An Ancient Germ Cell-Specific RNA-Binding Protein Protects
Total Page:16
File Type:pdf, Size:1020Kb
Load more
										Recommended publications
									
								- 
												  Supplemental Figure 1. VimentinDouble mutant specific genes Transcript gene_assignment Gene Symbol RefSeq FDR Fold- FDR Fold- FDR Fold- ID (single vs. Change (double Change (double Change wt) (single vs. wt) (double vs. single) (double vs. wt) vs. wt) vs. single) 10485013 BC085239 // 1110051M20Rik // RIKEN cDNA 1110051M20 gene // 2 E1 // 228356 /// NM 1110051M20Ri BC085239 0.164013 -1.38517 0.0345128 -2.24228 0.154535 -1.61877 k 10358717 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 /// BC 1700025G04Rik NM_197990 0.142593 -1.37878 0.0212926 -3.13385 0.093068 -2.27291 10358713 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 1700025G04Rik NM_197990 0.0655213 -1.71563 0.0222468 -2.32498 0.166843 -1.35517 10481312 NM_027283 // 1700026L06Rik // RIKEN cDNA 1700026L06 gene // 2 A3 // 69987 /// EN 1700026L06Rik NM_027283 0.0503754 -1.46385 0.0140999 -2.19537 0.0825609 -1.49972 10351465 BC150846 // 1700084C01Rik // RIKEN cDNA 1700084C01 gene // 1 H3 // 78465 /// NM_ 1700084C01Rik BC150846 0.107391 -1.5916 0.0385418 -2.05801 0.295457 -1.29305 10569654 AK007416 // 1810010D01Rik // RIKEN cDNA 1810010D01 gene // 7 F5 // 381935 /// XR 1810010D01Rik AK007416 0.145576 1.69432 0.0476957 2.51662 0.288571 1.48533 10508883 NM_001083916 // 1810019J16Rik // RIKEN cDNA 1810019J16 gene // 4 D2.3 // 69073 / 1810019J16Rik NM_001083916 0.0533206 1.57139 0.0145433 2.56417 0.0836674 1.63179 10585282 ENSMUST00000050829 // 2010007H06Rik // RIKEN cDNA 2010007H06 gene // --- // 6984 2010007H06Rik ENSMUST00000050829 0.129914 -1.71998 0.0434862 -2.51672
- 
												  A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes MellitusPage 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
- 
												  High-Throughput Discovery of Novel Developmental PhenotypesHigh-throughput discovery of novel developmental phenotypes The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Dickinson, M. E., A. M. Flenniken, X. Ji, L. Teboul, M. D. Wong, J. K. White, T. F. Meehan, et al. 2016. “High-throughput discovery of novel developmental phenotypes.” Nature 537 (7621): 508-514. doi:10.1038/nature19356. http://dx.doi.org/10.1038/nature19356. Published Version doi:10.1038/nature19356 Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:32071918 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Nature. Manuscript Author Author manuscript; Manuscript Author available in PMC 2017 March 14. Published in final edited form as: Nature. 2016 September 22; 537(7621): 508–514. doi:10.1038/nature19356. High-throughput discovery of novel developmental phenotypes A full list of authors and affiliations appears at the end of the article. Abstract Approximately one third of all mammalian genes are essential for life. Phenotypes resulting from mouse knockouts of these genes have provided tremendous insight into gene function and congenital disorders. As part of the International Mouse Phenotyping Consortium effort to generate and phenotypically characterize 5000 knockout mouse lines, we have identified 410 Users may view, print, copy, and download text and data-mine the content in such documents, for the purposes of academic research, subject always to the full Conditions of use:http://www.nature.com/authors/editorial_policies/license.html#terms #Corresponding author: [email protected].
