DOCSLIB.ORG

HOXB6 Homeo Box B6 HOXB5 Homeo Box B5 WNT5A Wingless-Type

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
HOXB6 Homeo Box B6 HOXB5 Homeo Box B5 WNT5A Wingless-Type 5 6 6 5 . 4 2 1 1 1 2 4 6 4 3 2 9 9 7 0 5 7 5 8 6 4 0 8 2 3 1 8 3 7 1 0 0 4 0 2 5 0 8 7 5 4 1 1 0 3 6 0 4 8 3 7 4 7 6 9 6 7 1 5 0 8 1 4 1 1 7 1 0 0 4 2 0 8 1 1 1 2 5 3 5 0 7 2 6 9 1 2 1 8 3 5 2 9 8 0 6 0 9 5 1 9 9 2 1 1 6 0 2 3 0 3 6 9 1 6 5 5 7 1 1 2 1 1 7 5 4 6 6 4 1 1 2 8 4 7 1 6 2 7 7 5 4 3 2 4 3 6 9 4 1 7 1 3 4 1 2 1 3 1 1 4 7 3 1 1 1 1 5 3 2 6 1 5 1 3 5 4 5 2 3 1 1 6 1 7 3 2 5 4 3 1 6 1 5 3 1 7 6 5 1 1 1 4 6 1 6 2 7 2 1 2 e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S HOXB6 homeo box B6 HOXB5 homeo box B5 WNT5A wingless-type MMTV integration site family, member 5A WNT5A wingless-type MMTV integration site family, member 5A FKBP11 FK506 binding protein 11, 19 kDa EPOR erythropoietin receptor SLC5A6 solute carrier family 5 sodium-dependent vitamin transporter, member 6 SLC5A6 solute carrier family 5 sodium-dependent vitamin transporter, member 6 RAD52 RAD52 homolog S. cerevisiae AQP3 aquaporin 3 N33 Putative prostate cancer tumor suppressor LOC51313 AD021 protein Ells1 hypothetical protein Ells1 ATP6V1G1 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G isoform 1 ZNF236 zinc finger protein 236 CCK cholecystokinin FGFR4 fibroblast growth factor receptor 4 MYL5 myosin, light polypeptide 5, regulatory DNASE1L1 deoxyribonuclease I-like 1 PPIF peptidylprolyl isomerase F cyclophilin F HK1 hexokinase 1 PAPSS2 3’-phosphoadenosine 5’-phosphosulfate synthase 2 SLC16A2 solute carrier family 16 monocarboxylic acid transporters, member 2 putative transporter FGFR4 fibroblast growth factor receptor 4 PLXNB1 plexin B1 PLXNB1 plexin B1 CHI3L2 chitinase 3-like 2 LTF lactotransferrin Homo sapiens cDNA FLJ37284 fis, clone BRAMY2013590 LXN latexin protein ANK3 ankyrin 3, node of Ranvier ankyrin G ANK3 ankyrin 3, node of Ranvier ankyrin G ABLIM1 actin binding LIM protein 1 ABLIM1 actin binding LIM protein 1 PON3 paraoxonase 3 TGFBR3 transforming growth factor, beta receptor III betaglycan, 300kDa CTSH cathepsin H CA2 carbonic anhydrase II SIAT4C sialyltransferase 4C beta-galactosidase alpha-2,3-sialytransferase NALP2 NALP2 protein LAMC2 laminin, gamma 2 GSTM2 glutathione S-transferase M2 muscle CYFIP2 cytoplasmic FMR1 interacting protein 2 CRABP2 cellular retinoic acid binding protein 2 APOD apolipoprotein D HMGCS2 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2 mitochondrial FMO5 flavin containing monooxygenase 5 FLJ10948 hypothetical protein FLJ10948 DDB1 damage-specific DNA binding protein 1, 127kDa LOC51092 CGI-40 protein FVT1 follicular lymphoma variant translocation 1 CYP2A6 cytochrome P450, subfamily IIA phenobarbital-inducible, polypeptide 6 WFDC2 WAP four-disulfide core domain 2 IGFBP2 insulin-like growth factor binding protein 2, 36kDa IGFBP2 insulin-like growth factor binding protein 2, 36kDa IL18BP interleukin 18 binding protein C9orf12 chromosome 9 open reading frame 12 SLC20A1 solute carrier family 20 phosphate transporter, member 1 GPX4 glutathione peroxidase 4 phospholipid hydroperoxidase DKFZP564L2423 hypothetical protein DKFZp564L2423 TFAP2B transcription factor AP-2 beta activating enhancer