Supplementary Table 3
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse
Welcome to More Choice CD Marker Handbook For more information, please visit: Human bdbiosciences.com/eu/go/humancdmarkers Mouse bdbiosciences.com/eu/go/mousecdmarkers Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse CD3 CD3 CD (cluster of differentiation) molecules are cell surface markers T Cell CD4 CD4 useful for the identification and characterization of leukocytes. The CD CD8 CD8 nomenclature was developed and is maintained through the HLDA (Human Leukocyte Differentiation Antigens) workshop started in 1982. CD45R/B220 CD19 CD19 The goal is to provide standardization of monoclonal antibodies to B Cell CD20 CD22 (B cell activation marker) human antigens across laboratories. To characterize or “workshop” the antibodies, multiple laboratories carry out blind analyses of antibodies. These results independently validate antibody specificity. CD11c CD11c Dendritic Cell CD123 CD123 While the CD nomenclature has been developed for use with human antigens, it is applied to corresponding mouse antigens as well as antigens from other species. However, the mouse and other species NK Cell CD56 CD335 (NKp46) antibodies are not tested by HLDA. Human CD markers were reviewed by the HLDA. New CD markers Stem Cell/ CD34 CD34 were established at the HLDA9 meeting held in Barcelona in 2010. For Precursor hematopoetic stem cell only hematopoetic stem cell only additional information and CD markers please visit www.hcdm.org. Macrophage/ CD14 CD11b/ Mac-1 Monocyte CD33 Ly-71 (F4/80) CD66b Granulocyte CD66b Gr-1/Ly6G Ly6C CD41 CD41 CD61 (Integrin b3) CD61 Platelet CD9 CD62 CD62P (activated platelets) CD235a CD235a Erythrocyte Ter-119 CD146 MECA-32 CD106 CD146 Endothelial Cell CD31 CD62E (activated endothelial cells) Epithelial Cell CD236 CD326 (EPCAM1) For Research Use Only. -
Viewed Under 23 (B) Or 203 (C) fi M M Male Cko Mice, and Largely Unaffected Magni Cation; Scale Bars, 500 M (B) and 50 M (C)
BRIEF COMMUNICATION www.jasn.org Renal Fanconi Syndrome and Hypophosphatemic Rickets in the Absence of Xenotropic and Polytropic Retroviral Receptor in the Nephron Camille Ansermet,* Matthias B. Moor,* Gabriel Centeno,* Muriel Auberson,* † † ‡ Dorothy Zhang Hu, Roland Baron, Svetlana Nikolaeva,* Barbara Haenzi,* | Natalya Katanaeva,* Ivan Gautschi,* Vladimir Katanaev,*§ Samuel Rotman, Robert Koesters,¶ †† Laurent Schild,* Sylvain Pradervand,** Olivier Bonny,* and Dmitri Firsov* BRIEF COMMUNICATION *Department of Pharmacology and Toxicology and **Genomic Technologies Facility, University of Lausanne, Lausanne, Switzerland; †Department of Oral Medicine, Infection, and Immunity, Harvard School of Dental Medicine, Boston, Massachusetts; ‡Institute of Evolutionary Physiology and Biochemistry, St. Petersburg, Russia; §School of Biomedicine, Far Eastern Federal University, Vladivostok, Russia; |Services of Pathology and ††Nephrology, Department of Medicine, University Hospital of Lausanne, Lausanne, Switzerland; and ¶Université Pierre et Marie Curie, Paris, France ABSTRACT Tight control of extracellular and intracellular inorganic phosphate (Pi) levels is crit- leaves.4 Most recently, Legati et al. have ical to most biochemical and physiologic processes. Urinary Pi is freely filtered at the shown an association between genetic kidney glomerulus and is reabsorbed in the renal tubule by the action of the apical polymorphisms in Xpr1 and primary fa- sodium-dependent phosphate transporters, NaPi-IIa/NaPi-IIc/Pit2. However, the milial brain calcification disorder.5 How- molecular identity of the protein(s) participating in the basolateral Pi efflux remains ever, the role of XPR1 in the maintenance unknown. Evidence has suggested that xenotropic and polytropic retroviral recep- of Pi homeostasis remains unknown. Here, tor 1 (XPR1) might be involved in this process. Here, we show that conditional in- we addressed this issue in mice deficient for activation of Xpr1 in the renal tubule in mice resulted in impaired renal Pi Xpr1 in the nephron. -
