Genomics of Inherited Bone Marrow Failure and Myelodysplasia Michael
Total Page:16
File Type:pdf, Size:1020Kb
Load more
										Recommended publications
									
								- 
												  Identification of the DNA Repair Defects in a Case of Dubowitz SyndromeIdentification of the DNA Repair Defects in a Case of Dubowitz Syndrome Jingyin Yue, Huimei Lu, Shijie Lan, Jingmei Liu, Mark N. Stein, Bruce G. Haffty, Zhiyuan Shen* The Cancer Institute of New Jersey, Robert Wood Johnson Medical School, New Brunswick, New Jersey, United States of America Abstract Dubowitz Syndrome is an autosomal recessive disorder with a unique set of clinical features including microcephaly and susceptibility to tumor formation. Although more than 140 cases of Dubowitz syndrome have been reported since 1965, the genetic defects of this disease has not been identified. In this study, we systematically analyzed the DNA damage response and repair capability of fibroblasts established from a Dubowitz Syndrome patient. Dubowitz syndrome fibroblasts are hypersensitive to ionizing radiation, bleomycin, and doxorubicin. However, they have relatively normal sensitivities to mitomycin-C, cisplatin, and camptothecin. Dubowitz syndrome fibroblasts also have normal DNA damage signaling and cell cycle checkpoint activations after DNA damage. These data implicate a defect in repair of DNA double strand break (DSB) likely due to defective non-homologous end joining (NHEJ). We further sequenced several genes involved in NHEJ, and identified a pair of novel compound mutations in the DNA Ligase IV gene. Furthermore, expression of wild type DNA ligase IV completely complement the DNA repair defects in Dubowitz syndrome fibroblasts, suggesting that the DNA ligase IV mutation is solely responsible for the DNA repair defects. These data suggests that at least subset of Dubowitz syndrome can be attributed to DNA ligase IV mutations. Citation: Yue J, Lu H, Lan S, Liu J, Stein MN, et al.
- 
												  Inherited Bone Marrow Failure Syndrome (IBMFS) TestingLab Management Guidelines V2.0.2021 Inherited Bone Marrow Failure Syndrome (IBMFS) Testing MOL.TS.360.A v2.0.2021 Introduction Inherited bone marrow failure syndrome (IBMFS) genetic testing is addressed by this guideline. Procedures addressed The inclusion of any procedure code in this table does not imply that the code is under management or requires prior authorization. Refer to the specific Health Plan's procedure code list for management requirements. Procedures addressed by this Procedure codes guideline IBMFS Multigene panel 81479 What are inherited bone marrow failure syndromes Definition Bone marrow failure (BMF) is the inability of the bone marrow to produce a sufficient quantity of functional blood cells to meet physiologic demands.1 BMF is typically classified into three categories, based on presumed etiology: inherited, secondary, or idiopathic.1 Inherited bone marrow failure syndromes (IBMFSs) are a group of genetically defined disorders that are characterized by BMF. Individuals presenting with aplastic anemia (AA), myelodysplastic syndrome (MDS), acute myeloid leukemia (AML), and chronic unexplained cytopenias should be evaluated for an IBMFS.1 Incidence "The incidence of inherited bone marrow failures accounts for 10% to 15% of marrow aplasia and 30% of pediatric bone marrow failure disorders with approximately 65 cases per million live births every year."2 Seventy-five percent of children with an IBMFS have an identifiable cause.2 ©2021 eviCore healthcare. All Rights Reserved. 1 of 17 400 Buckwalter Place Boulevard, Bluffton, SC 29910 (800) 918-8924 www.eviCore.com Lab Management Guidelines V2.0.2021 Symptoms While specific features may vary by each type of IBMFS, features that are present in most IBMFSs include bone marrow failure with single or multi-lineage cytopenia.
