DOCSLIB.ORG

(12) United States Patent (10) Patent No.: US 8,609,416 B2 Barnett (45) Date of Patent: Dec

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(12) United States Patent (10) Patent No.: US 8,609,416 B2 Barnett (45) Date of Patent: Dec USOO8609416B2 (12) United States Patent (10) Patent No.: US 8,609,416 B2 Barnett (45) Date of Patent: Dec. 17, 2013 (54) METHODS AND COMPOSITIONS OTHER PUBLICATIONS COMPRISING HEAT SHOCKPROTEINS Novoselova et al., “Treatment with extracellular HSP70/HSC70 pro (75) Inventor: Michael E. Barnett, Manhattan, KS tein can reduce polyglutamine toxicity and aggregation.” J (US) Neurochem 94:597-606, 2005.* Johnson et al., (1993) Exogenous HSP70 becomes cell associated but (73) Assignee: Ventria Bioscience, Fort Collins, CO not internalized, by stressed arterial Smooth muscle cell. In vitro (US) Cellular and Developmental Biology—Animal, vol. 29A. No. 10, pp. 807-821. (*) Notice: Subject to any disclaimer, the term of this Bethke et al., (2002) Different efficiency of heat shock proteins patent is extended or adjusted under 35 (HSP) to activate human monocytes and dendritic cells; Superiority of U.S.C. 154(b) by 244 days. HSP60, The Journal of Immunology, vol. 169, pp. 6141-6148. Khan et al., (2008) Toll-like receptor 4-mediated growth of (21) Appl. No.: 12/972,112 endometriosis by human heat-shock protein 70, Human Reproduc tion, vol. 23, No. 10, pp. 2210-2219. (22) Filed: Dec. 17, 2010 Lasunskaia E.B., et al., (2003) Transfection of NSO myeloma fusion partner cells with HSP70 gene results in higher hybridoma yield by (65) Prior Publication Data improving cellular resistance to apoptosis, Biotechnology and Bioengineering 81 (4):496-504. US 2011 FO189751A1 Aug. 4, 2011 * cited by examiner Related U.S. Application Data (60) Provisional application No. 61/288,234, filed on Dec. Primary Examiner — Rosanne Kosson 18, 2009. (74) Attorney, Agent, or Firm — Dennis A. Bennett (51) Int. Cl. CI2N 5/02 (2006.01) (57) ABSTRACT (52) U.S. Cl. USPC ........................................... 435/405:435/.407 Compositions, and uses thereof, which are beneficial for (58) Field of Classification Search eukaryotic cells in culture, and methods for their use in pro USPC .................................................. 435/405, 407 moting cell growth, viability and recombinant protein expres See application file for complete search history. Sion. The methods disclosed in the present application are useful, for example, for improving cell viability and in accel (56) References Cited erating the rate of cell growth of cells grown in culture. In one aspect, the Supplements of the invention are useful for U.S. PATENT DOCUMENTS improving or enhancing the yield of the recombinant proteins 2004/OO72347 A1 4/2004 Schuler et al. from the cell cultures. 2010, OO15713 A1 1/2010 Deeter 2012,0315697 A1 12/2012 Pettit et al. 2013. O157356 A1 6, 2013 Barnett 25 Claims, 15 Drawing Sheets Seracare + Hsp70 and Cellastim neg control Sera + Hsp70 Cellastim 1.0 ug/ml 5.0 ug/ml 10.0 ug/ml conc. of Hsp70 U.S. Patent Dec. 17, 2013 Sheet 1 of 15 US 8,609,416 B2 Figure 1 Sigma Albumin 1600 14OO 2OO OOO 8OO 6OO 2 41 61 81 01 121 141 16 81 201 22 Mw (kDa) Celastin PO107 101 126 151 Mw (kDa) Celastin PO71 as -"T"- 13 25 37 49 61 73 85 97 09 12 133 45 157 169 181 1932O5 2.17 229 Mw (kDa) U.S. Patent Dec. 17, 2013 Sheet 2 of 15 US 8,609,416 B2 Figure 1 continued Cellastim P0171 (solid line) and Sigma Albumin (dotted line) 13 25 37 49 61 73 85 97 109 121 133 145 157 169 18, 1932O5 217 229 Mw (kDa) P0171 (solid line) and PO107 (dotted line) 1500 OOO 500 3 25 37 49 61 73 85 97 O9 12 133 45 157 69 18, 1932O5 2.17 229 Mw (kDa) U.S. Patent Dec. 17, 2013 Sheet 3 of 15 US 8,609,416 B2 Igure 1 continue fee.8 28:8-8-2ss 3-4-3 is : sess st . rts ---------- 5. i.3 s 33 ir U.S. Patent Dec. 17, 2013 Sheet 4 of 15 US 8,609,416 B2 Figure 2 2 3 4 S 6 7 8 9 0. 