binding protein 2 beta KIAA0857 KIAA0857 protein EPB72 erythrocyte membrane protein band 7.2 stomatin RALGPS1A Ral guanine nucleotide exchange factor RalGPS1A NME4 non-metastatic cells 4, protein expressed in MB myoglobin KIAA0222 KIAA0222 gene product ABCD3 ATP-binding cassette, sub-family D ALD, member 3 RAB2L RAB2, member RAS oncogene family-like NQO1 NADPH dehydrogenase, quinone 1 FLJ10607 hypothetical protein FLJ10607 similar to glucosamine-phosphate N-acetyltransferase DKFZp761F2014 hypothetical protein DKFZp761F2014 EPHX2 epoxide hydrolase 2, cytoplasmic ACOX2 acyl-Coenzyme A oxidase 2, branched chain DKFZP564D0372 hypothetical protein DKFZp564D0372 TFF1 trefoil factor 1 breast cancer, estrogen-inducible sequence expressed in C9orf12 chromosome 9 open reading frame 12 FLJ10509 hypothetical protein FLJ10509 FLJ38045 hypothetical protein FLJ38045 ATP6V1G1 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G isoform 1 BLVRA biliverdin reductase A HRASLS3 HRAS-like suppressor 3 PDCD4 programmed cell death 4 neoplastic transformation inhibitor PDCD4 programmed cell death 4 neoplastic transformation inhibitor FLNB filamin B, beta actin binding protein 278 TRPS1 trichorhinophalangeal syndrome I KIAA1243 KIAA1243 protein KIAA0303 KIAA0303 protein KIAA0303 KIAA0303 protein BECN1 beclin 1 coiled-coil, myosin-like BCL2 interacting protein EIF4G3 eukaryotic translation initiation factor 4 gamma, 3 SLC11A3 solute carrier family 11 proton-coupled divalent metal ion transporters, member 3 RNASE4 ribonuclease, RNase A family, 4 APBB2 amyloid beta A4 precursor protein-binding, family B, member 2 Fe65-like Homo sapiens cDNA FLJ40165 fis, clone TESTI2015962 INPP4B inositol polyphosphate-4-phosphatase, type II, 105kDa GLUD1 glutamate dehydrogenase 1 PRO1489 hypothetical protein PRO1489 RERG RAS-like, estrogen-regulated, growth-inhibitor NRG1 neuregulin 1 GSTM3 glutathione S-transferase M3 brain KIAA0876 KIAA0876 protein DIP13B DIP13 beta D5S346 DNA segment, single copy probe LNS-CAI/LNS-CAII deleted in polyposis ACADSB acyl-Coenzyme A dehydrogenase, short/branched chain ACADSB acyl-Coenzyme A dehydrogenase, short/branched chain VAV3 vav 3 oncogene XBP1 X-box binding protein 1 FBP1 fructose-1,6-bisphosphatase 1 GATA3 GATA binding protein 3 ESR1 estrogen receptor 1 TCEAL1 transcription elongation factor A SII-like 1 LRBA LPS-responsive vesicle trafficking, beach and anchor containing HIS1 HMBA-inducible FLJ13322 hypothetical protein FLJ13322 CEGP1 CEGP1 protein PTP4A2 protein tyrosine phosphatase type IVA, member 2 NAT1 N-acetyltransferase 1 arylamine N-acetyltransferase KIAA1025 KIAA1025 protein LIV-1 LIV-1 protein, estrogen regulated COX6C cytochrome c oxidase subunit VIc IGBP1 immunoglobulin CD79A binding protein 1 C4B complement component 4B IRS1 insulin receptor substrate 1 BC008967 hypothetical gene BC008967 AKR7A2 aldo-keto reductase family 7, member A2 aflatoxin aldehyde reductase HSD17B4 hydroxysteroid 17-beta dehydrogenase 4 ASAH1 N-acylsphingosine amidohydrolase acid ceramidase 1 FLJ25604 hypothetical protein FLJ25604 CYB5 cytochrome b-5 PTPRT protein tyrosine phosphatase, receptor type, T DUSP4 dual specificity phosphatase 4 SELENBP1 selenium binding protein 1 FER1L3 fer-1-like 3, myoferlin C.