- 
												  Open Full PageCCR PEDIATRIC ONCOLOGY SERIES CCR Pediatric Oncology Series Recommendations for Childhood Cancer Screening and Surveillance in DNA Repair Disorders Michael F. Walsh1, Vivian Y. Chang2, Wendy K. Kohlmann3, Hamish S. Scott4, Christopher Cunniff5, Franck Bourdeaut6, Jan J. Molenaar7, Christopher C. Porter8, John T. Sandlund9, Sharon E. Plon10, Lisa L. Wang10, and Sharon A. Savage11 Abstract DNA repair syndromes are heterogeneous disorders caused by around the world to discuss and develop cancer surveillance pathogenic variants in genes encoding proteins key in DNA guidelines for children with cancer-prone disorders. Herein, replication and/or the cellular response to DNA damage. The we focus on the more common of the rare DNA repair dis- majority of these syndromes are inherited in an autosomal- orders: ataxia telangiectasia, Bloom syndrome, Fanconi ane- recessive manner, but autosomal-dominant and X-linked reces- mia, dyskeratosis congenita, Nijmegen breakage syndrome, sive disorders also exist. The clinical features of patients with DNA Rothmund–Thomson syndrome, and Xeroderma pigmento- repair syndromes are highly varied and dependent on the under- sum. Dedicated syndrome registries and a combination of lying genetic cause. Notably, all patients have elevated risks of basic science and clinical research have led to important in- syndrome-associated cancers, and many of these cancers present sights into the underlying biology of these disorders. Given the in childhood. Although it is clear that the risk of cancer is rarity of these disorders, it is recommended that centralized increased, there are limited data defining the true incidence of centers of excellence be involved directly or through consulta- cancer and almost no evidence-based approaches to cancer tion in caring for patients with heritable DNA repair syn- surveillance in patients with DNA repair disorders.
- 
												  Unravelling the Cellular Origin and Clinical Prognostic Markers of InfantPublished Ahead of Print on January 24, 2019, as doi:10.3324/haematol.2018.206375. Copyright 2019 Ferrata Storti Foundation. Unravelling the cellular origin and clinical prognostic markers of infant B-cell acute lymphoblastic leukemia using genome-wide analysis by Antonio Agraz-Doblas, Clara Bueno, Rachael Bashford-Rogers, Anindita Roy, Pauline Schneider, Michela Bardini, Paola Ballerini, Gianni Cazzaniga, Thaidy Moreno, Carlos Revilla, Marta Gut, Maria G Valsecchi, Irene Roberts, Rob Pieters, Paola De Lorenzo, Ignacio Varela, Pablo Menendez, and Ronald W Stam Haematologica 2019 [Epub ahead of print] Citation: Antonio Agraz-Doblas, Clara Bueno, Rachael Bashford-Rogers, Anindita Roy, Pauline Schneider, Michela Bardini, Paola Ballerini, Gianni Cazzaniga, Thaidy Moreno, Carlos Revilla, Marta Gut, Maria G Valsecchi, Irene Roberts, Rob Pieters, Paola De Lorenzo, Ignacio Varela, Pablo Menendez, and Ronald W Stam. Unravelling the cellular origin and clinical prognostic markers of infant B-cell acute lymphoblastic leukemia using genome-wide analysis Haematologica. 2019; 104:xxx doi:10.3324/haematol.2018.206375 Publisher's Disclaimer. E-publishing ahead of print is increasingly important for the rapid dissemination of science. Haematologica is, therefore, E-publishing PDF files of an early version of manuscripts that have completed a regular peer review and have been accepted for publication. E-publishing of this PDF file has been approved by the authors. After having E-published Ahead of Print, manuscripts will then undergo technical and English editing, typesetting, proof correction and be presented for the authors' final approval; the final version of the manuscript will then appear in print on a regular issue of the journal. All legal disclaimers that apply to the journal also pertain to this production process.
