DOCSLIB.ORG

ONLINE SUPPLEMENTARY TABLE Table 2. Differentially Expressed

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
ONLINE SUPPLEMENTARY TABLE Table 2. Differentially Expressed ONLINE SUPPLEMENTARY TABLE Table 2. Differentially Expressed Probe Sets in Livers of GK Rats. A. Immune/Inflammatory (67 probe sets, 63 genes) Age Strain Probe ID Gene Name Symbol Accession Gene Function 5 WKY 1398390_at small inducible cytokine B13 precursor Cxcl13 AA892854 chemokine activity; lymph node development 5 WKY 1389581_at interleukin 33 Il33 BF390510 cytokine activity 5 WKY *1373970_at interleukin 33 Il33 AI716248 cytokine activity 5 WKY 1369171_at macrophage stimulating 1 (hepatocyte growth factor-like) Mst1; E2F2 NM_024352 serine-throenine kinase; tumor suppression 5 WKY 1388071_x_at major histocompatability antigen Mhc M24024 antigen processing and presentation 5 WKY 1385465_at sialic acid binding Ig-like lectin 5 Siglec5 BG379188 sialic acid-recognizing receptor 5 WKY 1393108_at major histocompatability antigen Mhc BM387813 antigen processing and presentation 5 WKY 1388202_at major histocompatability antigen Mhc BI395698 antigen processing and presentation 5 WKY 1371171_at major histocompatability antigen Mhc M10094 antigen processing and presentation 5 WKY 1370382_at major histocompatability antigen Mhc BI279526 antigen processing and presentation 5 WKY 1371033_at major histocompatability antigen Mhc AI715202 antigen processing and presentation 5 WKY 1383991_at leucine rich repeat containing 8 family, member E Lrrc8e BE096426 proliferation and activation of lymphocytes and monocytes. 5 WKY 1383046_at complement component factor H Cfh; Fh AA957258 regulation of complement cascade 4 WKY 1369522_a_at CD244 natural killer cell receptor 2B4 2B4; Nmrk NM_022259 regulation of NK- and T-cell function 4 WKY 1368762_at ubiquitin D Ubd NM_053299 antigen processing and presentation; IFN gamma regulated 4 WKY 1382950_at guanylate nucleotide binding protein 4 Gbp4; Gbp3 AA901350 guanylate-binding protein; IFN gamma regulated 4 WKY 1394846_at paired-Ig-like receptor A2 Pira2 AI237640 immune regulator 4 WKY 1389369_at vacuolar protein sorting 52 Vps52 BF289017 antigen processing and presentation 4 WKY 1370791_at defensin RatNP-3 precursor NP-3b U16683 defense response to bacteria & fungi; xenobiotic processing 4 WKY 1376311_at netrin G1 Ntng1 BM391312 cytokine/chemokine expression; leukocyte infiltration 4 WKY 1391481_at endogenous retrovirus RNA (ERV). Erv BE104424 hypertension related immunosuppressive activity 4 WKY 1367794_at alpha-2-macroglobulin A2m1 NM_012488 acute phase response; plasma proteinase inhibitor 4 WKY 1370428_x_at major histocompatability antigen Mhc AJ249701 antigen processing and presentation 4 WKY 1370822_at major histocompatability antigen Mhc AF307302 antigen processing and presentation 4 WKY 1389734_x_at major histocompatability antigen Mhc BI282965 antigen processing and presentation 4 WKY 1383449_at major histocompatability antigen Mhc AA801218 antigen processing and presentation 4 WKY 1397859_x_at major histocompatability antigen Mhc BI291927 antigen processing and presentation 3 WKY 1391579_at purinergic receptor P2X, ligand-gated ion channel, 7 P2rx7 AI385229 ATP-dependent activation & release of proinflammatory cytokines 3 WKY 1387839_at major histocompatability antigen Mhc NM_012646 antigen processing and presentation 3 WKY 1388255_x_at major histocompatability antigen Mhc AJ243338 antigen processing and presentation 3 WKY 1372727_at suppresor of cytokine signaling 2 Socs-2 BM384088 inhibition of cytokine signalling 3 WKY 1388233_at cytokine inducible SH2-containing protein Cis AF065161 inhibition of cytokine signalling 3 WKY 1378690_at lymphocyte antigen 6, locus A Ly6a BI291986 CD4+ T cell proliferation and cytokine production 3 WKY 1382319_at G protein-coupled