC382239 1 0 2 NM_177450 carnosine dipeptidase 1 1 0 2 NM_008770 claudin 11 1 0 2 NM_009835 chemokine C-C motif receptor 6 1 0 2 NM_026979 C1q and tumor necrosis factor related protein 2 1 0 2 NM_029426 brain-selective kinase 2 isoform alpha 1 0 2 NM_001039146 hypothetical protein LOC627280 1 0 2 NM_145684 arachidonate lipoxygenase epidermal 1 0 2 NM_177755 hypothetical protein LOC268807 1 0 2 NM_001007583 bestrophin 3 1 0 2 NM_008936 paired like homeodomain factor 1 1 1 0 NM_023543 beta chimerin 1 1 0 NM_178247 developmental pluripotency associated 1 1 1 0 NM_175170 pogo transposable element with KRAB domain 1 1 0 NM_008811 pyruvate dehydrogenase E1 alpha 2 1 1 0 NM_182839 tubulin polymerization-promoting protein 1 1 0 NM_011776 zona pellucida glycoprotein 3 1 1 0 NM_027921 solute carrier family 16 monocarboxylic acid 1 1 0 NM_009131 C-type lectin domain family 11 member a 1 1 0 NM_013806 ATP-binding cassette sub-family C, member 2 1 1 0 NM_021517 PDZ domain containing 1 1 1 0 NM_008239 forkhead box Q1 1 1 0 NM_025556 hypothetical protein LOC66423 1 1 0 NM_178618 hypothetical protein LOC69640 1 1 0 NM_033648 corticosteroid-induced protein 1 1 0 NM_198658 nuclear receptor subfamily 1 group H, member 5 1 1 0 NM_177191 synaptonemal complex protein 2 1 1 0 NM_178079 peptidase M20 domain containing 1 1 1 0 NM_153508 calsyntenin 3 1 1 0 NM_001013767 calpain 11 1 1 0 NM_178254 transcription factor-like 5 protein 1 1 0 NM_145581 sialic acid binding Ig-like lectin 5 1 1 0 NM_001009940 interleukin 19 1 1 0 NM_207533 developing brain homeobox 2 1 1 0 NM_013808 cysteine and glycine-rich protein 3 1 1 0 NM_028918 tetratricopeptide repeat domain 25 1 1 0 NM_172658 solute carrier organic anion transporter family 1 1 0 NM_032393 microtubule-associated protein 1 A 1 1 0 NM_007473 aquaporin 7 1 1 0 NM_029372 hypothetical protein LOC75645 1 1 0 NM_001083894 lipase member H isoform 1 1 1 0 NM_021611 myosin light chain 2 precursor 1 1 0 NM_001081406 peptidylprolyl isomerase cyclophilin-like 5 1 1 0 NM_012045 phospholipase A2 group IIF 1 1 0 NM_001081250 myosin heavy polypeptide 13, skeletal muscle 1 1 0 NM_172487 proline-rich transmembrane protein 3 1 1 0 NM_016689 aquaporin 3 1 1 0 NM_001081233 predicted gene EG433923 1 1 0 NM_174987 hypothetical protein LOC67892 1 1 0 NM_001105189 vomeronasal 2 receptor 78 1 1 0 NM_029975 UL16 binding protein 1 1 1 0 NM_025432 trafficking protein particle complex 2 1 1 0 NM_028011 target of myb1-like 1 1 1 0 NM_175771 transmembrane protein 47 1 1 0 NM_178388 transmembrane protein 202 1 1 0 NM_175564 transmembrane protein 169 1 1 0 NM_126166 toll-like receptor 3 1 1 0 NM_172830 solute carrier family 4 sodium bicarbonate 1 1 0 NM_011392 solute carrier family 34 sodium phosphate 1 1 0 NM_172892 solute carrier family 13 sodium/sulfate 1 1 0 NM_015825 SH3-binding domain glutamic acid-rich protein 1 1 0 NM_145373 secreted and transmembrane 1A 1 1 0 NM_153504 ring finger protein 183 1 1 0 NM_008865 prolactin family 3 subfamily b, member 1 1 1 0 NM_001080771 PR domain containing 13 1 1 0 NM_001004025 protein phosphatase 3 regulatory subunit B, 1 1 0 NM_145521 phosphatidic acid phosphatase type 2 domain 1 1 0 NM_011110 phospholipase A2 group V 1 1 0 NM_145981 phytanoyl-CoA hydroxylase interacting protein 1 1 0 NM_001081957 extracellular proteinase inhibitor family 1 1 0 NM_145932 organic solute transporter alpha 1 1 0 NM_146956 olfactory receptor 525 1 1 0 NM_130869 NOBOX oogenesis homeobox 1 1 0 NM_153079 neuromedin U receptor 2 1 1 0 NM_008700 NK2 transcription factor related locus 5 1 1 0 NM_080457 mucin 4 1 1 0 NM_011985 matrix metallopeptidase 23 1 1 0 NM_008607 matrix metallopeptidase 13 1 1 0 NM_144934 methyl-CpG binding domain protein 3-like 2 1 1 0 NM_008545 melanoma antigen family B 3 1 1 0 NM_026092 lysozyme-like 1 1 1 0 NM_001033427 lysozyme G-like 2 1 1 0 NM_028175 leucine rich repeat containing 8 family member 1 1 0 NM_133203 killer cell lectin-like receptor subfamily A, 1 1 0 NM_023184 Kruppel-like factor 15 1 1 0 NM_021275 potassium voltage-gated channel shaker-related 1 1 0 NM_008405 integrin beta 2-like 1 1 0 NM_018885 Iroquois related homeobox 4 1 1 0 NM_173027 inositol hexaphosphate kinase 3 1 1 0 NM_010464 homeobox C13 1 1 0 NM_010445 H6 homeo box 1 1 1 0 NM_001044380 hedgehog interacting protein-like 1 1 1 0 NM_001083929 glutathione peroxidase 3 isoform 1 1 1 0 NM_010242 fucosyltransferase 4 1 1 0 NM_008241 forkhead box G1 1 1 0 NM_133862 fibrinogen gamma polypeptide 1 1 0 NM_153111 FEV ETS oncogene family 1 1 0 NM_010184 Fc receptor IgE, high affinity I, alpha 1 1 0 NM_010125 E74-like factor 5 1 1 0 NM_001081325 predicted gene EG629219 1 1 0 NM_013504 desmocollin 1 1 1 0 NM_175223 axonemal dynein light chain hp28 homolog 1 1 0 NM_007866 delta-like 3 1 1 0 NM_013932 DEAD Asp-Glu-Ala-Asp box polypeptide 25 1 1 0 NM_172306 cytochrome P450 family 4, subfamily a family 1 1 0 NM_010009 cytochrome P450 family 27, subfamily b, 1 1 0 NM_019568 kidney-expressed chemokine CXC 1 1 0 NM_026778 collagen triple helix repeat containing 1 1 1 0 NM_027085 chloride intracellular channel 3 1 1 0 NM_019815 claudin 18 1 1 0 NM_021600 cholinergic receptor nicotinic, delta 1 1 0 NM_021609 chemokine binding protein 2 1 1 0 NM_144855 cystathionine beta-synthase isoform 1 1 1 0 NM_009813 calsequestrin 1 1 1 0 NM_007577 complement component 5 receptor 1 1 1 0 NM_181344 complement component 1 r subcomponent-like 1 1 0 NM_145229 cleft palate-related protein 1 1 1 0 NM_001033221 hypothetical protein LOC106722 1 1 0 NM_031404 actin-like 6B 1 1 0 NM_178414 acyl-CoA synthetase medium-chain family member 1 1 0 NM_028790 acyl-CoA thioesterase 12 1 1 0 NM_177392 hypothetical protein LOC338369 1 1 0 NM_001081074 APOBEC1 complementation factor 1 1 0 NM_177074 hypothetical protein LOC320106 1 1 0 NM_030218 hypothetical protein LOC78906 1 1 0 NM_175280 hypothetical protein LOC78774 1 1 0 NM_025572 hypothetical protein LOC66451 1 1 0 NM_026415 hypothetical protein LOC67859 1 1 0 NM_024279 hypothetical protein LOC78634 1 1 0 NM_183097 hypothetical protein LOC73453 1 1 0 NM_001033176 hypothetical protein LOC76713 1 1 0 NM_029309 hypothetical protein LOC75495 1 1 0 NM_001081180 serine peptidase inhibitor Kazal type 5 1 1 0 NM_010225 forkhead box F2 1 0 1 NM_177360 doublesex and mab-3 related transcription factor 1 0 1 NM_007974 coagulation factor II thrombin receptor-like 1 0 1 NM_032398 plasmalemma vesicle associated protein 1 0 1 NM_183204 ring finger protein 182 1 0 1 NM_001033403 hypothetical protein LOC328657 1 0 1 NM_021384 radical S-adenosyl methionine domain containing 1 0 1 NM_001034059 hypothetical protein LOC434778 1 0 1 NM_008051 fucosyltransferase 1 1 0 1 NM_009899 chloride channel calcium activated 1 1 0 1 NM_173774 deleted in neuroblastoma 5 1 0 1 NM_027401 hypothetical protein LOC70363 1 0 1 NM_011825 gremlin 2 homolog cysteine knot superfamily 1 0 1 NM_009694 apolipoprotein B editing complex 2 1 0 1 NM_001081283 transmembrane protein 28 1 0 1 NM_172612 Rho family GTPase 1 1 0 1 NM_001105057 vomeronasal receptor Vmn2r60 1 0 1 NM_144867 slowmo homolog 1 1 0 1 NM_199223 reticulon 4 receptor-like 2 1 0 1 NM_011859 odd-skipped related 1 1 0 1 NM_010369 glycophorin A 1 0 1 NM_023485 syncoilin 1 0 1 NM_008814 pancreatic and duodenal homeobox 1 1 0 1 NM_001024841 hypothetical protein LOC229588 1 0 1 NM_001081143 guanine nucleotide binding protein alpha 1 0 1 NM_008596 synaptophysin-like 2 1 0 1 NM_010108 ephrin A3 1 0 1 NM_013851 ATP-binding cassette sub-family A ABC1, 1 0 1 NM_177087 hypothetical protein LOC320159 1 0 1 NM_010235 fos-like antigen 1 1 0 1 NM_010250 gamma-aminobutyric acid GABA-A receptor 1 0 1 NM_009511 vasoactive intestinal peptide receptor 2 1 0 1 NM_013518 fibroblast growth factor 9 1 0 1 NM_008777 phenylalanine hydroxylase 1 0 1 NM_001102602 vomeronasal 2 receptor 85 1 0 1 NM_021481 trehalase 1 0 1 NM_011581 thrombospondin 2 1 0 1 NM_011441 SRY-box 17 1 0 1 NM_011731 solute carrier family 6 neurotransmitter 1 0 1 NM_153106 peptidyl arginine deiminase egg and embryo 1 0 1 NM_172854 olfactomedin-like 2A 1 0 1 NM_010823 myeloproliferative leukemia virus oncogene 1 0 1 NM_028660 kallikrein-related peptidase 9 1 0 1 NM_007919 elastase 2 1 0 1 NM_001039121 beta-defensin 43 1 0 1 NM_001039555 cytochrome P450 family 2, subfamily c, 1 0 1 NM_001004159 C-type lectin domain family 4 member b2 1 0 1 NM_016675 claudin 2 1 0 1 NM_023186 putative chitinase precursor 1 0 1 NM_007562 basonuclin 1 1 0 1 NM_176924 Fc fragment of IgG binding protein 1 0 1 NM_001033980 hypothetical protein LOC436062 1 0 1 NM_008381 inhibin beta-B 1 0 1 NM_031388 ubiquitin specific peptidase 26 1 0 1 NM_028480 pregnancy-specific glycoprotein 30 1 0 1 NM_153760 MHC I like leukocyte 2 short form 1 0 1 NM_010021 deleted in azoospermia-like 1 0 1 NM_146197 acyl-CoA synthetase medium-chain family member 1 0 1 NM_001033041 amino carboxymuconate semialdehyde 1 0 1 NM_144940 urocanase domain containing 1 1 0 1 NM_027052 solute carrier family 38 member 4 1 0 1 NM_177860 hypothetical protein LOC329763 1 0 1 NM_013482 Bruton agammaglobulinemia tyrosine kinase 1 0 1 NM_026180 ATP-binding cassette sub-family G WHITE, 1 0 1 NM_178689 hypothetical protein LOC226265 1 0 1 NM_146188 potassium channel tetramerisation domain 1 0 1 NM_011535 T-box 3 protein isoform 1 1 0 1 NM_198864 SLIT and NTRK-like family member 3 1 0 1 NM_013582 luteinizing hormone/choriogonadotropin receptor 1 0 1 NM_011998 carbohydrate chondroitin 6/keratan 1 0 1 NM_145399 secretagogin EF-hand calcium binding protein 1 0 1 NM_172784 low density lipoprotein receptor-related protein 1 0 1 NM_177695 transmembrane channel-like gene family 3 1 0 1 NM_080420 lactoperoxidase 1 0 1 NM_033509 loop tail associated protein 1 0 1 NM_146240 peptidylglycine alpha-amidating monooxygenase 1 0 1 NM_027970 hypothetical protein LOC71868 1 0 1 NM_011377 single-minded homolog 2 1 0 1 NM_181064 Nkrp1f protein 1 0 1 NM_130859 caspase recruitment domain family member 10 1 0 1 NM_008536 transmembrane 4 superfamily member 1 1 0 1 NM_130458 trans-acting transcription factor 7 1 0 1 NM_009242 secreted acidic cysteine rich glycoprotein 1 0 1 NM_010883 norrin 1 0 1 NM_024237 extracellular matrix protein TM14 1 0 1 NM_008862 protein kinase inhibitor alpha 1 0 1 NM_011527 T-cell acute lymphocytic leukemia 1 1 0 1 NM_207210 dual-specificity tyrosine-Y-phosphorylation 1 0 1 NM_008047 follistatin-like 1 1 0 1 NM_178255 hyaluronan and proteoglycan link protein 3 1 0 1 NM_133204 zinc finger protein 371 1 0 1 NM_027704 zinc finger DHHC domain containing 11 1 0 1 NM_009522 wingless-related MMTV integration site 3A 1 0 1 NM_001104537 vomeronasal receptor Vmn2r83 1 0 1 NM_001102579 vomeronasal receptor Vmn2r67 1 0 1 NM_019918 calcium-sensing receptor like 1 1 0 1 NM_031250 urocortin 3 1 0 1 NM_001012392 long palate lung and nasal epithelium carcinoma 1 0 1 NM_172799 tubulin tyrosine ligase-like family member 6 1 0 1 NM_009440 testis specific X-linked 1 0 1 NM_080510 tripartite motif-containing 69 1 0 1 NM_001014398 taste receptor protein 1 1 0 1 NM_011627 trophoblast glycoprotein 1 0 1 NM_001101483 transmembrane protein 22 1 0 1 NM_175408 transmembrane protein 139 1 0 1 NM_026104 transmembrane and coiled-coil domains 5 1 0 1 NM_172476 Tmc7 protein 1 0 1 NM_133212 toll-like receptor 8 1 0 1 NM_009334 transcription factor AP-2 beta isoform 1 1 0 1 NM_025285 stathmin-like 2 1 0 1 NM_001013797 serine peptidase inhibitor Kazal type 6 1 0 1 NM_001048217 serine protease inhibitor Kazal type 11 1 0 1 NM_011443 sex-determining region Y-box 2 1 0 1 NM_009233 SRY sex determining region Y-box 1 1 0 1 NM_011435 superoxide dismutase 3 extracellular 1 0 1 NM_177570 schlafen like 1 1 0 1 NM_201353 solute carrier family 6 neurotransmitter 1 0 1 NM_178934 solute carrier family 2 facilitated glucose 1 0 1 NM_009202 solute carrier family 22 member 1 1 0 1 NM_001033499 SH2 domain protein 1B2 1 0 1 NM_009144 secreted frizzled-related protein 2 1 0 1 NM_001025379 sema domain immunoglobulin domain Ig, short 1 0 1 NM_026205 ring finger protein 151 1 0 1 NM_182929 regulating synaptic membrane exocytosis 3 1 0 1 NM_177740 RGM domain family member A 1 0 1 NM_023622 RalGDS-like protein 3 1 0 1 NM_009038 recoverin 1 0 1 NM_015745 retinol binding protein 3 interstitial 1 0 1 NM_009034 retinol binding protein 2 cellular 1 0 1 NM_207270 protein tyrosine phosphatase receptor type, H 1 0 1 NM_175204 proteasome prosome macropain subunit, beta 1 0 1 NM_001037539 prokineticin 2 isoform 2 1 0 1 NM_029947 PR domain containing 8 1 0 1 NM_001034885 patatin-like phospholipase domain containing 1 1 0 1 NM_026385 plasma membrane proteolipid 1 0 1 NM_021311 piwi like homolog 1 1 0 1 NM_172439 phosphatidylinositol 45 bisphosphate 1 0 1 NM_001033361 G protein-coupled receptor 15-like 1 0 1 NM_008821 plasmacytoma expressed transcript 2 1 0 1 NM_008769 ornithine transcarbamylase 1 0 1 NM_013887 opsin 4 1 0 1 NM_201258 oogenesin 3 1 0 1 NM_019409 oligodendrocyte myelin glycoprotein 1 0 1 NM_146513 olfactory receptor 95 1 0 1 NM_001005570 olfactory receptor 707 1 0 1 NM_133859 olfactomedin-like 3 1 0 1 NM_001039234 NLR family pyrin domain containing 1C 1 0 1 NM_170671 Myc-binding protein-associated protein 1 0 1 NM_020597 beta-microseminoprotein 1 0 1 NM_198224 membrane-spanning 4-domains subfamily A, member 1 0 1 NM_008561 melanocortin 3 receptor 1 0 1 NM_053201 melanoma antigen family E, 1 1 0 1 NM_027111 lysozyme G-like 1 precursor 1 0 1 NM_010663 keratin 17 1 0 1 NM_001012520 killer cell lectin-like receptor family I member 1 0 1 NM_010642 kallikrein 1-related peptidase b21 1 0 1 NM_001039042 kallikrein 13 precursor 1 0 1 NM_029416 zinc finger protein 393 1 0 1 NM_207261 2P K ion channel TRESK 1 0 1 NM_020574 potassium voltage-gated channel Isk-related 1 0 1 NM_008412 involucrin 1 0 1 NM_177193 immunoglobulin superfamily containing 1 0 1 NM_173767 inscuteable 1 0 1 NM_178258 interleukin 22 receptor alpha 