- 
												  RBMX Is a Novel Hepatic Transcriptional Regulator of SREBP-1C Gene Response to High-Fructose DietView metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector FEBS Letters 581 (2007) 218–222 RBMX is a novel hepatic transcriptional regulator of SREBP-1c gene response to high-fructose diet Tadashi Takemotoa, Yoshihiko Nishiob,*, Osamu Sekineb, Chikako Ikeuchib, Yoshio Nagaib, Yasuhiro Maenob, Hiroshi Maegawab, Hiroshi Kimuraa, Atsunori Kashiwagib a Division of Molecular Genetics in Medicine, Department of Biochemistry and Molecular Biology, Shiga University of Medical Science, Shiga 520-2192, Japan b Division of Endocrinology and Metabolism, Department of Medicine, Shiga University of Medical Science, Shiga 520-2192, Japan Received 24 October 2006; accepted 1 December 2006 Available online 14 December 2006 Edited by Berend Wieringa nisms by which the high-fructose diet induces SREBP-1c gene Abstract In rodents a high-fructose diet induces metabolic derangements similar to those in metabolic syndrome. Previously expression in the liver. we suggested that in mouse liver an unidentified nuclear protein We previously reported a variation of susceptibility to these binding to the sterol regulatory element (SRE)-binding protein- metabolic disorders after monitoring the effects of high-fruc- 1c (SREBP-1c) promoter region plays a key role for the re- tose diet in different mouse strains [6]. Ten strains of inbred sponse to high-fructose diet. Here, using MALDI-TOF MASS mice were separated into CBA and DBA groups according technique, we identified an X-chromosome-linked RNA binding to their response to high-fructose diet. The hepatic mRNA motif protein (RBMX) as a new candidate molecule. In electro- expression of SREBP-1c in CBA/JN mice was remarkably ele- phoretic mobility shift assay, anti-RBMX antibody displaced the vated by high-fructose diet but not in DBA/2N.
- 
												  1 Lessons from Non-Canonical Splicing 1 2 Christopher R Sibley1,2*, Lorea Blazquez1* and Jernej Ule1 3 4 Addresses: 5View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by UCL Discovery 1 Lessons from non-canonical splicing 2 3 Christopher R Sibley1,2*, Lorea Blazquez1* and Jernej Ule1 4 5 Addresses: 6 1Department of Molecular Neuroscience, UCL Institute of Neurology, Russell 7 Square House, Russell Square, London, WC1B 5EH, UK 8 9 2Division of Brain Sciences, Imperial College, Burlington Danes, DuCane Road, 10 London W12 0NN, UK 11 12 13 Additional information: 14 * These authors contributed equally to this work 15 16 17 Correspondence to JU 18 19 E-mail: [email protected] 20 21 22 DOI: 10.1038/nrgXXXX [office use only] 1 Abstract Recent improvements in experimental and computational techniques used to study the transcriptome have enabled an unprecedented view of RNA processing, revealing many previously unknown non-canonical splicing events. 5 This includes cryptic events located far from the currently annotated exons, and unconventional splicing mechanisms that have important roles in regulating gene expression. These non-canonical splicing events are a major source of newly emerging transcripts during evolution, especially when they involve sequences derived from transposable elements. They are therefore under precise 10 regulation and quality control, which minimises their potential to disrupt gene expression. While non-canonical splicing can lead to aberrant transcripts that cause many diseases, we also explain how it can be exploited for new therapeutic strategies. 15 Introduction The vast majority of human genes contain more than one exon, and therefore introns need to be spliced from the nascent transcript and exons joined to form an mRNA that can be translated into a protein.
- 
												  Splicing and Editing of Ionotropic Glutamate Receptors: a Comprehensive Analysis Based on Human RNA‑Seq DataCellular and Molecular Life Sciences (2021) 78:5605–5630 https://doi.org/10.1007/s00018-021-03865-z Cellular andMolecular Life Sciences ORIGINAL ARTICLE Splicing and editing of ionotropic glutamate receptors: a comprehensive analysis based on human RNA‑Seq data Robin Herbrechter1 · Nadine Hube1 · Raoul Buchholz1 · Andreas Reiner1 Received: 20 March 2021 / Revised: 12 May 2021 / Accepted: 22 May 2021 / Published online: 8 June 2021 © The Author(s) 2021 Abstract Ionotropic glutamate receptors (iGluRs) play key roles for signaling in the central nervous system. Alternative splicing and RNA editing are well-known mechanisms to increase iGluR diversity and to provide context-dependent regulation. Earlier work on isoform identifcation has focused on the analysis of cloned transcripts, mostly from rodents. We here set out to obtain a systematic overview of iGluR splicing and editing in human brain based on RNA-Seq data. Using data from two large-scale transcriptome studies, we established a workfow for the de novo identifcation and quantifcation of alternative splice and editing events. We detected all canonical iGluR splice junctions, assessed the abundance of alternative events described in the literature, and identifed new splice events in AMPA, kainate, delta, and NMDA receptor subunits. Notable events include an abundant transcript encoding the GluA4 amino-terminal domain, GluA4-ATD, a novel C-terminal GluD1 (delta receptor 1) isoform, GluD1-b, and potentially new GluK4 and GluN2C isoforms. C-terminal GluN1 splicing may be controlled by inclusion of a cassette exon, which shows preference for one of the two acceptor sites in the last exon. Moreo- ver, we identifed alternative untranslated regions (UTRs) and species-specifc diferences in splicing.