1 2 3 4 5 6 7 S 9 () U.S. Patent Dec. 17, 2013 Sheet 5 Of 15 US 8,609,416 B2 Figure 3 Cell Prime, Seracare, and Cellastim Albumin in cell Culture neg Cont Cell Prime SeraCare Cellastim 0.5 mg/ml 1.0 mg/ml 5 mg/ml 10 mg/ml album in Concentration Endotoxin levels in old (B000) vs. new (B0000C) process U.S. Patent Dec. 17, 2013 Sheet 6 of 15 US 8,609,416 B2 Figure 3 continued Cell Viability from old (B000) and new (B0000C) process 5 10 - S.S. S.So S s°ss Soss So deSS NS.S. S Se. Sg. SSC S CSS & 5 g g g g g g (5 & &SSSSSSSSSS) (S&S (S S S S S S &S U.S. Patent Dec. 17, 2013 Sheet 7 Of 15 US 8,609,416 B2 Figure 4 A LANE: 2 3 4. 7 8 9 () () 75 MW S) (kDa)kD 25 2) S B Hsp- Hisp-2 1) SDBE 2) SDBE 3) Hsp70/HSA 4) HSA 5) HSA 6) Hsp70 7) C.-amylase 8) 01-amylase U.S. Patent Dec. 17, 2013 Sheet 8 of 15 US 8,609,416 B2 Figure 4 continued Enzymatic activity of ATP-agarose purified Hsp70 from Cellastim has 4. & ox o o o ovu r c D N C O has C ce e d E dialysate 1 dialysate 2 sample 1 sample 2 U.S. Patent Dec. 17, 2013 Sheet 9 Of 15 US 8,609,416 B2 Figure 5 Hsp70 and Seracare Albumin in Cell Culture neg cont Hsp70 Seracare Hsp70 + Seracare S& 0.5ug/ml 1 ug/ml 5ug/ml 10 ug/ml X1000 for Sera care U.S. Patent Dec. 17, 2013 Sheet 10 of 15 US 8,609,416 B2 Figure 6: Seracare vs. Hsp70 1600 -- 1400 1200 - 1000 -a-Seracare 8OO --Hsp70 600 -- HSp 400 - 200 O Atom-A-T-A-I-A 0.5 1 5 10 mg/ml product added U.S. Patent Dec. 17, 2013 Sheet 11 of 15 US 8,609,416 B2 Figure 7 Seracare + Hsp70 and Cellastim neg control a Sera + Hsp70 Cellastim 1.0 ug/ml 5.0 Ug/ml 10.0 ug/ml conc. of Hsp70 U.S. Patent Dec. 17, 2013 Sheet 12 of 15 US 8,609,416 B2 Figure 8 A Removal of ATP binding Proteins from Cellastim gd neg control Starting Part A G 0.5 mg/ml 1.0 mg/ml 5.0 mg/ml 10.0 mg/ml Album in Concentration Rescue and recovery of lost performance E dr s CD o ce d s > Control (n=4) A (n=4) A+ Hsp70 (n=5) Sample Description U.S. Patent Dec. 17, 2013 Sheet 13 of 15 US 8,609,416 B2 Figure 9 Lipid Comparison Cellastim vs. Plasma vs. Yeast 1.8 1.6 1.4 1.2 s O.8 O.2 Cellastim HSA(n=3) Il pHSA (n=1) Yeast HSA(n=2) Lipid Comparison Cellastim vs. Plasma vs. Yeast O.9 0.8 O.7 O6 O.5 s O.4 O.3 O.2 O.1 O Cellastim pHSA (n=1) Yeast HSA(n=2) U.S. Patent Dec. 17, 2013 Sheet 14 of 15 US 8,609,416 B2 Figure 9 continued Effect of adding exogenous Lipids 25 Celastim (n=3) O Defatted Celastim (n=3) Defatted Celastim + Linoleic acid Novazyme + Linoleic acid U.S. Patent Dec. 17, 2013 Sheet 15 Of 15 US 8,609,416 B2 Figure 10 Differential Scanning Calorimetry d w 7 O 9. Cellastim e s p-HSA Oy-HSA s E l R 73 oO Transition Temperature US 8,609,416 B2 1. 