Supplemental figures
Supplemental figure 1: Tumor sample selection. A total of 98 thymic tumor specimens were
stored in Memorial Sloan-Kettering Cancer Center tumor banks during the study period. 64 cases
corresponded to previously untreated tumors, which were resected upfront after diagnosis.
Adjuvant treatment was delivered in 7 patients (radiotherapy in 4 cases, cyclophosphamide-
doxorubicin-vincristine (CAV) chemotherapy in 3 cases). 34 tumors were resected after
induction treatment, consisting of chemotherapy in 16 patients (cyclophosphamide-doxorubicin-
cisplatin (CAP) in 11 cases, cisplatin-etoposide (PE) in 3 cases, cisplatin-etoposide-ifosfamide
(VIP) in 1 case, and cisplatin-docetaxel in 1 case), in radiotherapy (45 Gy) in 1 patient, and in
sequential chemoradiation (CAP followed by a 45 Gy-radiotherapy) in 1 patient. Among these
34 patients, 6 received adjuvant radiotherapy.
1 Supplemental Figure 2: Amino acid alignments of KIT H697 in the human protein and related orthologs, using (A) the Homologene database (exons 14 and 15), and (B) the UCSC Genome
Browser database (exon 14). Residue H697 is highlighted with red boxes. Both alignments indicate that residue H697 is highly conserved.
2 Supplemental Figure 3: Direct comparison of the genomic profiles of thymic squamous cell carcinomas (n=7) and lung primary squamous cell carcinomas (n=6). (A) Unsupervised clustering analysis. Gains are indicated in red, and losses in green, by genomic position along the 22 chromosomes. (B) Genomic profiles and recurrent copy number alterations in thymic carcinomas and lung squamous cell carcinomas. Gains are indicated in red, and losses in blue.
3 Supplemental Methods
Mutational profiling
The exonic regions of interest (NCBI Human Genome Build 36.1) were broken into amplicons of 500 bp or less, and specific primers were designed using Primer 3 (on the
World Wide Web for general users and for biologist programmers (see Supplemental
Table 2) [1]. M13 tails were added to facilitate Sanger sequencing.
PCR reactions were carried out in 384 well plates, in a Duncan DT-24 water bath thermal cycler, with 10 ng of DNA as template, using a touchdown PCR protocol with
HotStart Taq (Kapa Biosystems, Cape Town, South Africa). The touchdown PCR method consisted of : 1 cycle of 95°C for 5 min; 3 cycles of 95°C for 30 sec, 64°C for 30 sec,
72°C for 60 sec; 3 cycles of 95°C for 30 sec, 62°C for 30 sec, 72°C for 60 sec; 3 cycles of 95°C for 30 sec, 60°C for 30 sec, 72°C for 60 sec; 37 cycles of 95°C for 30 sec, 58°C for 30 sec, 72°C for 60 sec; 1 cycle of 70°C for 5 min. Templates were purified using
AMPure (Agencourt Biosciences, Beverly, MA). The purified PCR reactions were split into two, and sequenced bidirectionally with M13 forward and reverse primers and Big
Dye Terminator Kit v.3.1 (Applied Biosystems, Foster City, CA), at Agencourt
Biosciences. Dye terminators were removed using the CleanSEQ kit (Agencourt
Biosciences), and sequence reactions were run on ABI PRISM 3730xl sequencing apparatus (Applied Biosystems, Foster City, CA).
1 Mutation detection
Raw mass-spectrometry data were processed using the SpectroTYPER software
(Sequenom, Sequenom, San Diego, CA). DNA sequencing chromatograms were
analyzed using an institutional mutation detection pipeline. Briefly, bi-directional reads
and mapping tables (to link read names to sample identifiers, gene names, read direction,
and amplicon) were subjected to a QC filter which excludes reads that have an average
phred score of < 10 for bases 100-200. Passing reads were assembled against the
reference sequences for each gene, containing all coding and UTR exons including 5Kb
upstream and downstream of the gene, using command line Consed 16.0 (PMID:
9521923) [2]. Assemblies were passed on to Polyphred 6.02b (PMID: 9207020) which
generated a list of putative candidate mutations, and to Polyscan 3.0 (PMID: 17416743)
which generated a second list of putative mutations. The lists were merged together into a
combined report, and the putative mutation calls were normalized to ‘+’ genomic coordinates and annotated using the Genomic Mutation Consequence Calculator (PMID:
17599934). The resulting list of annotated putative mutations was loaded into a Postgres
database along with select assembly details for each mutation call (assembly position,
coverage, and methods supporting mutation call). To reduce the number of false positives generated by the mutation detection software packages, only point mutations which are
supported by at least one bi-directional read pair and at least one sample mutation called
by Polyphred were considered, and only the putative mutations which are annotated as
having non-synonymous coding effects, occur within 11 bp of an exon boundary, or have
a conservation score > 0.699 (http://genome.ucsc.edu/cgi-
bin/hgTrackUi?hgsid=108554407&g=multiz17way) were included in the final candidate
2 list. Indels called by any method were manually reviewed and included in the candidate
list if found to hit an exon. All data were also manually reviewed to identify putative
mutations. Synonymous variants and those with entries in the NCBI SNP database were
excluded. All putative mutations were confirmed by a second PCR and sequencing reaction, in parallel with amplification and sequencing of matched normal tissue DNA.