2 1 0 1 NM_010483 5-hydroxytryptamine serotonin receptor 5B 1 0 1 NM_010482 5-hydroxytryptamine serotonin receptor 1B 1 0 1 NM_008290 hydroxysteroid 17-beta dehydrogenase 2 1 0 1 NM_053176 histidine-rich glycoprotein 1 0 1 NM_008277 4-hydroxyphenylpyruvic acid dioxygenase 1 0 1 NM_008257 H6 homeo box 3 1 0 1 NM_008237 hairy and enhancer of split 3 1 0 1 NM_175189 hepatocyte cell adhesion molecule 1 0 1 NM_130455 glutamate receptor ionotropic, NMDA3B 1 0 1 NM_010338 G protein-coupled receptor 37 precursor 1 0 1 NM_206973 G protein-coupled receptor 152 1 0 1 NM_010951 G protein-coupled receptor 143 1 0 1 NM_031999 transmembrane 7 superfamily member 1 1 0 1 NM_001033473 hypothetical protein LOC382384 1 0 1 NM_010297 glycine receptor alpha 4 subunit 1 0 1 NM_183193 forkhead box I2 1 0 1 NM_001083905 fetuin beta isoform 3 1 0 1 NM_177070 F-box and WD-40 domain protein 16 1 0 1 NM_001038658 lifeguard isoform 2 1 0 1 NM_007954 esterase 1 1 0 1 NM_007884 epiphycan 1 0 1 NM_010144 Eph receptor B4 1 0 1 NM_010133 engrailed 1 1 0 1 NM_001099307 hypothetical protein LOC636104 1 0 1 NM_001081239 leukocyte immunoglobulin-like receptor 1 0 1 NM_001029977 complement factor H-related protein C 1 0 1 NM_177921 hypothetical protein LOC331537 1 0 1 NM_175538 hypothetical protein LOC245269 1 0 1 NM_145744 dual specificity phosphatase 15 1 0 1 NM_001099297 dual oxidase 1 1 0 1 NM_030596 desmoglein 3 1 0 1 NM_001081695 DNA cytosine-5--methyltransferase 3-like 1 0 1 NM_019957 deoxyribonuclease II beta 1 0 1 NM_134144 cytochrome P450 family 2, subfamily c, 1 0 1 NM_007813 cytochrome P450 family 2, subfamily b, 1 0 1 NM_009999 cytochrome P450 family 2, subfamily b, 1 0 1 NM_009142 chemokine C-X3-C motif ligand 1 1 0 1 NM_027904 carboxypeptidase N polypeptide 2 homolog 1 0 1 NM_001042611 ceruloplasmin isoform a 1 0 1 NM_007741 collagen type IX, alpha 2 1 0 1 NM_153384 Usher syndrome 3A homolog isoform 1 1 0 1 NM_053165 C-type lectin domain family 2 member h 1 0 1 NM_153506 C-type lectin domain family 2 member e 1 0 1 NM_025519 chromatin modifying protein 4C 1 0 1 NM_053200 carboxylesterase 3 1 0 1 NM_001039185 carcinoembryonic antigen-related cell adhesion 1 0 1 NM_009872 cyclin-dependent kinase 5 regulatory subunit 2 1 0 1 NM_020279 chemokine C-C motif ligand 28 1 0 1 NM_207268 coiled-coil domain containing 87 1 0 1 NM_019582 calcium channel voltage-dependent, alpha 1F 1 0 1 NM_138948 calcium binding protein 7 1 0 1 NM_011795 complement component 1 q subcomponent-like 1 1 0 1 NM_175938 butyrophilin 2 1 0 1 NM_007553 bone morphogenetic protein 2 1 0 1 NM_001013778 hypothetical protein LOC383103 1 0 1 NM_009724 ATPase H+/K+ exchanging, beta polypeptide 1 0 1 NM_008554 achaete-scute complex homolog 2 1 0 1 NM_177566 Rho guanine nucleotide exchange factor GEF 15 1 0 1 NM_018816 apolipoprotein M 1 0 1 NM_144790 ankyrin repeat domain 33 1 0 1 NM_053156 allantoicase 1 0 1 NM_009645 activation-induced cytidine deaminase 1 0 1 NM_207531 anterior gradient homolog 3 1 0 1 NM_021475 ADAM-like decysin 1 1 0 1 NM_030718 cis-AB transferase 1 0 1 NM_177864 butyrophilin-like protein 1 0 1 NM_001039485 hypothetical protein LOC225617 1 0 1 NM_030135 cystatin SC 1 0 1 NM_173435 hypothetical protein LOC245492 1 0 1 NM_029070 hypothetical protein LOC74720 1 0 1 NM_175250 hypothetical protein LOC76971 1 0 1 NM_172414 hypothetical protein LOC72350 1 0 1 NM_029816 hypothetical protein LOC76964 1 0 1 NM_024271 hypothetical protein LOC76413 1 0 1 NM_025956 hypothetical protein LOC67082 1 0 1 NM_011658 twist gene homolog 1 1 0 1 NM_144799 LIM and cysteine-rich domains 1 1 0 1 NM_007701 visual system homeobox 2 1 0 1 NM_009878 cyclin-dependent kinase inhibitor 2D 1 0 0 NM_001033246 coiled-coil domain containing 110 1 0 0 NM_013465 alpha-2-HS-glycoprotein 1 0 0 NM_026134 cylicin basic protein of sperm head 1 0 0 NM_018741 insulin-like growth factor binding protein-like 1 0 0 NM_029655 sorting nexin 7 1 0 0 NM_146255 solute carrier family 1 glutamate transporter 1 0 0 NM_011285 retinitis pigmentosa GTpase regulator 1 0 0 NM_172801 otopetrin 2 1 0 0 NM_178893 coronin actin binding protein 2A 1 0 0 NM_145437 leukocyte mono-Ig-like receptor 4 1 0 0 NM_009571 zinc finger protein 2 Y linked 1 0 0 NM_021478 tubby like protein 1 1 0 0 NM_026433 transmembrane protein 100 1 0 0 NM_010933 natriuretic peptide precursor type C 1 0 0 NM_001112698 nerve growth factor beta isoform B 1 0 0 NM_021285 fast skeletal myosin alkali light chain 1 1 0 0 NM_019394 melanoma inhibitory activity 1 1 0 0 NM_175730 homeobox C5 1 0 0 NM_028979 cytochrome P450 family 2, subfamily j, 1 0 0 NM_029939 hypothetical protein LOC77609 1 0 0 NM_138581 hypothetical protein LOC27660 1 0 0 NM_001099323 zinc finger with KRAB and SCAN domains 16 1 0 0 NM_011719 wingless-type MMTV integration site 9B 1 0 0 NM_080856 ankyrin repeat and SOCS box-containing 14 1 0 0 NM_145594 fibrinogen-like protein 1 1 0 0 NM_027741 maestro 1 0 0 NM_001008785 T-cell activation kelch repeat protein isoform 1 0 0 NM_013786 hydroxysteroid 17-beta dehydrogenase 9 1 0 0 NM_007972 coagulation factor X 1 0 0 NM_013470 annexin A3 1 0 0 NM_023279 tubulin beta 3 1 0 0 NM_175328 solute carrier family 6 member 15 1 0 0 NM_001080929 cerebellar degeneration-related protein 2-like 1 0 0 NM_183116 hypothetical protein LOC76306 1 0 0 NM_013690 endothelial-specific receptor tyrosine kinase 1 0 0 NM_198635 hypothetical protein LOC333669 1 0 0 NM_008486 alanyl membrane aminopeptidase 1 0 0 NM_207216 UDP glycosyltransferases 3 family polypeptide 1 0 0 NM_025453 transmembrane 4 L six family member 20 1 0 0 NM_011569 tektin 1 1 0 0 NM_199059 TATA box binding protein like 2 1 0 0 NM_009317 T-cell acute lymphocytic leukemia 2 1 0 0 NM_001009574 trace amine-associated receptor 5 1 0 0 NM_173377 seminal vesicle secretion 3 beta 1 0 0 NM_001033286 solute carrier family 30 member 10 1 0 0 NM_031194 solute carrier family 22 member 8 1 0 0 NM_027760 Ras association RalGDS/AF-6 domain family 8 1 0 0 NM_001085502 5'-nucleotidase cytosolic IA 1 0 0 NM_010894 neurogenic differentiation 1 1 0 0 NM_145379 G protein-coupled receptor MrgF 1 0 0 NM_001030289 matrix metalloproteinase 27 1 0 0 NM_008610 matrix metalloproteinase 2 1 0 0 NM_198250 leucine rich repeat containing 4B 1 0 0 NM_177142 lipase member I 1 0 0 NM_001081134 potassium voltage-gated channel subfamily G, 1 0 0 NM_021487 potassium voltage-gated channel Isk-related 1 0 0 NM_013712 integrin beta 1 binding protein 2 1 0 0 NM_027397 insulin related protein 2 islet 2 1 0 0 NM_010554 interleukin 1 alpha 1 0 0 NM_001033459 hypothetical protein LOC381667 1 0 0 NM_008103 glial cells missing homolog 1 1 0 0 NM_181548 ES cell-expressed Ras 1 0 0 NM_144848 epiplakin 1 1 0 0 NM_010112 embryonal Fyn-associated substrate 1 0 0 NM_007815 cytochrome P450 family 2, subfamily c, 1 0 0 NM_001033784 coiled-coil domain containing 13 1 0 0 NM_175020 hypothetical protein LOC232717 1 0 0 NM_001001185 cDNA sequence BC048507 1 0 0 NM_001033785 A kinase PRKA anchor protein 14 1 0 0 NM_029638 amiloride binding protein 1 amine oxidase 1 0 0 NM_027074 hypothetical protein LOC69416 1 0 0 NM_021717 nuclear receptor interacting protein 2 1 0 0 NM_031166 inhibitor of DNA binding 4 1 0 0 NM_027964 zinc finger SWIM domain containing 2 1 0 0 NM_177354 vasohibin 1 1 0 0 NM_013834 secreted frizzled-related protein 1 1 0 0 NM_016798 PDZ and LIM domain 3 1 0 0 NM_172908 ovochymase 2 precursor 1 0 0 NM_177068 olfactomedin-like 2B 1 0 0 NM_010924 nicotinamide N-methyltransferase 1 0 0 NM_153101 MAS-related GPR member A2 1 0 0 NM_175271 G protein-coupled receptor 23 1 0 0 NM_153601 glutamate-ammonia ligase glutamine synthase 1 0 0 NM_001024230 hypothetical protein LOC432555 1 0 0 NM_028615 developmental pluripotency-associated 2 1 0 0 NM_010516 cysteine rich protein 61 1 0 0 NM_010004 cytochrome P450 family 2, subfamily c, 1 0 0 NM_017474 chloride channel calcium activated 3 1 0 0 NM_172553 ALX homeobox 1 1 0 0 NM_011921 aldehyde dehydrogenase family 1 subfamily A7 1 0 0 NM_031884 ATP-binding cassette subfamily G, member 5 1 0 0 NM_001081671 hypothetical protein LOC73347 1 0 0 NM_001034037 hypothetical protein LOC67085 1 0 0 NM_012016 endoplasmic reticulum ER to nucleus signalling 1 0 0 NM_009877 cyclin-dependent kinase inhibitor 2A isoform 1 1 0 0 NM_008217 hyaluronan synthase 3 1 0 0 NM_026222 coiled-coil domain containing 39 1 0 0 NM_009548 zinc finger protein 179 1 0 0 NM_023395 WAP four-disulfide core domain 1 1 0 0 NM_008817 paternally expressed 3 1 0 0 NM_172907 olfactomedin-like 1 1 0 0 NM_008644 mucin 10 1 0 0 NM_013593 myoglobin 1 0 0 NM_028957 hyaluronoglucosaminidase 5 1 0 0 NM_001007461 gasdermin 3 1 0 0 NM_145831 terra 1 0 0 NM_177036 CEA-related cell adhesion molecule 19 1 0 0 NM_146174 hypothetical protein LOC232748 1 0 0 NM_009699 aquaporin 2 1 0 0 NM_172641 hypothetical protein LOC226245 1 0 0 NM_177839 tenascin N 1 0 0 NM_134127 cytochrome P450 family 4, subfamily f, 1 0 0 NM_009922 calponin 1 1 0 0 NM_199221 CD300 antigen like family member B 1 0 0 NM_177397 ATPase H+ transporting, lysosomal V1 subunit 1 0 0 NM_029306 hypothetical protein LOC69325 1 0 0 NM_145389 hypothetical protein LOC212998 1 0 0 NM_020026 UDP-GalNAc:betaGlcNAc beta 1 0 0 NM_001004145 NLR family pyrin domain containing 4G 1 0 0 NM_181596 resistin-like gamma 1 0 0 NM_023597 spermatid WD-repeat protein 1 0 0 NM_009114 S100 calcium binding protein A9 calgranulin B 1 0 0 NM_134022 hypothetical protein LOC103712 1 0 0 NM_029781 RAB36 member RAS oncogene family 1 0 0 NM_009876 cyclin-dependent kinase inhibitor 1C P57 1 0 0 NM_001105160 cytochrome P450 family 3, subfamily a, 1 0 0 NM_001001492 Leber congenital amaurosis 5-like 1 0 0 NM_001113327 hypothetical protein LOC76156 isoform b 1 0 0 NM_001104539 vomeronasal receptor Vmn2r90 1 0 0 NM_022414 neuroglobin 1 0 0 NM_019985 C-type lectin domain family 1 member b 1 0 0 NM_009138 chemokine C-C motif ligand 25 1 0 0 NM_009198 solute carrier family 17 sodium phosphate 1 0 0 NM_181858 CD59b antigen 1 0 0 NM_001029929 zinc finger MYND-type containing 15 1 0 0 NM_009576 zinc finger protein of the cerebellum 4 1 0 0 NM_011765 zinc finger protein 97 1 0 0 NM_175480 zinc finger protein 612 1 0 0 NM_009554 zinc finger protein 37 1 0 0 NM_028325 zinc finger CCHC domain containing 12 1 0 0 NM_001111293 X-linked lymphocyte-regulated 5B 1 0 0 NM_139298 wingless-type MMTV integration site 9A 1 0 0 NM_009520 wingless related MMTV integration site 2b 1 0 0 NM_026323 WAP four-disulfide core domain 2 1 0 0 NM_001039501 WAP four-disulfide core domain 10 1 0 0 NM_001103366 vomeronasal receptor Vmn2r87 1 0 0 NM_001105190 vomeronasal receptor Vmn2r79 1 0 0 NM_001105060 vomeronasal receptor Vmn2r63 1 0 0 NM_001104648 vomeronasal receptor Vmn2r56 1 0 0 NM_198961 vomeronasal 2 receptor 43 1 0 0 NM_001104614 vomeronasal receptor Vmn2r3 1 0 0 NM_001104632 vomeronasal receptor Vmn2r19 1 0 0 NM_001104628 vomeronasal receptor Vmn2r17 1 0 0 NM_001104627 vomeronasal receptor Vmn2r16 1 0 0 NM_001104579 vomeronasal receptor Vmn2r115 1 0 0 NM_001102584 vomeronasal receptor Vmn2r114 1 0 0 NM_001104573 vomeronasal receptor Vmn2r111 1 0 0 NM_001104569 vomeronasal 2 receptor 107 1 0 0 NM_001104562 vomeronasal receptor Vmn2r100 1 0 0 NM_139307 vasorin 1 0 0 NM_134230 vomeronasal 1 receptor E11 1 0 0 NM_030738 vomeronasal 1 receptor D6 1 0 0 NM_009474 urate oxidase 1 0 0 NM_178671 UBX domain containing 3 1 0 0 NM_001033773 ubiquitin-conjugating enzyme E2U putative 1 0 0 NM_181591 thioredoxin domain containing 3 spermatozoa 1 0 0 NM_177709 tumor suppressor candidate 5 1 0 0 NM_001081228 tetratricopeptide repeat domain 30A2 1 0 0 NM_177667 tetratricopeptide repeat domain 22 1 0 0 NM_153097 tripartite motif-containing 60 1 0 0 NM_031172 tripartite motif protein 17 1 0 0 NM_022322 tenomodulin 1 0 0 NM_011608 tumor necrosis factor receptor superfamily 1 0 0 NM_029537 transmembrane protein 98 1 0 0 NM_025915 transmembrane protein 88 1 0 0 NM_027865 transmembrane protein 25 1 0 0 NM_026685 transmembrane protein 174 1 0 0 NM_205819 toll-like receptor 11 1 0 0 NM_025416 thioesterase superfamily member 5 1 0 0 NM_009363 trefoil factor 2 1 0 0 NM_025687 testis expressed gene 12 1 0 0 NM_011902 tektin 2 1 0 0 NM_021480 L-threonine dehydrogenase 1 0 0 NM_018756 2-cell-stage variable group, member 1 1 0 0 NM_013773 T-cell leukemia/lymphoma 1B 1 1 0 0 NM_145224 T-box 22 isoform 1 1 0 0 NM_001001320 T-box 10 isoform 1 1 0 0 NM_181275 taste receptor type 2, member 139 1 0 0 NM_053205 trace amine-associated receptor 1 1 0 0 NM_018802 synaptotagmin VIII 1 0 0 NM_021363 seminal vesicle secretion 3 alpha 1 0 0 NM_172888 seminal vesicle-secreted protein I 1 0 0 NM_020564 sulfotransferase family 5A member 1 1 0 0 NM_018751 sulfotransferase family cytosolic, 1C, member 1 0 0 NM_001077591 serine/threonine kinase 22 substrate 1 isoform 1 0 0 NM_054098 STEAP family member 4 1 0 0 NM_009218 somatostatin receptor 3 1 0 0 NM_183136 serine protease inhibitor Kazal type 8 1 0 0 NM_133711 spermatogenesis related gene 2 1 0 0 NM_029299 spermatogenesis associated 19 1 0 0 NM_026293 sperm acrosome associated 1 1 0 0 NM_009237 SRY-box containing gene 3 1 0 0 NM_020049 solute carrier family 6 neurotransmitter 1 0 0 NM_133254 solute carrier family 5 sodium/glucose 1 0 0 NM_011397 solute carrier family 23 nucleobase 1 0 0 NM_020516 solute carrier family 16 member 8 1 0 0 NM_146136 solute carrier family 16 member 4 1 0 0 NM_153081 solute carrier family 16 member 11 1 0 0 NM_011388 solute carrier family 10 member 2 1 0 0 NM_011384 sine oculis-related homeobox 6 homolog 1 0 0 NM_011380 sine oculis-related homeobox 2 homolog 1 0 0 NM_011367 sex hormone binding globulin 1 0 0 NM_008223 serine or cysteine proteinase inhibitor clade 1 0 0 NM_173052 serine or cysteine proteinase inhibitor clade 1 0 0 NM_144834 serine or cysteine proteinase inhibitor clade 1 0 0 NM_026907 secreted and transmembrane 1B 1 0 0 NM_146013 SEC14 S. cerevisiae-like 