Fkbp10 (NM 010221) Mouse Untagged Clone – MC201811 | Origene
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MC201811 Fkbp10 (NM_010221) Mouse Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Fkbp10 (NM_010221) Mouse Untagged Clone Tag: Tag Free Symbol: Fkbp10 Synonyms: AI325255; FKBP-10; FKBP-65; Fkbp-rs1; Fkbp1-rs; Fkbp6; FKBP65; Fkbprp Vector: PCMV6-Kan/Neo E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 3 Fkbp10 (NM_010221) Mouse Untagged Clone – MC201811 Fully Sequenced ORF: >BC029546 sequence for NM_010221 GTCCGCTCTCACTGCCGGCGTCCCTGGTCTGGGCACCATGTTCCTTGTGGGGTCCTCCAGCCACACCCTC CATCGGCTCCGCATACTGCCGTTGCTGTTGCTTCTACAGACCTTGGAGAGGGGACTGGGCCGTGCCAGCC CGGCCGGAGCCCCCTTGGAAGATGTGGTCATCGAGAGATACCACATCCCTCGGGCCTGTCCCCGAGAAGT GCAGATGGGGGATTTTGTGCGTTACCACTACAATGGCACTTTCGAAGACGGGAAAAAGTTTGACTCCAGC TATGACCGTAGCACCCTGGTGGCCATCGTTGTGGGCGTAGGCCGCCTCATCACCGGCATGGACCGGGGTC TCATGGGCATGTGTGTCAACGAGCGCCGCCGCCTCATTGTGCCTCCCCACCTGGGCTACGGCAGCATCGG TGTGGCGGGCCTCATCCCCCCTGATGCCACCCTCTATTTTGACGTGGTCCTGCTGGACGTGTGGAACAAA GCAGACACGGTGCAGTCAACTATCCTCCTGCGCCCTCCCTACTGCCCCCGAATGGTGCAGAACAGTGACT TTGTGCGCTATCACTACAATGGCACTCTGCTGGATGGCACTGCCTTTGACAACAGCTACAGTAGGGGAGG CACTTATGACACCTACATCGGCTCTGGTTGGCTGATCAAAGGCATGGACCAGGGGCTGCTGGGCATGTGC -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Genetic and Genomic Analysis of Hyperlipidemia, Obesity and Diabetes Using (C57BL/6J × TALLYHO/Jngj) F2 Mice
University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Nutrition Publications and Other Works Nutrition 12-19-2010 Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P. Stewart Marshall University Hyoung Y. Kim University of Tennessee - Knoxville, [email protected] Arnold M. Saxton University of Tennessee - Knoxville, [email protected] Jung H. Kim Marshall University Follow this and additional works at: https://trace.tennessee.edu/utk_nutrpubs Part of the Animal Sciences Commons, and the Nutrition Commons Recommended Citation BMC Genomics 2010, 11:713 doi:10.1186/1471-2164-11-713 This Article is brought to you for free and open access by the Nutrition at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Nutrition Publications and Other Works by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. Stewart et al. BMC Genomics 2010, 11:713 http://www.biomedcentral.com/1471-2164/11/713 RESEARCH ARTICLE Open Access Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P Stewart1, Hyoung Yon Kim2, Arnold M Saxton3, Jung Han Kim1* Abstract Background: Type 2 diabetes (T2D) is the most common form of diabetes in humans and is closely associated with dyslipidemia and obesity that magnifies the mortality and morbidity related to T2D. The genetic contribution to human T2D and related metabolic disorders is evident, and mostly follows polygenic inheritance. The TALLYHO/ JngJ (TH) mice are a polygenic model for T2D characterized by obesity, hyperinsulinemia, impaired glucose uptake and tolerance, hyperlipidemia, and hyperglycemia. -
Mouse FKBP10 ORF Mammalian Expression Plasmid, N-His Tag
Mouse FKBP10 ORF mammalian expression plasmid, N-His tag Catalog Number: MG5A1953-NH General Information Plasmid Resuspension protocol Gene : FK506 binding protein 10 1. Centrifuge at 5,000×g for 5 min. Official Symbol : FKBP10 2. Carefully open the tube and add 100 l of sterile water to Synonym : Fkbp6; FKBP65; Fkbprp; FKBP-10; dissolve the DNA. FKBP-65; AI325255; Fkbp-rs1; Fkbp1-rs 3. Close the tube and incubate for 10 minutes at room Source : Mouse temperature. cDNA Size: 1746bp 4. Briefly vortex the tube and then do a quick spin to RefSeq : NM_010221.2 concentrate the liquid at the bottom. Speed is less than Description 5000×g. Lot : Please refer to the label on the tube 5. Store the plasmid at -20 ℃. Vector : pCMV3-SP-N-His Shipping carrier : Each tube contains approximately 10 μg of lyophilized plasmid. The plasmid is ready for: Storage : • Restriction enzyme digestion The lyophilized plasmid can be stored at ambient temperature • PCR amplification for three months. • E. coli transformation Quality control : • DNA sequencing The plasmid is confirmed by full-length sequencing with primers in the sequencing primer list. E.coli strains for transformation (recommended Sequencing primer list : but not limited) pCMV3-F: 5’ CAGGTGTCCACTCCCAGGTCCAAG 3’ Most commercially available competent cells are appropriate for pcDNA3-R : 5’ GGCAACTAGAAGGCACAGTCGAGG 3’ the plasmid, e.g. TOP10, DH5α and TOP10F´. Or Forward T7 : 5’ TAATACGACTCACTATAGGG 3’ ReverseBGH : 5’ TAGAAGGCACAGTCGAGG 3’ pCMV3-F and pcDNA3-R are designed by Sino Biological Inc. Customers can order the primer pair from any oligonucleotide supplier. Manufactured By Sino Biological Inc., FOR RESEARCH USE ONLY. -
A Key Actor of Collagen Crosslinking in Clear Cell Renal Cell Carcinoma
www.aging-us.com AGING 2021, Vol. 13, No. 15 Research Paper FK506 binding protein 10: a key actor of collagen crosslinking in clear cell renal cell carcinoma Yubai Zhang1,4, Yue Yin2, Sijia Liu3, Lei Yang1,4, Changhua Sun4, Ruihua An1 1Department of Urology Surgery, The First Affiliated Hospital of Harbin Medical University, Harbin, China 2Department of Oncology Radiotherapy, The Second Affiliated Hospital of Harbin Medical University, Harbin, China 3Department of Gynecological Radiotherapy, The Affiliated Tumor Hospital of Harbin Medical University, Harbin, China 4Department of Urology Surgery, The First Hospital of Harbin, Harbin, China Correspondence to: Ruihua An; email: [email protected], https://orcid.org/0000-0002-7041-2014 Keywords: FKBP10, clear cell renal cell carcinoma, collagen synthesis, prognosis Received: May 27, 2021 Accepted: July 10, 2021 Published: August 13, 2021 Copyright: © 2021 Zhang et al. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Clear cell renal cell carcinoma (ccRCC) is the most common type of malignant tumor in the kidney. With numbers of patients whose physical condition or tumor stage not suitable for radical surgery, they only have a narrow choice of using VEGF/mTOR targeted drugs to control their tumors, but ccRCC often shows resistance to these drugs. Therefore, identifying a new therapeutic target is of urgent necessity. In this study, for the first time, we concluded from bioinformatics analyses and in vitro research that FK506 binding protein 10 (FKBP10), together with its molecular partner Lysyl hydroxylase 2 (LH2/PLOD2), participate in the process of type I collagen synthesis in ccRCC via regulating crosslinking of pro-collagen chains. -
CD Markers Are Routinely Used for the Immunophenotyping of Cells
ptglab.com 1 CD MARKER ANTIBODIES www.ptglab.com Introduction The cluster of differentiation (abbreviated as CD) is a protocol used for the identification and investigation of cell surface molecules. So-called CD markers are routinely used for the immunophenotyping of cells. Despite this use, they are not limited to roles in the immune system and perform a variety of roles in cell differentiation, adhesion, migration, blood clotting, gamete fertilization, amino acid transport and apoptosis, among many others. As such, Proteintech’s mini catalog featuring its antibodies targeting CD markers is applicable to a wide range of research disciplines. PRODUCT FOCUS PECAM1 Platelet endothelial cell adhesion of blood vessels – making up a large portion molecule-1 (PECAM1), also known as cluster of its intracellular junctions. PECAM-1 is also CD Number of differentiation 31 (CD31), is a member of present on the surface of hematopoietic the immunoglobulin gene superfamily of cell cells and immune cells including platelets, CD31 adhesion molecules. It is highly expressed monocytes, neutrophils, natural killer cells, on the surface of the endothelium – the thin megakaryocytes and some types of T-cell. Catalog Number layer of endothelial cells lining the interior 11256-1-AP Type Rabbit Polyclonal Applications ELISA, FC, IF, IHC, IP, WB 16 Publications Immunohistochemical of paraffin-embedded Figure 1: Immunofluorescence staining human hepatocirrhosis using PECAM1, CD31 of PECAM1 (11256-1-AP), Alexa 488 goat antibody (11265-1-AP) at a dilution of 1:50 anti-rabbit (green), and smooth muscle KD/KO Validated (40x objective). alpha-actin (red), courtesy of Nicola Smart. PECAM1: Customer Testimonial Nicola Smart, a cardiovascular researcher “As you can see [the immunostaining] is and a group leader at the University of extremely clean and specific [and] displays Oxford, has said of the PECAM1 antibody strong intercellular junction expression, (11265-1-AP) that it “worked beautifully as expected for a cell adhesion molecule.” on every occasion I’ve tried it.” Proteintech thanks Dr. -
Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase -
Antigen-Specific Memory CD4 T Cells Coordinated Changes in DNA
Downloaded from http://www.jimmunol.org/ by guest on September 24, 2021 is online at: average * The Journal of Immunology The Journal of Immunology published online 18 March 2013 from submission to initial decision 4 weeks from acceptance to publication http://www.jimmunol.org/content/early/2013/03/17/jimmun ol.1202267 Coordinated Changes in DNA Methylation in Antigen-Specific Memory CD4 T Cells Shin-ichi Hashimoto, Katsumi Ogoshi, Atsushi Sasaki, Jun Abe, Wei Qu, Yoichiro Nakatani, Budrul Ahsan, Kenshiro Oshima, Francis H. W. Shand, Akio Ametani, Yutaka Suzuki, Shuichi Kaneko, Takashi Wada, Masahira Hattori, Sumio Sugano, Shinichi Morishita and Kouji Matsushima J Immunol Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Author Choice option Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Freely available online through http://www.jimmunol.org/content/suppl/2013/03/18/jimmunol.120226 7.DC1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material Permissions Email Alerts Subscription Author Choice Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 24, 2021. Published March 18, 2013, doi:10.4049/jimmunol.1202267 The Journal of Immunology Coordinated Changes in DNA Methylation in Antigen-Specific Memory CD4 T Cells Shin-ichi Hashimoto,*,†,‡ Katsumi Ogoshi,* Atsushi Sasaki,† Jun Abe,* Wei Qu,† Yoichiro Nakatani,† Budrul Ahsan,x Kenshiro Oshima,† Francis H. -
A Yeast Phenomic Model for the Influence of Warburg Metabolism on Genetic Buffering of Doxorubicin Sean M