Genomic profiling data interpretation
Significant transitions in copy number were identified from the calculated fluorescence ratios of the scanned images, using the circular binary segmentation algorithm [3]. Gains and losses for a subset of analyses were defined using sample- specific thresholds. Specifically, median absolute deviation (MAD) of the difference between the observed values and the segmentation means was used to estimate the within-sample variation. The sample-specific threshold to call gains and losses is then defined as 1.5 MAD above or below the sample median of the segmented values. Regions of high level amplification or deletion (amplitude higher than 3 MAD) were declared to be recurrent if present in at least two samples. For comparison with profiles from pulmonary primary squamous cell carcinomas, we used genomic profiles generated from a different Memorial Sloan-Kettering Cancer Center Institutional Review Board- approved study.
Expression profiling data interpretation
The robust multichip average (RMA) method was used to estimate expression of probe sets [4]. For unsupervised clustering, we applied a hierarchical clustering algorithm
3 on the most variable 1429 genes, with the Pearson correlation coefficient as the measure
of similarity and average linkage as the method to join clusters.
Immunohistochemistry
A tissue microarray (TMA) was constructed using formalin-fixed, paraffin-embedded
previously untreated tumor tissue specimens, which were reviewed by a single
pathologist (M.F.Z.). Triplicate 0.6 mm biopsy cores were taken from selected areas
containing a high ratio of tumor epithelial cells on parallel hematoxylin and eosin (H&E)-
stained sections and arrayed onto master paraffin blocks using a manual tissue arrayer
(Beecher Instruments, Sun Prairie, WI). For previously treated tumors,
immunohistochemistry was done on individual paraffin-embedded tumor blocks. Five-
micrometer sections from the tissue microarray or the tumor blocks were deparaffinized
in xylene and dehydrated in graded alcohols.
Ba/F3-KIT mutant transformant assays
The KITV560del and KITH697Y mutations were generated using the QuikChange II XL
site-directed Mutagenesis Kit (Stratagene, Agilent Technologies, Santa Clara, CA) and
pMSCV-wtKIT-IRES-GFP, a retroviral expression vector (kindly provided by Dr. Gary
Gilliland, Harvard Medical School) containing a wild-type human KIT cDNA (GNNK- isoform). Ba/F3 cells were co-transfected with the KITV560del or the KITH697Y cDNA (25
μg) and a hygromycin-resistance gene (25:1 ratio) by electroporation as previously
described [5].
4 Ba/F3 cells were maintained with 10 ng/ml recombinant murine IL-3 and 200 μg hygromycin for 10 days, and then selected for IL-3-independent growth. The IL3- independent BaF3 KITV560del and KITH697Y cells reached optimal growth with 20 ng/ml human stem cell factor (hSCF). KIT cell surface expression was confirmed by flow cytometry using PE-conjugated anti-CD117 (BD Biosciences, San Jose, CA) antibody.
Total KIT expression was confirmed by immunoblots using an anti-KIT (Oncogene, San
Diego, CA) antibody (data not shown). IL-3-independent clones were verified by direct sequencing to harbor mutant cDNAs. For drug sensitivity assays, Ba/F3 KITV560del and
KITH697Y cells were starved from hSCF for 4 hours. 15 minutes prior to drug administration, 20ng/ml of hSCF was added.
References
1. Krawetz S, Misener S (eds): Bioinformatics Methods and Protocols: Methods in
Molecular Biology. Humana Press, Totowa, NJ, 2000;pp 365-6.
2. Gordon D, Abajian C, Green P. Consed: A Graphical Tool for Sequence Finishing.
Genome Res 1998;8:195-202.
3. Olshen AB, Venkatraman ES, Lucito R, Wigler M. Circular binary segmentation for
the analysis of array-based DNA copy number data. Biostatistics 2004;5:557-72.
4. Irizarry RA, Hobbs B, Collin F, et al. Exploration, normalization, and summaries of
high density oligonucleotide array probe level data. Biostatistics 2003;4:249-64.
5 5. Guo T, Agaram NP, Wong GC, et al. Sorafenib inhibits the imatinib-resistant
KITT670I gatekeeper mutation in gastrointestinal stromal tumor. Clin Cancer Res
2007;13:4874-81.
6 Supplemental Tables
Supplemental Table 1: List of mutations screened using mass spectrometry-based sequencing
(Sequenom).