2 1 0 0 NM_145565 serine dehydratase 1 0 0 NM_153100 receptor transporter protein 3 1 0 0 NM_009100 repetin 1 0 0 NM_001033489 ring finger protein 207 1 0 0 NM_183032 ribonuclease RNase A family, 9 non-active 1 0 0 NM_001040089 reproductive homeobox 3F 1 0 0 NM_198598 reproductive homeobox on X chromosome 11 1 0 0 NM_021340 retinal G protein coupled receptor 1 0 0 NM_020509 resistin like alpha 1 0 0 NM_181989 retinal short chain dehydrogenase reductase 2 1 0 0 NM_176971 RAB9B member RAS oncogene family 1 0 0 NM_009184 PTK6 protein tyrosine kinase 6 1 0 0 NM_007677 pregnancy specific glycoprotein 17 1 0 0 NM_007676 pregnancy specific glycoprotein 16 1 0 0 NM_053259 protease serine, 28 1 0 0 NM_020487 protease serine, 21 1 0 0 NM_021400 proteoglycan 4 isoform 1 1 0 0 NM_001001319 preferentially expressed antigen in melanoma 1 0 0 NM_029948 PRAME family member 12 1 0 0 NM_008919 pancreatic polypeptide receptor 1 1 0 0 NM_172874 podocan 1 0 0 NM_175498 paraneoplastic antigen MA2 1 0 0 NM_011126 palate lung, and nasal epithelium clone 1 0 0 NM_053191 peptidase inhibitor 15 1 0 0 NM_021453 pepsinogen 5 group I 1 0 0 NM_019540 pore forming protein-like 1 0 0 NM_001042726 protocadherin 8 isoform 2 1 0 0 NM_130878 protocadherin 21 1 0 0 NM_001039223 hypothetical protein LOC623781 1 0 0 NM_001103158 hypothetical protein LOC100041379 1 0 0 NM_001007077 hypothetical protein LOC194227 1 0 0 NM_177865 skint 2 1 0 0 NM_001076790 hypothetical protein LOC238568 1 0 0 NM_001039115 zinc finger protein 306-like 1 0 0 NM_011021 orthopedia homolog 1 0 0 NM_013623 orosomucoid 3 1 0 0 NM_011016 orosomucoid 2 1 0 0 NM_001011785 olfactory receptor 987 1 0 0 NM_146854 olfactory receptor 982 1 0 0 NM_146514 olfactory receptor 96 1 0 0 NM_001011813 olfactory receptor 93 1 0 0 NM_146423 olfactory receptor 887 1 0 0 NM_146798 olfactory receptor 878 1 0 0 NM_146670 olfactory receptor 815 1 0 0 NM_146929 olfactory receptor 807 1 0 0 NM_146551 olfactory receptor 788 1 0 0 NM_001011738 olfactory receptor 744 1 0 0 NM_001011809 olfactory receptor 728 1 0 0 NM_146494 olfactory receptor 722 1 0 0 NM_146959 olfactory receptor 631 1 0 0 NM_147098 olfactory receptor 630 1 0 0 NM_147099 olfactory receptor 616 1 0 0 NM_147115 olfactory receptor 578 1 0 0 NM_147041 olfactory receptor 57 1 0 0 NM_147091 olfactory receptor 568 1 0 0 NM_146325 olfactory receptor 554 1 0 0 NM_001011815 olfactory receptor 533 1 0 0 NM_146310 olfactory receptor 493 1 0 0 NM_146411 olfactory receptor 462 1 0 0 NM_146273 olfactory receptor 448 1 0 0 NM_146656 olfactory receptor 444 1 0 0 NM_147024 olfactory receptor 378 1 0 0 NM_001011770 olfactory receptor 332 1 0 0 NM_146879 olfactory receptor 330 1 0 0 NM_146620 olfactory receptor 292 1 0 0 NM_001011808 olfactory receptor 198 1 0 0 NM_146485 olfactory receptor 183 1 0 0 NM_020513 odorant receptor MOR10 1 0 0 NM_146313 olfactory receptor 145 1 0 0 NM_001011775 olfactory receptor 1419 1 0 0 NM_146308 olfactory receptor 1356 1 0 0 NM_147042 olfactory receptor 1353 1 0 0 NM_207703 olfactory receptor 1335 1 0 0 NM_206816 olfactory receptor 128 1 0 0 NM_146892 olfactory receptor 1223 1 0 0 NM_147013 olfactory receptor 1038 1 0 0 NM_001011872 olfactory receptor 1034 1 0 0 NM_207149 olfactory receptor 1010 1 0 0 NM_146572 olfactory receptor 1009 1 0 0 NM_145746 outer dense fiber of sperm tails 4 1 0 0 NM_027019 shippo 1 1 0 0 NM_008754 odorant binding protein Ia 1 0 0 NM_145153 2'-5'oligoadenylate synthetase 1F 1 0 0 NM_010934 neuropeptide Y receptor Y1 1 0 0 NM_181345 nucleophosmin/nucleoplasmin 2 1 0 0 NM_172203 NADPH oxidase 1 1 0 0 NM_008711 noggin 1 0 0 NM_008703 neuromedin B receptor 1 0 0 NM_001004194 NLR family pyrin domain containing 4E 1 0 0 NM_009123 NK1 transcription factor related locus 2 1 0 0 NM_025684 nephrocan 1 0 0 NM_001098789 NADH dehydrogenase ubiquinone 1 alpha 1 0 0 NM_008671 nucleosome assembly protein 1-like 2 1 0 0 NM_008670 baculoviral IAP repeat-containing 1a 1 0 0 NM_021508 myozenin 1 1 0 0 NM_010866 myogenic differentiation 1 1 0 0 NM_175441 myosin light chain kinase 1 0 0 NM_010855 myosin heavy polypeptide 4, skeletal muscle 1 0 0 NM_016749 myosin binding protein H 1 0 0 NM_031188 major urinary protein 1 1 0 0 NM_008645 murinoglobulin 1 1 0 0 NM_008631 metallothionein 4 1 0 0 NM_013601 homeo box msh-like 2 1 0 0 NM_009074 macrophage stimulating 1 receptor 1 0 0 NM_175531 MAS-related GPR member B2 1 0 0 NM_020021 Moloney sarcoma oncogene 1 0 0 NM_010809 matrix metallopeptidase 3 1 0 0 NM_080453 matrix metalloproteinase 28 epilysin isoform 1 0 0 NM_008605 matrix metalloproteinase 12 1 0 0 NM_029993 melan-A 1 0 0 NM_013729 Mix1 homeobox-like 1 1 0 0 NM_153749 MHC I like leukocyte 1 1 0 0 NM_177321 melanoma inhibitory activity 2 1 0 0 NM_026243 UDP-N-acetylglucosamine: alpha-13-D-mannoside 1 0 0 NM_008570 mast cell protease 1 1 0 0 NM_008552 MAS1 oncogene 1 0 0 NM_010758 myelin-associated glycoprotein 1 0 0 NM_013590 lysozyme 1 1 0 0 NM_008524 lumican 1 0 0 NM_153388 leucine rich repeat and fibronectin type III 1 0 0 NM_010728 lysyl oxidase 1 0 0 NM_001085540 hypothetical protein LOC626943 1 0 0 NM_001024672 UbiE-YGHL1 fusion protein 1 0 0 NM_001085536 hypothetical protein LOC546849 1 0 0 NM_001081248 similar to arylacetamide deacetylase 1 0 0 NM_001109970 Xlr-related meiosis regulated Xmr 1 0 0 NM_025622 lectin galactose-binding, soluble 2 1 0 0 NM_029959 lipocalin 1 0 0 NM_001099774 keratin associated protein 17-1 1 0 0 NM_212487 keratin Kb40 1 0 0 NM_027983 keratin 33A 1 0 0 NM_010644 kallikrein 1-related petidase b26 1 0 0 NM_010640 kallikrein 1-related peptidase b11 1 0 0 NM_029013 kelch domain containing 6 1 0 0 NM_175429 potassium channel tetramerisation domain 1 0 0 NM_001030292 potassium channel subfamily K, member 15 1 0 0 NM_145963 potassium inwardly-rectifying channel J14 1 0 0 NM_019659 potassium inwardly-rectifying channel subfamily 1 0 0 NM_001081140 potassium voltage-gated channel shaker-related 1 0 0 NM_028202 kelch repeat and BTB POZ domain containing 5 1 0 0 NM_008406 inter-alpha trypsin inhibitor heavy chain 1 1 0 0 NM_027837 intestine specific homeobox 1 0 0 NM_018826 Iroquois related homeobox 5 1 0 0 NM_010573 Iroquois related homeobox 1 1 0 0 NM_172535 IQ motif and ubiquitin domain containing 1 0 0 NM_026090 IQ motif containing F4 1 0 0 NM_016971 interleukin 22 1 0 0 NM_033608 immunoglobulin superfamily member 9 1 0 0 NM_177591 immunoglobulin superfamily member 1 long 1 0 0 NM_008314 5-hydroxytryptamine receptor 5A 1 0 0 NM_008289 hydroxysteroid 11-beta dehydrogenase 2 1 0 0 NM_010460 homeo box B7 1 0 0 NM_008269 homeo box B6 1 0 0 NM_134032 homeo box B2 1 0 0 NM_010449 homeobox A1 1 0 0 NM_175074 high mobility group nucleosomal binding domain 3 1 0 0 NM_178210 histone cluster 1 H4j 1 0 0 NM_175663 histone cluster 1 H2ba 1 0 0 NM_018792 histone H1-like protein in spermatids 1 1 0 0 NM_008219 hemoglobin Z beta-like embryonic chain 1 0 0 NM_019545 hydroxyacid oxidase glycolate oxidase 3 1 0 0 NM_201611 histocompatibility 2 M region locus 10.6 1 0 0 NM_001033978 histocompatibility 2 class II antigen E beta2 1 0 0 NM_031378 gasdermin C1 1 0 0 NM_010351 goosecoid homeobox 1 0 0 NM_008177 gastrin releasing peptide receptor 1 0 0 NM_053118 G protein-coupled receptor family C, group 5, 1 0 0 NM_199058 G protein-coupled receptor 6 1 0 0 NM_175191 G protein-coupled receptor 22 1 0 0 NM_001033360 G protein-coupled receptor 101 1 0 0 NM_001033414 hypothetical protein LOC330004 1 0 0 NM_001033412 hypothetical protein LOC329839 1 0 0 NM_001033404 hypothetical protein LOC328695 1 0 0 NM_001111140 hypothetical protein LOC278795 1 0 0 NM_001033356 hypothetical protein LOC243967 1 0 0 NM_001018031 otolin-1 1 0 0 NM_001033452 hypothetical protein LOC381411 1 0 0 NM_001014997 killer cell lectin-like receptor subfamily H 1 0 0 NM_001001650 epidermis-specific serine protease-like 1 0 0 NM_145935 glycine-N-acyltransferase 1 0 0 NM_146020 glycolipid transfer protein domain containing 2 1 0 0 NM_001001496 gap junction protein alpha 6 1 0 0 NM_008110 growth differentiation factor 9 1 0 0 NM_028087 glucosaminyl N-acetyl transferase 3 mucin 1 0 0 NM_008100 glucagon 1 0 0 NM_008082 galanin receptor 1 1 0 0 NM_017369 gamma-aminobutyric acid GABA-A receptor 1 0 0 NM_008557 chloride conductance inducer protein MAT-8 1 0 0 NM_026286 ferritin mitochondrial 1 0 0 NM_001033469 forkhead box R1 1 0 0 NM_008242 forkhead box D1 1 0 0 NM_008030 flavin containing monooxygenase 3 1 0 0 NM_010218 four jointed box 1 1 0 0 NM_010204 fibroblast growth factor 6 1 0 0 NM_030610 fibroblast growth factor 20 1 0 0 NM_008004 fibroblast growth factor 17 1 0 0 NM_177703 F-box and WD-40 domain protein 19 1 0 0 NM_001033981 similar to hemoglobin theta 1 1 0 0 NM_010172 coagulation factor VII 1 0 0 NM_025276 envoplakin 1 0 0 NM_133867 epidermal growth factor receptor pathway 1 0 0 NM_177671 Eph receptor A10 1 0 0 NM_010131 empty spiracles homolog 1 1 0 0 NM_026419 elastase 3 pancreatic 1 0 0 NM_007914 ets homologous factor 1 0 0 NM_001039252 hypothetical protein LOC639653 1 0 0 NM_001099305 hypothetical protein LOC628456 1 0 0 NM_001037922 hypothetical protein LOC624855 1 0 0 NM_001034906 similar to tripartite motif-containing 43 1 0 0 NM_001024727 hypothetical protein LOC545952 1 0 0 NM_001024709 hypothetical protein LOC544710 1 0 0 NM_001033783 hypothetical protein LOC434396 1 0 0 NM_177701 hypothetical protein LOC235327 1 0 0 NM_183166 hypothetical protein LOC233164 1 0 0 NM_144511 esterase 31-like 1 0 0 NM_010107 ephrin A1 1 0 0 NM_007895 eosinophil-associated ribonuclease A family, 1 0 0 NM_053113 eosinophil-associated ribonuclease A family, 1 0 0 NM_177069 F-box domain containing protein 1 0 0 NM_001025384 hypothetical protein LOC574405 1 0 0 NM_181682 desmoglein 1 beta 1 0 0 NM_007873 double C2 beta 1 0 0 NM_010069 double C2 alpha 1 0 0 NM_019964 DnaJ homolog subfamily B, member 8 1 0 0 NM_008299 DnaJ Hsp40 homolog subfamily B, member 3 1 0 0 NM_181683 beta-defensin 37 1 0 0 NM_001037502 beta-defensin 28 1 0 0 NM_207276 beta-defensin 21 1 0 0 NM_027442 D-aspartate oxidase 1 0 0 NM_172928 doublecortin-like kinase 3 1 0 0 NM_001081106 cytokine like 1 1 0 0 NM_007823 cytochrome P450 family 4, subfamily b, 1 0 0 NM_177382 cytochrome P450 family 2, subfamily r, 1 0 0 NM_001081148 cytochrome P450 family 2, subfamily b, 1 0 0 NM_028593 cytochrome b reductase 1 1 0 0 NM_203320 chemokine C-X-C motif ligand 3 1 0 0 NM_011339 chemokine C-X-C motif ligand 15 1 0 0 NM_008176 chemokine C-X-C motif ligand 1 1 0 0 NM_022326 cathepsin M 1 0 0 NM_007800 cathepsin G preproprotein 1 0 0 NM_021445 cathepsin 6 1 0 0 NM_198858 cardiotrophin 2 1 0 0 NM_007795 cardiotrophin 1 1 0 0 NM_007786 casein kappa 1 0 0 NM_009972 casein beta 1 0 0 NM_007785 casein alpha s2-like A 1 0 0 NM_031402 cysteine-rich secretory protein LCCL domain 1 0 0 NM_009639 cysteine-rich secretory protein 3 1 0 0 NM_145493 complexin 4 1 0 0 NM_009946 complexin 2 1 0 0 NM_178669 clarin 3 1 0 0 NM_153197 dendritic cell inhibitory receptor 3 1 0 0 NM_001007223 C-type lectin domain family 3 member a 1 0 0 NM_030601 chloride channel calcium activated 2 1 0 0 NM_173385 cartilage intermediate layer protein nucleotide 1 0 0 NM_023850 carbohydrate keratan sulfate Gal-6 1 0 0 NM_145129 cholinergic receptor nicotinic, alpha 1 0 0 NM_007389 cholinergic receptor nicotinic, alpha 1 1 0 0 NM_007699 cholinergic receptor muscarinic 4 1 0 0 NM_027839 CEA-related cell adhesion molecule 20 1 0 0 NM_027210 CEA-related cell adhesion molecule 13 1 0 0 NM_133238 CD209a antigen 1 0 0 NM_007627 cholecystokinin B receptor 1 0 0 NM_026439 steroid-sensitive protein 1 1 0 0 NM_175631 cerebellin 4 precursor 1 0 0 NM_009808 caspase 12 1 0 0 NM_009802 carbonic anhydrase 6 1 0 0 NM_011797 carbonic anhydrase 14 1 0 0 NM_001110807 calpain 12 1 0 0 NM_144817 calcium/calmodulin-dependent protein kinase I 1 0 0 NM_001008706 calmodulin 5 1 0 0 NM_133183 voltage-dependent calcium channel gamma-6 1 0 0 NM_001081662 hypothetical protein LOC97476 1 0 0 NM_019959 C1q and tumor necrosis factor related protein 1 1 0 0 NM_177818 hypothetical protein LOC328505 1 0 0 NM_001033636 hypothetical protein LOC109294 1 0 0 NM_025631 bactericidal/permeability-increasing 1 0 0 NM_007559 bone morphogenetic protein 8b 1 0 0 NM_007554 bone morphogenetic protein 4 1 0 0 NM_007542 biglycan 1 0 0 NM_013479 Bcl2-like 10 1 0 0 NM_001001180 hypothetical protein LOC407812 1 0 0 NM_001001179 cDNA sequence BC048546 1 0 0 NM_001081369 hypothetical protein LOC270150 1 0 0 NM_001025575 complement factor H-related protein B 1 0 0 NM_146232 hypothetical protein LOC236149 1 0 0 NM_007519 bile acid-Coenzyme A: amino acid 1 0 0 NM_001081167 UDP-GlcNAc:betaGal 1 0 0 NM_020283 UDP-Gal:betaGlcNAc beta 1 0 0 NM_177280 hypothetical protein LOC320871 1 0 0 NM_001033793 hypothetical protein LOC546118 1 0 0 NM_001080965 aurora kinase C isoform a 1 0 0 NM_134157 ATPase H+ transporting, lysosomal V1 subunit 1 0 0 NM_146026 ATPase family AAA domain containing 4 1 0 0 NM_001039645 aspartate beta-hydroxylase domain containing 1 1 0 0 NM_009714 asialoglycoprotein receptor 1 1 0 0 NM_029569 ankyrin repeat and SOCs box-containing protein 1 0 0 NM_019915 ADP-ribosyltransferase 2b 1 0 0 NM_029799 arrestin domain containing 5 1 0 0 NM_133205 arrestin 3 retinal 1 0 0 NM_172520 Rho guanine nucleotide exchange factor GEF 19 1 0 0 NM_009701 aquaporin 5 1 0 0 NM_177744 apolipoprotein L 10a 1 0 0 NM_009675 amine oxidase copper containing 3 1 0 0 NM_011922 annexin A10 1 0 0 NM_028085 harmonin-interacting ankyrin-repeat containing 1 0 0 NM_028665 ankyrin repeat domain 42 1 0 0 NM_013913 angiopoietin-like 3 1 0 0 NM_145146 afamin 1 0 0 NM_011781 a disintegrin and metalloprotease domain 25 1 0 0 NM_007391 acrosomal vesicle protein 1 1 0 0 NM_134247 acyl-CoA thioesterase 4 1 0 0 NM_021370 amiloride-sensitive cation channel 5 1 0 0 NM_011994 ATP-binding cassette sub-family D, member 2 1 0 0 NM_021418 hypothetical protein