DOCSLIB.ORG

Mouse Ccdc60 Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Ccdc60 Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Ccdc60 Knockout Project (CRISPR/Cas9) Objective: To create a Ccdc60 knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Ccdc60 gene (NCBI Reference Sequence: NM_177759 ; Ensembl: ENSMUSG00000043913 ) is located on Mouse chromosome 5. 14 exons are identified, with the ATG start codon in exon 1 and the TAG stop codon in exon 14 (Transcript: ENSMUST00000050178). Exon 6~7 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 6 starts from about 34.31% of the coding region. Exon 6~7 covers 19.02% of the coding region. The size of effective KO region: ~6090 bp. The KO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 6 7 14 Legends Exon of mouse Ccdc60 Knockout region Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section upstream of Exon 6 is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. The gRNA site is selected outside of these tandem repeats. Overview of the Dot Plot (down) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section downstream of Exon 7 is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 8 https://www.alphaknockout.com Overview of the GC Content Distribution (up) Window size: 300 bp Sequence 12 Summary: Full Length(2000bp) | A(29.2% 584) | C(23.7% 474) | T(24.0% 480) | G(23.1% 462) Note: The 2000 bp section upstream of Exon 6 is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Overview of the GC Content Distribution (down) Window size: 300 bp Sequence 12 Summary: Full Length(2000bp) | A(28.55% 571) | C(24.25% 485) | T(24.45% 489) | G(22.75% 455) Note: The 2000 bp section downstream of Exon 7 is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 4 of 8 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 2000 1 2000 2000 100.0% chr5 - 116163574 116165573 2000 browser details YourSeq 111 569 760 2000 94.4% chr10 + 79641612 79641868 257 browser details YourSeq 107 614 765 2000 93.6% chr10 + 79641244 79642097 854 browser details YourSeq 104 614 765 2000 94.1% chr13 - 103756642 103756803 162 browser details YourSeq 101 639 796 2000 93.9% chr16 - 91421057 91421359 303 browser details YourSeq 101 617 796 2000 83.5% chr12 + 106428532 106428677 146 browser details YourSeq 100 614 765 2000 93.9% chr12 + 109062907 109063112 206 browser details YourSeq 99 614 766 2000 95.5% chr14 - 31526593 31526902 310 browser details YourSeq 99 614 765 2000 93.0% chr13 - 103756694 103757011 318 browser details YourSeq 99 641 775 2000 95.3% chr1 - 78991554 78991845 292 browser details YourSeq 98 615 761 2000 86.3% chr11 - 119583186 119583314 129 browser details YourSeq 98 614 765 2000 92.2% chr10 + 8112527 8112842 316 browser details YourSeq 97 615 760 2000 93.0% chr16 - 11625332 11625489 158 browser details YourSeq 93 634 765 2000 94.3% chr13 - 103756954 103757090 137 browser details YourSeq 90 590 712 2000 97.0% chr17 - 29739162 29739424 263 browser details YourSeq 90 614 723 2000 95.1% chr19 + 25372019 25372221 203 browser details YourSeq 89 614 725 2000 94.0% chr8 - 104391337 104391461 125 browser details YourSeq 89 615 725 2000 96.0% chr13 - 103756243 103756994 752 browser details YourSeq 88 451 712 2000 97.9% chr19 - 41633139 41633563 425 browser details YourSeq 87 590 723 2000 92.4% chr15 - 86573943 86574211 269 Note: The 2000 bp section upstream of Exon 6 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 2000 1 2000 2000 100.0% chr5 - 116155484 116157483 2000 browser details YourSeq 336 1345 1697 2000 97.8% chr5 + 116189001 116189354 354 browser details YourSeq 245 346 648 2000 90.8% chr8 - 57770801 57771124 324 browser details YourSeq 236 346 648 2000 89.2% chrX - 8044872 8045407 536 browser details YourSeq 234 346 649 2000 88.8% chr10 + 78431265 78431590 326 browser details YourSeq 231 347 655 2000 88.0% chr11 + 95933618 95933945 