Gene Effect Nucleotide change Nucleotide position
AKT1 E17K G to A 49 BRAF G469A, G469E, G469V G to C, G to A, G to T 1406 BRAF D594G, D594V A to G, A to T 1781 BRAF V600M G to A 1798 BRAF V600A, V600E, V600G T to C, T to A, T to G 1799 EGFR G719C, G719S G to T, G to A 2155 EGFR G719A, G719D G to C, G to A 2156 EGFR D761Y G to T 2281 EGFR S768I G to T 2303 EGFR T790M C to T 2369 EGFR T854A A to G 2560 EGFR L858M C to A 2572 EGFR L858R T to G 2573 EGFR L861Q T to A, T to G 2582 ERBB2 L755S T to C 2264 ERBB2 D769H G to C 2305 ERBB2 V777M, V777L G to A, G to T 2329 HRAS G12C, G12R, G12S G to T, G to C, G to A 34 HRAS G12A, G12D, G12V G to T, G to C, G to A 35 HRAS G13C, G13R, G13S G to T, G to C, G to A 37 HRAS G13D, G13V G to T, G to A 38 HRAS Q61E, Q61K C to G, C to A 181 HRAS Q61L, Q61P, Q61R A to T, A to C, A to G 182 HRAS Q61H G to T, G to C 183 KRAS G12C, G12R, G12S G to T, G to C, G to A 34 KRAS G12A, G12D, G12V G to T, G to C, G to A 35 KRAS G13C, G13R, G13S G to T, G to C, G to A 37 KRAS G13A, G13D, G13V G to T, G to C, G to A 38 KRAS Q61E, Q61K C to G, C to A 181 KRAS Q61L, Q61P, Q61R A to T, A to C, A to G 182 KRAS Q61H G to T, G to C 183 KRAS A146P, A146T G to C, G to A 436 MEK1 Q56P A to C 167 MEK1 K57N G to C 171 MEK1 D67N G to A 199 NRAS G12C, G12R, G12S G to T, G to C, G to A 34 NRAS G12A, G12D, G12V G to T, G to C, G to A 35
1 NRAS G13C, G13R, G13S G to T, G to C, G to A 37 NRAS G13A, G13D, G13V G to T, G to C, G to A 38 NRAS Q61E, Q61K C to G, C to A 181 NRAS Q61L, Q61P, Q61R A to T, A to C, A to G 182 NRAS Q61H G to T, G to C 183 PIK3CA R88Q G to A 263 PIK3CA N345K T to A, T to G 1035 PIK3CA C420R T to C 1258 PIK3CA E542K, E542Q G to A, G to C 1624 PIK3CA E545K G to A 1633 PIK3CA E545A, E545G A to C, A to G 1634 PIK3CA E545D G to T 1635 PIK3CA M1043I G to T 3129 PIK3CA H1047Y C to T 3139 PIK3CA H1047L, H1047R A to T, A to G 3140
2 Supplemental Table 2: Primers used for direct sequencing.
Gene Target genomic Primer Name Sequence Primer location Predicted coordinates size
TP53 chr17:7520563-7520665 TP53_674173_L_10262116_chr17_7520247_20 AGCCCAACCCTTGTCCTTAC chr17:7520405-7520425 404 TP53 chr17:7520563-7520665 TP53_674173_R_10262117_chr17_7521014_20 CAGCCATTCTTTTCCTGCTC chr17:7520789-7520809 404 TP53 chr17:7520424-7520446 TP53_674179_L_8923774_chr17_7520030_20 TCATCTGGACCTGGGTCTTC chr17:7520227-7520247 377 TP53 chr17:7520424-7520446 TP53_674179_R_8923775_chr17_7520743_20 CCCCTCTGAGTCAGGAAACA chr17:7520584-7520604 377 TP53 chr17:7520036-7520315 TP53_674185_L_10158326_chr17_7519830_20 GCCAAAGGGTGAAGAGGAAT chr17:7519933-7519953 492 TP53 chr17:7520036-7520315 TP53_674185_R_10158327_chr17_7520773_20 GTAAGGACAAGGGTTGGGCT chr17:7520405-7520425 492 TP53 chr17:7519095-7519475 TP53_674190_L_11806990__7516988_20 TTACCTGCAATTGGGGCATT chr17:7517188-7517208 312 TP53 chr17:7519095-7519475 TP53_674190_R_11806991__7517279_20 GCAGGCTAGGCTAAGCTATGATG chr17:7517470-7517499 312 TP53 chr17:7519476-7519536 TP53_674191_L_11674646_chr17_7519210_20 GTCACTCAGGCTGGAGCAC chr17:7519473-7519492 234 TP53 chr17:7519476-7519536 TP53_674191_R_11674647_chr17_7519897_20 CACTCTCAAAGAGGCCAAGG chr17:7519685-7519706 234 TP53 chr17:7518901-7519014 TP53_674206_L_9762236_chr17_7518645_20 TTGCACATCTCATGGGGTTA chr17:7518773-7518793 389 TP53 chr17:7518901-7519014 TP53_674206_R_9762237_chr17_7519382_20 