LOC58229 1 0 0 NM_001077424 alpha-14-N-acetylglucosaminyltransferase 1 0 0 NM_177824 RIKEN cDNA 9830107B12 1 0 0 NM_001081651 RIKEN cDNA 9530096D07 1 0 0 NM_172524 hypothetical protein LOC214112 1 0 0 NM_001081289 hypothetical protein LOC71532 1 0 0 NM_001033157 hypothetical protein LOC236366 1 0 0 NM_183087 hypothetical protein LOC70638 1 0 0 NM_175017 hypothetical protein LOC232217 1 0 0 NM_027702 hypothetical protein LOC71162 1 0 0 NM_177901 hypothetical protein LOC330820 1 0 0 NM_177801 hypothetical protein LOC328019 1 0 0 NM_172534 hypothetical protein LOC214604 1 0 0 NM_183111 hypothetical protein LOC75258 1 0 0 NM_026291 hypothetical protein LOC67646 1 0 0 NM_026263 hypothetical protein LOC67593 1 0 0 NM_001100394 hypothetical protein LOC75087 1 0 0 NM_029053 hypothetical protein LOC74685 1 0 0 NM_025723 hypothetical protein LOC66715 1 0 0 NM_001009544 PHD finger protein 8 1 0 0 NM_175497 hypothetical protein LOC238880 1 0 0 NM_001081314 hypothetical protein LOC75697 1 0 0 NM_028455 Rho GTPase activating protein 8 1 0 0 NM_178399 hypothetical protein LOC76982 1 0 0 NM_001101431 hypothetical protein LOC70291 1 0 0 NM_172417 hypothetical protein LOC74183 1 0 0 NM_172411 hypothetical protein LOC71874 1 0 0 NM_027087 hypothetical protein LOC69464 1 0 0 NM_025620 2210417D09Rik protein 1 0 0 NM_027363 calcineurin B homologous protein 2 1 0 0 NM_029680 hypothetical protein LOC76627 1 0 0 NM_028494 hypothetical protein LOC73297 1 0 0 NM_182745 hypothetical protein LOC76421 1 0 0 NM_001033162 hypothetical protein LOC71836 1 0 0 NM_029821 HIU hydrolase 1 0 0 NM_001113558 hypothetical protein LOC68527 isoform b 1 0 0 NM_183249 WDNM1-like protein 1 0 0 NM_024449 sclerostin 1 0 0 NM_009160 surfactant associated protein D 1 0 0 NM_022881 regulator of G-protein signaling 18 1 0 0 NM_023129 phospholamban 1 0 0 NM_172446 transcriptional corepressor Corl1 1 0 0 NM_024406 fatty acid binding protein 4 adipocyte 1 0 0 NM_015779 neutrophil elastase 1 0 0 NM_145592 dickkopf homolog 4 1 0 0 NM_027022 chemokine-like factor super family 2A 1 0 0 NM_009893 chordin 1 0 0 NM_009052 brain expressed X-linked 1 1 0 0 NM_007526 BarH-like homeobox 1 1 0 0 NM_007443 alpha 1 microglobulin/bikunin 1 0 0 NM_009654 albumin 1 0 0 NM_009621 a disintegrin-like and metalloprotease 0 54848 4 NM_008630 metallothionein 2 0 1837 66 NM_001111099 cyclin-dependent kinase inhibitor 1A P21 0 1354 5 NM_013542 granzyme B 0 895 20 NM_021397 repressor of GATA 0 713 4 NM_001080815 gastric inhibitory polypeptide receptor 0 543 21 NM_008147 glycoprotein 49 A 0 309 179 NM_031395 synaptotagmin-like 3 isoform a 0 453 2 NM_147776 von Willebrand factor A domain-related protein 0 348 1 NM_178241 interleukin 8 receptor alpha 0 322 21 NM_013532 leukocyte immunoglobulin-like receptor 0 326 4 NM_001004174 hypothetical protein LOC433470 0 325 0 NM_207279 phosphatidylinositol-specific phospholipase C X 0 319 0 NM_009137 chemokine C-C motif ligand 22 0 275 0 NM_008355 interleukin 13 0 273 0 NM_010548 interleukin 10 0 253 1 NM_026358 ovary-specific acidic protein 0 250 0 NM_029662 major facilitator superfamily domain containing 0 241 2 NM_178653 saccharopine dehydrogenase putative 0 202 9 NM_008520 latent transforming growth factor beta binding 0 211 0 NM_001113548 ADAMTS-like 5 isoform 1 0 204 2 NM_008485 laminin gamma 2 0 73 129 NM_177716 hypothetical protein LOC239650 0 200 0 NM_009828 cyclin A2 0 191 0 NM_026976 Fas apoptotic inhibitory molecule 0 187 1 NM_009947 copine VI 0 184 2 NM_007720 chemokine C-C motif receptor 8 0 182 0 NM_011831 insulin-like 5 0 181 0 NM_028416 kringle-containing transmembrane protein 2 0 176 1 NM_009778 complement component 3 0 157 19 NM_026410 cell division cycle associated 5 0 150 16 NM_009916 chemokine C-C motif receptor 4 0 129 32 NM_010740 CD93 antigen 0 116 24 NM_010564 inhibin alpha 0 112 1 NM_033475 RAB34 member of RAS oncogene family 0 112 0 NM_013652 chemokine C-C motif ligand 4 0 106 5 NM_021283 interleukin 4 0 106 0 NM_001033264 glutaminase 2 liver mitochondrial 0 80 23 NM_175653 histone cluster 1 H3c 0 72 29 NM_138653 B-box and SPRY domain containing 0 99 1 NM_145392 Bcl2-associated athanogene 2 0 89 7 NM_009387 thymidine kinase 1 0 79 17 NM_023824 progestin and adipoQ receptor family member IV 0 89 3 NM_009430 protease serine, 2 0 91 0 NM_026929 ChaC cation transport regulator-like 1 0 84 7 NM_028189 UDP-GlcNAc:betaGal 0 90 0 NM_010959 oncoprotein-induced transcript 3 0 88 0 NM_175012 gastrin releasing peptide 0 76 10 NM_011496 aurora kinase B 0 85 1 NM_028006 epsilon-tubulin 1 0 61 18 NM_172659 solute carrier family 2 facilitated glucose 0 72 6 NM_176834 ring finger protein 208 0 76 0 NM_144526 hypothetical protein LOC109212 0 31 43 NM_010177 Fas ligand TNF superfamily member 6 0 67 5 NM_009968 crystallin zeta 0 66 0 NM_009763 bone marrow stromal cell antigen 1 0 63 0 NM_144847 nuclear receptor binding protein 2 0 47 16 NM_013694 transition protein 2 0 62 1 NM_010415 heparin-binding EGF-like growth factor 0 62 0 NM_028331 C1q and tumor necrosis factor related protein 6 0 52 0 NM_031380 follistatin-like 3 0 45 2 NM_008169 glutamate receptor ionotropic, NMDA1 zeta 1 0 43 4 NM_016904 CDC28 protein kinase 1b 0 11 36 NM_178596 gap junction membrane channel protein chi 1 0 40 6 NM_133198 liver glycogen phosphorylase 0 44 1 NM_001014976 extra spindle poles-like 1 0 39 2 NM_011228 RAB33A member of RAS oncogene family 0 40 0 NM_019738 p8 protein 0 30 9 NM_173762 centromere protein E 0 19 20 NM_183224 TAFA3 protein 0 34 5 NM_010170 coagulation factor II thrombin receptor-like 0 38 1 NM_010313 guanine nucleotide-binding protein beta-5 0 38 0 NM_153776 hole protein 0 38 0 NM_001081085 hypothetical protein LOC72080 0 5 32 NM_054037 secretoglobin family 3A, member 1 type A 0 37 1 NM_001002927 preproenkephalin 1 0 2 34 NM_008510 chemokine C motif ligand 1 0 36 0 NM_080850 PAS domain containing serine/threonine kinase 0 34 0 NM_024413 pleckstrin homology domain containing family F 0 34 0 NM_197959 hypothetical protein LOC70218 0 1 33 NM_008651 myeloblastosis oncogene-like 1 0 23 11 NM_007537 Bcl2-like 2 0 33 0 NM_177900 brain link protein 2 0 16 17 NM_026656 mucolipin 2 isoform 1 0 32 0 NM_008506 lung carcinoma myc related oncogene 1 0 0 31 NM_011329 chemokine C-C motif ligand 1 0 30 0 NM_017405 lipolysis stimulated lipoprotein receptor 0 30 0 NM_001003405 Tesp4 protein 0 29 0 NM_008113 Rho GDP dissociation inhibitor GDI gamma 0 16 12 NM_028716 PHD finger protein 19 0 28 0 NM_010473 histidine rich calcium binding protein 0 28 0 NM_008675 neuroblastoma suppression of tumorigenicity 1 0 27 1 NM_019656 tetraspanin 6 0 27 0 NM_013912 apelin 0 27 0 NM_008871 serine or cysteine proteinase inhibitor clade 0 27 0 NM_182694 gametogenetin isoform 1 0 26 0 NM_016662 Max dimerization protein 3 0 26 0 NM_172453 PIF1 homolog 0 1 25 NM_175682 hypothetical protein LOC319259 0 23 3 NM_010316 guanine nucleotide binding protein G protein 0 25 0 NM_177583 anterior pharynx defective 1b homolog 0 22 3 NM_009954 breast cancer anti-estrogen resistance 1 0 22 3 NM_010558 interleukin 5 0 10 14 NM_009482 undifferentiated embryonic cell transcription 0 24 0 NM_001081399 protease serine, 33 0 0 24 NM_007490 ADP-ribosyltransferase 2a 0 16 8 NM_175486 hypothetical protein LOC235599 0 1 22 NM_170684 copine 7 protein 0 16 7 NM_009255 serine or cysteine proteinase inhibitor clade 0 15 8 NM_053088 interferon induced transmembrane protein 5 0 5 17 NM_024441 heat shock protein 2 0 22 0 NM_175096 starch binding domain 1 0 19 2 NM_011383 sine oculis-related homeobox 5 homolog 0 19 2 NM_178389 galactose-4-epimerase UDP 0 20 1 NM_009862 cell division cycle 45 homolog S. 0 2 19 NM_001080810 hypothetical protein LOC328918 0 17 4 NM_009445 Ttk protein kinase isoform 1 0 7 14 NM_172685 calcium-binding transporter 0 20 0 NM_009004 kinesin family member 20A 0 20 0 NM_001036740 UDP-Gal:betaGal beta 13-galactosyltransferase 0 13 8 NM_001083322 NKG2-D isoform b 0 19 0 NM_183124 beta-defensin 41 0 19 0 NM_176913 dipeptidase 2 0 19 0 NM_030063 acyl-Coenzyme A binding domain containing 7 0 11 9 NM_177337 ADP-ribosylation factor-like 11 0 18 1 NM_010388 histocompatibility 2 class II, locus Mb2 0 5 13 NM_007679 CCAAT/enhancer binding protein delta 0 18 0 NM_011522 synaptogyrin 3 0 18 0 NM_026950 OCIA domain containing 2 0 18 0 NM_029529 solute carrier family 35 member D3 0 14 4 NM_213729 inhibitor of CDK interacting with cyclin A1 0 5 12 NM_028849 claudin domain containing 2 0 17 0 NM_198664 TBC1 domain family member 2 0 17 0 NM_013639 peripherin 0 1 16 NM_001033292 espin-like 0 15 2 NM_007805 cytochrome b-561 0 11 6 NM_026515 hypothetical protein LOC68026 0 12 5 NM_145450 hypothetical protein LOC217887 0 1 15 NM_183424 P518 precursor 0 16 0 NM_183318 retrotransposon gag domain containing 4 0 16 0 NM_001033158 RAS-like family 12 0 16 0 NM_145530 ras homolog gene family member V 0 16 0 NM_145829 N-acetylglutamate synthase isoform 1 0 9 8 NM_133759 zinc finger and BTB domain containing 3 0 0 16 NM_001025602 interleukin 1 receptor-like 1 isoform a 0 11 5 NM_009393 troponin C cardiac/slow skeletal 0 9 7 NM_021472 ribonuclease RNase A family 4 0 15 0 NM_027476 zinc finger DHHC domain containing 24 0 15 0 NM_198108 hypothetical protein LOC226123 0 14 1 NM_001005511 lemur tyrosine kinase 3 0 5 9 NM_001033525 potassium inwardly-rectifying channel subfamily 0 13 2 NM_021467 troponin I skeletal, slow 1 0 14 0 NM_175105 aquaporin 11 0 14 0 NM_009404 tumor necrosis factor ligand superfamily 0 14 0 NM_011923 angiopoietin-like 2 0 11 3 NM_172578 expressed sequence C79407 0 10 4 NM_011764 zinc finger protein 90 0 0 13 NM_001033878 vomeronasal receptor Vmn2r66 0 0 13 NM_001039160 very large inducible GTPase 1 0 7 7 NM_146030 pleckstrin homology domain containing family H 0 13 0 NM_001033284 hypothetical protein LOC226527 0 13 0 NM_030880 protein kinase C and casein kinase substrate in 0 13 0 NM_007515 solute carrier family 7 cationic amino acid 0 5 8 NM_001013749 transmembrane protein 151B 0 11 2 NM_026100 Tctex1 domain containing 1 0 10 3 NM_009015 RAD54 like 0 1 11 NM_028908 hypothetical protein LOC74393 0 9 4 NM_178184 histone cluster 1 H2an 0 9 4 NM_133818 hypothetical protein LOC98404 0 0 12 NM_011332 chemokine C-C motif ligand 17 0 8 5 NM_008087 growth arrest specific 2 0 12 0 NM_007900 ect2 oncogene 0 12 0 NM_028404 DNA topoisomerase 1 mitochondrial 0 12 0 NM_026955 hypothetical protein LOC69137 0 12 0 NM_001113179 budding uninhibited by benzimidazoles 1 homolog 0 11 1 NM_008815 ets variant gene 4 E1A enhancer binding 0 11 1 NM_001111060 CD59a antigen 0 9 3 NM_013888 DnaJ Hsp40 homolog subfamily C, member 12 0 8 4 NM_026228 solute carrier family 39 metal ion 0 5 6 NM_013529 glutamine fructose-6-phosphate transaminase 2 0 11 0 NM_010244 Friend virus susceptibility 1 b allele 0 11 0 NM_026677 RAS-associated protein RAB13 0 11 0 NM_176848 F-box protein 2 0 11 0 NM_027773 whn-dependent transcript 3 0 11 0 NM_172492 leucine-rich repeats and transmembrane domains 0 11 0 NM_007427 agouti related protein 0 11 0 NM_183288 hypothetical protein LOC70559 0 11 0 NM_027222 hypothetical protein LOC69816 0 11 0 NM_023209 PDZ binding kinase 0 10 1 NM_008428 potassium inwardly-rectifying channel J8 0 10 1 NM_019517 beta-site APP-cleaving enzyme 2 0 1 9 NM_175431 hypothetical protein LOC207921 0 9 2 NM_011171 protein C receptor endothelial 0 0 10 NM_028968 interferon induced transmembrane protein 7 0 8 3 NM_023645 KDEL Lys-Asp-Glu-Leu containing 1 0 8 3 NM_007803 cortactin 0 8 3 NM_010744 transmembrane emp24 domain containing 1 0 10 0 NM_013822 jagged 1 0 10 0 NM_009204 solute carrier family 2 facilitated glucose 0 10 0 NM_019410 profilin 2 0 10 0 NM_010664 keratin 18 0 2 8 NM_178679 zinc finger protein 365 0 1 9 NM_009577 zinc finger protein interacting with K protein 0 9 1 NM_010423 hairy/enhancer-of-split related with YRPW motif 0 8 2 NM_177384 tetratricopeptide repeat domain 16 0 4 5 NM_146009 centrosomal protein 290 0 3 6 NM_177366 G protein-coupled receptor 157 0 3 6 NM_001039720 RIKEN cDNA 9030619P08 0 3 6 NM_177056 transmembrane protein 198 0 2 7 NM_001039242 membrane-associated ring finger C3HC4 10 0 9 0 NM_029352 dual specificity phosphatase 9 0 1 8 NM_007765 collapsin response mediator protein 1 0 0 9 NM_019432 transmembrane protein 37 0 7 2 NM_021482 synaptogyrin 4 0 8 1 NM_016785 thiopurine methyltransferase 0 8 1 NM_019832 G kinase anchoring protein 1 0 8 1 NM_022415 prostaglandin E synthase 0 8 1 NM_146007 collagen type VI, alpha 2 0 5 3 NM_177883 hypothetical protein LOC330323 0 5 3 NM_011270 Rh blood group D antigen 0 1 7 NM_177303 neuronal leucine rich repeat-4 0 8 0 NM_145825 centrin 4 0 8 0 NM_027945 citrate synthase-like protein 0 8 0 NM_009104 ribonucleotide reductase M2 0 8 0 NM_001012396 protein tyrosine phosphatase-like proline 0 8 0 NM_013892 proprotein convertase subtilisin/kexin type 1 0 8 0 NM_029972 ermin ERM-like protein 0 8 0 NM_028623 cystatin E/M 0 8 0 NM_027828 hypothetical protein LOC104943 0 0 8 NM_011851 5' nucleotidase ecto 0 7 1 NM_198214 syntaphilin 0 7 1 NM_146227 testes-specific protease 50 0 7 1 NM_153503 ring finger protein 113A1 0 7 1 NM_153513 hypothetical protein LOC229600 0 7 1 NM_018731 ATPase H+/K+ exchanging, gastric, alpha 0 5 2 NM_001002012 heat shock protein 2 0 4 3 NM_009917 chemokine C-C motif receptor 5 0 4 3 NM_001080995 hypothetical protein LOC74041 0 0 7 NM_146017 gamma-aminobutyric acid GABA-A receptor pi 0 0 7 NM_022884 betaine-homocysteine methyltransferase 2 0 0 7 NM_172580 acyl-CoA thioesterase 6 0 7 0 NM_019820 cerebellin 3 precursor protein 0 7 0 NM_028878 solute carrier family 6 member 19 0 7 0 NM_178381 transmembrane protein 16J 0 7 0 NM_001081264 asparagine-linked glycosylation 6 homolog 0 7 0 NM_020047 tumor-associated calcium signal transducer 2 0 7 0 NM_019414 selenium binding protein 2 0 7 0 NM_139292 polyposis locus protein 1-like 1 0 7 0 NM_194059 nanos homolog 3 0 7 0 NM_201531 potassium