328 browser details YourSeq 230 348 648 2000 89.2% chr4 + 133248984 133249298 315 browser details YourSeq 229 346 648 2000 90.3% chr2 + 4950441 4950775 335 browser details YourSeq 225 347 648 2000 88.5% chr10 - 42124011 42553790 429780 browser details YourSeq 224 346 648 2000 88.9% chr18 - 57843784 57844091 308 browser details YourSeq 224 341 649 2000 90.1% chr15 + 64623432 64623756 325 browser details YourSeq 223 347 649 2000 90.0% chr19 - 29223950 29224262 313 browser details YourSeq 223 346 649 2000 87.6% chr10 - 63356498 63356813 316 browser details YourSeq 223 364 648 2000 89.7% chr1 - 130988954 130989257 304 browser details YourSeq 223 343 648 2000 90.3% chr1 - 88485483 88485810 328 browser details YourSeq 223 346 648 2000 88.4% chrX + 85571027 85571347 321 browser details YourSeq 223 347 648 2000 88.5% chr8 + 83920125 83920459 335 browser details YourSeq 221 346 648 2000 89.4% chr8 - 23202385 23202704 320 browser details YourSeq 221 346 646 2000 87.3% chr11 - 95879450 95879768 319 browser details YourSeq 221 352 648 2000 90.8% chr1 - 134452678 134453009 332 Note: The 2000 bp section downstream of Exon 7 is BLAT searched against the genome. No significant similarity is found. Page 5 of 8 https://www.alphaknockout.com Gene and protein information: Ccdc60 coiled-coil domain containing 60 [ Mus musculus (house mouse) ] Gene ID: 269693, updated on 24-Oct-2019 Gene summary Official Symbol Ccdc60 provided by MGI Official Full Name coiled-coil domain containing 60 provided by MGI Primary source MGI:MGI:2141043 See related Ensembl:ENSMUSG00000043913 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as AU018954; C130098D09 Expression Restricted expression toward testis adult (RPKM 123.1) See more Orthologs human all Genomic context Location: 5; 5 F See Ccdc60 in Genome Data Viewer Exon count: 16 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 5 NC_000071.6 (116125581..116289000, complement) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 5 NC_000071.5 (116575590..116738994, complement) Chromosome 5 - NC_000071.6 Page 6 of 8 https://www.alphaknockout.com Transcript information: This gene has 2 transcripts Gene: Ccdc60 ENSMUSG00000043913 Description coiled-coil domain containing 60 [Source:MGI Symbol;Acc:MGI:2141043] Location Chromosome 5: 116,124,641-116,288,985 reverse strand. GRCm38:CM000998.2 About this gene This gene has 2 transcripts (splice variants), 110 orthologues and is a member of 1 Ensembl protein family. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Ccdc60-201 ENSMUST00000050178.12 3522 545aa ENSMUSP00000049912.6 Protein coding CCDS19599 Q8C4J0 TSL:1 GENCODE basic APPRIS P1 Ccdc60-202 ENSMUST00000086483.3 2168 207aa ENSMUSP00000083671.3 Protein coding - A0A0R4J120 TSL:1 GENCODE basic 184.34 kb Forward strand 116.12Mb 116.14Mb 116.16Mb 116.18Mb 116.20Mb 116.22Mb 116.24Mb 116.26Mb 116.28Mb Genes C330018A13Rik-201 >lncRNA Gm14507-201 >lncRNA (Comprehensive set... Gm13837-201 >lncRNA Contigs < AC119977.18 AC158756.4 > Genes (Comprehensive set... < Ccdc60-201protein coding < Ccdc60-202protein coding Regulatory Build 116.12Mb 116.14Mb 116.16Mb 116.18Mb 116.20Mb 116.22Mb 116.24Mb 116.26Mb 116.28Mb Reverse strand 184.34 kb Regulation Legend CTCF Enhancer Open Chromatin Promoter Promoter Flank Gene Legend Protein Coding merged Ensembl/Havana Ensembl protein coding Non-Protein Coding RNA gene Page 7 of 8 https://www.alphaknockout.com Transcript: ENSMUST00000050178 < Ccdc60-201protein coding Reverse strand 164.34 kb ENSMUSP00000049... MobiDB lite Low complexity (Seg) Coiled-coils (Ncoils) Pfam Protein of unknown function DUF4698 PANTHER Protein of unknown function DUF4698 All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend missense variant synonymous variant Scale bar 0 60 120 180 240 300 360 420 480 545 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC. Page 8 of 8.