- 
												  ONLINE SUPPLEMENTARY TABLE Table 2. Differentially ExpressedONLINE SUPPLEMENTARY TABLE Table 2. Differentially Expressed Probe Sets in Livers of GK Rats. A. Immune/Inflammatory (67 probe sets, 63 genes) Age Strain Probe ID Gene Name Symbol Accession Gene Function 5 WKY 1398390_at small inducible cytokine B13 precursor Cxcl13 AA892854 chemokine activity; lymph node development 5 WKY 1389581_at interleukin 33 Il33 BF390510 cytokine activity 5 WKY *1373970_at interleukin 33 Il33 AI716248 cytokine activity 5 WKY 1369171_at macrophage stimulating 1 (hepatocyte growth factor-like) Mst1; E2F2 NM_024352 serine-throenine kinase; tumor suppression 5 WKY 1388071_x_at major histocompatability antigen Mhc M24024 antigen processing and presentation 5 WKY 1385465_at sialic acid binding Ig-like lectin 5 Siglec5 BG379188 sialic acid-recognizing receptor 5 WKY 1393108_at major histocompatability antigen Mhc BM387813 antigen processing and presentation 5 WKY 1388202_at major histocompatability antigen Mhc BI395698 antigen processing and presentation 5 WKY 1371171_at major histocompatability antigen Mhc M10094 antigen processing and presentation 5 WKY 1370382_at major histocompatability antigen Mhc BI279526 antigen processing and presentation 5 WKY 1371033_at major histocompatability antigen Mhc AI715202 antigen processing and presentation 5 WKY 1383991_at leucine rich repeat containing 8 family, member E Lrrc8e BE096426 proliferation and activation of lymphocytes and monocytes. 5 WKY 1383046_at complement component factor H Cfh; Fh AA957258 regulation of complement cascade 4 WKY 1369522_a_at CD244 natural killer
- 
												  Accepted By:- Signature Redacted Department of Biology Graduate Co-Chair: Michael TEXPLORING THE FUNCTIONAL CONSERVATION OF MUSCLEBLIND (MBL) PROTEINS by MASSACH USETTS INSTITUTE Julia C. Oddo d o ECHNOLOGY B.S. Molecular, Cellular, and Developmental Biology, SE 1 7 2015 Minor Biochemistry 2011 LIB RARIES SUBMITTED TO THE DEPARTMENT OF BIOLOGY IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTERS OF SCIENCE IN BIOLOGY AT THE MASSACHUSETTS INSTITUTE OF TECHNOLOGY SEPTEMBER 2015 C 2015 Massachusetts Institute of Technology. All rights reserved. The author hereby grants to MIT permission to reproduce and to distribute publicly paper and electronic copies of this thesis document in whole or in part in any medium now known or hereafter created. Signature redacted Signature of Auth or:_ Department of Biology May 22, 2015 Certified by: Signature redacte Thesis Supervisor: Chris B. Burge Professor of Biology and Biological Engineering Director Program CSB Certified by: Signature redactec Thesis Co-Supervisor: Eric T. Wang Research Fellow Accepted by:- Signature redacted Department of Biology Graduate Co-Chair: Michael T. Hemann Associate Professor of Biology 1 EXPLORING THE FUNCTIONAL CONSERVATION OF MUSCLEBLIND (MBL) PROTEINS by Julia C. Oddo Submitted to the Department of Biology on September 8th, 2015 in Partial Fulfillment of the Requirements for the Degree of Master of Science in Biology ABSTRACT Muscleblind (Mbl) is an evolutionarily conserved family of proteins involved in many aspects of RNA metabolism, including alternative splicing. Disruption of Muscleblind in several animals lends to a variety of defects and disease, including the multi-systemic disorder Myotonic Dystrophy (DM). Though much is known about the involvement of Muscleblind in DM, there is much basic knowledge of the protein's function to be discovered.