voltage-gated channel subfamily F, 0 7 0 NM_028001 JP-45 protein 0 7 0 NM_021782 interleukin 21 0 7 0 NM_001012402 heparan sulfate glucosamine 0 7 0 NM_175668 G protein-coupled receptor 4 0 7 0 NM_052992 phospholemman precursor 0 7 0 NM_009912 chemokine C-C motif receptor 1 0 7 0 NM_028974 hypothetical protein LOC74492 0 5 1 NM_053084 tripartite motif protein 32 0 5 1 NM_001033478 hypothetical protein LOC384198 0 5 1 NM_144939 fibroblast growth factor receptor substrate 3 0 5 1 NM_001039494 hypothetical protein LOC67077 0 5 1 NM_011889 septin 3 0 2 4 NM_029321 tetratricopeptide repeat domain 32 0 2 4 NM_019687 solute carrier family 22 member 4 0 2 4 NM_010739 mucin 13 epithelial transmembrane 0 3 3 NM_212445 KDEL Lys-Asp-Glu-Leu containing 2 protein 0 3 3 NM_198322 zinc finger protein 273 0 1 5 NM_001111030 activin receptor-like kinase 7 isoform 1 0 0 6 NM_175647 doublesex and mab-3 related transcription factor 0 0 6 NM_009405 troponin I skeletal, fast 2 0 0 6 NM_028443 hypothetical protein LOC73121 0 0 6 NM_027283 Rsb-66 protein 0 5 0 NM_001033540 hypothetical protein B430201F14 0 5 0 NM_183307 coiled-coil domain containing 63 0 5 0 NM_009627 adrenomedullin 0 5 0 NM_146173 tetraspanin 33 0 5 0 NM_198003 hypothetical protein LOC74149 0 5 0 NM_177574 vacuolar protein sorting 37D 0 5 0 NM_009285 stanniocalcin 1 0 5 0 NM_199007 tripin 0 5 0 NM_022984 resistin 0 5 0 NM_080637 expressed in non-metastatic cells 5 0 5 0 NM_008240 forkhead box J1 0 5 0 NM_027127 hypothetical protein LOC69590 0 4 1 NM_001039039 potassium channel tetramerisation domain 0 4 1 NM_153112 cell adhesion molecule 4 0 4 1 NM_054049 odd-skipped related 2 0 4 1 NM_001033171 killer cell lectin-like receptor subfamily G 0 4 1 NM_016902 nephronophthisis 1 juvenile homolog 0 4 1 NM_008245 hematopoietically expressed homeobox 0 4 1 NM_023649 harmonin isoform a1 0 4 1 NM_001033362 hypothetical protein LOC245536 0 4 1 NM_009508 solute carrier family 32 GABA vesicular 0 4 1 NM_198190 neurotrophin 5 0 4 1 NM_007732 collagen type XVII, alpha 1 0 4 1 NM_009897 creatine kinase mitochondrial 1, ubiquitous 0 3 2 NM_026924 ovo-like 2 isoform A 0 3 2 NM_028672 hypothetical protein LOC73873 0 3 2 NM_172837 lipase family member K 0 3 2 NM_001039647 guanylate binding protein 11 0 3 2 NM_173752 hypothetical protein LOC216551 0 3 2 NM_021890 fatty acid desaturase 3 0 2 3 NM_011990 solute carrier family 7 cationic amino acid 0 2 3 NM_001081984 popeye domain containing 2 isoform 1 0 2 3 NM_181074 leucine rich repeat and Ig domain containing 1 0 2 3 NM_027263 apoptosis-inducing TAF9-like domain 1 0 2 3 NM_011607 tenascin C 0 2 3 NM_022890 claudin 12 0 1 4 NM_009518 wingless related MMTV integration site 10a 0 1 4 NM_176953 DNA ligase IV 0 1 4 NM_001011707 cytochrome P450 family 2, subfamily c, 0 1 4 NM_031167 interleukin 1 receptor antagonist isoform 1 0 1 4 NM_001033767 hypothetical protein LOC240327 0 1 4 NM_001031851 alanine-glyoxylate aminotransferase 2 0 0 5 NM_019431 voltage-dependent calcium channel gamma-4 0 0 5 NM_199252 unc-93 homolog A 0 0 5 NM_030599 killer cell lectin-like receptor subfamily B 0 4 0 NM_178384 zinc finger protein 74 0 4 0 NM_013517 Fc receptor IgE, low affinity II, alpha 0 4 0 NM_172900 sialic acid binding Ig-like lectin G 0 4 0 NM_026817 RAB member of RAS oncogene family-like 2A 0 4 0 NM_011337 chemokine C-C motif ligand 3 0 4 0 NM_177190 t-complex 11 like 1 0 4 0 NM_001109747 hypothetical protein LOC66311 0 4 0 NM_026588 syntaxin 19 0 4 0 NM_009708 Rho family GTPase 2 0 4 0 NM_176838 RNA binding motif protein 35b 0 4 0 NM_145602 N-myc downstream regulated gene 4 0 4 0 NM_177922 extracellular signal-regulated kinase 7 0 4 0 NM_178203 histone cluster 1 H3b 0 4 0 NM_010320 guanine nucleotide binding protein G protein 0 4 0 NM_183309 hypothetical protein LOC330305 0 4 0 NM_019701 chloride channel Kb 0 4 0 NM_001109914 apolipoprotein L domain containing 1 0 4 0 NM_001033476 AHNAK nucleoprotein 2 0 4 0 NM_175688 hypothetical protein LOC319293 0 4 0 NM_011381 sine oculis-related homeobox 3 homolog 0 3 1 NM_144852 solute carrier family 7 cationic amino acid 0 3 1 NM_010221 FK506 binding protein 10 0 3 1 NM_153565 proprotein convertase subtilisin/kexin type 9 0 3 1 NM_001002267 Ras-induced senescence 1 0 3 1 NM_011897 sprouty homolog 2 0 3 1 NM_011661 tyrosinase 0 3 1 NM_029011 hypothetical protein LOC74580 0 3 1 NM_001033433 transmembrane protein 102 0 3 1 NM_001029938 Rab interacting lysosomal protein 0 3 1 NM_028376 profilin family member 4 0 3 1 NM_001039143 NACHT leucine rich repeat and PYD containing 5 0 3 1 NM_009718 neurogenin 2 0 3 1 NM_019487 heme binding protein 2 0 3 1 NM_001081971 hypothetical protein LOC383787 0 3 1 NM_009606 actin alpha 1, skeletal muscle 0 2 2 NM_053107 G protein-coupled receptor 45 0 2 2 NM_001043317 CD22 antigen 0 2 2 NM_198302 RNA binding motif protein 11 0 2 2 NM_001042659 frizzled 5 precursor 0 2 2 NM_009414 tryptophan hydroxylase 1 0 2 2 NM_001002238 tudor domain containing 1 isoform 1 0 2 2 NM_009028 RAS-like family 2, locus 9 0 2 2 NM_008002 fibroblast growth factor 10 0 2 2 NM_001101453 angiotensin I converting enzyme 0 2 2 NM_025831 hypothetical protein LOC66895 0 1 3 NM_001035509 SMAD-interacting zinc finger protein 2 0 1 3 NM_026405 RAB32 0 1 3 NM_133809 kynurenine 3-monooxygenase 0 1 3 NM_139147 Rab40b member RAS oncogene family 0 1 3 NM_001039510 adenosine A1 receptor 0 1 3 NM_010487 ELAV-like protein 3 0 1 3 NM_001004762 phospholipase A2 group IVC cytosolic, 0 1 3 NM_001081656 neuralized 2 0 1 3 NM_029292 hypothetical protein LOC75453 0 1 3 NM_023655 tripartite motif protein 29 0 1 3 NM_175030 Tctex1 domain containing 4 0 1 3 NM_201370 WEE1 homolog 2 0 1 3 NM_206974 potassium channel regulator isoform 2 0 1 3 NM_001037749 solute carrier family 22 organic cation 0 1 3 NM_001081192 hyperpolarization-activated cyclic 0 1 3 NM_175427 hypothetical protein LOC109349 0 1 3 NM_145449 interferon stimulated gene 12b2 0 0 4 NM_011312 S100 calcium binding protein A5 0 0 4 NM_031873 taste receptor type 1, member 2 0 0 4 NM_001081316 dermatan sulfate epimerase-like 0 0 4 NM_177130 glycosyltransferase 28 domain containing 1-like 0 0 4 NM_172709 otopetrin 1 0 0 4 NM_030166 UDP-N-acetyl-alpha-D-galactosamine:polypeptide 0 0 4 NM_001001130 zinc finger protein 85 related sequence 1 0 0 4 NM_001001490 G protein-coupled receptor 99 0 0 4 NM_146809 olfactory receptor 1426 0 0 4 NM_008738 neurturin 0 0 4 NM_177152 leucine-rich repeats and immunoglobulin-like 0 0 4 NM_011881 G protein-coupled receptor kinase 1 0 0 4 NM_007827 decay accelerating factor 2 0 0 4 NM_001013755 hypothetical protein LOC230757 0 0 4 NM_028283 nuclear membrane binding protein NUCLING 0 3 0 NM_025995 F-box only protein 5 0 3 0 NM_139206 centaurin delta 3 0 3 0 NM_001081116 Rho guanine nucleotide exchange factor GEF 17 0 3 0 NM_008104 glial cells missing homolog 2 0 3 0 NM_027037 hypothetical protein LOC69318 0 3 0 NM_019684 serine/arginine-rich protein specific kinase 3 0 3 0 NM_009547 zinc finger protein 161 0 3 0 NM_009844 CD19 antigen 0 3 0 NM_001033315 homeodomain interacting protein kinase 4 0 3 0 NM_001025605 hypothetical protein LOC217648 0 3 0 NM_010800 muscle intestine and stomach expression 1 0 3 0 NM_183199 ubiquitin specific peptidase 44 0 3 0 NM_010198 fibroblast growth factor 11 0 3 0 NM_026594 ribosomal protein L39-like protein 0 3 0 NM_011199 parathyroid hormone receptor 1 0 3 0 NM_172796 schlafen 9 0 3 0 NM_008590 mesoderm specific transcript 0 3 0 NM_145960 mitochondrial translational release factor 1 0 3 0 NM_010652 killer cell lectin-like receptor subfamily C 0 3 0 NM_026954 tumor suppressor candidate 1 0 3 0 NM_021367 thymic stromal lymphopoietin 0 3 0 NM_009234 SRY-box 11 0 3 0 NM_001010834 solute carrier family 10 sodium/bile acid 0 3 0 NM_178738 protease serine, 35 0 3 0 NM_008709 neuroblastoma myc-related oncogene 1 0 3 0 NM_011872 kallikrein 7 0 3 0 NM_175659 histone cluster 1 H2ah 0 3 0 NM_010374 granzyme F 0 3 0 NM_010214 four and a half LIM domains 4 0 3 0 NM_001037923 hypothetical protein LOC624866 0 3 0 NM_021294 diazepam binding inhibitor-like 5 0 3 0 NM_016669 crystallin mu 0 3 0 NM_007742 collagen type I, alpha 1 0 3 0 NM_011617 CD70 antigen 0 3 0 NM_146178 coiled-coil domain containing 106 0 3 0 NM_029121 ATPase H+ transporting, V1 subunit E-like 2 0 3 0 NM_182928 adrenomedullin 2 0 3 0 NM_176830 synaptonemal complex protein SC65 0 3 0 NM_019932 chemokine C-X-C motif ligand 4 0 2 1 NM_177586 eukaryotic translation initiation factor 5A2 0 2 1 NM_007939 Eph receptor A8 0 2 1 NM_011382 sine oculis-related homeobox 4 homolog 0 2 1 NM_001001804 epoxide hydrolase-related 0 2 1 NM_019935 OVO homolog-like 1 0 2 1 NM_008880 phospholipid scramblase 2 0 2 1 NM_025750 hypothetical protein LOC66761 0 2 1 NM_008035 folate receptor 2 fetal 0 2 1 NM_028191 cytochrome P450 family 2, subfamily c, 0 2 1 NM_010953 otoconin 90 0 2 1 NM_008432 potassium channel subfamily U, member 1 0 2 1 NM_172455 transmembrane serine protease 7 0 2 1 NM_001029978 transcription elongation factor A SII-like 3 0 2 1 NM_080853 solute carrier family 17 sodium-dependent 0 2 1 NM_028810 Rho family GTPase 3 0 2 1 NM_022430 membrane-spanning 4-domains subfamily A, member 0 2 1 NM_008373 interleukin 9 0 2 1 NM_203508 epididymal secretory protein 3 0 2 1 NM_008029 FMS-like tyrosine kinase 4 0 2 1 NM_133191 epidermal growth factor receptor pathway 0 2 1 NM_001024645 hypothetical protein LOC268747 0 2 1 NM_001085515 hypothetical protein LOC329828 0 2 1 NM_026152 hypothetical protein LOC67432 0 1 2 NM_009888 complement component factor H 0 1 2 NM_010110 ephrin B1 0 1 2 NM_130887 papilin 0 1 2 NM_010151 nuclear receptor subfamily 2 group F, member 1 0 1 2 NM_172271 solute carrier family 6 neurotransmitter 0 1 2 NM_001081395 angiomotin-like 1 0 1 2 NM_175448 retinaldehyde binding protein 1-like 2 0 1 2 NM_001003666 zinc finger protein 457 0 1 2 NM_001081441 WD repeat domain 86 0 1 2 NM_025658 membrane-spanning 4-domains subfamily A, member 0 1 2 NM_010582 inter-alpha trypsin inhibitor heavy chain 2 0 1 2 NM_144891 ganglioside-induced differentiation-associated 0 1 2 NM_178758 acyl-CoA synthetase medium-chain family member 0 1 2 NM_146061 Rho GTPase activating protein 8 0 1 2 NM_201518 fibronectin leucine rich transmembrane protein 0 1 2 NM_009567 zinc finger protein 93 0 1 2 NM_030709 transmembrane protease serine 5 spinesin 0 1 2 NM_011526 transgelin 0 1 2 NM_080464 protein phosphatase 1 regulatory inhibitor 0 1 2 NM_028973 leucine rich repeat containing 15 0 1 2 NM_010050 deiodinase iodothyronine, type II 0 1 2 NM_153778 okadin 0 1 2 NM_027286 angiotensin I converting enzyme 0 1 2 NM_177363 hypothetical protein LOC245126 0 1 2 NM_145980 RIKEN cDNA 8430408G22 0 0 3 NM_023612 endothelial cell-specific molecule 1 0 0 3 NM_194058 NACHT LRR and PYD containing protein 9b 0 0 3 NM_030733 G protein-coupled receptor 63 0 0 3 NM_001024848 apolipoprotein L 7b 0 0 3 NM_028852 spermatogenesis and centriole associated 1 0 0 3 NM_028807 hypothetical protein LOC74190 0 0 3 NM_207244 Cd200 receptor 4 0 0 3 NM_001111313 ribosomal protein L21-like 0 0 3 NM_027721 katanin p60 subunit A-like 2 0 0 3 NM_001013761 hypothetical protein LOC239789 0 0 3 NM_025751 hypothetical protein LOC66763 0 0 3 NM_178720 zona pellucida like domain containing 1 0 0 3 NM_153541 zinc finger and BTB domain containing 8 0 0 3 NM_023784 Yip1 domain family member 7 0 0 3 NM_134069 solute carrier family 17 sodium phosphate 0 0 3 NM_030744 ropporin rhophilin associated protein 1 0 0 3 NM_028801 mucin 5 subtype B, tracheobronchial 0 0 3 NM_010766 macrophage receptor with collagenous structure 0 0 3 NM_010729 lysyl oxidase-like 1 0 0 3 NM_026214 potassium channel tetramerisation domain 0 0 3 NM_027391 iodotyrosine dehalogenase 1 protein 0 0 3 NM_008342 insulin-like growth factor binding protein 2 0 0 3 NM_001033446 hypothetical protein LOC381142 0 0 3 NM_010057 distal-less homeobox 6 0 0 3 NM_173743 hypothetical protein LOC71898 0 0 3 NM_008764 tumor necrosis factor receptor superfamily 0 2 0 NM_010254 galanin receptor 2 0 2 0 NM_013921 transmembrane protease serine 8 intestinal 0 2 0 NM_008230 histidine decarboxylase 0 2 0 NM_008141 guanine nucleotide binding protein alpha 0 2 0 NM_199312 hypothetical protein LOC332713 0 2 0 NM_001105178 vomeronasal receptor Vmn2r50 0 2 0 NM_011540 titin-cap 0 2 0 NM_021347 gasdermin A1 0 2 0 NM_175027 Fanconi anemia complementation group B 0 2 0 NM_029297 dynein light chain roadblock-type 2 0 2 0 NM_010052 delta-like 1 homolog 0 2 0 NM_025458 transmembrane emp24 protein transport domain 0 2 0 NM_001081130 oxoglutarate dehydrogenase-like 0 2 0 NM_013534 leprecan-like 2 0 2 0 NM_026459 coiled-coil domain containing 70 0 2 0 NM_053008 oligodendrocyte transcription factor 3 0 2 0 NM_013906 a disintegrin-like and metalloprotease 0 2 0 NM_026619 glutathione S-transferase omega 2 0 2 0 NM_027551 kelch-like 30 0 2 0 NM_146245 leucine-rich repeat immunoglobulin-like and 0 2 0 NM_001008497 P2Y14 receptor 0 2 0 NM_011438 SRY-box containing gene 12 0 2 0 NM_001025606 transmembrane protein 171 0 2 0 NM_152229 nuclear receptor subfamily 2 group E, member 1 0 2 0 NM_011905 toll-like receptor 2 0 2 0 NM_001033205 zinc finger protein 575 0 2 0 NM_178753 spindlin family member 4 0 2 0 NM_130451 solute carrier family 2 member 10 0 2 0 NM_198650 solute carrier family 22 organic anion 0 2 0 NM_009168 src homology 2 domain-containing transforming 0 2 0 NM_172702 tumor differentially expressed 2-like 0 2 0 NM_177306 regulatory factor X domain containing 1 0 2 0 NM_145435 peptide YY 0 2 0 NM_023785 pro-platelet basic protein 0 2 0 NM_025273 pterin 4 alpha carbinolamine 0 2 0 NM_146451 olfactory receptor 164 0 2 0 NM_010341 G protein-coupled receptor 66 0 2 0 NM_022879 myosin light polypeptide 7, regulatory 0 2 0 NM_010827 musculin 0 2 0 NM_145132 melanin-concentrating hormone receptor 1 0 2 0 NM_053083 lysyl oxidase-like 4 0 2 0 