2 METHODS AND COMPOSITIONS fatty acids. Bovine serum albumin (BSA) has long been used COMPRISING HEAT SHOCKPROTEINS as a Supplement in cell culture media as it is a component of fetal bovine serum (FBS) which is commonly added to a basal CROSS-REFERENCE TO RELATED media at 1-20% total volume. BSA is a major component in a APPLICATIONS number of defined serum free media formulations since it is readily available in bulk, is relatively cheap, and can be puri This application claims the benefit of U.S. provisional fied to homogeneity relatively easily. Representative sources patent application No. 61/288.234 filed on Dec. 18, 2009, the of albumin include for example, plasma derived from bovine, entire contents of which are incorporated herein by reference. horse, pig and other mammalian species. 10 With the advent of the large scale production of recombi STATEMENT REGARDING FEDERALLY nant proteins, vaccines and other products destined for human SPONSORED RESEARCH ORDEVELOPMENT clinical use, stricter requirements on the formulations used in the production of those products have been instigated. Not Applicable. Because of the threat of animal-derived materials harboring 15 pathogens that may affect the safety of the products, many TECHNICAL FIELD existing recombinant production processes have been modi fied such that all materials or culture components used in the The invention relates to compositions, and uses thereof, entire process are devoid of animal-derived products. That is, which are beneficial for eukaryotic cells in culture, and meth the cell culture components cannot have been isolated or ods for their use in promoting cell growth, viability and purified from whole animal sources. Therefore, the recombi recombinant protein expression. nant production of media Supplements, as an alternative to the purification of these supplements directly from the whole BACKGROUND animal is preferred. Accordingly, human and cell culture components from other species can be manufactured using Investigation of biological processes often requires the 25 recombinant means, using defined tissue culture media, and examination of those processes in cells, tissues and organs using highly characterized tissue culture cells, which are cer that comprise less than the entire organism.
Load more

Recommended publications
  • Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS
    Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen,
    [Show full text]
  • Α Are Regulated by Heat Shock Protein 90
    The Levels of Retinoic Acid-Inducible Gene I Are Regulated by Heat Shock Protein 90- α Tomoh Matsumiya, Tadaatsu Imaizumi, Hidemi Yoshida, Kei Satoh, Matthew K. Topham and Diana M. Stafforini This information is current as of October 2, 2021. J Immunol 2009; 182:2717-2725; ; doi: 10.4049/jimmunol.0802933 http://www.jimmunol.org/content/182/5/2717 Downloaded from References This article cites 44 articles, 19 of which you can access for free at: http://www.jimmunol.org/content/182/5/2717.full#ref-list-1 Why The JI? Submit online. http://www.jimmunol.org/ • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average by guest on October 2, 2021 Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2009 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology The Levels of Retinoic Acid-Inducible Gene I Are Regulated by Heat Shock Protein 90-␣1 Tomoh Matsumiya,*‡ Tadaatsu Imaizumi,‡ Hidemi Yoshida,‡ Kei Satoh,‡ Matthew K. Topham,*† and Diana M. Stafforini2*† Retinoic acid-inducible gene I (RIG-I) is an intracellular pattern recognition receptor that plays important roles during innate immune responses to viral dsRNAs.