Load more

Recommended publications
  • Supplemental Figure 1. Vimentin
    Double mutant specific genes Transcript gene_assignment Gene Symbol RefSeq FDR Fold- FDR Fold- FDR Fold- ID (single vs. Change (double Change (double Change wt) (single vs. wt) (double vs. single) (double vs. wt) vs. wt) vs. single) 10485013 BC085239 // 1110051M20Rik // RIKEN cDNA 1110051M20 gene // 2 E1 // 228356 /// NM 1110051M20Ri BC085239 0.164013 -1.38517 0.0345128 -2.24228 0.154535 -1.61877 k 10358717 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 /// BC 1700025G04Rik NM_197990 0.142593 -1.37878 0.0212926 -3.13385 0.093068 -2.27291 10358713 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 1700025G04Rik NM_197990 0.0655213 -1.71563 0.0222468 -2.32498 0.166843 -1.35517 10481312 NM_027283 // 1700026L06Rik // RIKEN cDNA 1700026L06 gene // 2 A3 // 69987 /// EN 1700026L06Rik NM_027283 0.0503754 -1.46385 0.0140999 -2.19537 0.0825609 -1.49972 10351465 BC150846 // 1700084C01Rik // RIKEN cDNA 1700084C01 gene // 1 H3 // 78465 /// NM_ 1700084C01Rik BC150846 0.107391 -1.5916 0.0385418 -2.05801 0.295457 -1.29305 10569654 AK007416 // 1810010D01Rik // RIKEN cDNA 1810010D01 gene // 7 F5 // 381935 /// XR 1810010D01Rik AK007416 0.145576 1.69432 0.0476957 2.51662 0.288571 1.48533 10508883 NM_001083916 // 1810019J16Rik // RIKEN cDNA 1810019J16 gene // 4 D2.3 // 69073 / 1810019J16Rik NM_001083916 0.0533206 1.57139 0.0145433 2.56417 0.0836674 1.63179 10585282 ENSMUST00000050829 // 2010007H06Rik // RIKEN cDNA 2010007H06 gene // --- // 6984 2010007H06Rik ENSMUST00000050829 0.129914 -1.71998 0.0434862 -2.51672
    [Show full text]
  • ONLINE SUPPLEMENTARY TABLE Table 2. Differentially Expressed
    ONLINE SUPPLEMENTARY TABLE Table 2. Differentially Expressed Probe Sets in Livers of GK Rats. A. Immune/Inflammatory (67 probe sets, 63 genes) Age Strain Probe ID Gene Name Symbol Accession Gene Function 5 WKY 1398390_at small inducible cytokine B13 precursor Cxcl13 AA892854 chemokine activity; lymph node development 5 WKY 1389581_at interleukin 33 Il33 BF390510 cytokine activity 5 WKY *1373970_at interleukin 33 Il33 AI716248 cytokine activity 5 WKY 1369171_at macrophage stimulating 1 (hepatocyte growth factor-like) Mst1; E2F2 NM_024352 serine-throenine kinase; tumor suppression 5 WKY 1388071_x_at major histocompatability antigen Mhc M24024 antigen processing and presentation 5 WKY 1385465_at sialic acid binding Ig-like lectin 5 Siglec5 BG379188 sialic acid-recognizing receptor 5 WKY 1393108_at major histocompatability antigen Mhc BM387813 antigen processing and presentation 5 WKY 1388202_at major histocompatability antigen Mhc BI395698 antigen processing and presentation 5 WKY 1371171_at major histocompatability antigen Mhc M10094 antigen processing and presentation 5 WKY 1370382_at major histocompatability antigen Mhc BI279526 antigen processing and presentation 5 WKY 1371033_at major histocompatability antigen Mhc AI715202 antigen processing and presentation 5 WKY 1383991_at leucine rich repeat containing 8 family, member E Lrrc8e BE096426 proliferation and activation of lymphocytes and monocytes. 5 WKY 1383046_at complement component factor H Cfh; Fh AA957258 regulation of complement cascade 4 WKY 1369522_a_at CD244 natural killer