NM_001099331 hypothetical protein LOC100043899 0 2 0 NM_178036 lipocalin 0 2 0 NM_001012434 potassium channel tetramerisation domain 0 2 0 NM_198622 H1 histone family member X 0 2 0 NM_010372 granzyme D 0 2 0 NM_008179 G1 to phase transition 2 0 2 0 NM_008154 G-protein coupled receptor 3 0 2 0 NM_145741 growth differentiation factor 10 0 2 0 NM_022424 fibronectin type III domain containing 4 0 2 0 NM_010205 fibroblast growth factor 8 0 2 0 NM_007959 ets related protein 71 0 2 0 NM_001082542 stefin A1 like 1 0 2 0 NM_029794 cleavage and polyadenylation specific factor 0 2 0 NM_009894 cell death-inducing DNA fragmentation factor 0 2 0 NM_001081104 cholinergic receptor nicotinic, alpha 9 0 2 0 NM_023224 Casitas B-lineage lymphoma c 0 2 0 NM_080644 calcium channel voltage-dependent, gamma 0 2 0 NM_134117 hypothetical protein LOC106522 0 2 0 NM_025744 hypothetical protein LOC66748 0 2 0 NM_028671 hypothetical protein LOC73866 0 2 0 NM_176835 RIKEN cDNA 2810451A06 0 2 0 NM_025890 hypothetical protein LOC66991 0 2 0 NM_027104 hypothetical protein LOC71886 0 2 0 NM_009263 secreted phosphoprotein 1 0 2 0 NM_024469 basic helix-loop-helix domain containing class 0 1 1 NM_029048 speedy B 0 1 1 NM_146149 hypothetical protein LOC230579 0 1 1 NM_028420 calcium/calmodulin-dependent protein kinase II 0 1 1 NM_007743 procollagen type I, alpha 2 0 1 1 NM_009026 RAS dexamethasone-induced 1 0 1 1 NM_025703 transcription elongation factor A SII-like 8 0 1 1 NM_145419 hexokinase domain containing 1 0 1 1 NM_178406 G protein-coupled receptor 153 0 1 1 NM_201355 N-acetyltransferase 14 0 1 1 NM_001098226 TEA domain family member 3 isoform 2 0 1 1 NM_178386 solute carrier family 25 mitochondrial carrier 0 1 1 NM_013743 pyruvate dehydrogenase kinase isoenzyme 4 0 1 1 NM_013519 forkhead box C2 0 1 1 NM_027960 dipeptidase 3 0 1 1 NM_009989 cytochrome c testis 0 1 1 NM_207208 chloride channel calcium activated 6 0 1 1 NM_007628 cyclin A1 0 1 1 NM_207202 coiled-coil domain containing 120 0 1 1 NM_023143 complement component 1 r subcomponent 0 1 1 NM_172750 ADP-ribosylhydrolase like 1 0 1 1 NM_033564 Mpv17 transgene kidney disease mutant-like 0 1 1 NM_001013757 hypothetical protein LOC232585 0 1 1 NM_007586 calbindin 2 0 1 1 NM_175638 WNK lysine deficient protein kinase 4 0 1 1 NM_010008 cytochrome P450 family 2, subfamily j, 0 1 1 NM_177817 hypothetical protein LOC328479 0 1 1 NM_011565 TEA domain family member 2 0 1 1 NM_026038 proline racemase-like 0 1 1 NM_138652 ATPase H+/K+ transporting, nongastric, alpha 0 1 1 NM_027664 hypothetical protein LOC108653 0 1 1 NM_008256 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 0 1 1 NM_001083884 RIKEN cDNA 2210415F13 0 1 1 NM_175533 scavenger receptor protein family member 0 1 1 NM_144960 Fc receptor IgA, IgM, high affinity 0 1 1 NM_009140 chemokine C-X-C motif ligand 2 0 1 1 NM_009573 zinc finger protein of the cerebellum 1 0 1 1 NM_016873 WNT1 inducible signaling pathway protein 2 0 1 1 NM_001080550 WAP four-disulfide core domain 8 0 1 1 NM_172434 CUG-BP and ETR-3 like factor 3 0 1 1 NM_011619 troponin T2 cardiac 0 1 1 NM_001008499 trace amine-associated receptor 4 0 1 1 NM_175132 synaptopodin 2-like 0 1 1 NM_177753 SRY-box 21 0 1 1 NM_028937 spermatogenesis and oogenesis specific basic 0 1 1 NM_027572 solute carrier family 22 organic cation 0 1 1 NM_011387 solute carrier family 10 sodium/bile acid 0 1 1 NM_153790 scavenger receptor class F member 2 0 1 1 NM_054064 pregnancy-specific glycoprotein 29 0 1 1 NM_023043 prion protein dublet 0 1 1 NM_172454 pannexin 3 0 1 1 NM_146830 olfactory receptor 44 0 1 1 NM_010916 nescient helix loop helix 1 0 1 1 NM_178731 leucine rich repeat transmembrane neuronal 4 0 1 1 NM_145998 H6 homeo box 2 0 1 1 NM_198959 hypocretin orexin receptor 1 0 1 1 NM_022031 hyaluronan and proteoglycan link protein 2 0 1 1 NM_025331 guanine nucleotide binding protein gamma 11 0 1 1 NM_008132 glutamine repeat protein 1 0 1 1 NM_008023 forkhead box B2 0 1 1 NM_007957 extraembryonic spermatogenesis, homeobox 1 0 1 1 NM_013848 erythroblast membrane-associated protein 0 1 1 NM_007910 ephrin A4 0 1 1 NM_001013368 E2F transcription factor 8 0 1 1 NM_172708 docking protein 7 0 1 1 NM_029523 DEP domain containing 1a 0 1 1 NM_028146 dysbindin dystrobrevin binding protein 1 0 1 1 NM_183158 cytochrome P450 family 2, subfamily ab, 0 1 1 NM_007722 chemokine orphan receptor 1 0 1 1 NM_021719 claudin 15 0 1 1 NM_080640 brain and acute leukemia cytoplasmic isoform 0 1 1 NM_013475 apolipoprotein H precursor 0 1 1 NM_023114 apolipoprotein C-III 0 1 1 NM_028654 hypothetical protein LOC73808 0 1 1 NM_025732 hypothetical protein LOC66729 0 1 1 NM_025506 hypothetical protein LOC66353 0 1 1 NM_008366 interleukin 2 0 0 2 NM_021486 beta-carotene 1515'-monooxygenase 0 0 2 NM_010216 c-fos induced growth factor 0 0 2 NM_026680 golgi transport 1 homolog A 0 0 2 NM_027866 collectin sub-family member 11 0 0 2 NM_177567 hypothetical protein LOC193286 0 0 2 NM_001033364 protocadherin 24 0 0 2 NM_010459 homeo box B4 0 0 2 NM_001104565 vomeronasal receptor Vmn2r103 0 0 2 NM_001100181 cytochrome P450 family 4, subfamily a, 0 0 2 NM_007789 neurocan 0 0 2 NM_001081353 hypothetical protein LOC72371 0 0 2 NM_172859 hypothetical protein LOC241688 0 0 2 NM_008196 granzyme K 0 0 2 NM_010637 Kruppel-like factor 4 gut 0 0 2 NM_010143 Eph receptor B3 0 0 2 NM_177764 vomeronasal 2 receptor 57 0 0 2 NM_010746 natural cytotoxicity triggering receptor 1 0 0 2 NM_008181 glutathione S-transferase alpha 1 Ya 0 0 2 NM_028116 pygopus 1 0 0 2 NM_177898 NIMA never in mitosis gene a-related expressed 0 0 2 NM_001033779 hypothetical protein LOC433632 0 0 2 NM_028263 fibroblast growth factor binding protein 3 0 0 2 NM_007536 B-cell leukemia/lymphoma 2 related protein A1d 0 0 2 NM_177576 Sad1 and UNC84 domain containing 1 0 0 2 NM_010605 potassium inwardly-rectifying channel J5 0 0 2 NM_001081262 hypothetical protein LOC545527 0 0 2 NM_147220 ATP-binding cassette transporter sub-family A 0 0 2 NM_011459 serine or cysteine proteinase inhibitor clade 0 0 2 NM_199465 nexilin 0 0 2 NM_175731 N-acylsphingosine amidohydrolase 3 0 0 2 NM_177669 hypothetical protein LOC230623 0 0 2 NM_001005423 melanoregulin 0 0 2 NM_011019 oncostatin M receptor 0 0 2 NM_001105245 protocadherin 19 isoform a 0 0 2 NM_001105055 vomeronasal receptor Vmn2r58 0 0 2 NM_016909 translin-associated factor X 0 0 2 NM_183109 transmembrane protease serine 12 0 0 2 NM_001001183 cDNA sequence BC054438 0 0 2 NM_153099 testis serine protease 2 0 0 2 NM_013776 T-cell leukemia/lymphoma 1B 5 0 0 2 NM_001111296 sulfotransferase family 2A 0 0 2 NM_001030293 sprouty homolog 3 0 0 2 NM_021471 solute carrier organic anion transporter family 0 0 2 NM_001013390 sodium channel type IV, beta 0 0 2 NM_009019 recombination activating gene 1 0 0 2 NM_011645 mesotrypsin 0 0 2 NM_013766 prolactin family 3 subfamily c, member 1 0 0 2 NM_008852 paired-like homeodomain transcription factor 3 0 0 2 NM_017378 protocadherin 12 0 0 2 NM_008772 purinergic receptor P2Y G-protein coupled 1 0 0 2 NM_033321 purinergic receptor P2X5 0 0 2 NM_028910 olfactory receptor 701 0 0 2 NM_028186 naked cuticle-2 0 0 2 NM_010910 neurofilament light polypeptide 0 0 2 NM_001081044 myosin light polypeptide kinase 2, skeletal 0 0 2 NM_172979 mucin 15 0 0 2 NM_008585 meprin 1 alpha 0 0 2 NM_008579 meiosis expressed gene 1 0 0 2 NM_001033371 leucine rich repeat containing 36 0 0 2 NM_146063 keratin 6L 0 0 2 NM_023256 keratin 20 0 0 2 NM_199013 immunity-related GTPase family cinema 1 0 0 2 NM_172648 interferon activated gene 205 0 0 2 NM_001024842 homeobox C11 0 0 2 NM_177635 histocompatibility 2 M region locus 11 0 0 2 NM_013544 histocompatibility 2 M region locus 10.1 0 0 2 NM_177469 G protein-coupled receptor 123 0 0 2 NM_010290 gap junction protein delta 2 0 0 2 NM_205844 GDNF receptor alpha-like 0 0 2 NM_008075 gamma-aminobutyric acid GABA receptor rho 1 0 0 2 NM_008034 folate receptor 1 adult 0 0 2 NM_153573 FK506 binding protein 14 0 0 2 NM_010134 engrailed 2 0 0 2 NM_010054 distal-less homeobox 2 0 0 2 NM_007833 decorin 0 0 2 NM_145473 RNA-binding protein pippin 0 0 2 NM_153107 carboxypeptidase Z 0 0 2 NM_023289 CEA-related cell adhesion molecule 11 0 0 2 NM_007673 caudal type homeo box 2 0 0 2 NM_145621 CaM kinase-like vesicle-associated 0 0 2 NM_001113356 complement component C1rb 0 0 2 NM_010871 baculoviral IAP repeat-containing 1f 0 0 2 NM_145424 cis-retinol/3alpha hydroxysterol short-chain 0 0 2 NM_026853 ankyrin repeat and SOCS box-containing protein 0 0 2 NM_001109045 aquaporin 8 isoform 2 0 0 2 NM_019764 angiomotin like 2 0 0 2 NM_007442 aristaless 4 0 0 2 NM_001033199 calcium activated chloride channel 0 0 2 NM_177322 angiotensin II receptor type 1a 0 0 2 NM_178735 hypothetical protein LOC244425 0 0 2 NM_173759 hypothetical protein LOC225583 0 0 2 NM_178796 hypothetical protein LOC328830 isoform a 0 0 2 NM_025753 hypothetical protein LOC66766 0 0 2 NM_028826 septin 14 0 0 2 NM_027878 damage-regulated autophagy modulator 0 1 0 NM_025355 transcription elongation factor A SII-like 6 0 1 0 NM_198633 hypothetical protein LOC331392 0 1 0 NM_008649 major urinary protein 5 0 1 0 NM_001033338 RIMS binding protein 3 0 1 0 NM_001081680 zinc finger protein 72 0 1 0 NM_181418 Usher syndrome 1C binding protein 1 0 1 0 NM_030188 tetratricopeptide repeat domain 30A1 0 1 0 NM_198247 SERTA domain containing 4 0 1 0 NM_177742 tripartite motif family-like 1 0 1 0 NM_019981 testis-specific protein TES101RP 0 1 0 NM_008584 mesenchyme homeobox 2 0 1 0 NM_011834 aminoadipate aminotransferase 0 1 0 NM_001030294 olfactomedin 4 0 1 0 NM_175526 C-type lectin-like receptor-1 0 1 0 NM_178697 chloride channel calcium activated 5 0 1 0 NM_178776 hypothetical protein LOC320135 0 1 0 NM_008435 K+ voltage-gated channel subfamily S, 1 0 1 0 NM_053015 melanophilin 0 1 0 NM_001085513 hypothetical protein LOC277743 0 1 0 NM_013505 desmocollin 2 0 1 0 NM_023508 phosducin-like 2 0 1 0 NM_021610 glycoprotein A33 transmembrane 0 1 0 NM_144841 orthodenticle homolog 2 0 1 0 NM_011439 SRY-box 13 0 1 0 NM_008235 hairy and enhancer of split 1 0 1 0 NM_013696 thyrotropin releasing hormone receptor 0 1 0 NM_033610 synuclein beta 0 1 0 NM_011452 serine or cysteine proteinase inhibitor clade 0 1 0 NM_025719 NFKB activating protein-like 0 1 0 NM_023463 lymphocyte antigen 6 complex G6C 0 1 0 NM_010571 insulin receptor substrate 3 0 1 0 NM_001110790 G protein-coupled receptor 112 0 1 0 NM_023580 Eph receptor A1 0 1 0 NM_007921 E74-like factor 3 0 1 0 NM_010000 cytochrome P450 family 2, subfamily b, 0 1 0 NM_009608 actin alpha, cardiac 0 1 0 NM_026296 hypothetical protein LOC67656 0 1 0 NM_027103 hypothetical protein LOC69528 0 1 0 NM_001033141 hypothetical protein LOC68545 0 1 0 NM_080854 type IIc Na+/Pi-cotransporter 0 1 0 NM_178047 prominin 2 isoform 2 0 1 0 NM_011097 paired-like homeodomain transcription factor 1 0 1 0 NM_010930 nephroblastoma overexpressed 0 1 0 NM_175413 leucine rich repeat containing 39 isoform 2 0 1 0 NM_008178 GS homeobox 1 0 1 0 NM_001033498 GRAM domain containing 2 0 1 0 NM_001033437 hypothetical protein LOC380755 0 1 0 NM_175228 hypothetical protein LOC75905 0 1 0 NM_026860 hypothetical protein LOC68888 0 1 0 NM_174851 interleukin 28 receptor alpha 0 1 0 NM_001039385 VGF nerve growth factor inducible 0 1 0 NM_001100180 cytochrome P450 family 3, subfamily a, 0 1 0 NM_054073 testis specific gene A13 0 1 0 NM_053093 tachykinin 4 0 1 0 NM_001003685 growth hormone releasing hormone receptor 0 1 0 NM_013492 clusterin 0 1 0 NM_011413 sex-limited protein 0 1 0 NM_001033408 RNA binding motif protein 44 0 1 0 NM_172946 RIKEN cDNA 6330509G02 0 1 0 NM_001025610 membrane-spanning 4-domains subfamily A, member 0 1 0 NM_199015 hypothetical protein LOC219132 0 1 0 NM_011606 C-type lectin domain family 3 member b 0 1 0 NM_008938 peripherin 2 0 1 0 NM_008096 group specific component 0 1 0 NM_199036 F-box and WD-40 domain protein 15 0 1 0 NM_019446 BarH-like 1 0 1 0 NM_027870 armadillo repeat containing X-linked 3 0 1 0 NM_028075 tumor necrosis factor receptor superfamily 0 1 0 NM_001033792 hypothetical protein LOC545963 0 1 0 NM_207263 peptidoglycan recognition protein 4 0 1 0 NM_001081338 l3mbt-like 0 1 0 NM_001077632 NK2 transcription factor related locus 2 0 1 0 NM_001077189 Fc receptor IgG, low affinity IIb isoform 1 0 1 0 NM_009661 arachidonate 8-lipoxygenase 0 1 0 NM_001025567 orthodenticle homolog 3 isoform b 0 1 0 NM_022987 zinc finger protein of the cerebellum 5 0 1 0 NM_011763 zinc finger protein 9 0 1 0 NM_178763 zinc finger protein 750 0 1 0 NM_001009549 zinc finger protein 36-like 3 0 1 0 NM_013744 zinc finger protein 354B 0 1 0 NM_020262 zinc finger protein 109 0 1 0 NM_199309 zinc finger DHHC domain containing 19 0 1 0 NM_011725 X-linked lymphocyte-regulated protein pM1 0 1 0 NM_011798 chemokine C motif receptor 1 0 1 0 NM_053116 wingless-related MMTV integration site 16 0 1 0 NM_001105182 vomeronasal 2 receptor 69 0 1 0 NM_134183 vomeronasal 1 receptor C28 0 1 0 NM_172881 UDP glucuronosyltransferase 2 family 0 1 0 NM_033607 ubiquitin carboxyl-terminal esterase L4 0 1 0 NM_001079932 tripartite motif-containing 72 0 1 0 NM_001033235 tripartite motif-containing 40 0 1 0 NM_009394 fast skeletal muscle troponin C 0 1 0 NM_145987 transmembrane protein 82 0 1 0 NM_182991 brain-specific membrane-anchored protein 0 1 0 NM_026239 transmembrane protein 35 0 1 0 NM_021901 T-cell leukemia homeobox 1 0 1 0 NM_013774 T-cell leukemia/lymphoma 1B 4 0 1 0 NM_011545 transcription factor 21 0 1 0 NM_009308 synaptotagmin 4 0 1 0 NM_181529 synaptotagmin XV isoform a 0 1 0 NM_172829 beta galactoside alpha 26 sialyltransferase 2 0 1 0 NM_011425 somatostatin receptor 5 0 1 0 NM_144827 spermatogenesis associated 20 0 1 0 NM_025540 sarcolipin 0 1 0 NM_013797 solute carrier organic anion transporter family 0 1 0 NM_009203 solute carrier family 22 organic anion/cation 0 1 0 NM_028232 shugoshin-like 1 0 