    [Show full text]
  • 1 Supporting Information for a Microrna Network Regulates
    Supporting Information for A microRNA Network Regulates Expression and Biosynthesis of CFTR and CFTR-ΔF508 Shyam Ramachandrana,b, Philip H. Karpc, Peng Jiangc, Lynda S. Ostedgaardc, Amy E. Walza, John T. Fishere, Shaf Keshavjeeh, Kim A. Lennoxi, Ashley M. Jacobii, Scott D. Rosei, Mark A. Behlkei, Michael J. Welshb,c,d,g, Yi Xingb,c,f, Paul B. McCray Jr.a,b,c Author Affiliations: Department of Pediatricsa, Interdisciplinary Program in Geneticsb, Departments of Internal Medicinec, Molecular Physiology and Biophysicsd, Anatomy and Cell Biologye, Biomedical Engineeringf, Howard Hughes Medical Instituteg, Carver College of Medicine, University of Iowa, Iowa City, IA-52242 Division of Thoracic Surgeryh, Toronto General Hospital, University Health Network, University of Toronto, Toronto, Canada-M5G 2C4 Integrated DNA Technologiesi, Coralville, IA-52241 To whom correspondence should be addressed: Email: [email protected] (M.J.W.); yi- [email protected] (Y.X.); Email: [email protected] (P.B.M.) This PDF file includes: Materials and Methods References Fig. S1. miR-138 regulates SIN3A in a dose-dependent and site-specific manner. Fig. S2. miR-138 regulates endogenous SIN3A protein expression. Fig. S3. miR-138 regulates endogenous CFTR protein expression in Calu-3 cells. Fig. S4. miR-138 regulates endogenous CFTR protein expression in primary human airway epithelia. Fig. S5. miR-138 regulates CFTR expression in HeLa cells. Fig. S6. miR-138 regulates CFTR expression in HEK293T cells. Fig. S7. HeLa cells exhibit CFTR channel activity. Fig. S8. miR-138 improves CFTR processing. Fig. S9. miR-138 improves CFTR-ΔF508 processing. Fig. S10. SIN3A inhibition yields partial rescue of Cl- transport in CF epithelia.
    [Show full text]
  • The Plasma Peptides of Alzheimer's Disease
    Florentinus‑Mefailoski et al. Clin Proteom (2021) 18:17 https://doi.org/10.1186/s12014‑021‑09320‑2 Clinical Proteomics RESEARCH Open Access The plasma peptides of Alzheimer’s disease Angelique Florentinus‑Mefailoski1, Peter Bowden1, Philip Scheltens2, Joep Killestein3, Charlotte Teunissen4 and John G. Marshall1,5* Abstract Background: A practical strategy to discover proteins specifc to Alzheimer’s dementia (AD) may be to compare the plasma peptides and proteins from patients with dementia to normal controls and patients with neurological condi‑ tions like multiple sclerosis or other diseases. The aim was a proof of principle for a method to discover proteins and/ or peptides of plasma that show greater observation frequency and/or precursor intensity in AD. The endogenous tryptic peptides of Alzheimer’s were compared to normals, multiple sclerosis, ovarian cancer, breast cancer, female normal, sepsis, ICU Control, heart attack, along with their institution‑matched controls, and normal samples collected directly onto ice. Methods: Endogenous tryptic peptides were extracted from blinded, individual AD and control EDTA plasma sam‑ ples in a step gradient of acetonitrile for random and independent sampling by LC–ESI–MS/MS with a set of robust and sensitive linear quadrupole ion traps. The MS/MS spectra were ft to fully tryptic peptides within proteins identi‑ fed using the X!TANDEM algorithm. Observation frequency of the identifed proteins was counted using SEQUEST algorithm. The proteins with apparently increased observation frequency in AD versus AD Control were revealed graphically and subsequently tested by Chi Square analysis. The proteins specifc to AD plasma by Chi Square with FDR correction were analyzed by the STRING algorithm.
    [Show full text]
  • Molecular Cloning and Characterization of Cdna Encoding a Putative Stress-Induced Heat-Shock Protein from Camelus Dromedarius
    Int. J. Mol. Sci. 2011, 12, 4214-4236; doi:10.3390/ijms12074214 OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Article Molecular Cloning and Characterization of cDNA Encoding a Putative Stress-Induced Heat-Shock Protein from Camelus dromedarius Mohamed S. Elrobh *, Mohammad S. Alanazi, Wajahatullah Khan, Zainularifeen Abduljaleel, Abdullah Al-Amri and Mohammad D. Bazzi Genomic Research Chair Unit, Department of Biochemistry, College of Science, King Saud University, PO Box 2455, Riyadh 11451, Saudi Arabia; E-Mails: [email protected] (M.S.A.); [email protected] (W.K.); [email protected] (Z.A.); [email protected] (A.A.-A.) [email protected] (M.D.B.) * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +966-146-759-44; Fax: +966-146-757-91. Received: 5 May 2011; in revised form: 9 June 2011; / Accepted: 15 June 2011 / Published: 27 June 2011 Abstract: Heat shock proteins are ubiquitous, induced under a number of environmental and metabolic stresses, with highly conserved DNA sequences among mammalian species. Camelus dromedaries (the Arabian camel) domesticated under semi-desert environments, is well adapted to tolerate and survive against severe drought and high temperatures for extended periods. This is the first report of molecular cloning and characterization of full length cDNA of encoding a putative stress-induced heat shock HSPA6 protein (also called HSP70B′) from Arabian camel. A full-length cDNA (2417 bp) was obtained by rapid amplification of cDNA ends (RACE) and cloned in pET-b expression vector. The sequence analysis of HSPA6 gene showed 1932 bp-long open reading frame encoding 643 amino acids.
    [Show full text]
  • Heat Shock Proteins in Vascular Diabetic Complications: Review and Future Perspective
    International Journal of Molecular Sciences Review Heat Shock Proteins in Vascular Diabetic Complications: Review and Future Perspective Stefania Bellini 1,†, Federica Barutta 1,†, Raffaella Mastrocola 2 ID , Luigi Imperatore 1, Graziella Bruno 1 and Gabriella Gruden 1,* 1 Laboratory of Diabetic Nephropathy, Department of Medical Sciences, University of Turin, Corso Dogliotti 14, 10126 Turin, Italy; [email protected] (S.B.); [email protected] (F.B.); [email protected] (L.I.); [email protected] (G.B.) 2 Department of Clinical and Biological Sciences, University of Turin, Corso Raffaello 30, 10125 Turin, Italy; [email protected] * Correspondence: [email protected]; Tel.: +39-011-633-6035 † These authors contribute equally to this work. Received: 27 November 2017; Accepted: 11 December 2017; Published: 14 December 2017 Abstract: Heat shock proteins (HSPs) are a large family of proteins highly conserved throughout evolution because of their unique cytoprotective properties. Besides assisting protein refolding and regulating proteostasis under stressful conditions, HSPs also play an important role in protecting cells from oxidative stress, inflammation, and apoptosis. Therefore, HSPs are crucial in counteracting the deleterious effects of hyperglycemia in target organs of diabetes vascular complications. Changes in HSP expression have been demonstrated in diabetic complications and functionally related to hyperglycemia-induced cell injury. Moreover, associations between diabetic complications and altered circulating levels of both HSPs and anti-HSPs have been shown in clinical studies. HSPs thus represent an exciting therapeutic opportunity and might also be valuable as clinical biomarkers. However, this field of research is still in its infancy and further studies in both experimental diabetes and humans are required to gain a full understanding of HSP relevance.
    [Show full text]
  • Figure S1. HAEC ROS Production and ML090 NOX5-Inhibition
    Figure S1. HAEC ROS production and ML090 NOX5-inhibition. (a) Extracellular H2O2 production in HAEC treated with ML090 at different concentrations and 24 h after being infected with GFP and NOX5-β adenoviruses (MOI 100). **p< 0.01, and ****p< 0.0001 vs control NOX5-β-infected cells (ML090, 0 nM). Results expressed as mean ± SEM. Fold increase vs GFP-infected cells with 0 nM of ML090. n= 6. (b) NOX5-β overexpression and DHE oxidation in HAEC. Representative images from three experiments are shown. Intracellular superoxide anion production of HAEC 24 h after infection with GFP and NOX5-β adenoviruses at different MOIs treated or not with ML090 (10 nM). MOI: Multiplicity of infection. Figure S2. Ontology analysis of HAEC infected with NOX5-β. Ontology analysis shows that the response to unfolded protein is the most relevant. Figure S3. UPR mRNA expression in heart of infarcted transgenic mice. n= 12-13. Results expressed as mean ± SEM. Table S1: Altered gene expression due to NOX5-β expression at 12 h (bold, highlighted in yellow). N12hvsG12h N18hvsG18h N24hvsG24h GeneName GeneDescription TranscriptID logFC p-value logFC p-value logFC p-value family with sequence similarity NM_052966 1.45 1.20E-17 2.44 3.27E-19 2.96 6.24E-21 FAM129A 129. member A DnaJ (Hsp40) homolog. NM_001130182 2.19 9.83E-20 2.94 2.90E-19 3.01 1.68E-19 DNAJA4 subfamily A. member 4 phorbol-12-myristate-13-acetate- NM_021127 0.93 1.84E-12 2.41 1.32E-17 2.69 1.43E-18 PMAIP1 induced protein 1 E2F7 E2F transcription factor 7 NM_203394 0.71 8.35E-11 2.20 2.21E-17 2.48 1.84E-18 DnaJ (Hsp40) homolog.
    [Show full text]
  • Downloaded 18 July 2014 with a 1% False Discovery Rate (FDR)
    UC Berkeley UC Berkeley Electronic Theses and Dissertations Title Chemical glycoproteomics for identification and discovery of glycoprotein alterations in human cancer Permalink https://escholarship.org/uc/item/0t47b9ws Author Spiciarich, David Publication Date 2017 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California Chemical glycoproteomics for identification and discovery of glycoprotein alterations in human cancer by David Spiciarich A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Chemistry in the Graduate Division of the University of California, Berkeley Committee in charge: Professor Carolyn R. Bertozzi, Co-Chair Professor David E. Wemmer, Co-Chair Professor Matthew B. Francis Professor Amy E. Herr Fall 2017 Chemical glycoproteomics for identification and discovery of glycoprotein alterations in human cancer © 2017 by David Spiciarich Abstract Chemical glycoproteomics for identification and discovery of glycoprotein alterations in human cancer by David Spiciarich Doctor of Philosophy in Chemistry University of California, Berkeley Professor Carolyn R. Bertozzi, Co-Chair Professor David E. Wemmer, Co-Chair Changes in glycosylation have long been appreciated to be part of the cancer phenotype; sialylated glycans are found at elevated levels on many types of cancer and have been implicated in disease progression. However, the specific glycoproteins that contribute to cell surface sialylation are not well characterized, specifically in bona fide human cancer. Metabolic and bioorthogonal labeling methods have previously enabled enrichment and identification of sialoglycoproteins from cultured cells and model organisms. The goal of this work was to develop technologies that can be used for detecting changes in glycoproteins in clinical models of human cancer.
    [Show full text]
  • A Master Autoantigen-Ome Links Alternative Splicing, Female Predilection, and COVID-19 to Autoimmune Diseases
    bioRxiv preprint doi: https://doi.org/10.1101/2021.07.30.454526; this version posted August 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. A Master Autoantigen-ome Links Alternative Splicing, Female Predilection, and COVID-19 to Autoimmune Diseases Julia Y. Wang1*, Michael W. Roehrl1, Victor B. Roehrl1, and Michael H. Roehrl2* 1 Curandis, New York, USA 2 Department of Pathology, Memorial Sloan Kettering Cancer Center, New York, USA * Correspondence: [email protected] or [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.30.454526; this version posted August 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Abstract Chronic and debilitating autoimmune sequelae pose a grave concern for the post-COVID-19 pandemic era. Based on our discovery that the glycosaminoglycan dermatan sulfate (DS) displays peculiar affinity to apoptotic cells and autoantigens (autoAgs) and that DS-autoAg complexes cooperatively stimulate autoreactive B1 cell responses, we compiled a database of 751 candidate autoAgs from six human cell types. At least 657 of these have been found to be affected by SARS-CoV-2 infection based on currently available multi-omic COVID data, and at least 400 are confirmed targets of autoantibodies in a wide array of autoimmune diseases and cancer.
    [Show full text]
  • Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays
    Supplemental Table S1. Primers for SYBRGreen quantitative RT-PCR assays. Gene Accession Primer Sequence Length Start Stop Tm GC% GAPDH NM_002046.3 GAPDH F TCCTGTTCGACAGTCAGCCGCA 22 39 60 60.43 59.09 GAPDH R GCGCCCAATACGACCAAATCCGT 23 150 128 60.12 56.52 Exon junction 131/132 (reverse primer) on template NM_002046.3 DNAH6 NM_001370.1 DNAH6 F GGGCCTGGTGCTGCTTTGATGA 22 4690 4711 59.66 59.09% DNAH6 R TAGAGAGCTTTGCCGCTTTGGCG 23 4797 4775 60.06 56.52% Exon junction 4790/4791 (reverse primer) on template NM_001370.1 DNAH7 NM_018897.2 DNAH7 F TGCTGCATGAGCGGGCGATTA 21 9973 9993 59.25 57.14% DNAH7 R AGGAAGCCATGTACAAAGGTTGGCA 25 10073 10049 58.85 48.00% Exon junction 9989/9990 (forward primer) on template NM_018897.2 DNAI1 NM_012144.2 DNAI1 F AACAGATGTGCCTGCAGCTGGG 22 673 694 59.67 59.09 DNAI1 R TCTCGATCCCGGACAGGGTTGT 22 822 801 59.07 59.09 Exon junction 814/815 (reverse primer) on template NM_012144.2 RPGRIP1L NM_015272.2 RPGRIP1L F TCCCAAGGTTTCACAAGAAGGCAGT 25 3118 3142 58.5 48.00% RPGRIP1L R TGCCAAGCTTTGTTCTGCAAGCTGA 25 3238 3214 60.06 48.00% Exon junction 3124/3125 (forward primer) on template NM_015272.2 Supplemental Table S2. Transcripts that differentiate IPF/UIP from controls at 5%FDR Fold- p-value Change Transcript Gene p-value p-value p-value (IPF/UIP (IPF/UIP Cluster ID RefSeq Symbol gene_assignment (Age) (Gender) (Smoking) vs. C) vs. C) NM_001178008 // CBS // cystathionine-beta- 8070632 NM_001178008 CBS synthase // 21q22.3 // 875 /// NM_0000 0.456642 0.314761 0.418564 4.83E-36 -2.23 NM_003013 // SFRP2 // secreted frizzled- 8103254 NM_003013
    [Show full text]
  • 1 Mi-2Β-Targeted Inhibition Induces Immunotherapy Response In
    Mi-2β-targeted inhibition induces immunotherapy response in melanoma Bo Zhu1, Zhengyu Wang2, Licheng Yao3, Xingyu Lin3, Jie Zhang4, Xin Li5, James R. Hagman6, Jingwei Shao2, Phuc D. Tran2, Meng Cao7, Jianming Zhang8, Colin R. Goding9, Xuebin Liao3*, Hong-yu Li2*, Peng Cao7*, Xiao Miao5*, Rutao Cui10* 1Department of Cancer Immunology and Virology, Dana Farber Cancer Institute, Harvard Medical School, Boston, MA 02115, USA 2Department of Pharmaceutical Sciences, College of Pharmacy, University of Arkansas for Medical Science, Little Rock, AR 72205, USA 3Key Laboratory of Bioorganic Phosphorus Chemistry and Chemical Biology, Beijing Advanced Innovation Center for Human Brain Protection, School of Pharmaceutical Sciences, Tsinghua University, Beijing 100084, China 4Adobe Inc., San Jose, CA 95110, USA 5Department of Dermatology, Yueyang Hospital of Integrated Traditional Chinese and Western Medicine, Shanghai University of Traditional Chinese Medicine, Shanghai 200437, China 6Department of Biomedical Research, National Jewish Health, Denver, CO 80206, USA 71 Affiliated Hospital of Integrated Traditional Chinese and Western Medicine, School of Pharmacy, Nanjing University of Chinese Medicine, Nanjing 210023, China 8National Research Center for Translational Medicine, Shanghai State Key Laboratory of Medical Genomics, Rui-Jin Hospital, Shanghai JiaoTong University School of Medicine, 197 Ruijin second Rd，Shanghai 200025, China 9Ludwig Institute for Cancer Research, University of Oxford, Headington, Oxford OX3 7DQ, UK 10Skin Disease Institute, Department of Dermatology, The 2nd Hospital, School of Medicine, Zhejiang University, 88 Jiefang Road, Hangzhou, Zhejiang 310009, China *To whom correspondence should be addressed, Rutao Cui: [email protected], Xiao Miao: [email protected], Peng Cao: [email protected], Hong-yu Li: [email protected], and Xuebin Liao: [email protected] 1 Abstract Recent development of some new immune checkpoint inhibitors has been particularly successfully in melanoma, but the majority of melanoma patients exhibit resistance.
    [Show full text]
  • Genomics of Inherited Bone Marrow Failure and Myelodysplasia Michael
    Genomics of inherited bone marrow failure and myelodysplasia Michael Yu Zhang A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Washington 2015 Reading Committee: Mary-Claire King, Chair Akiko Shimamura Marshall Horwitz Program Authorized to Offer Degree: Molecular and Cellular Biology 1 ©Copyright 2015 Michael Yu Zhang 2 University of Washington ABSTRACT Genomics of inherited bone marrow failure and myelodysplasia Michael Yu Zhang Chair of the Supervisory Committee: Professor Mary-Claire King Department of Medicine (Medical Genetics) and Genome Sciences Bone marrow failure and myelodysplastic syndromes (BMF/MDS) are disorders of impaired blood cell production with increased leukemia risk. BMF/MDS may be acquired or inherited, a distinction critical for treatment selection. Currently, diagnosis of these inherited syndromes is based on clinical history, family history, and laboratory studies, which directs the ordering of genetic tests on a gene-by-gene basis. However, despite extensive clinical workup and serial genetic testing, many cases remain unexplained. We sought to define the genetic etiology and pathophysiology of unclassified bone marrow failure and myelodysplastic syndromes. First, to determine the extent to which patients remained undiagnosed due to atypical or cryptic presentations of known inherited BMF/MDS, we developed a massively-parallel, next- generation DNA sequencing assay to simultaneously screen for mutations in 85 BMF/MDS genes. Querying 71 pediatric and adult patients with unclassified BMF/MDS using this assay revealed 8 (11%) patients with constitutional, pathogenic mutations in GATA2 , RUNX1 , DKC1 , or LIG4 . All eight patients lacked classic features or laboratory findings for their syndromes.
    [Show full text]