receptor 68 Gpr68 BM389005 inhibition of cytokine signalling/LPS inflammatory response 3 WKY 1374558_at icos ligand inducible T-cell co-stimulator Icosl AI010316 positive regulator of IL-4 3 WKY 1370429_at major histocompatability antigen Mhc L40362 antigen processing and presentation 3 WKY 1370186_at proteosome (prosome, macropain) subunit, beta type 9 Psmb9; Lmp2 AI599350 antigen processing and presentation 3 WKY 1369427_at macrophage expressed gene 1 Mpeg1 NM_022617 complement activity 3 WKY 1397222_at tripartite motif protein 39 Trim39; Rnf23 AW528473 clustered within the class I region of MHC 3 WKY 1379994_at polycystic kidney and hepatic disease 1-like 1 Pkhd1l1 AI070694 possible role in cellular immunity 3 WKY 1385029_at caspase 12 Casp12 BE110921 apoptosis 3 WKY *1387605_at caspase 12 Casp12 NM_130422 inhibition of cytokine signalling 3 WKY 1373536_at carboxypeptidase B Cpb AW525196 fibrinolysis inhibitor 3 WKY 1382868_at sema domain, transmembrane domain (TM), and cytoplasmic domain Sema6a BM387083 apoptosis; signal transduction 3 WKY 1378418_at TRAF-interacting protein with forkhead-associated domain, family member B Tifab BI285027 cytokine signal transduction 5 GK 1369836_at interferon-induced protein with tetratricopeptide repeats 1, proinflammatory Ifit1; Garg16 NM_020096 IFN-gamma regulated; inhibits cellular stress response 5 GK 1373992_at interferon-inducible GTPase Iigp1 AI408440 IFN-gamma regulated; resistance to intracellular pathogens 5 GK *1377950_at interferon-inducible GTPase Iigp1 AA955213 IFN-gamma regulated; resistance to intracellular pathogens 5 GK 1368490_at CD14 antigen Cd14 NM_021744 LPS signalling 5 GK 1388236_x_at major histocompatability antigen Mhc M24026 antigen processing and presentation 5 GK 1371213_at major histocompatability antigen Mhc AJ005023 antigen processing and presentation 5 GK 1371119_at major histocompatability antigen Mhc L40364 antigen processing and presentation 5 GK 1369110_x_at major histocompatability antigen Mhc NM_012645 antigen processing and presentation 5 GK 1379818_at major histocompatability antigen Mhc BF288109 antigen processing and presentation 4 GK 1388485_at chemokine (C-X-C motif) ligand 14 Cxcl14; Brak BG380414 chemokine signalling 4 GK 1386695_at lymphocyte antigen 75 Ly75 BF565756 antigen processing and presentation 4 GK 1396714_at phospholipase A2, activating protein Plaa; Plap BF394289 endothelial and smooth muscle response to inflammation 4 GK 1396205_at major histocompatability antigen Mhc BI303419 antigen processing and presentation 4 GK 1370463_x_at major histocompatability antigen Mhc U50449 antigen processing and presentation 1 Table 2. Cont’d. A. Immune/Inflammatory (67 probe sets, 63 genes) Age Strain Probe ID Gene Name Symbol Accession Gene Function 4 GK 1396304_at major histocompatability antigen Mhc BI292055 antigen processing and presentation 3 GK 1396155_at immunoglobulin heavy chain: constant region and partial variable region Ighg BF283527 immunoglobulin 3 GK 1387902_a_at immunoglobulin kappa chain complex Igkc L22655 immunoglobulin 3 GK 1370056_at lymphocyte antigen 6 complex locus C Ly6-C antigen Ly6c NM_020103 CD4+ T cell proliferation and cytokine production 3 GK 1374334_at Immunoglobulin heavy chain (alpha polypeptide) Ighg AI412189 immunoglobulin 3 GK 1379357_at major histocompatability antigen Mhc AI408767 antigen processing and presentation 3 GK 1388342_at ets variant gene 3 Etv3 BI291344 macrophage differentiation 3 GK 1387366_at interleukin enhancer binding factor 3 Ilf3 NM_053412 double-stranded RNA-binding protein B. Lipid Metabolism (46 probe sets, 37 genes) Age Strain Probe ID Gene Name Symbol Accession Gene Function 5 WKY 1369663_at epoxide hydrolase 2, cytoplasmic Ephx2 NM_022936 eicosanoid breakdown; hypercholesterolemia 5 WKY 1367939_at retinol binding protein 1, cellular