- 
												  A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes MellitusPage 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
- 
												  Genome-Wide DNA Methylation Profiling Identifies Differential Methylation in Uninvolved Psoriatic EpidermisGenome-Wide DNA Methylation Profiling Identifies Differential Methylation in Uninvolved Psoriatic Epidermis Deepti Verma, Anna-Karin Ekman, Cecilia Bivik Eding and Charlotta Enerbäck The self-archived postprint version of this journal article is available at Linköping University Institutional Repository (DiVA): http://urn.kb.se/resolve?urn=urn:nbn:se:liu:diva-147791 N.B.: When citing this work, cite the original publication. Verma, D., Ekman, A., Bivik Eding, C., Enerbäck, C., (2018), Genome-Wide DNA Methylation Profiling Identifies Differential Methylation in Uninvolved Psoriatic Epidermis, Journal of Investigative Dermatology, 138(5), 1088-1093. https://doi.org/10.1016/j.jid.2017.11.036 Original publication available at: https://doi.org/10.1016/j.jid.2017.11.036 Copyright: Elsevier http://www.elsevier.com/ Genome-Wide DNA Methylation Profiling Identifies Differential Methylation in Uninvolved Psoriatic Epidermis Deepti Verma*a, Anna-Karin Ekman*a, Cecilia Bivik Edinga and Charlotta Enerbäcka *Authors contributed equally aIngrid Asp Psoriasis Research Center, Department of Clinical and Experimental Medicine, Division of Dermatology, Linköping University, Linköping, Sweden Corresponding author: Charlotta Enerbäck Ingrid Asp Psoriasis Research Center, Department of Clinical and Experimental Medicine, Linköping University SE-581 85 Linköping, Sweden Phone: +46 10 103 7429 E-mail: [email protected] Short title Differential methylation in psoriasis Abbreviations CGI, CpG island; DMS, differentially methylated site; RRBS, reduced representation bisulphite sequencing Keywords (max 6) psoriasis, epidermis, methylation, Wnt, susceptibility, expression 1 ABSTRACT Psoriasis is a chronic inflammatory skin disease with both local and systemic components. Genome-wide approaches have identified more than 60 psoriasis-susceptibility loci, but genes are estimated to explain only one third of the heritability in psoriasis, suggesting additional, yet unidentified, sources of heritability.
- 
												  Download Validation DataPrimePCR™Assay Validation Report Gene Information Gene Name FAST kinase domain-containing protein 1 Gene Symbol Fastkd1 Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. NM_001191738 UniGene ID Rn.226110 Ensembl Gene ID ENSRNOG00000024335 Entrez Gene ID 311112 Assay Information Unique Assay ID qRnoCEP0034063 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSRNOT00000036585 Amplicon Context Sequence AAAAAAAAAAACTACAGTCATGATCTGCCTGCTCCAAATATCTGTTCTCTCAGGTA GTCCATCCGTGTATCCTTCGTTGACATTGCCATGGAGTTCCA Amplicon Length (bp) 68 Chromosome Location 3:62537455-62537552 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 97 R2 0.9997 cDNA Cq 23.19 cDNA Tm (Celsius) 79 gDNA Cq Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Fastkd1, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. Details for each transcript can be found on the Ensembl website at www.ensembl.org.
- 
												  Ryanodine Receptors Are Part of the Myospryn Complex in Cardiac Muscle Received: 10 March 2017 Matthew Awww.nature.com/scientificreports OPEN Ryanodine receptors are part of the myospryn complex in cardiac muscle Received: 10 March 2017 Matthew A. Benson1, Caroline L. Tinsley2, Adrian J. Waite 2, Francesca A. Carlisle2, Steve M. Accepted: 12 June 2017 M. Sweet3, Elisabeth Ehler4, Christopher H. George5, F. Anthony Lai5,6, Enca Martin-Rendon7 Published online: 24 July 2017 & Derek J. Blake 2 The Cardiomyopathy–associated gene 5 (Cmya5) encodes myospryn, a large tripartite motif (TRIM)- related protein found predominantly in cardiac and skeletal muscle. Cmya5 is an expression biomarker for a number of diseases afecting striated muscle and may also be a schizophrenia risk gene. To further understand the function of myospryn in striated muscle, we searched for additional myospryn paralogs. Here we identify a novel muscle-expressed TRIM-related protein minispryn, encoded by Fsd2, that has extensive sequence similarity with the C-terminus of myospryn. Cmya5 and Fsd2 appear to have originated by a chromosomal duplication and are found within evolutionarily-conserved gene clusters on diferent chromosomes. Using immunoafnity purifcation and mass spectrometry we show that minispryn co-purifes with myospryn and the major cardiac ryanodine receptor (RyR2) from heart. Accordingly, myospryn, minispryn and RyR2 co-localise at the junctional sarcoplasmic reticulum of isolated cardiomyocytes. Myospryn redistributes RyR2 into clusters when co-expressed in heterologous cells whereas minispryn lacks this activity. Together these data suggest a novel role for the myospryn complex in the assembly of ryanodine receptor clusters in striated muscle. Te unique cytoskeletal organisation of striated muscle is dependent upon the formation of specialised interac- tions between proteins that have both structural and signalling functions1.