- 
												  Mapping of Diabetes Susceptibility Loci in a Domestic Cat Breed with an Unusually High Incidence of Diabetes MellitusG C A T T A C G G C A T genes Article Mapping of Diabetes Susceptibility Loci in a Domestic Cat Breed with an Unusually High Incidence of Diabetes Mellitus 1,2, 3, 4 5 Lois Balmer y , Caroline Ann O’Leary y, Marilyn Menotti-Raymond , Victor David , Stephen O’Brien 6,7, Belinda Penglis 8, Sher Hendrickson 9, Mia Reeves-Johnson 3, 3 10 3 3,11, Susan Gottlieb , Linda Fleeman , Dianne Vankan , Jacquie Rand z and 1, , Grant Morahan * z 1 Centre for Diabetes Research, Harry Perkins Institute for Medical Research, University of Western Australia, Nedlands 6009, Australia; [email protected] 2 School of Medical and Health Sciences, Edith Cowan University, Joondalup, Perth 6027, Australia 3 School of Veterinary Science, the University of Queensland, Gottan 4343, Australia; [email protected] (C.A.O.); [email protected] (M.R.-J.); [email protected] (S.G.); [email protected] (D.V.); [email protected] (J.R.) 4 Laboratory of Genomic Diversity, Center for Cancer Research (FNLCR), Frederick, MD 21702, USA; [email protected] 5 Laboratory of Basic Research, Center for Cancer Research (FNLCR), National Cancer Institute, Frederick, MD 21702, USA; [email protected] 6 Laboratory of Genomics Diversity, Center for Computer Technologies, ITMO University, 197101 St. Petersburg, Russia; [email protected] 7 Guy Harvey Oceanographic Center, Halmos College of Arts and Sciences, Nova Southeastern University, Ft Lauderdale, FL 33004, USA 8 IDEXX Laboratories, East Brisbane 4169, Australia; [email protected] 9 Department of Biology, Shepherd University, Shepherdstown, WV 25443, USA; [email protected] 10 Animal Diabetes Australia, Melbourne 3155, Australia; l.fl[email protected] 11 American College of Veterinary Internal Medicine, University of Zurich, 8006 Zurich, Switzerland * Correspondence: [email protected] These authors contributed equally to this work.