Load more

Recommended publications
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • Pancreatic Fibroblast Heterogeneity: from Development to Cancer
    cells Review Pancreatic Fibroblast Heterogeneity: From Development to Cancer 1, 2, 2,3 Paloma E. Garcia y, Michael K. Scales y, Benjamin L. Allen and Marina Pasca di Magliano 2,3,4,* 1 Program in Molecular and Cellular Pathology, University of Michigan Medical School, University of Michigan, Ann Arbor, MI 48105, USA; [email protected] 2 Department of Cell and Developmental Biology, University of Michigan Medical School, University of Michigan, Ann Arbor, MI 48109, USA; [email protected] (M.K.S.); [email protected] (B.L.A.) 3 Rogel Cancer Center, Michigan Medicine, University of Michigan, Ann Arbor, MI 48109, USA 4 Department of Surgery, Michigan Medicine, University of Michigan, Ann Arbor, MI 48109, USA * Correspondence: [email protected]; Tel.: +1-734-276-7104 Authors contributed equally to this work. y Received: 22 October 2020; Accepted: 10 November 2020; Published: 12 November 2020 Abstract: Pancreatic ductal adenocarcinoma (PDA) is characterized by an extensive fibroinflammatory microenvironment that accumulates from the onset of disease progression. Cancer-associated fibroblasts (CAFs) are a prominent cellular component of the stroma, but their role during carcinogenesis remains controversial, with both tumor-supporting and tumor-restraining functions reported in different studies. One explanation for these contradictory findings is the heterogeneous nature of the fibroblast populations, and the different roles each subset might play in carcinogenesis. Here, we review the current literature on the origin and function of pancreatic fibroblasts, from the developing organ to the healthy adult pancreas, and throughout the initiation and progression of PDA. We also discuss clinical approaches to targeting fibroblasts in PDA. Keywords: fibroblasts; pancreas; cancer-associated fibroblasts; pancreas development; pancreatic cancer; tumor microenvironment; hedgehog; transforming growth factor Beta 1.
    [Show full text]
  • KLF2 Induced
    UvA-DARE (Digital Academic Repository) The transcription factor KLF2 in vascular biology Boon, R.A. Publication date 2008 Link to publication Citation for published version (APA): Boon, R. A. (2008). The transcription factor KLF2 in vascular biology. General rights It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons). Disclaimer/Complaints regulations If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You will be contacted as soon as possible. UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl) Download date:23 Sep 2021 Supplementary data: Genes induced by KLF2 Dekker et al. LocusLink Accession Gene Sequence Description Fold p-value ID number symbol change (FDR) 6654 AK022099 SOS1 cDNA FLJ12037 fis, clone HEMBB1001921. 100.00 5.9E-09 56999 AF086069 ADAMTS9 full length insert cDNA clone YZ35C05. 100.00 1.2E-09 6672 AF085934 SP100 full length insert cDNA clone YR57D07. 100.00 6.7E-13 9031 AF132602 BAZ1B Williams Syndrome critical region WS25 mRNA, partial sequence.
    [Show full text]
  • Gentaur Products List
    Chapter 2 : Gentaur Products List • Rabbit Anti LAMR1 Polyclonal Antibody Cy5 Conjugated Conjugated • Rabbit Anti Podoplanin gp36 Polyclonal Antibody Cy5 • Rabbit Anti LAMR1 CT Polyclonal Antibody Cy5 • Rabbit Anti phospho NFKB p65 Ser536 Polyclonal Conjugated Conjugated Antibody Cy5 Conjugated • Rabbit Anti CHRNA7 Polyclonal Antibody Cy5 Conjugated • Rat Anti IAA Monoclonal Antibody Cy5 Conjugated • Rabbit Anti EV71 VP1 CT Polyclonal Antibody Cy5 • Rabbit Anti Connexin 40 Polyclonal Antibody Cy5 • Rabbit Anti IAA Indole 3 Acetic Acid Polyclonal Antibody Conjugated Conjugated Cy5 Conjugated • Rabbit Anti LHR CGR Polyclonal Antibody Cy5 Conjugated • Rabbit Anti Integrin beta 7 Polyclonal Antibody Cy5 • Rabbit Anti Natrexone Polyclonal Antibody Cy5 Conjugated • Rabbit Anti MMP 20 Polyclonal Antibody Cy5 Conjugated Conjugated • Rabbit Anti Melamine Polyclonal Antibody Cy5 Conjugated • Rabbit Anti BCHE NT Polyclonal Antibody Cy5 Conjugated • Rabbit Anti NAP1 NAP1L1 Polyclonal Antibody Cy5 • Rabbit Anti Acetyl p53 K382 Polyclonal Antibody Cy5 • Rabbit Anti BCHE CT Polyclonal Antibody Cy5 Conjugated Conjugated Conjugated • Rabbit Anti HPV16 E6 Polyclonal Antibody Cy5 Conjugated • Rabbit Anti CCP Polyclonal Antibody Cy5 Conjugated • Rabbit Anti JAK2 Polyclonal Antibody Cy5 Conjugated • Rabbit Anti HPV18 E6 Polyclonal Antibody Cy5 Conjugated • Rabbit Anti HDC Polyclonal Antibody Cy5 Conjugated • Rabbit Anti Microsporidia protien Polyclonal Antibody Cy5 • Rabbit Anti HPV16 E7 Polyclonal Antibody Cy5 Conjugated • Rabbit Anti Neurocan Polyclonal
    [Show full text]
  • Pdf Sub-Classification of Patients with a Molecular Alteration Provides Better Response [57]
    Theranostics 2021, Vol. 11, Issue 12 5759 Ivyspring International Publisher Theranostics 2021; 11(12): 5759-5777. doi: 10.7150/thno.57659 Research Paper Homeobox B5 promotes metastasis and poor prognosis in Hepatocellular Carcinoma, via FGFR4 and CXCL1 upregulation Qin He1, Wenjie Huang2, Danfei Liu1, Tongyue Zhang1, Yijun Wang1, Xiaoyu Ji1, Meng Xie1, Mengyu Sun1, Dean Tian1, Mei Liu1, Limin Xia1 1. Department of Gastroenterology, Institute of Liver and Gastrointestinal Diseases, Hubei Key Laboratory of Hepato-Pancreato-Biliary Diseases, Tongji Hospital of Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430030, Hubei Province, China. 2. Hubei Key Laboratory of Hepato-Pancreato-Biliary Diseases; Hepatic Surgery Center, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology; Clinical Medicine Research Center for Hepatic Surgery of Hubei Province; Key Laboratory of Organ Transplantation, Ministry of Education and Ministry of Public Health, Wuhan, Hubei, 430030, China. Corresponding author: Dr. Limin Xia, Department of Gastroenterology, Institute of Liver and Gastrointestinal Diseases, Hubei Key Laboratory of Hepato-Pancreato-Biliary Diseases, Tongji Hospital of Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430030, Hubei Province, China; Phone: 86 27 6937 8507; Fax: 86 27 8366 2832; E-mail: [email protected]. © The author(s). This is an open access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/). See http://ivyspring.com/terms for full terms and conditions. Received: 2020.12.29; Accepted: 2021.03.17; Published: 2021.03.31 Abstract Background: Since metastasis remains the main reason for HCC-associated death, a better understanding of molecular mechanism underlying HCC metastasis is urgently needed.
    [Show full text]
  • To Study Mutant P53 Gain of Function, Various Tumor-Derived P53 Mutants
    Differential effects of mutant TAp63γ on transactivation of p53 and/or p63 responsive genes and their effects on global gene expression. A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science By Shama K Khokhar M.Sc., Bilaspur University, 2004 B.Sc., Bhopal University, 2002 2007 1 COPYRIGHT SHAMA K KHOKHAR 2007 2 WRIGHT STATE UNIVERSITY SCHOOL OF GRADUATE STUDIES Date of Defense: 12-03-07 I HEREBY RECOMMEND THAT THE THESIS PREPARED UNDER MY SUPERVISION BY SHAMA KHAN KHOKHAR ENTITLED Differential effects of mutant TAp63γ on transactivation of p53 and/or p63 responsive genes and their effects on global gene expression BE ACCEPTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF Master of Science Madhavi P. Kadakia, Ph.D. Thesis Director Daniel Organisciak , Ph.D. Department Chair Committee on Final Examination Madhavi P. Kadakia, Ph.D. Steven J. Berberich, Ph.D. Michael Leffak, Ph.D. Joseph F. Thomas, Jr., Ph.D. Dean, School of Graduate Studies 3 Abstract Khokhar, Shama K. M.S., Department of Biochemistry and Molecular Biology, Wright State University, 2007 Differential effect of TAp63γ mutants on transactivation of p53 and/or p63 responsive genes and their effects on global gene expression. p63, a member of the p53 gene family, known to play a role in development, has more recently also been implicated in cancer progression. Mice lacking p63 exhibit severe developmental defects such as limb truncations, abnormal skin, and absence of hair follicles, teeth, and mammary glands. Germline missense mutations of p63 have been shown to be responsible for several human developmental syndromes including SHFM, EEC and ADULT syndromes and are associated with anomalies in the development of organs of epithelial origin.
    [Show full text]
  • Figure S1. Representative Report Generated by the Ion Torrent System Server for Each of the KCC71 Panel Analysis and Pcafusion Analysis
    Figure S1. Representative report generated by the Ion Torrent system server for each of the KCC71 panel analysis and PCaFusion analysis. (A) Details of the run summary report followed by the alignment summary report for the KCC71 panel analysis sequencing. (B) Details of the run summary report for the PCaFusion panel analysis. A Figure S1. Continued. Representative report generated by the Ion Torrent system server for each of the KCC71 panel analysis and PCaFusion analysis. (A) Details of the run summary report followed by the alignment summary report for the KCC71 panel analysis sequencing. (B) Details of the run summary report for the PCaFusion panel analysis. B Figure S2. Comparative analysis of the variant frequency found by the KCC71 panel and calculated from publicly available cBioPortal datasets. For each of the 71 genes in the KCC71 panel, the frequency of variants was calculated as the variant number found in the examined cases. Datasets marked with different colors and sample numbers of prostate cancer are presented in the upper right. *Significantly high in the present study. Figure S3. Seven subnetworks extracted from each of seven public prostate cancer gene networks in TCNG (Table SVI). Blue dots represent genes that include initial seed genes (parent nodes), and parent‑child and child‑grandchild genes in the network. Graphical representation of node‑to‑node associations and subnetwork structures that differed among and were unique to each of the seven subnetworks. TCNG, The Cancer Network Galaxy. Figure S4. REVIGO tree map showing the predicted biological processes of prostate cancer in the Japanese. Each rectangle represents a biological function in terms of a Gene Ontology (GO) term, with the size adjusted to represent the P‑value of the GO term in the underlying GO term database.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • Ribonuclease and Deoxyribonuclease Activities in Experimental and Human Tumors by the Histochemical Substrate Film Method*
    Ribonuclease and Deoxyribonuclease Activities in Experimental and Human Tumors by the Histochemical Substrate Film Method* R. DAOUSTJANDHARUKOAMANOÕ (Laboratoires de Recherche, Institut du Cancer de Montréal,Hôpital Notre-Dame et Universitéde Montréal,Montréal,Canada) SUMMARY The ribonuclease and deoxyribonuclease activities of 65 experimental and human tu mors (32 different types) have been examined by histochemical substrate film methods. A same general pattern was obtained for the distribution of both nucleases in the various types of experimental and human tumors. The connective tissue stroma and the necrotic regions of the tumor masses showed various levels of nuclease activity, whereas the neoplastic cells showed no demonstrable activity. It appears that deficien cies in ribonuclease and deoxyribonuclease activities represent general properties of cancer cells. The possible significance of the losses of nuclease activities in carcinogenesis is dis cussed. Studies on nucleases by histochemical methods MATERIALS AND METHODS have shown that losses of ribonuclease (RNase) The experimental tumors used in the present and deoxyribonuclease (DNase) activities take study were mostly rat, mouse, and hamster trans- place in rat liver during azo-dye carcinogenesis (1, plantable tumors (see Table 1). The tumor-bearing 6). The loss of RNase activity is progressive and animals were obtained from commercial or private occurs before parenchymal cells become cancerous, sources, and the tumors were used as supplied or whereas the loss of DNase activity is abrupt and closely associated with the neoplastic transforma TABLE1 tion of parenchymal cells. EXPERIMENTALTUMORS If a loss of RNase or DNase activity plays an important role in tumor formation, the lack of SpeciesRat"""MouseHamsterTumorPrimary demonstrable nuclease activity observed in rat hepatomaNovikoff primary hepatomas should also be observed in a hepatomaWalker variety of tumors.
    [Show full text]
  • Cells Using Gene Expression Profiling and Insulin Gene Methylation
    RESEARCH ARTICLE Comparison of enteroendocrine cells and pancreatic β-cells using gene expression profiling and insulin gene methylation ☯ ☯ Gyeong Ryul Ryu , Esder Lee , Jong Jin Kim, Sung-Dae MoonID, Seung-Hyun Ko, Yu- Bae Ahn, Ki-Ho SongID* Division of Endocrinology & Metabolism, Department of Internal Medicine, College of Medicine, The Catholic University of Korea, Seoul, Korea ☯ These authors contributed equally to this work. a1111111111 * [email protected] a1111111111 a1111111111 a1111111111 a1111111111 Abstract Various subtypes of enteroendocrine cells (EECs) are present in the gut epithelium. EECs and pancreatic β-cells share similar pathways of differentiation during embryonic develop- ment and after birth. In this study, similarities between EECs and β-cells were evaluated in OPEN ACCESS detail. To obtain specific subtypes of EECs, cell sorting by flow cytometry was conducted Citation: Ryu GR, Lee E, Kim JJ, Moon S-D, Ko S- from STC-1 cells (a heterogenous EEC line), and each single cell was cultured and pas- H, Ahn Y-B, et al. (2018) Comparison of saged. Five EEC subtypes were established according to hormone expression, measured enteroendocrine cells and pancreatic β-cells using by quantitative RT-PCR and immunostaining: L, K, I, G and S cells expressing glucagon-like gene expression profiling and insulin gene methylation. PLoS ONE 13(10): e0206401. https:// peptide-1, glucose-dependent insulinotropic polypeptide, cholecystokinin, gastrin and doi.org/10.1371/journal.pone.0206401 secretin, respectively. Each EEC subtype was found to express not only the corresponding Editor: Wataru Nishimura, International University gut hormone but also other gut hormones. Global microarray gene expression profiles of Health and Welfare School of Medicine, JAPAN revealed a higher similarity between each EEC subtype and MIN6 cells (a β-cell line) than Received: March 29, 2018 between C2C12 cells (a myoblast cell line) and MIN6 cells, and all EEC subtypes were highly similar to each other.
    [Show full text]
  • CDH12 Cadherin 12, Type 2 N-Cadherin 2 RPL5 Ribosomal
    5 6 6 5 . 4 2 1 1 1 2 4 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 A A A A A A A A A A A A A A A A A A A A C C C C C C C C C C C C C C C C C C C C R R R R R R R R R R R R R R R R R R R R B , B B B B B B B B B B B B B B B B B B B , 9 , , , , 4 , , 3 0 , , , , , , , , 6 2 , , 5 , 0 8 6 4 , 7 5 7 0 2 8 9 1 3 3 3 1 1 7 5 0 4 1 4 0 7 1 0 2 0 6 7 8 0 2 5 7 8 0 3 8 5 4 9 0 1 0 8 8 3 5 6 7 4 7 9 5 2 1 1 8 2 2 1 7 9 6 2 1 7 1 1 0 4 5 3 5 8 9 1 0 0 4 2 5 0 8 1 4 1 6 9 0 0 6 3 6 9 1 0 9 0 3 8 1 3 5 6 3 6 0 4 2 6 1 0 1 2 1 9 9 7 9 5 7 1 5 8 9 8 8 2 1 9 9 1 1 1 9 6 9 8 9 7 8 4 5 8 8 6 4 8 1 1 2 8 6 2 7 9 8 3 5 4 3 2 1 7 9 5 3 1 3 2 1 2 9 5 1 1 1 1 1 1 5 9 5 3 2 6 3 4 1 3 1 1 4 1 4 1 7 1 3 4 3 2 7 6 4 2 7 2 1 2 1 5 1 6 3 5 6 1 3 6 4 7 1 6 5 1 1 4 1 6 1 7 6 4 7 e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]