- 
												  1 Supporting Information for a Microrna Network RegulatesSupporting Information for A microRNA Network Regulates Expression and Biosynthesis of CFTR and CFTR-ΔF508 Shyam Ramachandrana,b, Philip H. Karpc, Peng Jiangc, Lynda S. Ostedgaardc, Amy E. Walza, John T. Fishere, Shaf Keshavjeeh, Kim A. Lennoxi, Ashley M. Jacobii, Scott D. Rosei, Mark A. Behlkei, Michael J. Welshb,c,d,g, Yi Xingb,c,f, Paul B. McCray Jr.a,b,c Author Affiliations: Department of Pediatricsa, Interdisciplinary Program in Geneticsb, Departments of Internal Medicinec, Molecular Physiology and Biophysicsd, Anatomy and Cell Biologye, Biomedical Engineeringf, Howard Hughes Medical Instituteg, Carver College of Medicine, University of Iowa, Iowa City, IA-52242 Division of Thoracic Surgeryh, Toronto General Hospital, University Health Network, University of Toronto, Toronto, Canada-M5G 2C4 Integrated DNA Technologiesi, Coralville, IA-52241 To whom correspondence should be addressed: Email: [email protected] (M.J.W.); yi- [email protected] (Y.X.); Email: [email protected] (P.B.M.) This PDF file includes: Materials and Methods References Fig. S1. miR-138 regulates SIN3A in a dose-dependent and site-specific manner. Fig. S2. miR-138 regulates endogenous SIN3A protein expression. Fig. S3. miR-138 regulates endogenous CFTR protein expression in Calu-3 cells. Fig. S4. miR-138 regulates endogenous CFTR protein expression in primary human airway epithelia. Fig. S5. miR-138 regulates CFTR expression in HeLa cells. Fig. S6. miR-138 regulates CFTR expression in HEK293T cells. Fig. S7. HeLa cells exhibit CFTR channel activity. Fig. S8. miR-138 improves CFTR processing. Fig. S9. miR-138 improves CFTR-ΔF508 processing. Fig. S10. SIN3A inhibition yields partial rescue of Cl- transport in CF epithelia.