Rbp1 NM_012733 intracellular retinol carrier 5 WKY 1383303_at acyl-CoA synthetase medium-chain family member 3 Acsm3; Sa; Sah BI282211 fatty acid metabolism; hypertension 5 WKY 1377407_at Aa2-174 Cc1-38; Aa2-174 BI290154 fatty acid metabolism 4 WKY 1374610_at 1-acylglycerol-3-phosphate O-acyltransferase 9 Agpat9 AI599365 phospholipid biosynthesis 4 WKY 1368396_at carboxyl ester lipase Cel NM_016997 cholesterol, triglyceride catabolism 4 WKY 1368745_at solute carrier family 10, member 2 Slc10a2; Isbat NM_017222 bile salt transporter 4 WKY 1381732_at fatty acid binding protein 7 Fabp7 BF398558 fatty acid transporter 4 WKY 1369531_at sulfotransferase family, cytosolic, 1C, member 2 Sult1c2 NM_133547 degradation of bile acids through sulfation 4 WKY *1377672_at sulfotransferase family, cytosolic, 1C, member 2 Sult1c2 BI300997 degradation of bile acids through sulfation 4 WKY 1383600_at solute carrier family 13 (sodium-dependent citrate transporter), member 5 Slc13a5; Nact BG381311 citrate transport; fatty acid and cholesterol synthesis 3 WKY 1393551_at apolipoprotein A-II Apoa2 AI044529 apolipoprotein; HDL 3 WKY 1368784_at apobec-1 complementation factor Apobec-1 NM_133400 apolipoprotein synthesis; HDL 3 WKY 1388349_at creatine kinase, mitochondrial 2, sarcomeric Ckmt2 AA799557 phosphocreatine metabolism 3 WKY 1370257_at phospholipase A2, group IB Pla2g1b AI234860 phospholipid catabolism 3 WKY *1370024_at fatty acid binding protein 7 Fabp7 NM_030832 fatty acid transporter 3 WKY 1387766_a_at retinol binding protein 2, cellular Rbp2 NM_012640 vitamin A availability and storage 3 WKY 1369440_at ATP-binding cassette, sub-family G (WHITE), member 5 Abcg5; Sterolin 2 NM_130414 cholesterol absorption & transport 3 WKY 1385014_at nucleoside diphosphate linked moiety X-type motif 11 nudix BG377996 phosphohydrolase; regulation of CoA & acetylCoA levels 3 WKY 1387787_at myosin, light polypeptide 2, regulatory Myl2; Mlc2 NM_012605 trafficking of Bile Salt Export Protein 3 WKY *1388200_at myosin, light polypeptide 2, regulatory Myl2; Mlc2 BF419995 trafficking of Bile
Load more

Recommended publications
  • View of the Literature
    Roles of Adipose Tissue-Derived Factors in Adipose Tissue Development and Lipid Metabolism Dissertation Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Jinsoo Ahn, M.S. Graduate Program in Ohio State University Nutrition The Ohio State University 2015 Dissertation Committee: Kichoon Lee, Ph.D., Advisor Earl H. Harrison, Ph.D. Ramesh Selvaraj, Ph.D. Ouliana Ziouzenkova, Ph.D. Copyright by Jinsoo Ahn 2015 Abstract Obesity is a global trend and major risk factor for serious diseases including type 2 diabetes, heart disease, and hypertension. Obesity is characterized by excess fat accumulation, especially in the visceral area. The pathogenic effects related to common obesity are largely attributed to dysregulated secretion of adipokines followed by insulin resistance in peripheral tissues when adipose tissue mass is altered. White adipose tissue serves as a dynamic endocrine organ as well as a major energy reservoir for whole-body energy homeostasis. Adipokines influence various metabolic processes in the body including adipocyte differentiation; however, precise physiological roles of adipokines need to be further investigated. In addition, a large proportion of adipokines still needs to be identified. Information from the gene expression omnibus (GEO) profile, a public repository for microarray data, combined with confirmatory studies on mRNA and protein expression were used to identify a novel adipose tissue-specific gene, chordin-like 1 (Chrdl1). Further analysis showed that Chrdl1 encodes a putative secreted protein which is a new adipokine. Chrdl1 expression increases during 3T3-L1 adipocyte development in vitro and mouse adipose tissue development in vivo.
    [Show full text]
  • FABP2 Ala54thr Polymorphism and Post-Training Changes of Body Composition and Biochemical Parameters in Caucasian Women
    G C A T T A C G G C A T genes Article FABP2 Ala54Thr Polymorphism and Post-Training Changes of Body Composition and Biochemical Parameters in Caucasian Women Agata Leo ´nska-Duniec 1,*, Katarzyna Switała´ 1, Ildus I. Ahmetov 2,3 , Craig Pickering 4 , Myosotis Massidda 5 , Maciej Buryta 6, Andrzej Mastalerz 7 and Ewelina Maculewicz 7 1 Faculty of Physical Education, Gdansk University of Physical Education and Sport, 80-336 Gdansk, Poland; [email protected] 2 Laboratory of Molecular Genetics, Kazan State Medical University, 420012 Kazan, Russia; [email protected] 3 Department of Physical Education, Plekhanov Russian University of Economics, 117997 Moscow, Russia 4 Institute of Coaching and Performance, School of Sport and Wellbeing, University of Central Lancashire, Preston PR1 2HE, UK; [email protected] 5 Department of Life and Environmental Sciences, University of Cagliari, 09124 Cagliari, Italy; [email protected] 6 Institute of Physical Culture Sciences, University of Szczecin, 70-453 Szczecin, Poland; [email protected] 7 Faculty of Physical Education, Jozef Pilsudski University of Physical Education in Warsaw, 00-968 Warsaw, Poland; [email protected] (A.M.); [email protected] (E.M.) * Correspondence: [email protected] Abstract: The functional FABP2 Ala54Thr polymorphism (rs1799883) is strongly associated with lipid Citation: Leo´nska-Duniec,A.; Switała,´ K.; Ahmetov, I.I.; Pickering, and carbohydrate metabolism, although the function of its potential modifying effect on training- C.; Massidda, M.; Buryta, M.; induced changes in obesity-related parameters is still unknown. The aim of the present study was Mastalerz, A.; Maculewicz, E.
    [Show full text]
  • Supplemental Figure 1. Vimentin
    Double mutant specific genes Transcript gene_assignment Gene Symbol RefSeq FDR Fold- FDR Fold- FDR Fold- ID (single vs. Change (double Change (double Change wt) (single vs. wt) (double vs. single) (double vs. wt) vs. wt) vs. single) 10485013 BC085239 // 1110051M20Rik // RIKEN cDNA 1110051M20 gene // 2 E1 // 228356 /// NM 1110051M20Ri BC085239 0.164013 -1.38517 0.0345128 -2.24228 0.154535 -1.61877 k 10358717 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 /// BC 1700025G04Rik NM_197990 0.142593 -1.37878 0.0212926 -3.13385 0.093068 -2.27291 10358713 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 1700025G04Rik NM_197990 0.0655213 -1.71563 0.0222468 -2.32498 0.166843 -1.35517 10481312 NM_027283 // 1700026L06Rik // RIKEN cDNA 1700026L06 gene // 2 A3 // 69987 /// EN 1700026L06Rik NM_027283 0.0503754 -1.46385 0.0140999 -2.19537 0.0825609 -1.49972 10351465 BC150846 // 1700084C01Rik // RIKEN cDNA 1700084C01 gene // 1 H3 // 78465 /// NM_ 1700084C01Rik BC150846 0.107391 -1.5916 0.0385418 -2.05801 0.295457 -1.29305 10569654 AK007416 // 1810010D01Rik // RIKEN cDNA 1810010D01 gene // 7 F5 // 381935 /// XR 1810010D01Rik AK007416 0.145576 1.69432 0.0476957 2.51662 0.288571 1.48533 10508883 NM_001083916 // 1810019J16Rik // RIKEN cDNA 1810019J16 gene // 4 D2.3 // 69073 / 1810019J16Rik NM_001083916 0.0533206 1.57139 0.0145433 2.56417 0.0836674 1.63179 10585282 ENSMUST00000050829 // 2010007H06Rik // RIKEN cDNA 2010007H06 gene // --- // 6984 2010007H06Rik ENSMUST00000050829 0.129914 -1.71998 0.0434862 -2.51672
    [Show full text]
  • KLF2 Induced
    UvA-DARE (Digital Academic Repository) The transcription factor KLF2 in vascular biology Boon, R.A. Publication date 2008 Link to publication Citation for published version (APA): Boon, R. A. (2008). The transcription factor KLF2 in vascular biology. General rights It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons). Disclaimer/Complaints regulations If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You will be contacted as soon as possible. UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl) Download date:23 Sep 2021 Supplementary data: Genes induced by KLF2 Dekker et al. LocusLink Accession Gene Sequence Description Fold p-value ID number symbol change (FDR) 6654 AK022099 SOS1 cDNA FLJ12037 fis, clone HEMBB1001921. 100.00 5.9E-09 56999 AF086069 ADAMTS9 full length insert cDNA clone YZ35C05. 100.00 1.2E-09 6672 AF085934 SP100 full length insert cDNA clone YR57D07. 100.00 6.7E-13 9031 AF132602 BAZ1B Williams Syndrome critical region WS25 mRNA, partial sequence.
    [Show full text]
  • Gentaur Products List
    Chapter 2 : Gentaur Products List • Rabbit Anti LAMR1 Polyclonal Antibody Cy5 Conjugated Conjugated • Rabbit Anti Podoplanin gp36 Polyclonal Antibody Cy5 • Rabbit Anti LAMR1 CT Polyclonal Antibody Cy5 • Rabbit Anti phospho NFKB p65 Ser536 Polyclonal Conjugated Conjugated Antibody Cy5 Conjugated • Rabbit Anti CHRNA7 Polyclonal Antibody Cy5 Conjugated • Rat Anti IAA Monoclonal Antibody Cy5 Conjugated • Rabbit Anti EV71 VP1 CT Polyclonal Antibody Cy5 • Rabbit Anti Connexin 40 Polyclonal Antibody Cy5 • Rabbit Anti IAA Indole 3 Acetic Acid Polyclonal Antibody Conjugated Conjugated Cy5 Conjugated • Rabbit Anti LHR CGR Polyclonal Antibody Cy5 Conjugated • Rabbit Anti Integrin beta 7 Polyclonal Antibody Cy5 • Rabbit Anti Natrexone Polyclonal Antibody Cy5 Conjugated • Rabbit Anti MMP 20 Polyclonal Antibody Cy5 Conjugated Conjugated • Rabbit Anti Melamine Polyclonal Antibody Cy5 Conjugated • Rabbit Anti BCHE NT Polyclonal Antibody Cy5 Conjugated • Rabbit Anti NAP1 NAP1L1 Polyclonal Antibody Cy5 • Rabbit Anti Acetyl p53 K382 Polyclonal Antibody Cy5 • Rabbit Anti BCHE CT Polyclonal Antibody Cy5 Conjugated Conjugated Conjugated • Rabbit Anti HPV16 E6 Polyclonal Antibody Cy5 Conjugated • Rabbit Anti CCP Polyclonal Antibody Cy5 Conjugated • Rabbit Anti JAK2 Polyclonal Antibody Cy5 Conjugated • Rabbit Anti HPV18 E6 Polyclonal Antibody Cy5 Conjugated • Rabbit Anti HDC Polyclonal Antibody Cy5 Conjugated • Rabbit Anti Microsporidia protien Polyclonal Antibody Cy5 • Rabbit Anti HPV16 E7 Polyclonal Antibody Cy5 Conjugated • Rabbit Anti Neurocan Polyclonal
    [Show full text]
  • ACE2 Interaction Networks in COVID-19: a Physiological Framework for Prediction of Outcome in Patients with Cardiovascular Risk Factors
    Journal of Clinical Medicine Article ACE2 Interaction Networks in COVID-19: A Physiological Framework for Prediction of Outcome in Patients with Cardiovascular Risk Factors Zofia Wicik 1,2 , Ceren Eyileten 2, Daniel Jakubik 2,Sérgio N. Simões 3, David C. Martins Jr. 1, Rodrigo Pavão 1, Jolanta M. Siller-Matula 2,4,* and Marek Postula 2 1 Centro de Matemática, Computação e Cognição, Universidade Federal do ABC, Santo Andre 09606-045, Brazil; zofi[email protected] (Z.W.); [email protected] (D.C.M.J.); [email protected] (R.P.) 2 Department of Experimental and Clinical Pharmacology, Medical University of Warsaw, Center for Preclinical Research and Technology CEPT, 02-091 Warsaw, Poland; [email protected] (C.E.); [email protected] (D.J.); [email protected] (M.P.) 3 Federal Institute of Education, Science and Technology of Espírito Santo, Serra, Espírito Santo 29056-264, Brazil; [email protected] 4 Department of Internal Medicine II, Division of Cardiology, Medical University of Vienna, 1090 Vienna, Austria * Correspondence: [email protected]; Tel.: +43-1-40400-46140; Fax: +43-1-40400-42160 Received: 9 October 2020; Accepted: 17 November 2020; Published: 21 November 2020 Abstract: Background: Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection (coronavirus disease 2019; COVID-19) is associated with adverse outcomes in patients with cardiovascular disease (CVD). The aim of the study was to characterize the interaction between SARS-CoV-2 and Angiotensin-Converting Enzyme 2 (ACE2) functional networks with a focus on CVD. Methods: Using the network medicine approach and publicly available datasets, we investigated ACE2 tissue expression and described ACE2 interaction networks that could be affected by SARS-CoV-2 infection in the heart, lungs and nervous system.
    [Show full text]
  • The Role of the Mtor Pathway in Developmental Reprogramming Of
    THE ROLE OF THE MTOR PATHWAY IN DEVELOPMENTAL REPROGRAMMING OF HEPATIC LIPID METABOLISM AND THE HEPATIC TRANSCRIPTOME AFTER EXPOSURE TO 2,2',4,4'- TETRABROMODIPHENYL ETHER (BDE-47) An Honors Thesis Presented By JOSEPH PAUL MCGAUNN Approved as to style and content by: ________________________________________________________** Alexander Suvorov 05/18/20 10:40 ** Chair ________________________________________________________** Laura V Danai 05/18/20 10:51 ** Committee Member ________________________________________________________** Scott C Garman 05/18/20 10:57 ** Honors Program Director ABSTRACT An emerging hypothesis links the epidemic of metabolic diseases, such as non-alcoholic fatty liver disease (NAFLD) and diabetes with chemical exposures during development. Evidence from our lab and others suggests that developmental exposure to environmentally prevalent flame-retardant BDE47 may permanently reprogram hepatic lipid metabolism, resulting in an NAFLD-like phenotype. Additionally, we have demonstrated that BDE-47 alters the activity of both mTOR complexes (mTORC1 and 2) in hepatocytes. The mTOR pathway integrates environmental information from different signaling pathways, and regulates key cellular functions such as lipid metabolism, innate immunity, and ribosome biogenesis. Thus, we hypothesized that the developmental effects of BDE-47 on liver lipid metabolism are mTOR-dependent. To assess this, we generated mice with liver-specific deletions of mTORC1 or mTORC2 and exposed these mice and their respective controls perinatally to
    [Show full text]
  • RBP2 Belongs to a Family of Demethylases, Specific For
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector RBP2 Belongs to a Family of Demethylases, Specific for Tri- and Dimethylated Lysine 4 on Histone 3 Jesper Christensen,1,2,4 Karl Agger,1,2,4 Paul A.C. Cloos,1,2,4 Diego Pasini,1,2 Simon Rose,2 Lau Sennels,3 Juri Rappsilber,3 Klaus H. Hansen,1,2 Anna Elisabetta Salcini,2,* and Kristian Helin1,2,* 1 Centre for Epigenetics 2 Biotech Research and Innovation Centre (BRIC) University of Copenhagen, Ole Maaløes Vej 5, 2200 Copenhagen, Denmark 3 Wellcome Trust Centre for Cell Biology, University of Edinburgh, Edinburgh, EH9 3JR, UK 4 These authors contributed equally to this work. *Correspondence: [email protected] (K.H.), [email protected] (A.E.S.) DOI 10.1016/j.cell.2007.02.003 SUMMARY activity (Strahl and Allis, 2000; Turner, 2000). Thus, some of these modifications appear to play important roles in Methylation of histones has been regarded as dividing the genome into transcriptionally active and a stable modification defining the epigenetic inactive areas. program of the cell, which regulates chromatin As an example of this, tri- and dimethylation of histone structure and transcription. However, the recent H3 at lysine 4 (H3K4me3/me2) is restricted to euchromatin discovery of histone demethylases has chal- and is generally associated with active transcription (Sims lenged the stable nature of histone methylation. and Reinberg, 2006). The H3K4 tri- and dimethylation marks may facilitate transcription by the recruitment of nu- Here we demonstrate that the JARID1 proteins cleosome remodeling complexes and histone-modifying RBP2, PLU1, and SMCX are histone demethy- enzymes or by preventing transcriptional repressors lases specific for di- and trimethylated histone from binding to chromatin.
    [Show full text]
  • Differential Proteomic Analysis of the Pancreas of Diabetic Db/Db Mice Reveals the Proteins Involved in the Development of Complications of Diabetes Mellitus
    Int. J. Mol. Sci. 2014, 15, 9579-9593; doi:10.3390/ijms15069579 OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Article Differential Proteomic Analysis of the Pancreas of Diabetic db/db Mice Reveals the Proteins Involved in the Development of Complications of Diabetes Mellitus Victoriano Pérez-Vázquez 1,*, Juan M. Guzmán-Flores 1, Daniela Mares-Álvarez 1, Magdalena Hernández-Ortiz 2, Maciste H. Macías-Cervantes 1, Joel Ramírez-Emiliano 1 and Sergio Encarnación-Guevara 2 1 Depto. de Ciencias Médicas, División de Ciencias de la Salud, Campus León, Universidad de Guanajuato, León, Guanajuato 37320, Mexico; E-Mails: [email protected] (J.M.G.-F.); [email protected] (D.M.-A.); [email protected] (M.H.M.-C.); [email protected] (J.R.-E.) 2 Centro de Ciencias Genómicas, Universidad Nacional Autónoma de México, Cuernavaca, Morelos 62210, Mexico; E-Mails: [email protected] (M.H.-O.); [email protected] (S.E.-G.) * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +52-477-7143-812; Fax: +52-477-7167-623. Received: 4 April 2014; in revised form: 14 May 2014 / Accepted: 19 May 2014 / Published: 30 May 2014 Abstract: Type 2 diabetes mellitus is characterized by hyperglycemia and insulin-resistance. Diabetes results from pancreatic inability to secrete the insulin needed to overcome this resistance. We analyzed the protein profile from the pancreas of ten-week old diabetic db/db and wild type mice through proteomics. Pancreatic proteins were separated in two-dimensional polyacrylamide gel electrophoresis (2D-PAGE) and significant changes in db/db mice respect to wild type mice were observed in 27 proteins.
    [Show full text]
  • Serine Proteases with Altered Sensitivity to Activity-Modulating
    (19) & (11) EP 2 045 321 A2 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 08.04.2009 Bulletin 2009/15 C12N 9/00 (2006.01) C12N 15/00 (2006.01) C12Q 1/37 (2006.01) (21) Application number: 09150549.5 (22) Date of filing: 26.05.2006 (84) Designated Contracting States: • Haupts, Ulrich AT BE BG CH CY CZ DE DK EE ES FI FR GB GR 51519 Odenthal (DE) HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI • Coco, Wayne SK TR 50737 Köln (DE) •Tebbe, Jan (30) Priority: 27.05.2005 EP 05104543 50733 Köln (DE) • Votsmeier, Christian (62) Document number(s) of the earlier application(s) in 50259 Pulheim (DE) accordance with Art. 76 EPC: • Scheidig, Andreas 06763303.2 / 1 883 696 50823 Köln (DE) (71) Applicant: Direvo Biotech AG (74) Representative: von Kreisler Selting Werner 50829 Köln (DE) Patentanwälte P.O. Box 10 22 41 (72) Inventors: 50462 Köln (DE) • Koltermann, André 82057 Icking (DE) Remarks: • Kettling, Ulrich This application was filed on 14-01-2009 as a 81477 München (DE) divisional application to the application mentioned under INID code 62. (54) Serine proteases with altered sensitivity to activity-modulating substances (57) The present invention provides variants of ser- screening of the library in the presence of one or several ine proteases of the S1 class with altered sensitivity to activity-modulating substances, selection of variants with one or more activity-modulating substances. A method altered sensitivity to one or several activity-modulating for the generation of such proteases is disclosed, com- substances and isolation of those polynucleotide se- prising the provision of a protease library encoding poly- quences that encode for the selected variants.
    [Show full text]
  • Table SI. Primer List of Genes Used for Reverse Transcription‑Quantitative PCR Validation
    Table SI. Primer list of genes used for reverse transcription‑quantitative PCR validation. Genes Forward (5'‑3') Reverse (5'‑3') Length COL1A1 AGTGGTTTGGATGGTGCCAA GCACCATCATTTCCACGAGC 170 COL6A1 CCCCTCCCCACTCATCACTA CGAATCAGGTTGGTCGGGAA 65 COL2A1 GGTCCTGCAGGTGAACCC CTCTGTCTCCTTGCTTGCCA 181 DCT CTACGAAACCAGGATGACCGT ACCATCATTGGTTTGCCTTTCA 192 PDE4D ATTGCCCACGATAGCTGCTC GCAGATGTGCCATTGTCCAC 181 RP11‑428C19.4 ACGCTAGAAACAGTGGTGCG AATCCCCGGAAAGATCCAGC 179 GPC‑AS2 TCTCAACTCCCCTCCTTCGAG TTACATTTCCCGGCCCATCTC 151 XLOC_110310 AGTGGTAGGGCAAGTCCTCT CGTGGTGGGATTCAAAGGGA 187 COL1A1, collagen type I alpha 1; COL6A1, collagen type VI, alpha 1; COL2A1, collagen type II alpha 1; DCT, dopachrome tautomerase; PDE4D, phosphodiesterase 4D cAMP‑specific. Table SII. The differentially expressed mRNAs in the ParoAF_Control group. Gene ID logFC P‑Value Symbol Description ENSG00000165480 ‑6.4838 8.32E‑12 SKA3 Spindle and kinetochore associated complex subunit 3 ENSG00000165424 ‑6.43924 0.002056 ZCCHC24 Zinc finger, CCHC domain containing 24 ENSG00000182836 ‑6.20215 0.000817 PLCXD3 Phosphatidylinositol‑specific phospholipase C, X domain containing 3 ENSG00000174358 ‑5.79775 0.029093 SLC6A19 Solute carrier family 6 (neutral amino acid transporter), member 19 ENSG00000168916 ‑5.761 0.004046 ZNF608 Zinc finger protein 608 ENSG00000134343 ‑5.56371 0.01356 ANO3 Anoctamin 3 ENSG00000110400 ‑5.48194 0.004123 PVRL1 Poliovirus receptor‑related 1 (herpesvirus entry mediator C) ENSG00000124882 ‑5.45849 0.022164 EREG Epiregulin ENSG00000113448 ‑5.41752 0.000577 PDE4D Phosphodiesterase
    [Show full text]
  • Relating Metatranscriptomic Profiles to the Micropollutant
    1 Relating Metatranscriptomic Profiles to the 2 Micropollutant Biotransformation Potential of 3 Complex Microbial Communities 4 5 Supporting Information 6 7 Stefan Achermann,1,2 Cresten B. Mansfeldt,1 Marcel Müller,1,3 David R. Johnson,1 Kathrin 8 Fenner*,1,2,4 9 1Eawag, Swiss Federal Institute of Aquatic Science and Technology, 8600 Dübendorf, 10 Switzerland. 2Institute of Biogeochemistry and Pollutant Dynamics, ETH Zürich, 8092 11 Zürich, Switzerland. 3Institute of Atmospheric and Climate Science, ETH Zürich, 8092 12 Zürich, Switzerland. 4Department of Chemistry, University of Zürich, 8057 Zürich, 13 Switzerland. 14 *Corresponding author (email: [email protected] ) 15 S.A and C.B.M contributed equally to this work. 16 17 18 19 20 21 This supporting information (SI) is organized in 4 sections (S1-S4) with a total of 10 pages and 22 comprises 7 figures (Figure S1-S7) and 4 tables (Table S1-S4). 23 24 25 S1 26 S1 Data normalization 27 28 29 30 Figure S1. Relative fractions of gene transcripts originating from eukaryotes and bacteria. 31 32 33 Table S1. Relative standard deviation (RSD) for commonly used reference genes across all 34 samples (n=12). EC number mean fraction bacteria (%) RSD (%) RSD bacteria (%) RSD eukaryotes (%) 2.7.7.6 (RNAP) 80 16 6 nda 5.99.1.2 (DNA topoisomerase) 90 11 9 nda 5.99.1.3 (DNA gyrase) 92 16 10 nda 1.2.1.12 (GAPDH) 37 39 6 32 35 and indicates not determined. 36 37 38 39 S2 40 S2 Nitrile hydration 41 42 43 44 Figure S2: Pearson correlation coefficients r for rate constants of bromoxynil and acetamiprid with 45 gene transcripts of ECs describing nucleophilic reactions of water with nitriles.
    [Show full text]