AGTCACAGCACATGACGGAG chr17:7519142-7519162 389 TP53 chr17:7518223-7518333 TP53_674214_L_9378982_chr17_7517847_20 TGGAAGAAATCGGTAAGAGGTG chr17:7518129-7518150 267 TP53 chr17:7518223-7518333 TP53_674214_R_9378983_chr17_7518788_20 CTGCTTGCCACAGGTCTCC chr17:7518376-7518395 267 TP53 chr17:7517743-7517880 TP53_674222_L_10742560_chr17_7517465_20 GTGGTTTCTTCTTTGGCTGG chr17:7517604-7517624 377 TP53 chr17:7517743-7517880 TP53_674222_R_10742561_chr17_7518178_20 CAAGGGTGGTTGGGAGTAGA chr17:7517961-7517981 377 TP53 chr17:7517577-7517651 TP53_674227_L_10972200_chr17_7517319_20 TGTCTTTGAGGCATCACTGC chr17:7517448-7517468 370 TP53 chr17:7517577-7517651 TP53_674227_R_10972201_chr17_7518018_20 GCGCACAGAGGAAGAGAATC chr17:7517798-7517818 370 TP53 chr17:7517249-7517309 TP53_674232_L_11806988__7518765_20 AAGCAGGCTAGGCTAAGCTATG chr17:7517186-7517208 200 TP53 chr17:7517249-7517309 TP53_674232_R_11806989__7519337_20 AAGGACCAGACCAGCTTTCA chr17:7517365-7517385 200 TP53 chr17:7514651-7514758 TP53_674233_L_chr17_7514491 TCAACCGGAGGAAGACTAAAAA chr17:7514491-7514513 500 TP53 chr17:7514651-7514758 TP53_674233_R_chr17_7514990_new ATCAGCCAAGATTGCACCAT chr17:7514970-7514990- 500 TP53 chr17:7512444-7512824 TP53_674237_L_9365434_chr17_7512164_20 CCCACACTCATTGCAGACTC chr17:7512355-7512374 467 TP53 chr17:7512444-7512824 TP53_674237_R_9365435_chr17_7513521_20 CTTGGCTTACTGCAGCCTTT chr17:7512800-7512821 467 TP53 chr17:7512825-7513204 TP53_674238_L_11806984__7512598_20 AAGAAATTGACCCTGAGCATAAA chr17:7512903-7512922 402 TP53 chr17:7512825-7513204 TP53_674238_R_11806985_chr17_15025376_20 CCCTCACTGTTGAATTTTCTCT chr17:7513282-7513304 402 TP53 chr17:7513205-7513584 TP53_674239_L_11607576_chr17_7513035_20 CAACAGGGAGAGGGAACAAG chr17:7513120-7513140 592 TP53 chr17:7513205-7513584 TP53_674239_R_11607577_chr17_7514178_20 CAGTCTACCTCCCGCCATAA chr17:7513692-7513712 592 TP53 chr17:7513585-7513733 TP53_674240_L_11245318_chr17_7513347_20 CCACAACAAAACACCAGTGC chr17:7513466-7513486 349 TP53 chr17:7513585-7513733 TP53_674240_R_11245319_chr17_7514004_20 AAAGCATTGGTCAGGGAAAA chr17:7513795-7513815 349
3 TP53 chr17:7510128-7510287 TP53_674253_L_9326234_chr17_7509742_20 GTGCTGTGTGCTGGGATTAC chr17:7509935-7509955 533 TP53 chr17:7510128-7510287 TP53_674253_R_9326235_chr17_7510767_20 GTGCCAGGAGCTGTTCTAGG chr17:7510448-7510468 533 TP53 chr17:7505821-7506057 TP53_674254_L_8904592_chr17_7505640_20 CGGAACTCCTGAGCTGAAAG chr17:7505711-7505731 418 TP53 chr17:7505821-7506057 TP53_674254_R_8904593_chr17_7506474_20 GCAGGAGAGTTGCTTGAACC chr17:7506148-7506168 418 PTEN chr10:89613935-89614285 PTEN_Exon1cod_L_chr10_89614098 ATCAGCTACCGCCAAGTCC chr10:89614098-89614119 309 PTEN chr10:89613935-89614285 PTEN_Exon1cod_R_chr10_89614406 GCAACCTGACCAGGGTTAAA chr10: 89614386-89614406 309 PTEN chr10:89643761-89643846 PTEN_263484_L_8650644_chr10_89643531_20 CTCCAGCTATAGTGGGGAAA chr10:89643646-89643666 376 PTEN chr10:89643761-89643846 PTEN_263484_R_8650645_chr10_89644242_20 CTGTATCCCCCTGAAGTCCA chr10:89644002-89644022 376 PTEN chr10:89675249-89675294 PTEN_263485_L_8342848_chr10_89674921_22 CCATAGAAGGGGTATTTGTTGG chr10:89675085-89675107 410 PTEN chr10:89675249-89675294 PTEN_263485_R_8342849_chr10_89675698_21 TGCCAACAATGTTTTACCTCA chr10:89675474-89675495 410 PTEN chr10:89680782-89680826 PTEN_263486_L_8707764_chr10_89680600_22 AAAGATTCAGGCAATGTTTGTT