1 0 NM_173024 serine or cysteine peptidase inhibitor clade 0 1 0 NM_009245 serine or cysteine proteinase inhibitor clade 0 1 0 NM_001014761 sodium channel voltage-gated, type II, beta 0 1 0 NM_001099742 secretoglobin family 1C, member 1 0 1 0 NM_027301 retinol dehydrogenase similar protein 0 1 0 NM_008998 RAB17 member RAS oncogene family 0 1 0 NM_008970 parathyroid hormone-like peptide precursor 0 1 0 NM_020623 parathyroid hormone 0 1 0 NM_020576 MHC psoriasis candidate 0 1 0 NM_028216 prostate stem cell antigen 0 1 0 NM_178774 proline rich region 18 0 1 0 NM_028477 prolactin family 8 subfamily a, member 1 0 1 0 NM_019587 plexin B3 0 1 0 NM_001081333 pleckstrin homology domain containing family G 0 1 0 NM_011107 phospholipase A2 group IB, pancreas 0 1 0 NM_013631 pyruvate kinase liver and red blood cell isoform 0 1 0 NM_008952 pipecolic acid oxidase 0 1 0 NM_031190 phosphoglycerate kinase 2 0 1 0 NM_001081070 protein disulfide isomerase associated 2 0 1 0 NM_054076 opticin 0 1 0 NM_011012 opioid receptor-like 1 0 1 0 NM_146937 olfactory receptor 63 0 1 0 NM_146315 olfactory receptor 62 0 1 0 NM_146726 olfactory receptor 514 0 1 0 NM_146536 olfactory receptor 313 0 1 0 NM_029173 nucleoredoxin 0 1 0 NM_001031664 nudix-type motif 10 0 1 0 NM_001007472 notochord 0 1 0 NM_010923 neuronatin isoform alpha 0 1 0 NM_021432 nucleosome assembly protein 1-like 5 0 1 0 NM_028069 mucin-like protocadherin isoform 2 0 1 0 NM_181729 mucin 6 gastric 0 1 0 NM_133246 membrane-spanning 4-domains subfamily A, member 0 1 0 NM_203492 MAS-related GPR member G 0 1 0 NM_139296 monooxygenase DBH-like 2 0 1 0 NM_010810 matrix metallopeptidase 7 0 1 0 NM_010796 macrophage galactose N-acetyl-galactosamine 0 1 0 NM_008589 mesoderm posterior 2 0 1 0 NM_008572 mast cell protease 8 0 1 0 NM_010776 mannose binding lectin C 0 1 0 NM_018832 PDZ domain containing X chromosome 0 1 0 NM_008521 leukotriene C4 synthase 0 1 0 NM_138682 leucine rich repeat containing 4 0 1 0 NM_175478 leucine rich repeat and fibronectin type III 0 1 0 NM_026334 lipase gastric 0 1 0 NM_153558 lipocalin 13 0 1 0 NM_026235 acheron 0 1 0 NM_001033131 keratinocyte differentiation associated protein 0 1 0 NM_010667 keratin 86 0 1 0 NM_001003668 keratin 83 0 1 0 NM_213728 keratin 72 0 1 0 NM_010659 keratin complex 1 acidic, gene 1 0 1 0 NM_181317 K+ voltage-gated channel subfamily S, 2 0 1 0 NM_001081087 kelch repeat and BTB POZ domain containing 10 0 1 0 NM_001018013 izumo sperm-egg fusion 1 0 1 0 NM_016889 insulinoma-associated 1 0 1 0 NM_008324 indoleamine-pyrrole 23 dioxygenase 0 1 0 NM_146100 internexin neuronal intermediate filament 0 1 0 NM_009909 interleukin 8 receptor beta 0 1 0 NM_010552 interleukin 17 0 1 0 NM_010518 insulin-like growth factor binding protein 5 0 1 0 NM_015777 immunoglobulin CD79A binding protein 1b 0 1 0 NM_023892 LW glycoprotein 0 1 0 NM_008273 homeo box D11 0 1 0 NM_010402 heart and neural crest derivatives expressed 0 1 0 NM_138311 H1 histone family member O, oocyte-specific 0 1 0 NM_010373 granzyme E 0 1 0 NM_010350 glutamate receptor ionotropic, NMDA2C epsilon 0 1 0 NM_175669 G protein-coupled receptor 82 0 1 0 NM_175520 G protein-coupled receptor 81 0 1 0 NM_010340 G-protein-coupled receptor 50 0 1 0 NM_008159 G protein-coupled receptor 33 0 1 0 NM_001014394 G protein-coupled receptor 113 0 1 0 NM_029771 G protein-coupled estrogen receptor 1 0 1 0 NM_010314 guanine nucleotide binding protein G protein 0 1 0 NM_001033280 hypothetical protein LOC225443 0 1 0 NM_080450 gap junction membrane channel protein epsilon 1 0 1 0 NM_080454 gap junction protein gamma 2 isoform 1 0 1 0 NM_148951 GIPC PDZ domain containing family member 3 0 1 0 NM_023608 osteoblast differentiation promoting factor 0 1 0 NM_008592 forkhead box C1 0 1 0 NM_008260 forkhead box A3 0 1 0 NM_021891 fidgetin-like 1 0 1 0 NM_013513 erythrocyte protein band 4.2 0 1 0 NM_001081471 UbiE3 protein 0 1 0 NM_007929 epithelial membrane protein 2 0 1 0 NM_001081318 predicted gene EG625716 0 1 0 NM_001082547 EG433016 protein 0 1 0 NM_001014395 hypothetical protein LOC382156 0 1 0 NM_173745 dual specificity phosphatase 18 0 1 0 NM_010056 distal-less homeobox 5 isoform 1 0 1 0 NM_001001444 beta-defensin 29 0 1 0 NM_172826 dapper antagonist of beta-catenin, homolog 2 0 1 0 NM_021532 dapper 1 0 1 0 NM_019792 cytochrome P450 family 3, subfamily a, 0 1 0 NM_007818 cytochrome P450 family 3, subfamily a, 0 1 0 NM_001104927 cytochrome P450 family 2, subfamily j, 0 1 0 NM_133657 cytochrome P450 family 2, subfamily a, 0 1 0 NM_009995 cytochrome P450 family 21, subfamily a, 0 1 0 NM_009933 collagen type VI, alpha 1 0 1 0 NM_007726 cannabinoid receptor 1 brain 0 1 0 NM_001081375 cornifelin 0 1 0 NM_001005860 C-type lectin domain family 4 member a4 0 1 0 NM_020293 claudin 9 0 1 0 NM_016887 claudin 7 0 1 0 NM_009903 claudin 4 0 1 0 NM_009604 cholinergic receptor nicotinic, gamma 0 1 0 NM_021454 CDC42 effector protein Rho GTPase binding 5 0 1 0 NM_199225 CD300C antigen 0 1 0 NM_054042 CD248 antigen endosialin 0 1 0 NM_021443 chemokine C-C motif ligand 8 0 1 0 NM_028492 coiled-coil domain containing 103 0 1 0 NM_007607 carbonic anhydrase 4 0 1 0 NM_026769 calcyon protein 0 1 0 NM_007582 voltage-dependent calcium channel gamma-1 0 1 0 NM_176995 hypothetical protein LOC319749 0 1 0 NM_175033 selenoprotein V 0 1 0 NM_026624 hypothetical protein LOC68222 0 1 0 NM_001110506 hypothetical protein LOC212516 0 1 0 NM_177632 hypothetical protein LOC224093 0 1 0 NM_027395 brain abundant membrane attached signal protein 0 1 0 NM_009732 arginine vasopressin 0 1 0 NM_001033215 hypothetical protein LOC105590 0 1 0 NM_026414 skin aspartic protease 0 1 0 NM_009700 aquaporin 4 0 1 0 NM_013468 ankyrin repeat domain 1 cardiac muscle 0 1 0 NM_030611 aldo-keto reductase family 1 member C6 0 1 0 NM_021515 adenylate kinase 1 0 1 0 NM_001081652 hypothetical protein LOC192950 0 1 0 NM_198662 similar to arylacetamide deacetylase esterase 0 1 0 NM_177656 hypothetical protein LOC228778 0 1 0 NM_001082535 intramembrane protease 5 isoform b 0 1 0 NM_026109 glycoprotein 25L 0 1 0 NM_001033185 hypothetical protein LOC78465 0 1 0 NM_028180 hypothetical protein LOC72277 0 1 0 NM_026808 fat-inducing transcript 1 0 1 0 NM_009452 tumor necrosis factor ligand superfamily 0 1 0 NM_011517 synaptonemal complex protein 3 0 1 0 NM_009235 SRY-box 15 0 1 0 NM_010921 NK-3 transcription factor locus 1 0 1 0 NM_199364 leucine zipper putative tumor suppressor 1 0 0 1 NM_145222 UDP-GlcNAc:betaGal 0 0 1 NM_011302 retinoschisis 1 homolog 0 0 1 NM_146250 G protein-coupled receptor 1 0 0 1 NM_009892 chitinase 3-like 3 0 0 1 NM_007769 deleted in malignant brain tumors 1 0 0 1 NM_183163 rhomboid veinlet-like 2 0 0 1 NM_175305 leucine rich repeat containing 19 0 0 1 NM_001039558 hypothetical protein LOC654818 0 0 1 NM_172793 butyrophilin-like 9 0 0 1 NM_029310 hypothetical protein LOC75497 0 0 1 NM_009526 wingless-related MMTV integration site 6 0 0 1 NM_008458 serine or cysteine proteinase inhibitor clade 0 0 1 NM_010544 Indian hedgehog 0 0 1 NM_133355 glutamate receptor ionotropic, delta 2 Grid2 0 0 1 NM_029021 hypothetical protein LOC74614 0 0 1 NM_016914 proteoglycan 3 0 0 1 NM_145536 hypothetical protein LOC228788 0 0 1 NM_183022 amiloride-sensitive cation channel 4 pituitary 0 0 1 NM_173769 zinc finger protein 641 0 0 1 NM_011720 wingless related MMTV integration site 8b 0 0 1 NM_027300 testis and spermatogenesis cell apoptosis 0 0 1 NM_029367 sperm acrosome associated 3 0 0 1 NM_177082 trans-acting transcription factor 8 0 0 1 NM_178706 sialic acid binding Ig-like lectin H 0 0 1 NM_001037907 ripply2 protein 0 0 1 NM_008888 paired-like homeobox 2b 0 0 1 NM_001048219 NACHT LRR and PYD containing protein 9a isoform 0 0 1 NM_010920 NK2 transcription factor related locus 6 0 0 1 NM_030679 myosin heavy polypeptide 1, skeletal muscle, 0 0 1 NM_001034898 membrane-spanning 4-domains subfamily A, member 0 0 1 NM_007641 membrane-spanning 4-domains subfamily A, member 0 0 1 NM_001081372 liver carboxylesterase N-like 0 0 1 NM_010616 kinesin family member 12 0 0 1 NM_010603 potassium inwardly-rectifying channel J12 0 0 1 NM_008382 inhibin beta E 0 0 1 NM_010451 homeobox A2 0 0 1 NM_008215 hyaluronan synthase1 0 0 1 NM_172670 glycosyltransferase-like 1B 0 0 1 NM_007412 adrenomedullin receptor 0 0 1 NM_001034871 hypothetical protein LOC328788 0 0 1 NM_020488 gamma-aminobutyric acid GABA-A receptor 0 0 1 NM_010168 coagulation factor II 0 0 1 NM_001039116 DMRT-like family C1b 0 0 1 NM_010030 beta-defensin 2 0 0 1 NM_007724 cyclic nucleotide gated channel alpha 2 0 0 1 NM_007695 chitinase 3-like 1 0 0 1 NM_001100177 calcium binding and coiled-coil domain 2 b 0 0 1 NM_172808 anthrax toxin receptor-like 0 0 1 NM_009646 autoimmune regulator autoimmune 0 0 1 NM_172845 a disintegrin-like and metalloprotease 0 0 1 NM_013456 actinin alpha 3 0 0 1 NM_001001982 hypothetical protein LOC214239 0 0 1 NM_177841 hypothetical protein LOC329366 0 0 1 NM_198614 hypothetical protein LOC237397 0 0 1 NM_025944 hypothetical protein LOC67063 0 0 1 NM_009253 serine or cysteine proteinase inhibitor clade 0 0 1 NM_010844 mucin 5 subtypes A and C, 0 0 1 NM_177719 microrchidia 2B 0 0 1 NM_133730 keratin 25 0 0 1 NM_008317 hyaluronoglucosaminidase 1 0 0 1 NM_027543 G-protein coupled receptor 173 0 0 1 NM_201411 fibronectin leucine rich transmembrane protein 0 0 1 NM_007994 fructose bisphosphatase 2 0 0 1 NM_015730 cholinergic receptor nicotinic, alpha 4 0 0 1 NM_028500 calreticulin 3 isoform 1 0 0 1 NM_001024728 hypothetical protein LOC546049 0 0 1 NM_029419 apolipoprotein L 7a 0 0 1 NM_001085514 hypothetical protein LOC329375 0 0 1 NM_008371 interleukin 7 0 0 1 NM_001102662 skint 1 0 0 1 NM_146256 4-hydroxyphenylpyruvate dioxygenase-like 0 0 1 NM_007925 elastin 0 0 1 NM_178755 carboxypeptidase 2 cytosolic 0 0 1 NM_027519 hypothetical protein LOC70717 0 0 1 NM_013823 klotho 0 0 1 NM_175475 cytochrome P450 family 26, subfamily b, 0 0 1 NM_029861 cannabinoid receptor interacting protein 1 0 0 1 NM_001011873 X Kell blood group precursor related family 0 0 1 NM_175539 WD repeat domain 40C 0 0 1 NM_023478 uroplakin 3A 0 0 1 NM_021324 tweety 1 isoform 2 0 0 1 NM_009769 Kruppel-like factor 5 0 0 1 NM_134248 hepatitis A virus cellular receptor 1 0 0 1 NM_194060 forkhead box O6 0 0 1 NM_178674 F-box and leucine-rich repeat protein 21 0 0 1 NM_134065 ependymin 2 0 0 1 NM_028258 DAZ interacting protein 1-like 0 0 1 NM_030069 hypothetical protein LOC78252 0 0 1 NM_025487 hypothetical protein LOC66322 0 0 1 NM_001024145 phospholipase A2 group IVF 0 0 1 NM_008806 phosphodiesterase 6B cGMP, rod receptor, beta 0 0 1 NM_130866 olfactory receptor 78 0 0 1 NM_139134 chondrolectin 0 0 1 NM_007631 cyclin D1 0 0 1 NM_177369 myosin heavy polypeptide 8, skeletal muscle, 0 0 1 NM_022886 sciellin 0 0 1 NM_028207 dual specificity phosphatase 3 vaccinia virus 0 0 1 NM_009416 tropomyosin 2 beta 0 0 1 NM_001081322 myosin VC 0 0 1 NM_177002 integral membrane transport protein UST1R 0 0 1 NM_001081115 hypothetical protein LOC233038 0 0 1 NM_001033220 hypothetical protein LOC239691 0 0 1 NM_009385 NK2 homeobox 1 0 0 1 NM_153590 killer cell lectin-like receptor family E member 0 0 1 NM_001033366 diffuse panbronchiolitis critical region 1 0 0 1 NM_001037134 cyclin E2 isoform 1 0 0 1 NM_145570 transmembrane protein 166 0 0 1 NM_008547 male germ cell-associated kinase 0 0 1 NM_022428 Iroquois related homeobox 6 0 0 1 NM_146079 guanylate cyclase activator 1B 0 0 1 NM_130886 caspase recruitment domain family member 14 0 0 1 NM_178405 ATPase Na+/K+ transporting, alpha 2 0 0 1 NM_013731 serum/glucocorticoid regulated kinase 2 0 0 1 NM_001112697 cholinergic receptor muscarinic 1 0 0 1 NM_054071 fibroblast growth factor receptor-like 1 0 0 1 NM_011775 zona pellucida glycoprotein 2 0 0 1 NM_009580 zona pellucida glycoprotein 1 0 0 1 NM_011483 zinc and ring finger 4 0 0 1 NM_011769 zinc finger imprinted 1 0 0 1 NM_009570 zinc finger protein 1 Y linked 0 0 1 NM_011727 X-linked lymphocyte-regulated 3C 0 0 1 NM_009523 wingless-related MMTV integration site 4 0 0 1 NM_054068 visual system homeobox 1 homolog 0 0 1 NM_001104540 vomeronasal receptor Vmn2r91 0 0 1 NM_001105058 vomeronasal receptor Vmn2r61 0 0 1 NM_001104619 vomeronasal receptor Vmn2r6 0 0 1 NM_001104644 vomeronasal receptor Vmn2r53 0 0 1 NM_019917 vomeronasal 2 receptor, 1b 0 0 1 NM_001104638 vomeronasal receptor Vmn2r23 0 0 1 NM_001100616 vomeronasal 2 receptor 121 0 0 1 NM_001104581 vomeronasal receptor Vmn2r117 0 0 1 NM_001104570 vomeronasal receptor Vmn2r108 0 0 1 NM_001104568 vomeronasal receptor Vmn2r106 0 0 1 NM_001104564 vomeronasal receptor Vmn2r102 0 0 1 NM_153786 vestigial like 2 homolog 0 0 1 NM_152811 UDP glucuronosyltransferase 2 family 0 0 1 NM_011667 ubiquitin-activating enzyme E1 Chr Y 1 0 0 1 NM_001080971 tubulin beta 1 0 0 1 NM_029264 tubulin tyrosine ligase-like family member 10 0 0 1 NM_001001445 transient receptor potential cation channel 0 0 1 NM_020277 transient receptor potential cation channel 0 0 1 NM_001024134 tripartite motif protein 15 0 0 1 NM_012034 tryptase gamma 1 0 0 1 NM_172880 transmembrane protease serine 11e 0 0 1 NM_020626 transmembrane protein 27 0 0 1 NM_145539 transmembrane 4 superfamily member 4 0 0 1 NM_021297 toll-like receptor 4 0 0 1 NM_009381 thyroid hormone-responsive protein 0 0 1 NM_009379 thrombopoietin 0 0 1 NM_009377 tyrosine hydroxylase 0 0 1 NM_009337 T-cell lymphoma breakpoint 1 0 0 1 NM_198960 transcription factor AP-2 epsilon 0 0 1 NM_009328 transcription factor 15 0 0 1 NM_011532 T-box 1 0 0 1 NM_019754 transgelin 3 0 0 1 NM_145133 Traf2 binding protein 0 0 1 NM_009299 seminal vesicle antigen 0 0 1 NM_032400 succinate receptor 1 0 0 1 NM_001082543 stefin A1 0 0 1 NM_001081565 synovial sarcoma X member B, breakpoint 8 0 0 1 NM_199319 synovial sarcoma X member B, breakpoint 5 0 0 1 NM_009216 somatostatin receptor 1 0 0 1 NM_011474 small proline-rich protein 2H 0 0 