- 
												  Table SI. Primer List of Genes Used for Reverse Transcription‑Quantitative PCR ValidationTable SI. Primer list of genes used for reverse transcription‑quantitative PCR validation. Genes Forward (5'‑3') Reverse (5'‑3') Length COL1A1 AGTGGTTTGGATGGTGCCAA GCACCATCATTTCCACGAGC 170 COL6A1 CCCCTCCCCACTCATCACTA CGAATCAGGTTGGTCGGGAA 65 COL2A1 GGTCCTGCAGGTGAACCC CTCTGTCTCCTTGCTTGCCA 181 DCT CTACGAAACCAGGATGACCGT ACCATCATTGGTTTGCCTTTCA 192 PDE4D ATTGCCCACGATAGCTGCTC GCAGATGTGCCATTGTCCAC 181 RP11‑428C19.4 ACGCTAGAAACAGTGGTGCG AATCCCCGGAAAGATCCAGC 179 GPC‑AS2 TCTCAACTCCCCTCCTTCGAG TTACATTTCCCGGCCCATCTC 151 XLOC_110310 AGTGGTAGGGCAAGTCCTCT CGTGGTGGGATTCAAAGGGA 187 COL1A1, collagen type I alpha 1; COL6A1, collagen type VI, alpha 1; COL2A1, collagen type II alpha 1; DCT, dopachrome tautomerase; PDE4D, phosphodiesterase 4D cAMP‑specific. Table SII. The differentially expressed mRNAs in the ParoAF_Control group. Gene ID logFC P‑Value Symbol Description ENSG00000165480 ‑6.4838 8.32E‑12 SKA3 Spindle and kinetochore associated complex subunit 3 ENSG00000165424 ‑6.43924 0.002056 ZCCHC24 Zinc finger, CCHC domain containing 24 ENSG00000182836 ‑6.20215 0.000817 PLCXD3 Phosphatidylinositol‑specific phospholipase C, X domain containing 3 ENSG00000174358 ‑5.79775 0.029093 SLC6A19 Solute carrier family 6 (neutral amino acid transporter), member 19 ENSG00000168916 ‑5.761 0.004046 ZNF608 Zinc finger protein 608 ENSG00000134343 ‑5.56371 0.01356 ANO3 Anoctamin 3 ENSG00000110400 ‑5.48194 0.004123 PVRL1 Poliovirus receptor‑related 1 (herpesvirus entry mediator C) ENSG00000124882 ‑5.45849 0.022164 EREG Epiregulin ENSG00000113448 ‑5.41752 0.000577 PDE4D Phosphodiesterase
- 
												  Integrated Genomic Analysis Identifies ANKRD36 Gene As a Novel and Common Biomarker of Disease Progression in Chronic Myeloid LeukemiaPreprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 25 August 2021 doi:10.20944/preprints202108.0498.v1 Article Integrated Genomic Analysis Identifies ANKRD36 Gene as a Novel and Common Biomarker of Disease Progression in Chronic Myeloid Leukemia Zafar Iqbal 1,2,3, Muhammad Absar2, Tanveer Akhtar2, Aamer Aleem4, Abid Jameel5, Sulman Basit 6, Anhar Ullah7, Sibtain Afzal8, Khushnooda Ramzan9, Mahmood Rasool10, Sajjad Karim10, Zeenat Mirza10, Mudassar Iqbal11, Mar- yam AlMajed1, Buthinah AlShehab1, Sarah AlMukhaylid1, Nouf AlMutairi1, Nawaf Al-anazi1, 12, Muhammad Farooq Sabar13, Muhammad Arshad14, Muhammad Asif15, Masood Shammas16 and Amer Mehmood15 1: Clinical Laboratory Sciences, College of Applied Medical Sciences (CoAMS-A), King Saud Bin Abdulaziz University for Health Sciences, King Abdulaziz Medical City/Kind Abdullah International Medical Research Centre (KAIMRC)/Saudi Society for Blood and Marrow Transplantation (SSBMT), King Abdulaziz Medical City, National Guard Health Affairs, Al-Ahsa, Saudi Arabia. 2:Hematology, Oncology and Pharmaco-genetic Engineering Sciences (HOPES) Group, Health Sciences Labora- tories (HaSiL), Department of Zoology, University of the Punjab (ZPU), Lahore 54590, Pakistan. 3: Next-Generation Medical Biotechnology & Genomic Medicine Division, Department of Biotechnology, Qarshi University, Lahore, Pakistan. 4Division of Hematology/Oncology, Department of Medicine, KKUH and College of Medicine, King Saud University, Riyadh, Saudi Arabia. 5 Khyber Teaching Hospital and Hayatabad Medical Complex, Peshawar, Pakistan. 6Taibah University Madinah-Center for Genetics and, Inherited Diseases Center for Genetics and Inherited Diseases,, Taibah University Madinah, 30001, Saudi Arabia, Almadinah Almunawarah 30001, Saudi Arabia. 7 National Heart and Lung Institute, Imperial College London, UK. 8Biomedical Research Laboratory, College of Medicine, Alfaisal University, Riyadh, Saudi Arabia. 9Research Centre, King Faisal Specialist Hospital and Research Centre, Riyadh, Saudi Arabia.
- 
												  Supplementary Table S4. FGA Co-Expressed Gene List in LUADSupplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase