HSP90-Incorporating Chaperome Networks As Biosensor for Disease-Related Pathways in Patient- Specific Midbrain Dopamine Neurons
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Karyopherin Alpha Proteins Regulate Oligodendrocyte Differentiation
RESEARCH ARTICLE Karyopherin Alpha Proteins Regulate Oligodendrocyte Differentiation Benjamin M. Laitman1,2,3*, John N. Mariani1,2,3, Chi Zhang1,2,3, Setsu Sawai1,2,3, Gareth R. John1,2,3 1 Friedman Brain Institute, New York, New York, United States of America, 2 Corinne Goldsmith Dickinson Center for Multiple Sclerosis, New York, New York, United States of America, 3 Neurology, Icahn School of Medicine at Mount Sinai, New York, NY, New York, United States of America * [email protected] a1111111111 a1111111111 a1111111111 a1111111111 Abstract a1111111111 Proper regulation of the coordinated transcriptional program that drives oligodendrocyte (OL) differentiation is essential for central nervous system myelin formation and repair. Nuclear import, mediated in part by a group of karyopherin alpha (Kpna) proteins, regulates transcription factor access to the genome. Understanding how canonical nuclear import OPEN ACCESS functions to control genomic access in OL differentiation may aid in the creation of novel Citation: Laitman BM, Mariani JN, Zhang C, Sawai therapeutics to stimulate myelination and remyelination. Here, we show that members of S, John GR (2017) Karyopherin Alpha Proteins the Kpna family regulate OL differentiation, and may play distinct roles downstream of differ- Regulate Oligodendrocyte Differentiation. PLoS ONE 12(1): e0170477. doi:10.1371/journal. ent pro-myelinating stimuli. Multiple family members are expressed in OLs, and their phar- pone.0170477 macologic inactivation dose-dependently decreases the rate of differentiation. Additionally, Editor: Fernando de Castro, Instituto Cajal-CSIC, upon differentiation, the three major Kpna subtypes (P/α2, Q/α3, S/α1) display differential SPAIN responses to the pro-myelinating cues T3 and CNTF. -
Identification of TPD52 and DNAJB1 As Two Novel Bile Biomarkers for Cholangiocarcinoma by Itraq‑Based Quantitative Proteomics Analysis
2622 ONCOLOGY REPORTS 42: 2622-2634, 2019 Identification of TPD52 and DNAJB1 as two novel bile biomarkers for cholangiocarcinoma by iTRAQ‑based quantitative proteomics analysis HONGYUE REN1*, MINGXU LUO2,3*, JINZHONG CHEN4, YANMING ZHOU5, XIUMEI LI4, YANYAN ZHAN6, DONGYAN SHEN7 and BO CHEN3 1Department of Pathology, The Affiliated Southeast Hospital of Xiamen University, Zhangzhou, Fujian 363000; 2Department of Gastrointestinal Surgery, Xiamen Humanity Hospital; Departments of 3Gastrointestinal Surgery, 4Endoscopy Center and 5Hepatopancreatobiliary Surgery, Xiamen Cancer Hospital, The First Affiliated Hospital of Xiamen University, Xiamen Fujian 361003; 6Cancer Research Center, Xiamen University Medical College, Xiamen, Fujian 361002; 7Biobank, Xiamen Cancer Hospital, The First Affiliated Hospital of Xiamen University, Xiamen, Fujian 361003, P.R. China Received December 17, 2018; Accepted September 26, 2019 DOI: 10.3892/or.2019.7387 Abstract. Cholangiocarcinoma (CCA) represents a type of proteins may contribute to tumor pathogenesis. In addition, the epithelial cancer with a late diagnosis and poor outcome. expression levels of TPD52 and DNAJB1 were found to be However, the molecular mechanisms responsible for the devel- closely associated with the clinical parameters and prognosis opment of CCA have not yet been fully identified. Thus, in this of patients with CCA. On the whole, the findings of this study study, we aimed to elucidate some of these mechanisms. For indicate that TPD52 and DNAJB1 may serve as novel bile this purpose, isobaric tags for relative and absolute quantifica- biomarkers for CCA. tion (iTRAQ) was performed to analyze the secretory proteins from the 2 CCA cell lines, TFK1 and HuCCT1, as well as from Introduction a normal biliary epithelial cell line, human intrahepatic biliary epithelial cells (HiBECs). -
Computational Genome-Wide Identification of Heat Shock Protein Genes in the Bovine Genome [Version 1; Peer Review: 2 Approved, 1 Approved with Reservations]
F1000Research 2018, 7:1504 Last updated: 08 AUG 2021 RESEARCH ARTICLE Computational genome-wide identification of heat shock protein genes in the bovine genome [version 1; peer review: 2 approved, 1 approved with reservations] Oyeyemi O. Ajayi1,2, Sunday O. Peters3, Marcos De Donato2,4, Sunday O. Sowande5, Fidalis D.N. Mujibi6, Olanrewaju B. Morenikeji2,7, Bolaji N. Thomas 8, Matthew A. Adeleke 9, Ikhide G. Imumorin2,10,11 1Department of Animal Breeding and Genetics, Federal University of Agriculture, Abeokuta, Nigeria 2International Programs, College of Agriculture and Life Sciences, Cornell University, Ithaca, NY, 14853, USA 3Department of Animal Science, Berry College, Mount Berry, GA, 30149, USA 4Departamento Regional de Bioingenierias, Tecnologico de Monterrey, Escuela de Ingenieria y Ciencias, Queretaro, Mexico 5Department of Animal Production and Health, Federal University of Agriculture, Abeokuta, Nigeria 6Usomi Limited, Nairobi, Kenya 7Department of Animal Production and Health, Federal University of Technology, Akure, Nigeria 8Department of Biomedical Sciences, Rochester Institute of Technology, Rochester, NY, 14623, USA 9School of Life Sciences, University of KwaZulu-Natal, Durban, 4000, South Africa 10School of Biological Sciences, Georgia Institute of Technology, Atlanta, GA, 30032, USA 11African Institute of Bioscience Research and Training, Ibadan, Nigeria v1 First published: 20 Sep 2018, 7:1504 Open Peer Review https://doi.org/10.12688/f1000research.16058.1 Latest published: 20 Sep 2018, 7:1504 https://doi.org/10.12688/f1000research.16058.1 Reviewer Status Invited Reviewers Abstract Background: Heat shock proteins (HSPs) are molecular chaperones 1 2 3 known to bind and sequester client proteins under stress. Methods: To identify and better understand some of these proteins, version 1 we carried out a computational genome-wide survey of the bovine 20 Sep 2018 report report report genome. -
PLATFORM ABSTRACTS Abstract Abstract Numbers Numbers Tuesday, November 6 41
American Society of Human Genetics 62nd Annual Meeting November 6–10, 2012 San Francisco, California PLATFORM ABSTRACTS Abstract Abstract Numbers Numbers Tuesday, November 6 41. Genes Underlying Neurological Disease Room 134 #196–#204 2. 4:30–6:30pm: Plenary Abstract 42. Cancer Genetics III: Common Presentations Hall D #1–#6 Variants Ballroom 104 #205–#213 43. Genetics of Craniofacial and Wednesday, November 7 Musculoskeletal Disorders Room 124 #214–#222 10:30am–12:45 pm: Concurrent Platform Session A (11–19): 44. Tools for Phenotype Analysis Room 132 #223–#231 11. Genetics of Autism Spectrum 45. Therapy of Genetic Disorders Room 130 #232–#240 Disorders Hall D #7–#15 46. Pharmacogenetics: From Discovery 12. New Methods for Big Data Ballroom 103 #16–#24 to Implementation Room 123 #241–#249 13. Cancer Genetics I: Rare Variants Room 135 #25–#33 14. Quantitation and Measurement of Friday, November 9 Regulatory Oversight by the Cell Room 134 #34–#42 8:00am–10:15am: Concurrent Platform Session D (47–55): 15. New Loci for Obesity, Diabetes, and 47. Structural and Regulatory Genomic Related Traits Ballroom 104 #43–#51 Variation Hall D #250–#258 16. Neuromuscular Disease and 48. Neuropsychiatric Disorders Ballroom 103 #259–#267 Deafness Room 124 #52–#60 49. Common Variants, Rare Variants, 17. Chromosomes and Disease Room 132 #61–#69 and Everything in-Between Room 135 #268–#276 18. Prenatal and Perinatal Genetics Room 130 #70–#78 50. Population Genetics Genome-Wide Room 134 #277–#285 19. Vascular and Congenital Heart 51. Endless Forms Most Beautiful: Disease Room 123 #79–#87 Variant Discovery in Genomic Data Ballroom 104 #286–#294 52. -
Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. -
Gene Targeting Therapies (Roy Alcalay)
Recent Developments in Gene - Targeted Therapies for Parkinson’s Disease Roy Alcalay, MD, MS Alfred and Minnie Bressler Associate Professor of Neurology Division of Movement Disorders Columbia University Medical Center Disclosures Funding: Dr. Alcalay is funded by the National Institutes of Health, the DOD, the Michael J. Fox Foundation and the Parkinson’s Foundation. Dr. Alcalay receives consultation fees from Genzyme/Sanofi, Restorbio, Janssen, and Roche. Gene Localizations Identified in PD Gene Symbol Protein Transmission Chromosome PARK1 SNCA α-synuclein AD 4q22.1 PARK2 PRKN parkin (ubiquitin ligase) AR 6q26 PARK3 ? ? AD 2p13 PARK4 SNCA triplication α-synuclein AD 4q22.1 PARK5 UCH-L1 ubiquitin C-terminal AD 4p13 hydrolase-L1 PARK6 PINK1 PTEN-induced kinase 1 AR 1p36.12 PARK7 DJ-1 DJ-1 AR 1p36.23 PARK8 LRRK2 leucine rich repeat kinase 2 AD 12q12 PARK9 ATP13A2 lysosomal ATPase AR 1p36.13 PARK10 ? ? (Iceland) AR 1p32 PARK11 GIGYF2 GRB10-interacting GYF protein 2 AD 2q37.1 PARK12 ? ? X-R Xq21-q25 PARK13 HTRA2 serine protease AD 2p13.1 PARK14 PLA2G6 phospholipase A2 (INAD) AR 22q13.1 PARK15 FBXO7 F-box only protein 7 AR 22q12.3 PARK16 ? Discovered by GWAS ? 1q32 PARK17 VPS35 vacuolar protein sorting 35 AD 16q11.2 PARK18 EIF4G1 initiation of protein synth AD 3q27.1 PARK19 DNAJC6 auxilin AR 1p31.3 PARK20 SYNJ1 synaptojanin 1 AR 21q22.11 PARK21 DNAJC13 8/RME-8 AD 3q22.1 PARK22 CHCHD2 AD 7p11.2 PARK23 VPS13C AR 15q22 Gene Localizations Identified in PD Disorder Symbol Protein Transmission Chromosome PD GBA β-glucocerebrosidase AD 1q21 SCA2 -
Synergistic Genetic Interactions Between Pkhd1 and Pkd1 Result in an ARPKD-Like Phenotype in Murine Models
BASIC RESEARCH www.jasn.org Synergistic Genetic Interactions between Pkhd1 and Pkd1 Result in an ARPKD-Like Phenotype in Murine Models Rory J. Olson,1 Katharina Hopp ,2 Harrison Wells,3 Jessica M. Smith,3 Jessica Furtado,1,4 Megan M. Constans,3 Diana L. Escobar,3 Aron M. Geurts,5 Vicente E. Torres,3 and Peter C. Harris 1,3 Due to the number of contributing authors, the affiliations are listed at the end of this article. ABSTRACT Background Autosomal recessive polycystic kidney disease (ARPKD) and autosomal dominant polycystic kidney disease (ADPKD) are genetically distinct, with ADPKD usually caused by the genes PKD1 or PKD2 (encoding polycystin-1 and polycystin-2, respectively) and ARPKD caused by PKHD1 (encoding fibrocys- tin/polyductin [FPC]). Primary cilia have been considered central to PKD pathogenesis due to protein localization and common cystic phenotypes in syndromic ciliopathies, but their relevance is questioned in the simple PKDs. ARPKD’s mild phenotype in murine models versus in humans has hampered investi- gating its pathogenesis. Methods To study the interaction between Pkhd1 and Pkd1, including dosage effects on the phenotype, we generated digenic mouse and rat models and characterized and compared digenic, monogenic, and wild-type phenotypes. Results The genetic interaction was synergistic in both species, with digenic animals exhibiting pheno- types of rapidly progressive PKD and early lethality resembling classic ARPKD. Genetic interaction be- tween Pkhd1 and Pkd1 depended on dosage in the digenic murine models, with no significant enhancement of the monogenic phenotype until a threshold of reduced expression at the second locus was breached. -
Fkbp10 (NM 010221) Mouse Untagged Clone – MC201811 | Origene
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MC201811 Fkbp10 (NM_010221) Mouse Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Fkbp10 (NM_010221) Mouse Untagged Clone Tag: Tag Free Symbol: Fkbp10 Synonyms: AI325255; FKBP-10; FKBP-65; Fkbp-rs1; Fkbp1-rs; Fkbp6; FKBP65; Fkbprp Vector: PCMV6-Kan/Neo E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 3 Fkbp10 (NM_010221) Mouse Untagged Clone – MC201811 Fully Sequenced ORF: >BC029546 sequence for NM_010221 GTCCGCTCTCACTGCCGGCGTCCCTGGTCTGGGCACCATGTTCCTTGTGGGGTCCTCCAGCCACACCCTC CATCGGCTCCGCATACTGCCGTTGCTGTTGCTTCTACAGACCTTGGAGAGGGGACTGGGCCGTGCCAGCC CGGCCGGAGCCCCCTTGGAAGATGTGGTCATCGAGAGATACCACATCCCTCGGGCCTGTCCCCGAGAAGT GCAGATGGGGGATTTTGTGCGTTACCACTACAATGGCACTTTCGAAGACGGGAAAAAGTTTGACTCCAGC TATGACCGTAGCACCCTGGTGGCCATCGTTGTGGGCGTAGGCCGCCTCATCACCGGCATGGACCGGGGTC TCATGGGCATGTGTGTCAACGAGCGCCGCCGCCTCATTGTGCCTCCCCACCTGGGCTACGGCAGCATCGG TGTGGCGGGCCTCATCCCCCCTGATGCCACCCTCTATTTTGACGTGGTCCTGCTGGACGTGTGGAACAAA GCAGACACGGTGCAGTCAACTATCCTCCTGCGCCCTCCCTACTGCCCCCGAATGGTGCAGAACAGTGACT TTGTGCGCTATCACTACAATGGCACTCTGCTGGATGGCACTGCCTTTGACAACAGCTACAGTAGGGGAGG CACTTATGACACCTACATCGGCTCTGGTTGGCTGATCAAAGGCATGGACCAGGGGCTGCTGGGCATGTGC -
Environmental Influences on Endothelial Gene Expression
ENDOTHELIAL CELL GENE EXPRESSION John Matthew Jeff Herbert Supervisors: Prof. Roy Bicknell and Dr. Victoria Heath PhD thesis University of Birmingham August 2012 University of Birmingham Research Archive e-theses repository This unpublished thesis/dissertation is copyright of the author and/or third parties. The intellectual property rights of the author or third parties in respect of this work are as defined by The Copyright Designs and Patents Act 1988 or as modified by any successor legislation. Any use made of information contained in this thesis/dissertation must be in accordance with that legislation and must be properly acknowledged. Further distribution or reproduction in any format is prohibited without the permission of the copyright holder. ABSTRACT Tumour angiogenesis is a vital process in the pathology of tumour development and metastasis. Targeting markers of tumour endothelium provide a means of targeted destruction of a tumours oxygen and nutrient supply via destruction of tumour vasculature, which in turn ultimately leads to beneficial consequences to patients. Although current anti -angiogenic and vascular targeting strategies help patients, more potently in combination with chemo therapy, there is still a need for more tumour endothelial marker discoveries as current treatments have cardiovascular and other side effects. For the first time, the analyses of in-vivo biotinylation of an embryonic system is performed to obtain putative vascular targets. Also for the first time, deep sequencing is applied to freshly isolated tumour and normal endothelial cells from lung, colon and bladder tissues for the identification of pan-vascular-targets. Integration of the proteomic, deep sequencing, public cDNA libraries and microarrays, delivers 5,892 putative vascular targets to the science community. -
Pathway-Based Genome-Wide Association Analysis of Coronary Heart Disease Identifies Biologically Important Gene Sets