chr10:89680691-89680713 235 PTEN chr10:89680782-89680826 PTEN_263486_R_8707765_chr10_89681023_23 TCTCACTCGATAATCTGGATGAC chr10:89680903-89680926 235 PTEN chr10:89682749-89682988 PTEN_263487_L_8399658_chr10_89682505_26 GGAATCCAGTGTTTCTTTTAAATACC chr10:89682627-89682653 437 PTEN chr10:89682749-89682988 PTEN_263487_R_8399659_chr10_89683334_22 GAAACCCAAAATCTGTTTTCCA chr10:89683042-89683064 437 PTEN chr10:89701854-89701996 PTEN_263488_L_9558330_chr10_89701672_20 GGCTACGACCCAGTTACCAT chr10:89701763-89701783 434 PTEN chr10:89701854-89701996 PTEN_263488_R_9558331_chr10_89702499_20 TAAAACCCATTGCTTTTGGC chr10:89702177-89702197 434 PTEN chr10:89707589-89707756 PTEN_263489_L_11635076_chr10_89707315_21 TGCTTGAGATCAAGATTGCAG chr10:89707452-89707473 492 PTEN chr10:89707589-89707756 PTEN_263489_R_11635077_chr10_89708258_20 GCCATAAGGCCTTTTCCTTC chr10:89707924-89707944 492 PTEN chr10:89710630-89710855 PTEN_263490_L_10963480_chr10_89710244_22 GCAACAGATAACTCAGATTGCC chr10:89710437-89710459 608 PTEN chr10:89710630-89710855 PTEN_263490_R_10963481_chr10_89711417_21 TTTTGACGCTGTGTACATTGG chr10:89711024-89711045 608 PTEN chr10:89715023-89715403 PTEN_263491_L_11621126_chr10_89714813_21 TGTTCATCTGCAAAATGGAAT chr10:89714918-89714939 579 PTEN chr10:89715023-89715403 PTEN_263491_R_11621127_chr10_89715930_20 TAAAACGGGAAAGTGCCATC chr10:89715477-89715497 579 EGFR chr7:55209908-55210007 EGFR_117519_L_1362393_chr7_55209557_ CCCCAGCAATATCAGCCTTA chr7:55209757-55209777 433 EGFR chr7:55209908-55210007 EGFR_117519_R_1362394_chr7_55209970_ CCAGTGCTGTCTCTAAGGGG chr7:55210170-55210190 433 KIT chr4:55286779-55286973 KIT_183557_L_9977016_chr4_55286629_20 ATGCCACATCCCAAGTGTTT chr4:55286704-55286724 470 KIT chr4:55286779-55286973 KIT_183557_R_9977017_chr4_55287526_21 GCATGGTTAAAATTGCTCTGG chr4:55287153-55287174 470 KIT chr4:55288140-55288247 KIT_183558_L_8489812_chr4_55287992_20 GTTTGGGACTGAGTGGCTGT chr4:55288066-55288086 285 KIT chr4:55288140-55288247 KIT_183558_R_8489813_chr4_55288521_20 ATACATGGGTTTCTGTGGGG chr4:55288331-55288351 285 KIT chr4:55288338-55288465 KIT_183559_L_11772766_chr4_55287970_20 CCACACCCTGTTCACTCCTT chr4:55288154-55288174 457 KIT chr4:55288338-55288465 KIT_183559_R_11772767_chr4_55288843_20 TGGCAAACCTATCAAAAGGG chr4:55288591-55288611 457 KIT chr4:55288933-55289044 KIT_183564_L_9988326_chr4_55288619_20 AGGTTGTTGAGGCAACTGCT chr4:55288776-55288796 401 KIT chr4:55288933-55289044 KIT_183564_R_9988327_chr4_55289376_22 GCAAGAGAGAACAACAGTCTGG chr4:55289155-55289177 401 KIT chr4:55290257-55290408 KIT_183566_L_11550136_chr4_55290091_20 TGACCACCCTTGGGTATTTT chr4:55290174-55290194 308 KIT chr4:55290257-55290408 KIT_183566_R_11550137_chr4_55290666_20 GCCTTGATTGCAAACCCTTA chr4:55290462-55290482 308
4 Supplemental Table 3: Clinical characteristics
Characteristics Number of patients
Total 45
Gender Men 23 Women 22
Masaoka stage I 5 II 14 III 18 IV 8
WHO type A 8 B2 22 B3 8 Thymic carcinoma (squamous cell carcinoma) 7
Neoadjuvant treatment No 27 Yes 18
* Type A and AB thymomas were excluded by study design
5 Supplemental Table 4: Expression profiling: differentially expressed genes between thymic carcinomas (n=5) and thymomas (n=18). Fold change higher than 1.50 indicates higher expression in thymic carcinomas, and fold change below -1.50 higher expression in thymomas.
FDR: False Discovery Rate.