Santos and Hartman Cancer & Metabolism (2019) 7:9 https://doi.org/10.1186/s40170-019-0201-3 RESEARCH Open Access A yeast phenomic model for the influence of Warburg metabolism on genetic buffering of doxorubicin Sean M. Santos and John L. Hartman IV* Abstract Background: The influence of the Warburg phenomenon on chemotherapy response is unknown. Saccharomyces cerevisiae mimics the Warburg effect, repressing respiration in the presence of adequate glucose. Yeast phenomic experiments were conducted to assess potential influences of Warburg metabolism on gene-drug interaction underlying the cellular response to doxorubicin. Homologous genes from yeast phenomic and cancer pharmacogenomics data were analyzed to infer evolutionary conservation of gene-drug interaction and predict therapeutic relevance. Methods: Cell proliferation phenotypes (CPPs) of the yeast gene knockout/knockdown library were measured by quantitative high-throughput cell array phenotyping (Q-HTCP), treating with escalating doxorubicin concentrations under conditions of respiratory or glycolytic metabolism. Doxorubicin-gene interaction was quantified by departure of CPPs observed for the doxorubicin-treated mutant strain from that expected based on an interaction model. Recursive expectation-maximization clustering (REMc) and Gene Ontology (GO)-based analyses of interactions identified functional biological modules that differentially buffer or promote doxorubicin cytotoxicity with respect to Warburg metabolism. Yeast phenomic and cancer pharmacogenomics data were integrated to predict differential gene expression causally influencing doxorubicin anti-tumor efficacy. Results: Yeast compromised for genes functioning in chromatin organization, and several other cellular processes are more resistant to doxorubicin under glycolytic conditions. Thus, the Warburg transition appears to alleviate requirements for cellular functions that buffer doxorubicin cytotoxicity in a respiratory context. -
Identification of Tetraspanin-7 As a Target of Autoantibodies in Type 1 Diabetes
Page 1 of 35 Diabetes Identification of Tetraspanin-7 as a Target of Autoantibodies in Type 1 Diabetes Running title: Tetraspanin-7 in Type 1 diabetes Kerry A. McLaughlin1, Carolyn C. Richardson1,2, Aarthi Ravishankar1, Christina Brigatti3, Daniela Liberati4, Vito Lampasona4, Lorenzo Piemonti3, Diana Morgan5, Richard G. Feltbower5 and Michael R. Christie1,2 1Diabetes Research Group, Division of Diabetes & Nutritional Sciences, King’s College London, London, U.K. 2School of Life Sciences, University of Lincoln, Lincoln, U.K. 3Diabetes Research Institute, IRCCS San Raffaele Scientific Institute, Milan, Italy 4Division of Genetics and Cellular Biology, IRCCS San Raffaele Scientific Institute, Milan, Italy 5Division of Epidemiology & Biostatistics, School of Medicine, University of Leeds, Leeds, UK Corresponding author: Dr Michael R Christie, School of Life Sciences, Joseph Banks Laboratories, University of Lincoln, Lincoln LN6 7DL, United Kingdom Phone: +44 1522 837434 Email: [email protected] Word count of abstract: 199 Word count of main text: 3,998 Number of figures: 4. One Supplementary Table 1 Diabetes Publish Ahead of Print, published online March 7, 2016 Diabetes Page 2 of 35 ABSTRACT The presence of autoantibodies to multiple islet autoantigens confers high risk for development of Type 1 diabetes. Four major autoantigens are established (insulin, glutamate decarboxylase, IA-2, and zinc transporter-8), but the molecular identity of a fifth, a 38kDa membrane glycoprotein (Glima), is unknown. Glima antibodies have been detectable only by immunoprecipitation from extracts of radiolabeled islet or neuronal cells. We sought to identify Glima to enable efficient assay of these autoantibodies. Mouse brain and lung were shown to express Glima.