1 NM_025721 sperm equatorial segment protein 1 0 0 1 NM_026457 spermatid associated 0 0 1 NM_029343 spermatogenesis associated 9 0 0 1 NM_027055 sperm acrosomal membrane protein 14 0 0 1 NM_021289 submaxillary gland androgen regulated protein 2 0 0 1 NM_011422 submaxillary gland androgen regulated protein 1 0 0 1 NM_198863 SLIT and NTRK-like family member 2 0 0 1 NM_177802 aromatic-preferring amino acid transporter 0 0 1 NM_145423 solute carrier family 5 iodide transporter 0 0 1 NM_172479 solute carrier family 38 member 5 0 0 1 NM_008766 solute carrier family 22 member 6 0 0 1 NM_001100466 skint 8 0 0 1 NM_001002898 signal-regulatory protein beta 1 0 0 1 NM_027917 apical protein 2 0 0 1 NM_009161 sarcoglycan alpha dystrophin-associated 0 0 1 NM_026460 serine or cysteine peptidase inhibitor clade 0 0 1 NM_025867 serine or cysteine proteinase inhibitor clade 0 0 1 NM_199314 serine or cysteine proteinase inhibitor clade 0 0 1 NM_001083917 voltage-gated sodium channel beta-3 subunit 0 0 1 NM_029489 sterile alpha motif domain containing 7 0 0 1 NM_021390 sal-like 1 0 0 1 NM_020568 plasma membrane associated protein S3-12 0 0 1 NM_009115 S100 protein beta polypeptide, neural 0 0 1 NM_184109 retrotransposon-like 1 0 0 1 NM_011272 relaxin 1 0 0 1 NM_138954 ret finger protein-like 4 0 0 1 NM_009047 RAS-like GTP binding protein Rem 0 0 1 NM_009043 regenerating islet-derived 2 0 0 1 NM_007376 pregnancy zone protein 0 0 1 NM_013645 parvalbumin 0 0 1 NM_011198 prostaglandin-endoperoxide synthase 2 0 0 1 NM_008963 prostaglandin H2 D-isomerase 0 0 1 NM_011195 pre T-cell antigen receptor alpha 0 0 1 NM_001081211 platelet-activating factor receptor 0 0 1 NM_054060 pregnancy-specific glycoprotein 25 0 0 1 NM_029614 protease serine, 23 0 0 1 NM_144944 prokineticin receptor 2 0 0 1 NM_023741 prolactin family 8 subfamily a, member 81 0 0 1 NM_011166 prolactin family 6 subfamily a, member 1 0 0 1 NM_031377 preferentially expressed antigen in 0 0 1 NM_011134 paraoxonase 1 0 0 1 NM_008890 phenylethanolamine N-methyltransferase 0 0 1 NM_026925 pancreatic lipase 0 0 1 NM_011109 phospholipase A2 group IID 0 0 1 NM_178621 phytanoyl-CoA hydroxylase interacting 0 0 1 NM_177605 PDZ domain containing 7 0 0 1 NM_008790 Purkinje cell protein 2 0 0 1 NM_053141 protocadherin beta 16 0 0 1 NM_053135 protocadherin beta 10 0 0 1 NM_018764 protocadherin 7 0 0 1 NM_153400 purinergic receptor P2X ligand-gated ion 0 0 1 NM_001085544 hypothetical protein LOC628923 0 0 1 NM_001034887 hypothetical protein LOC433416 0 0 1 NM_177571 hypothetical protein LOC194225 0 0 1 NM_175632 osteoclast associated receptor 0 0 1 NM_011011 opioid receptor kappa 1 0 0 1 NM_001111286 oocyte maturation alpha 0 0 1 NM_138648 oxidized low density lipoprotein lectin-like 0 0 1 NM_016968 oligodendrocyte transcription factor 1 0 0 1 NM_146882 olfactory receptor 874 0 0 1 NM_146863 olfactory receptor 770 0 0 1 NM_001085477 olfactory receptor 765 0 0 1 NM_019486 olfactory receptor 71 0 0 1 NM_147043 olfactory receptor 669 0 0 1 NM_207144 olfactory receptor 645 0 0 1 NM_146380 olfactory receptor 593 0 0 1 NM_020289 olfactory receptor 544 0 0 1 NM_146519 olfactory receptor 530 0 0 1 NM_010991 olfactory receptor 49 0 0 1 NM_020291 olfactory receptor 480 0 0 1 NM_146627 olfactory receptor 350 0 0 1 NM_146878 olfactory receptor 30 0 0 1 NM_146824 olfactory receptor 273 0 0 1 NM_001001807 olfactory receptor 234 0 0 1 NM_207693 olfactory receptor 216 0 0 1 NM_001012269 olfactory receptor 1513 0 0 1 NM_146698 olfactory receptor 1443 0 0 1 NM_147003 olfactory receptor 139 0 0 1 NM_146533 olfactory receptor 1367 0 0 1 NM_207254 olfactory receptor 1286 0 0 1 NM_146967 olfactory receptor 1226 0 0 1 NM_207674 olfactory receptor 1082 0 0 1 NM_001011764 olfactory receptor 106 0 0 1 NM_147010 olfactory receptor 1052 0 0 1 NM_008760 osteoglycin 0 0 1 NM_008747 neurotensin receptor 2 0 0 1 NM_027588 5'-nucleotidase cytosolic IB 0 0 1 NM_001009948 neurensin 2 0 0 1 NM_009513 neurensin 1 0 0 1 NM_008731 neuropeptide Y receptor Y2 0 0 1 NM_023456 neuropeptide Y 0 0 1 NM_001042612 NLR family pyrin domain containing 9C 0 0 1 NM_008699 NK2 transcription factor related locus 3 0 0 1 NM_021426 Na+/K+ transporting ATPase interacting 4 0 0 1 NM_010896 neurogenin 1 0 0 1 NM_010882 necdin 0 0 1 NM_194064 nanos homolog 2 0 0 1 NM_028279 N-acetylated alpha-linked acidic dipeptidase 2 0 0 1 NM_001099635 muscle embryonic myosin heavy chain 3 0 0 1 NM_001039544 major urinary protein 3 0 0 1 NM_010814 myelin oligodendrocyte glycoprotein 0 0 1 NM_032006 matrix metalloproteinase 1a interstitial 0 0 1 NM_172883 major facilitator superfamily domain containing 0 0 1 NM_027853 methyltransferase like 7B 0 0 1 NM_023061 melanoma cell adhesion molecule 0 0 1 NM_212447 MARVEL membrane-associating domain containing 0 0 1 NM_175296 maelstrom homolog 0 0 1 NM_013591 mucosal vascular addressin cell adhesion 0 0 1 NM_053247 lymphatic vessel endothelial hyaluronan receptor 0 0 1 NM_182785 Ly6/Plaur domain containing 4 0 0 1 NM_010733 leucine rich repeat protein 3 neuronal 0 0 1 NM_001013382 leucine rich repeat containing 52 0 0 1 NM_146117 leucine rich repeat containing 26 0 0 1 NM_001085542 hypothetical protein LOC627085 0 0 1 NM_001081672 hypothetical protein LOC625638 0 0 1 NM_001097977 hypothetical protein LOC433486 0 0 1 NM_001099330 hypothetical protein LOC100043868 0 0 1 NM_001110227 potassium inwardly-rectifying channel subfamily 0 0 1 NM_144862 LIM and senescent cell antigen like domains 2 0 0 1 NM_177693 lens intrinsic membrane protein 2 0 0 1 NM_178358 lipoma HMGIC fusion partner-like 1 0 0 1 NM_008497 luteinizing hormone beta 0 0 1 NM_153069 liver-expressed antimicrobial peptide 2 0 0 1 NM_001018087 leucine zipper down-regulated in cancer 1 0 0 1 NM_130856 keratin associated protein 16-8 0 0 1 NM_028770 keratin 80 0 0 1 NM_001003669 keratin 74 0 0 1 NM_001033397 keratin 26 0 0 1 NM_008462 killer cell lectin-like receptor subfamily A, 0 0 1 NM_008456 kallikrein 1-related peptidase b5 0 0 1 NM_010639 kallikrein 1 0 0 1 NM_001081667 kelch-like 34 0 0 1 NM_144810 kelch domain containing 8A 0 0 1 NM_032540 Kell blood group 0 0 1 NM_029550 hypothetical protein LOC64697 0 0 1 NM_031169 potassium large conductance calcium-activated 0 0 1 NM_025734 potassium voltage-gated channel subfamily G, 0 0 1 NM_010595 potassium voltage-gated channel subfamily A 0 0 1 NM_021566 junctophilin 2 0 0 1 NM_008374 interleukin 9 receptor 0 0 1 NM_145856 interleukin 17F 0 0 1 NM_008318 integrin binding sialoprotein precursor 0 0 1 NM_028920 hyaluronoglucosaminidase 6 0 0 1 NM_008308 5-hydroxytryptamine serotonin receptor 1A 0 0 1 NM_025731 HRAS-like suppressor family member 5 0 0 1 NM_010471 hippocalcin 0 0 1 NM_008270 homeo box B9 0 0 1 NM_178216 histone cluster 2 H3c1 isoform 2 0 0 1 NM_178204 histone cluster 1 H3d 0 0 1 NM_010420 homeo box gene expressed in ES cells 0 0 1 NM_008183 glutathione S-transferase mu 2 0 0 1 NM_008182 glutathione S-transferase alpha 2 Yc2 0 0 1 NM_176912 G protein-coupled receptor 77 0 0 1 NM_173410 G protein-coupled receptor 26 0 0 1 NM_173365 G protein-coupled receptor 20 0 0 1 NM_181749 G protein-coupled receptor 142 0 0 1 NM_181751 G-protein coupled receptor 119 0 0 1 NM_133776 G protein-coupled receptor 110 0 0 1 NM_001008423 hypothetical protein LOC380768 0 0 1 NM_001033255 hypothetical protein LOC214568 0 0 1 NM_025467 gastrokine 2 0 0 1 NM_001010937 gap junction membrane channel protein beta 6 0 0 1 NM_010289 gap junction protein alpha 10 0 0 1 NM_010277 glial fibrillary acidic protein 0 0 1 NM_001039560 glucosaminyl N-acetyl transferase family 0 0 1 NM_001033416 galactose-3-O-sulfotransferase 4 0 0 1 NM_008061 glucose-6-phosphatase catalytic subunit 0 0 1 NM_020510 frizzled 2 0 0 1 NM_021355 fibromodulin 0 0 1 NM_030614 fibroblast growth factor 16 0 0 1 NM_011598 fatty acid binding protein 9 testis 0 0 1 NM_001039038 hypothetical protein LOC621239 0 0 1 NM_031164 coagulation factor XIII beta subunit 0 0 1 NM_007942 erythropoietin 0 0 1 NM_027984 epsin 3 0 0 1 NM_001034102 hypothetical protein LOC545047 0 0 1 NM_001034892 hypothetical protein LOC434510 0 0 1 NM_001013805 hypothetical protein LOC433634 0 0 1 NM_001037751 hypothetical LOC432867 0 0 1 NM_001013776 hypothetical protein LOC382106 0 0 1 NM_173864 complement component C1SB 0 0 1 NM_203396 experimental autoimmune prostatitis antigen 2 0 0 1 NM_183160 hypothetical protein LOC226040 0 0 1 NM_172905 hypothetical protein LOC244180 0 0 1 NM_027717 DPY30 domain containing 2 0 0 1 NM_008748 dual specificity phosphatase 8 0 0 1 NM_181564 desmoglein 4 0 0 1 NM_181680 desmoglein 1 gamma 0 0 1 NM_011993 dihydropyrimidinase-related protein 4 0 0 1 NM_016779 dentin matrix protein 1 0 0 1 NM_007867 distal-less homeobox 4 0 0 1 NM_010055 distal-less homeobox 3 0 0 1 NM_007865 delta-like 1 0 0 1 NM_010043 desmin 0 0 1 NM_001037247 beta-defensin 36 0 0 1 NM_001039120 defensin beta 26 0 0 1 NM_139225 beta-defensin 10 0 0 1 NM_019910 demilune cell and parotid protein 0 0 1 NM_172776 hypothetical protein LOC236293 0 0 1 NM_007817 cytochrome P450 family 2, subfamily f, 0 0 1 NM_021282 cytochrome P450 family 2, subfamily e, 0 0 1 NM_010005 cytochrome P450 family 2, subfamily d, 0 0 1 NM_009997 cytochrome P450 family 2, subfamily a, 0 0 1 NM_001012477 stromal cell derived factor 1 isoform gamma 0 0 1 NM_019494 chemokine C-X-C motif ligand 11 0 0 1 NM_007774 crystallin gamma A 0 0 1 NM_001033638 Crx opposite strand transcript 1 0 0 1 NM_007770 cone-rod homeobox protein isoform 1 0 0 1 NM_181664 cysteine-rich protein 3 isoform TLP-A 0 0 1 NM_198408 corticotropin releasing hormone binding protein 0 0 1 NM_177638 crumbs homolog 3 0 0 1 NM_146223 complexin III 0 0 1 NM_009925 procollagen type X, alpha 1 0 0 1 NM_199201 CLM3 0 0 1 NM_016674 claudin 1 0 0 1 NM_016803 carbohydrate chondroitin 6/keratan 0 0 1 NM_009885 carboxyl ester lipase 0 0 1 NM_026087 CEA-related cell adhesion molecule 12 0 0 1 NM_130904 CD209d antigen 0 0 1 NM_206535 Cd200 receptor 2 0 0 1 NM_181816 coiled-coil domain containing 67 0 0 1 NM_001033455 coiled-coil domain containing 27 0 0 1 NM_019626 cerebellin 1 precursor protein 0 0 1 NM_013877 calcium binding protein 5 0 0 1 NM_013878 calcium binding protein 2 0 0 1 NM_001033794 hypothetical protein LOC546161 0 0 1 NM_001081663 butyrophilin-like 7 0 0 1 NM_030747 butyrophilin-like 6 0 0 1 NM_199303 bactericidal/permeability-increasing 0 0 1 NM_016778 Bcl-2-related ovarian killer protein 0 0 1 NM_173404 bone morphogenetic protein 3 0 0 1 NM_009756 bone morphogenetic protein 10 preproprotein 0 0 1 NM_212457 Bex4 protein 0 0 1 NM_145388 bestrophin 2 0 0 1 NM_001082546 stefin A-like protein 0 0 1 NM_182636 hypothetical protein LOC328643 0 0 1 NM_001040700 hypothetical protein LOC57355 0 0 1 NM_172295 hypothetical protein LOC242125 0 0 1 NM_153535 hypothetical protein LOC212326 0 0 1 NM_173862 hypothetical protein LOC239463 0 0 1 NM_146082 hypothetical protein LOC225004 0 0 1 NM_144890 hypothetical protein LOC228802 0 0 1 NM_194347 hypothetical protein LOC278676 0 0 1 NM_177629 hypothetical protein LOC219170 0 0 1 NM_001033197 hypothetical protein LOC99169 0 0 1 NM_007493 asialoglycoprotein receptor 2 0 0 1 NM_080847 ankyrin repeat and SOCS box-containing protein 0 0 1 NM_007492 aristaless related homeobox 0 0 1 NM_007482 arginase 1 liver 0 0 1 NM_175087 aquaporin 6 0 0 1 NM_013473 annexin A8 0 0 1 NM_001024851 ankyrin repeat domain 34 0 0 1 NM_001039554 angiopoietin-like 7 0 0 1 NM_001081978 amelogenin X chromosome isoform 1 0 0 1 NM_027907 alanine-glyoxylate aminotransferase 2-like 1 0 0 1 NM_016702 alanine-glyoxylate aminotransferase 0 0 1 NM_009636 AE binding protein 1 0 0 1 NM_011996 alcohol dehydrogenase 4 class II pi 0 0 1 NM_175939 a disintegrin and metallopeptidase domain 29 0 0 1 NM_134246 acyl-CoA thioesterase 3 0 0 1 NM_001100464 androgen binding protein beta 0 0 1 NM_009596 androgen binding protein alpha 0 0 1 NM_007377 apoptosis-associated tyrosine kinase 0 0 1 NM_175503 alanine and arginine rich domain containing 0 0 1 NM_026634 hypothetical protein LOC68243 0 0 1 NM_213615 SP140 nuclear body protein family member 0 0 1 NM_177624 hypothetical protein LOC218739 0 0 1 NM_001101503 hypothetical protein LOC380787 0 0 1 NM_173434 hypothetical protein LOC245240 0 0 1 NM_001033776 hypothetical protein LOC432677 0 0 1 NM_029530 6330527O06Rik protein 0 0 1 NM_027640 RIKEN cDNA 4931432M23 0 0 1 NM_028737 hypothetical protein LOC74054 0 0 1 NM_026652 hypothetical protein LOC68274 0 0 1 NM_029199 hypothetical protein LOC75185 0 0 1 NM_029131 hypothetical protein LOC74954 0 0 1 NM_183131 hypothetical protein LOC78118 0 0 1 NM_199034 hypothetical protein LOC381816 0 0 1 NM_027597 hypothetical protein LOC70897 0 0 1 NM_001081664 hypothetical protein LOC228151 0 0 1 NM_175307 hypothetical protein LOC100342 0 0 1 NM_028317 hypothetical protein LOC72668 0 0 1 NM_028113 hypothetical protein LOC72125 0 0 1 NM_025865 hypothetical protein LOC66952 0 0 1 NM_001081961 secreted Ly6/uPAR related protein 2 0 0 1 NM_025929 intectin 0 0 1 NM_029733 hypothetical protein LOC76770 0 0 1 NM_026918 zymogen granule membrane protein 16 0 0 1 NM_028540 hypothetical protein LOC73435 0 0 1 NM_025585 hypothetical protein LOC66479 isoform 2 0 0 1 NM_029324 hypothetical protein LOC75524 0 0 1 NM_027040 hypothetical protein LOC69327 0 0 1 NM_026789 hypothetical protein LOC68625 0 0 1 NM_026271 hypothetical protein LOC67606 0 0 1 NM_021447 tripartite motif-containing 54 0 0 1 NM_001042767 protein C 0 0 1 NM_021455 WBSCR14 protein 0 0 1 NM_010691 ladybird homeobox homolog 1 0 0 1 NM_008086 growth arrest specific 1 0 0 1 NM_133709 chordin-like 2 0 0 1 NM_013478 alpha-2-glycoprotein 1 zinc precursor 0 0 1 NM_009625 adenylate cyclase activating polypeptide 1 Transcripts expressed in CD4+ T cells are listed. The total number of tags from naive (3,382,975), effector (2,790,122) and memory (3,179,174) cells was normalized to 3,000,000.