European Journal of Human Genetics (2012) 20, 1168–1173 & 2012 Macmillan Publishers Limited All rights reserved 1018-4813/12 www.nature.com/ejhg ARTICLE Pathway-based genome-wide association analysis of coronary heart disease identifies biologically important gene sets Lisa de las Fuentes1,4, Wei Yang2,4, Victor G Da´vila-Roma´n1 and C Charles Gu*,2,3 Genome-wide association (GWA) studies of complex diseases including coronary heart disease (CHD) challenge investigators attempting to identify relevant genetic variants among hundreds of thousands of markers being tested. A selection strategy based purely on statistical significance will result in many false negative findings after adjustment for multiple testing. Thus, an integrated analysis using information from the learned genetic pathways, molecular functions, and biological processes is desirable. In this study, we applied a customized method, variable set enrichment analysis (VSEA), to the Framingham Heart Study data (404 467 variants, n ¼ 6421) to evaluate enrichment of genetic association in 1395 gene sets for their contribution to CHD. We identified 25 gene sets with nominal Po0.01; at least four sets are previously known for their roles in CHD: vascular genesis (GO:0001570), fatty-acid biosynthetic process (GO:0006633), fatty-acid metabolic process (GO:0006631), and glycerolipid metabolic process (GO:0046486). Although the four gene sets include 170 genes, only three of the genes contain a variant ranked among the top 100 in single-variant association tests of the 404 467 variants tested. Significant enrichment for novel gene sets less known for their importance to CHD were also identified: Rac 1 cell-motility signaling pathway (h_rac1 Pathway, Po0.001) and sulfur amino-acid metabolic process (GO:0000096, Po0.001). -
A 1.37-Mb 12P11.22-P11.21 Deletion Coincident with a 367-Kb 22Q11.2
CORE Metadata, citation and similar papers at core.ac.uk Provided by Elsevier - Publisher Connector Taiwanese Journal of Obstetrics & Gynecology 53 (2014) 74e78 Contents lists available at ScienceDirect Taiwanese Journal of Obstetrics & Gynecology journal homepage: www.tjog-online.com Short Communication A 1.37-Mb 12p11.22ep11.21 deletion coincident with a 367-kb 22q11.2 duplication detected by array comparative genomic hybridization in an adolescent girl with autism and difficulty in self-care of menstruation Chih-Ping Chen a,b,c,d,e,f,*, Shuan-Pei Lin b,g,h,i, Schu-Rern Chern b, Peih-Shan Wu j, Jun-Wei Su a,k, Chen-Chi Lee a, Wayseen Wang b,l a Department of Obstetrics and Gynecology, Mackay Memorial Hospital, Taipei, Taiwan b Department of Medical Research, Mackay Memorial Hospital, Taipei, Taiwan c Department of Biotechnology, Asia University, Taichung, Taiwan d School of Chinese Medicine, College of Chinese Medicine, China Medical University, Taichung, Taiwan e Institute of Clinical and Community Health Nursing, National Yang-Ming University, Taipei, Taiwan f Department of Obstetrics and Gynecology, School of Medicine, National Yang-Ming University, Taipei, Taiwan g Department of Medicine, Mackay Medical College, New Taipei City, Taiwan h Department of Pediatrics, Mackay Memorial Hospital, Taipei, Taiwan i Mackay Junior College of Medicine, Nursing, and Management, Taipei, Taiwan j Gene Biodesign Co. Ltd, Taipei, Taiwan k Department of Obstetrics and Gynecology, China Medical University Hospital, Taichung, Taiwan l Department of Bioengineering, Tatung University, Taipei, Taiwan article info abstract Article history: Objective: To present an array comparative genomic hybridization (aCGH) characterization of a 12p11.22 Accepted 21 October 2013 ep11.21 microdeletion and 22q11.2 microduplication in an adolescent girl with autism, mental retar- dation, facial dysmorphism, microcephaly, behavior problems, and an apparently balanced reciprocal Keywords: translocation of t(8;12)(q24.3;p11.2). -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.