- 
												  Cellular and Molecular Signatures in the Disease Tissue of EarlyCellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
- 
												  (12) United States Patent (10) Patent No.: US 8,609,416 B2 Barnett (45) Date of Patent: DecUSOO8609416B2 (12) United States Patent (10) Patent No.: US 8,609,416 B2 Barnett (45) Date of Patent: Dec. 17, 2013 (54) METHODS AND COMPOSITIONS OTHER PUBLICATIONS COMPRISING HEAT SHOCKPROTEINS Novoselova et al., “Treatment with extracellular HSP70/HSC70 pro (75) Inventor: Michael E. Barnett, Manhattan, KS tein can reduce polyglutamine toxicity and aggregation.” J (US) Neurochem 94:597-606, 2005.* Johnson et al., (1993) Exogenous HSP70 becomes cell associated but (73) Assignee: Ventria Bioscience, Fort Collins, CO not internalized, by stressed arterial Smooth muscle cell. In vitro (US) Cellular and Developmental Biology—Animal, vol. 29A. No. 10, pp. 807-821. (*) Notice: Subject to any disclaimer, the term of this Bethke et al., (2002) Different efficiency of heat shock proteins patent is extended or adjusted under 35 (HSP) to activate human monocytes and dendritic cells; Superiority of U.S.C. 154(b) by 244 days. HSP60, The Journal of Immunology, vol. 169, pp. 6141-6148. Khan et al., (2008) Toll-like receptor 4-mediated growth of (21) Appl. No.: 12/972,112 endometriosis by human heat-shock protein 70, Human Reproduc tion, vol. 23, No. 10, pp. 2210-2219. (22) Filed: Dec. 17, 2010 Lasunskaia E.B., et al., (2003) Transfection of NSO myeloma fusion partner cells with HSP70 gene results in higher hybridoma yield by (65) Prior Publication Data improving cellular resistance to apoptosis, Biotechnology and Bioengineering 81 (4):496-504. US 2011 FO189751A1 Aug. 4, 2011 * cited by examiner Related U.S. Application Data (60) Provisional application No. 61/288,234, filed on Dec. Primary Examiner — Rosanne Kosson 18, 2009.
- 
												  Integrated Genomic Analysis Identifies ANKRD36 Gene As a Novel and Common Biomarker of Disease Progression in Chronic Myeloid LeukemiaPreprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 25 August 2021 doi:10.20944/preprints202108.0498.v1 Article Integrated Genomic Analysis Identifies ANKRD36 Gene as a Novel and Common Biomarker of Disease Progression in Chronic Myeloid Leukemia Zafar Iqbal 1,2,3, Muhammad Absar2, Tanveer Akhtar2, Aamer Aleem4, Abid Jameel5, Sulman Basit 6, Anhar Ullah7, Sibtain Afzal8, Khushnooda Ramzan9, Mahmood Rasool10, Sajjad Karim10, Zeenat Mirza10, Mudassar Iqbal11, Mar- yam AlMajed1, Buthinah AlShehab1, Sarah AlMukhaylid1, Nouf AlMutairi1, Nawaf Al-anazi1, 12, Muhammad Farooq Sabar13, Muhammad Arshad14, Muhammad Asif15, Masood Shammas16 and Amer Mehmood15 1: Clinical Laboratory Sciences, College of Applied Medical Sciences (CoAMS-A), King Saud Bin Abdulaziz University for Health Sciences, King Abdulaziz Medical City/Kind Abdullah International Medical Research Centre (KAIMRC)/Saudi Society for Blood and Marrow Transplantation (SSBMT), King Abdulaziz Medical City, National Guard Health Affairs, Al-Ahsa, Saudi Arabia. 2:Hematology, Oncology and Pharmaco-genetic Engineering Sciences (HOPES) Group, Health Sciences Labora- tories (HaSiL), Department of Zoology, University of the Punjab (ZPU), Lahore 54590, Pakistan. 3: Next-Generation Medical Biotechnology & Genomic Medicine Division, Department of Biotechnology, Qarshi University, Lahore, Pakistan. 4Division of Hematology/Oncology, Department of Medicine, KKUH and College of Medicine, King Saud University, Riyadh, Saudi Arabia. 5 Khyber Teaching Hospital and Hayatabad Medical Complex, Peshawar, Pakistan. 6Taibah University Madinah-Center for Genetics and, Inherited Diseases Center for Genetics and Inherited Diseases,, Taibah University Madinah, 30001, Saudi Arabia, Almadinah Almunawarah 30001, Saudi Arabia. 7 National Heart and Lung Institute, Imperial College London, UK. 8Biomedical Research Laboratory, College of Medicine, Alfaisal University, Riyadh, Saudi Arabia. 9Research Centre, King Faisal Specialist Hospital and Research Centre, Riyadh, Saudi Arabia.