    [Show full text]
  • Table SI. Primer List of Genes Used for Reverse Transcription‑Quantitative PCR Validation
    Table SI. Primer list of genes used for reverse transcription‑quantitative PCR validation. Genes Forward (5'‑3') Reverse (5'‑3') Length COL1A1 AGTGGTTTGGATGGTGCCAA GCACCATCATTTCCACGAGC 170 COL6A1 CCCCTCCCCACTCATCACTA CGAATCAGGTTGGTCGGGAA 65 COL2A1 GGTCCTGCAGGTGAACCC CTCTGTCTCCTTGCTTGCCA 181 DCT CTACGAAACCAGGATGACCGT ACCATCATTGGTTTGCCTTTCA 192 PDE4D ATTGCCCACGATAGCTGCTC GCAGATGTGCCATTGTCCAC 181 RP11‑428C19.4 ACGCTAGAAACAGTGGTGCG AATCCCCGGAAAGATCCAGC 179 GPC‑AS2 TCTCAACTCCCCTCCTTCGAG TTACATTTCCCGGCCCATCTC 151 XLOC_110310 AGTGGTAGGGCAAGTCCTCT CGTGGTGGGATTCAAAGGGA 187 COL1A1, collagen type I alpha 1; COL6A1, collagen type VI, alpha 1; COL2A1, collagen type II alpha 1; DCT, dopachrome tautomerase; PDE4D, phosphodiesterase 4D cAMP‑specific. Table SII. The differentially expressed mRNAs in the ParoAF_Control group. Gene ID logFC P‑Value Symbol Description ENSG00000165480 ‑6.4838 8.32E‑12 SKA3 Spindle and kinetochore associated complex subunit 3 ENSG00000165424 ‑6.43924 0.002056 ZCCHC24 Zinc finger, CCHC domain containing 24 ENSG00000182836 ‑6.20215 0.000817 PLCXD3 Phosphatidylinositol‑specific phospholipase C, X domain containing 3 ENSG00000174358 ‑5.79775 0.029093 SLC6A19 Solute carrier family 6 (neutral amino acid transporter), member 19 ENSG00000168916 ‑5.761 0.004046 ZNF608 Zinc finger protein 608 ENSG00000134343 ‑5.56371 0.01356 ANO3 Anoctamin 3 ENSG00000110400 ‑5.48194 0.004123 PVRL1 Poliovirus receptor‑related 1 (herpesvirus entry mediator C) ENSG00000124882 ‑5.45849 0.022164 EREG Epiregulin ENSG00000113448 ‑5.41752 0.000577 PDE4D Phosphodiesterase
    [Show full text]
  • DNA Methylation Alterations in Blood Cells of Toddlers with Down Syndrome
    G C A T T A C G G C A T genes Article DNA Methylation Alterations in Blood Cells of Toddlers with Down Syndrome Oxana Yu. Naumova 1,2,* , Rebecca Lipschutz 2, Sergey Yu. Rychkov 1, Olga V. Zhukova 1 and Elena L. Grigorenko 2,3,4,* 1 Vavilov Institute of General Genetics RAS, 119991 Moscow, Russia; [email protected] (S.Y.R.); [email protected] (O.V.Z.) 2 Department of Psychology, University of Houston, Houston, TX 77204, USA; [email protected] 3 Department of Psychology, Saint-Petersburg State University, 199034 Saint Petersburg, Russia 4 Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX 77030, USA * Correspondence: [email protected] or [email protected] (O.Y.N.); [email protected] (E.L.G.) Abstract: Recent research has provided evidence on genome-wide alterations in DNA methylation patterns due to trisomy 21, which have been detected in various tissues of individuals with Down syndrome (DS) across different developmental stages. Here, we report new data on the systematic genome-wide DNA methylation perturbations in blood cells of individuals with DS from a previously understudied age group—young children. We show that the study findings are highly consistent with those from the prior literature. In addition, utilizing relevant published data from two other developmental stages, neonatal and adult, we track a quasi-longitudinal trend in the DS-associated DNA methylation patterns as a systematic epigenomic destabilization with age. Citation: Naumova, O.Y.; Lipschutz, R.; Rychkov, S.Y.; Keywords: Down syndrome; infants and toddlers; trisomy 21; DNA methylation; Illumina 450K Zhukova, O.V.; Grigorenko, E.L.
    [Show full text]
  • An Ancient Germ Cell-Specific RNA-Binding Protein Protects
    RESEARCH ARTICLE An ancient germ cell-specific RNA-binding protein protects the germline from cryptic splice site poisoning Ingrid Ehrmann1, James H Crichton2, Matthew R Gazzara3,4, Katherine James5, Yilei Liu1,6, Sushma Nagaraja Grellscheid1,7, TomazˇCurk8, Dirk de Rooij9,10, Jannetta S Steyn11, Simon Cockell11, Ian R Adams2, Yoseph Barash3,12*, David J Elliott1* 1Institute of Genetic Medicine, Newcastle University, Newcastle, United Kingdom; 2MRC Human Genetics Unit, MRC Institute of Genetics and Molecular Medicine, University of Edinburgh, Edinburgh, United Kingdom; 3Department of Genetics, Perelman School of Medicine, University of Pennsylvania, Philadelphia, United States; 4Department of Biochemistry and Biophysics, Perelman School of Medicine, University of Pennsylvania, Philadelphia, United States; 5Life Sciences, Natural History Museum, London, United Kingdom; 6Department of Plant and Microbial Biology, University of Zu¨ rich, Zu¨ rich, Switzerland; 7School of Biological and Biomedical Sciences, University of Durham, Durham, United Kingdom; 8Laboratory of Bioinformatics, Faculty of Computer and Information Sciences, University of Ljubljana, Ljubljana, Slovenia; 9Reproductive Biology Group, Division of Developmental Biology, Department of Biology, Faculty of Science, Utrecht University, Utrecht, The Netherlands; 10Center for Reproductive Medicine, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands; 11Bioinformatics Support Unit, Faculty of Medical Sciences, Newcastle University, Newcastle, United Kingdom; 12Department of Computer and Information Science, University of Pennsylvania, Philadelphia, United States *For correspondence: [email protected] (YB); [email protected] (DJE) Competing interests: The Abstract Male germ cells of all placental mammals express an ancient nuclear RNA binding authors declare that no protein of unknown function called RBMXL2. Here we find that deletion of the retrogene encoding competing interests exist.
    [Show full text]
  • Insulin and Glucose Alter Death-Associated Protein Kinase 3 (DAPK3) DNA Methylation
    Page 1 of 89 Diabetes Insulin and glucose alter death-associated protein kinase 3 (DAPK3) DNA methylation in human skeletal muscle Jonathan M. Mudry1, David G. Lassiter1, Carolina Nylén1, Sonia García-Calzón2, Erik Näslund3, Anna Krook2, Juleen R. Zierath1,2,4. Running title: DAPK3 DNA methylation in human skeletal muscle 1Department of Molecular Medicine and Surgery, Integrative Physiology, Karolinska Institutet, Stockholm, Sweden. 2Department of Physiology and Pharmacology, Integrative Physiology, Karolinska Institutet, Stockholm, Sweden. 3Division of Surgery, Department of Clinical Sciences, Danderyd Hospital, Karolinska Institutet, Stockholm, Sweden. 4Section of Integrative Physiology, The Novo Nordisk Foundation Center for Basic Metabolic Research, Faculty of Health and Medical Science, University of Copenhagen, Copenhagen, Denmark. Juleen R. Zierath Department of Molecular Medicine and Surgery, Section of Integrative Physiology, Karolinska Institutet, von Eulers väg 4a, SE 171 77 Stockholm, Sweden Phone: +46 (0)8 524 87581 Fax: +46 (0) 8 33 54 36 E-mail: [email protected] Diabetes Publish Ahead of Print, published online December 23, 2016 Diabetes Page 2 of 89 Abstract DNA methylation is altered by environmental factors. We hypothesized DNA methylation is altered in skeletal muscle in response to either insulin or glucose exposure. We performed a genome-wide DNA methylation analysis in muscle from healthy men before and after insulin exposure. DNA methylation of selected genes was determined in muscle from healthy and type 2 diabetic men before and after a glucose tolerance test. Insulin altered DNA methylation in the 3’UTR of the calcium pump ATP2A3 gene. Insulin increased DNA methylation in the gene body of DAPK3, a gene involved in cell proliferation, apoptosis and autophagy.
    [Show full text]
  • Search for Type 2 Diabetes Susceptibility Genes on Chromosomes 1Q, 3Q and 12Q
    J Hum Genet (2008) 53:314–324 DOI 10.1007/s10038-008-0254-6 ORIGINAL ARTICLE Search for type 2 diabetes susceptibility genes on chromosomes 1q, 3q and 12q F. Takeuchi Æ Y. Ochiai Æ M. Serizawa Æ K. Yanai Æ N. Kuzuya Æ H. Kajio Æ S. Honjo Æ N. Takeda Æ Y. Kaburagi Æ K. Yasuda Æ S. Shirasawa Æ T. Sasazuki Æ N. Kato Received: 19 October 2007 / Accepted: 10 January 2008 / Published online: 8 February 2008 Ó The Japan Society of Human Genetics and Springer 2008 Abstract To systematically evaluate genetic susceptibil- showed a marginally significant association with an overall ity to type 2 diabetes (T2D) in ‘‘candidate’’ regions on estimated odds ratio of 0.79 (P = 0.001). No significant chromosomes 1q, 3q and 12q, we examined disease asso- association was found for known candidate gene loci on 3q, ciation by using a total of 2,083 SNPs in two-step such as ADIPOQ and IGF2BP2. Using the available sam- screening; a screening panel comprised 473 cases and 285 ples, we have observed disease associations of SNPs controls and an extended (or combined) panel involved 658 derived from two novel gene loci in the Japanese popula- cases and 474 controls. For the total interval screened (40.9 tion through high-density searches of diabetes Mb), suggestive evidence of association was provided for susceptibility in three chromosomal regions. Independent several annotated gene loci. For example, in the MCF2L2 replication will clarify the etiological relevance of these gene on 3q, a significant association (a nominal P value of genomic loci to T2D.
    [Show full text]
  • Predict AID Targeting in Non-Ig Genes Multiple Transcription Factor
    Downloaded from http://www.jimmunol.org/ by guest on September 26, 2021 is online at: average * The Journal of Immunology published online 20 March 2013 from submission to initial decision 4 weeks from acceptance to publication Multiple Transcription Factor Binding Sites Predict AID Targeting in Non-Ig Genes Jamie L. Duke, Man Liu, Gur Yaari, Ashraf M. Khalil, Mary M. Tomayko, Mark J. Shlomchik, David G. Schatz and Steven H. Kleinstein J Immunol http://www.jimmunol.org/content/early/2013/03/20/jimmun ol.1202547 Submit online. Every submission reviewed by practicing scientists ? is published twice each month by http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://www.jimmunol.org/content/suppl/2013/03/20/jimmunol.120254 7.DC1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 26, 2021. Published March 20, 2013, doi:10.4049/jimmunol.1202547 The Journal of Immunology Multiple Transcription Factor Binding Sites Predict AID Targeting in Non-Ig Genes Jamie L. Duke,* Man Liu,†,1 Gur Yaari,‡ Ashraf M. Khalil,x Mary M. Tomayko,{ Mark J. Shlomchik,†,x David G.
    [Show full text]
  • A Genome-Wide Association Study in 574 Schizophrenia Trios Using DNA
    Molecular Psychiatry (2009) 14, 796–803 & 2009 Nature Publishing Group All rights reserved 1359-4184/09 $32.00 www.nature.com/mp ORIGINAL ARTICLE A genome-wide association study in 574 schizophrenia trios using DNA pooling G Kirov1, I Zaharieva2, L Georgieva1, V Moskvina1, I Nikolov1, S Cichon3, A Hillmer3, D Toncheva2, MJ Owen1 and MC O’Donovan1 1Department of Psychological Medicine, Cardiff University, Henry Wellcome Building, Heath Park, Cardiff, UK; 2Department of Medical Genetics, University Hospital ‘Maichin Dom’, Sofia, Bulgaria and 3Department of Genomics, Life and Brain Center, University of Bonn, Bonn, Germany The cost of genome-wide association (GWA) studies can be prohibitively high when large samples are genotyped. We conducted a GWA study on schizophrenia (SZ) and to reduce the cost, we used DNA pooling. We used a parent–offspring trios design to avoid the potential problems of population stratification. We constructed pools from 605 unaffected controls, 574 SZ patients and a third pool from all the parents of the patients. We hybridized each pool eight times on Illumina HumanHap550 arrays. We estimated the allele frequencies of each pool from the averaged intensities of the arrays. The significance level of results in the trios sample was estimated on the basis of the allele frequencies in cases and non-transmitted pseudocontrols, taking into account the technical variability of the data. We selected the highest ranked SNPs for individual genotyping, after excluding poorly performing SNPs and those that showed a trend in the opposite direction in the control pool. We genotyped 63 SNPs in 574 trios and analysed the results with the transmission disequilibrium test.
    [Show full text]
  • Lupus Nephritis Supp Table 5
    Supplementary Table 5 : Transcripts and DAVID pathways correlating with the expression of CD4 in lupus kidney biopsies Positive correlation Negative correlation Transcripts Pathways Transcripts Pathways Identifier Gene Symbol Correlation coefficient with CD4 Annotation Cluster 1 Enrichment Score: 26.47 Count P_Value Benjamini Identifier Gene Symbol Correlation coefficient with CD4 Annotation Cluster 1 Enrichment Score: 3.16 Count P_Value Benjamini ILMN_1727284 CD4 1 GOTERM_BP_FAT translational elongation 74 2.50E-42 1.00E-38 ILMN_1681389 C2H2 zinc finger protein-0.40001984 INTERPRO Ubiquitin-conjugating enzyme/RWD-like 17 2.00E-05 4.20E-02 ILMN_1772218 HLA-DPA1 0.934229063 SP_PIR_KEYWORDS ribosome 60 2.00E-41 4.60E-39 ILMN_1768954 RIBC1 -0.400186083 SMART UBCc 14 1.00E-04 3.50E-02 ILMN_1778977 TYROBP 0.933302249 KEGG_PATHWAY Ribosome 65 3.80E-35 6.60E-33 ILMN_1699190 SORCS1 -0.400223681 SP_PIR_KEYWORDS ubl conjugation pathway 81 1.30E-04 2.30E-02 ILMN_1689655 HLA-DRA 0.915891173 SP_PIR_KEYWORDS protein biosynthesis 91 4.10E-34 7.20E-32 ILMN_3249088 LOC93432 -0.400285215 GOTERM_MF_FAT small conjugating protein ligase activity 35 1.40E-04 4.40E-02 ILMN_3228688 HLA-DRB1 0.906190291 SP_PIR_KEYWORDS ribonucleoprotein 114 4.80E-34 6.70E-32 ILMN_1680436 CSH2 -0.400299744 SP_PIR_KEYWORDS ligase 54 1.50E-04 2.00E-02 ILMN_2157441 HLA-DRA 0.902996561 GOTERM_CC_FAT cytosolic ribosome 59 3.20E-33 2.30E-30 ILMN_1722755 KRTAP6-2 -0.400334007 GOTERM_MF_FAT acid-amino acid ligase activity 40 1.60E-04 4.00E-02 ILMN_2066066 HLA-DRB6 0.901531942 SP_PIR_KEYWORDS
    [Show full text]
  • Supplementary Data
    SUPPLEMENTARY METHODS 1) Characterisation of OCCC cell line gene expression profiles using Prediction Analysis for Microarrays (PAM) The ovarian cancer dataset from Hendrix et al (25) was used to predict the phenotypes of the cell lines used in this study. Hendrix et al (25) analysed a series of 103 ovarian samples using the Affymetrix U133A array platform (GEO: GSE6008). This dataset comprises clear cell (n=8), endometrioid (n=37), mucinous (n=13) and serous epithelial (n=41) primary ovarian carcinomas and samples from 4 normal ovaries. To build the predictor, the Prediction Analysis of Microarrays (PAM) package in R environment was employed (http://rss.acs.unt.edu/Rdoc/library/pamr/html/00Index.html). When more than one probe described the expression of a given gene, we used the probe with the highest median absolute deviation across the samples. The dataset from Hendrix et al. (25) and the dataset of OCCC cell lines described in this manuscript were then overlaid on the basis of 11536 common unique HGNC gene symbols. Only the 99 primary ovarian cancers samples and the four normal ovary samples were used to build the predictor. Following leave one out cross-validation, a predictor based upon 126 genes was able to identify correctly the four distinct phenotypes of primary ovarian tumour samples with a misclassification rate of 18.3%. This predictor was subsequently applied to the expression data from the 12 OCCC cell lines to determine the likeliest phenotype of the OCCC cell lines compared to primary ovarian cancers. Posterior probabilities were estimated for each cell line in comparison to the following phenotypes: clear cell, endometrioid, mucinous and serous epithelial.
    [Show full text]
  • A Review of Common and Rare Genetic Variants in Schizophrenia
    Virginia Commonwealth University VCU Scholars Compass Theses and Dissertations Graduate School 2011 A Review of Common and Rare Genetic Variants in Schizophrenia Jonathan Luedders Virginia Commonwealth University Follow this and additional works at: https://scholarscompass.vcu.edu/etd Part of the Medical Genetics Commons © The Author Downloaded from https://scholarscompass.vcu.edu/etd/2540 This Thesis is brought to you for free and open access by the Graduate School at VCU Scholars Compass. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of VCU Scholars Compass. For more information, please contact [email protected]. A Review of Common and Rare Genetic Variants in Schizophrenia A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science at Virginia Commonwealth University by Jonathan Craig Luedders B.S. at University of Nebraska-Lincoln, 2009 Director: Timothy York, PhD Assistant Professor Department of Human & Molecular Genetics 1 Acknowledgments I would like to thank Dr. Tim York and my committee for their advice, information, and support through this project. I would also like to thank my family and my girlfriend Michele for their support and encouragement. All of you were important in making this project possible. ii Table of Contents List of Tables……………………………………………………………………………………..iv List of Figures……………………………………………………………………………………..v List of Abbreviations……………………………………………………………………………..vi Abstract………………………………………………………………………………………….viii Chapter 1:
    [Show full text]