Gene Symbol Location Fold ChangeFDR
IGF2BP3 7p11 4.09 3.41E-03 CHI3L1 1q32.1 3.47 2.90E-02 CD24 6q21 3.38 3.98E-02 CCL20 2q33 3.29 4.23E-02 KRT17 17q12-q21 3.18 2.15E-02 GABRP 5q33 3.04 8.42E-03 SERPINB2 18q21.3 2.87 2.90E-02 CALML5 10p15.1 2.86 8.60E-03 KRT23 17q21.2 2.73 1.34E-02 FST 5q11.2 2.71 3.75E-03 COL1A1 17q21.33 2.49 2.15E-02 PI3 20q12-q13 2.48 2.66E-02 EHF 11p12 2.44 8.30E-03 MOCOS 18q12 2.43 1.26E-02 ATAD4 17q21.32 2.42 4.00E-02 COL5A1 9q34.2 2.36 1.68E-02 SLC12A8 3q21.2 2.34 6.99E-03 IL1RN 2q14.2 2.33 2.11E-02 CLDN3 7q11.23 2.33 2.65E-02 TGFA 2p13 2.32 1.60E-03 HOXB7 17q21.3 2.29 2.11E-02 THBS2 6q27 2.26 2.89E-02 ABHD9 20q12-q13.11 2.26 2.27E-03 FST 5q11.2 2.26 2.62E-03 ERBB3 12q13 2.26 4.24E-02 GREM1 15q13 2.25 3.32E-02 DHRS9 2q31.1 2.22 4.18E-02 ELF3 1q32.2 2.17 3.82E-02 LRRC15 3q29 2.11 1.71E-02 COL5A2 2q14 2.10 4.75E-02 PITX1 5q31 2.09 6.47E-03 F2RL1 5q13 2.08 2.72E-02 TMPRSS4 11q23.3 2.07 1.63E-02 PHLDA2 11p15.5 2.06 2.28E-02 KCNMA1 10q22.3 2.06 3.38E-02 EMP2 16p13.2 2.06 8.60E-03 PLAU 10q24 2.06 2.67E-02 APOBEC3A 22q13.1-q13.2 2.05 2.99E-02 REEP1 2p11.2 2.05 4.85E-02 SPRR1A 1q21-q22 2.02 1.92E-02 APOBEC3B 22q13.1-q13.2 2.02 2.84E-02 KRT18 12q13 2.01 3.87E-02 TM4SF1 3q21-q25 2.00 2.83E-02 CXADR 21q21.1 2.00 4.07E-02 EPB41L4B 9q31-q32 2.00 2.65E-02 BSPRY 9q32 1.99 5.11E-03 ST14 11q24-q25 1.98 2.34E-02 ATF5 19q13.3 1.98 7.51E-03 SULF1 8q13.2-q13.3 1.97 4.78E-02 TNFAIP6 2q23.3 1.97 4.75E-02 CXCL11 4q21.2 1.93 2.77E-02 ARNTL2 12p12.2-p11.2 1.92 1.66E-02 MAFF 22q13.1 1.91 1.09E-02 DLX5 7q22 1.88 3.98E-02 MMP1 11q22.3 1.87 2.16E-02 JUP 17q21 1.86 1.92E-02
6 MYO6 6q13 1.86 1.97E-02 VTCN1 1p13.1 1.85 2.85E-02 IQCG 3q29 1.85 4.16E-02 RAPGEFL1 17q21.1 1.82 1.11E-02 FAM129A 1q25 1.82 4.85E-02 CEACAM1 19q13.2 1.80 4.25E-02 B3GALNT1 3q25 1.80 4.96E-02 INHBA 7p15-p13 1.80 3.08E-02 PITX2 4q25-q27 1.79 4.17E-02 SERPINB4 18q21.3 1.79 4.17E-02 MMP11 22q11.23 1.77 2.06E-02 NUAK2 1q32.1 1.77 1.76E-02 WWC1 5q35.1 1.77 7.65E-03 SLC2A1 1p35-p31.3 1.76 4.07E-02 DUSP5 10q25 1.76 3.64E-02 CD9 12p13.3 1.76 2.90E-02 TOM1L1 17q23.2 1.75 7.51E-03 SLCO3A1 15q26 1.75 4.11E-02 SLC27A2 15q21.2 1.73 4.07E-02 TNFAIP2 14q32 1.72 2.90E-02 B4GALT5 20q13.1 1.71 2.39E-02 ADAM8 10q26.3 1.70 2.20E-02 MALL 2q13 1.69 1.27E-02 BIK 22q13.31 1.69 3.98E-02 DUSP10 1q41 1.69 1.44E-02 CLDN4 7q11.23 1.68 3.82E-02 MYO1B 2q12-q34 1.67 4.04E-02 CHPT1 12q 1.66 3.98E-02 PROX1 1q32.2 1.66 2.57E-02 LSR 19q13.12 1.65 2.02E-02 GJB3 1p34 1.65 3.40E-02 MCTP2 15q26.2 1.65 4.12E-02 CYB5A 18q23 1.64 4.44E-02 SLC6A15 12q21.3 1.63 8.30E-03 LRRC8B 1p22.2 1.62 2.62E-03 TEAD4 12p13.3-p13.2 1.62 2.08E-02 HEPH Xq11 1.62 4.23E-02 HNT 6p26 1.61 2.65E-02 FOLH1 11p11.2 1.61 7.51E-03 TLR3 4q35 1.60 4.91E-02 FAP 2q23 1.59 4.47E-02 GRB7 17q12 1.59 2.78E-03 PADI3 1p36.13 1.58 3.32E-02 EPS8 12q13 1.58 2.75E-02 NDUFA4L2 12q13.3 1.56 4.82E-02 VDR 12q13.11 1.55 3.83E-02 GRP 18q21.1 1.54 3.19E-02 STARD5 15q26 1.53 4.16E-02 OCLN 5q13.1 1.53 4.00E-02 LMAN1 18q21.3 1.53 1.32E-02 KCNN3 1q21.3 1.53 4.83E-02 LLGL2 17q24 1.52 4.73E-02 TSPO 22q13.31 1.52 1.74E-02 AP1S2 Xp22.2 -1.51 1.60E-02 DCP2 5q22.2 -1.52 1.09E-02 GCHFR 15q15 -1.53 9.55E-03 C3orf63 3p14.3 -1.53 1.33E-02 PKIA 8q21.12 -1.55 2.63E-02 GYPC 2q14-q21 -1.56 1.41E-02 MAGEH1 Xp11.21 -1.56 1.26E-02 PRKACB 1p36.1 -1.57 3.08E-02 ZNF529 19q13.41 -1.57 3.32E-02 PIK3R1 5q13.1 -1.57 2.81E-02 KIAA1305 14q12 -1.58 3.01E-02 ARHGAP19 10q24.1 -1.59 8.60E-03 CCDC109B 4q25 -1.60 3.98E-02 SEPP1 5q31 -1.60 2.83E-02 GRK5 10q24-qter -1.63 3.50E-02 ZNF167 3p22.3-p21.1 -1.64 2.15E-02 RCAN1 21q22.12 -1.65 2.21E-02 GPSM3 6p21.3 -1.67 3.82E-03 NCKAP1L 12q13.1 -1.69 3.84E-02 SELPLG 12q24 -1.70 3.96E-02 HDAC4 2q37.3 -1.71 4.78E-02 MPP1 Xq28 -1.71 3.84E-02
7 RCBTB2 13q14.3 -1.71 6.30E-04 FAM69A 1p22.1 -1.72 4.60E-02 BACH2 6q15 -1.72 4.85E-02 C13orf15 13q14.11 -1.72 2.83E-02 GIMAP6 7 -1.72 1.34E-02 IRF8 16q24.1 -1.74 2.77E-02 MAPRE2 18q12.1 -1.75 1.80E-02 ARHGEF6 Xq26.3 -1.75 4.17E-02 NFATC3 16q22.2 -1.75 3.81E-02 RUFY3 4q13.3 -1.76 1.44E-02 PLXDC1 17q21.1 -1.79 4.95E-02 AIF1 6p21.3 -1.79 2.59E-02 ZEB1 10p11.2 -1.80 4.48E-02 SYNE1 6q25 -1.80 3.32E-03 TLR7 Xp22.3 -1.81 1.34E-02 PTGER4 5p13.1 -1.81 3.71E-02 DPP4 2q24.3 -1.82 3.77E-02 ACOX2 3p14.3 -1.83 4.78E-03 MFNG 22q12 -1.83 2.17E-02 KHDRBS3 8q24.2 -1.87 3.50E-02 LAIR1 19q13.4 -1.90 4.67E-02 DNASE1L3 3p21.1-p14.3 -1.92 8.60E-03 BEX4 Xq22.1-q22.3 -1.93 2.09E-02 SATB1 3p23 -1.94 4.29E-02 EPB41L3 18p11.32 -1.98 9.83E-03 GPRASP1 Xq22.1 -1.99 3.19E-02 CUGBP2 10p13 -1.99 8.30E-03 RHOBTB3 5q15 -2.00 2.15E-02 HBB 11p15.5 -2.01 4.18E-02 HBA2 16p13.3 -2.03 4.17E-02 PON3 7q21.3 -2.04 1.18E-02 CHRDL1 Xq22.3 -2.11 2.52E-02 ZAP70 2q12 -2.18 3.92E-02 GAS2 11p14.3-p15.2 -2.19 4.17E-02 SEPT6 Xq24 -2.21 3.19E-02 HPGD 4q34-q35 -2.22 3.84E-02 HPGD 4q34-q35 -2.29 3.89E-02 GMFG 19q13.2 -2.35 2.12E-02 C6orf32 6p22.3-p21.32 -2.36 1.13E-02 HBB 11p15.5 -2.37 3.84E-02 AKR1C3 10p15-p14 -2.37 1.74E-02 CD8B 2p12 -2.44 3.42E-02 ARHGAP15 2q22.2 -2.44 4.68E-02 PCDH9 13q14.3-q21.1 -2.51 2.57E-02 ITM2A Xq13.3-Xq21.2 -2.53 1.97E-02 TOX 8q12.1 -2.54 2.65E-02 CD1D 1q22-q23 -2.57 1.42E-02 CHI3L2 1p13.3 -2.60 4.29E-02 TRGV9 7p14 -2.61 4.97E-02 PRKCB1 16p11.2 -2.74 1.34E-02 PNMAL1 19q13.32 -2.91 1.66E-02 CXCL12 10q11.1 -2.97 2.27E-02 SLC27A6 5q23.3 -3.20 1.68E-02 TRD@ 14q11.2 -3.79 4.96E-02
8 Supplemental Table 5: Gene expression analysis of 23 thymic tumors (unsupervised hierarchical clustering). Gene set enrichment analysis of differentially expressed genes in cluster
1 vs. cluster 2. Most genes are related to the immune system.
Pathway Number of pathway genes Number of pathway Adjusted in the experiment set genes in the top list p-value
immune system process 701 76 5,3E-19 immune response 532 60 2,0E-15 T cell activation 86 21 6,5E-11 lymphocyte activation 139 26 6,5E-11 leukocyte activation 162 27 3,2E-10 cell activation 183 28 8,7E-10 mitosis 177 25 6,4E-08 response to stimulus 1907 107 6,4E-08 M phase of mitotic cell cycle 179 25 6,4E-08 cell cycle 623 50 1,4E-07 mitotic cell cycle 269 30 2,4E-07 cell cycle process 354 35 2,4E-07 cell cycle phase 289 30 1,1E-06 M phase 228 26 1,5E-06 lymphocyte differentiation 59 13 2,7E-06 regulation of T cell activation 56 12 1,2E-05 T cell differentiation 37 10 1,2E-05 leukocyte differentiation 85 14 3,1E-05 hemopoiesis 150 18 8,9E-05 cell division 187 20 1,4E-04 regulation of immune system process 141 17 1,5E-04 regulation of lymphocyte activation 72 12 1,5E-04 hemopoietic or lymphoid organ development 161 18 2,1E-04 regulation of cell activation 77 12 2,7E-04 regulation of leukocyte activation 77 12 2,7E-04 defense response 470 34 3,3E-04 immune system development 172 18 4,5E-04 positive regulation of antigen receptor-mediated signaling pathway 3 3 1,5E-03 regulation of multicellular organismal process 284 23 1,8E-03 positive regulation of immune system process 112 13 2,4E-03 T cell selection 8 4 2,6E-03 T cell differentiation in the thymus 8 4 2,6E-03 cell communication 2894 124 3,2E-03 response to virus 86 11 3,3E-03 signal transduction 2614 114 3,3E-03 positive regulation of multicellular organismal process 135 14 3,7E-03 mitotic sister chromatid segregation 27 6 6,0E-03 sister chromatid segregation 28 6 7,2E-03 positive regulation of T cell activation 40 7 8,0E-03 positive regulation of cell activation 53 8 8,0E-03 positive regulation of leukocyte activation 53 8 8,0E-03 antigen receptor-mediated signaling pathway 19 5 8,0E-03 establishment of chromosome localization 5 3 8,9E-03 mitotic cell cycle spindle assembly checkpoint 5 3 8,9E-03 chromosome localization 5 3 8,9E-03 cellular defense response 69 9 9,2E-03 positive regulation of mitosis 12 4 1,1E-02 immune response-activating cell surface receptor signaling pathway 22 5 1,5E-02 T cell receptor signaling pathway 13 4 1,5E-02
9 Supplemental Table 6. Genes differentially expressed between thymic carcinomas (n=5) and type A thymomas (n=5). Fold change higher than 1.50 indicates higher expression in thymic carcinomas, and fold change below -1.50 higher expression in type A thymomas. FDR: False
Discovery Rate.
Gene Symbol Location Fold Change FDR
S100A8 1q21 3.91 3.7E-02 IFI27 14q32 3.17 1.7E-02 SPP1 4q21-q25 2.69 3.8E-02 OAS2 12q24.2 2.46 3.9E-03 ADAMDEC1 8p21.2 2.42 3.9E-02 CALML3 10pter-p13 2.37 2.2E-02 SV2B 15q26.1 2.36 1.3E-02 PMAIP1 18q21.32 2.31 3.1E-02 SLC12A8 3q21.2 2.28 2.1E-02 IL1RN 2q14.2 2.25 4.2E-02 LAMP3 3q26.3-q27 2.19 3.8E-02 APOBEC3B 22q13.1-q13.2 2.15 3.2E-02 OAS1 12q24.1 2.11 4.1E-02 SRD5A1 5p15 2.11 2.4E-02 MOCOS 18q12 2.08 4.9E-02 ARNTL2 12p12.2-p11.2 2.04 1.7E-02 ISG20 15q26 2.00 1.5E-02 SPRR1A 1q21-q22 1.99 3.8E-02 NFE2L3 7p15-p14 1.96 3.9E-02 ACOT7 1p36.31-p36.11 1.93 1.3E-02 LYPD3 19q13.31 1.93 2.4E-02 SCD 10q24.31 1.91 1.5E-02 ECT2 3q26.1-q26.2 1.89 2.3E-02 PKP2 12p11 1.88 2.4E-02 ATF5 19q13.3 1.88 3.6E-02 ISG15 1p36.33 1.84 2.9E-02 SLC2A1 1p35-p31.3 1.82 3.7E-02 TNFSF10 3q26 1.80 4.7E-02 DTL 1q32.1-q32.2 1.79 3.2E-02 SUSD4 1q41 1.79 2.0E-02 RAPGEFL1 17q21.1 1.79 2.0E-02 RSAD2 2p25.2 1.79 3.3E-02 MELK 9p13.2 1.77 5.0E-02 PTTG1 5q35.1 1.77 2.4E-02 NP 14q13.1 1.74 1.4E-02 DSC2 18q12.1 1.72 3.5E-02 MX1 21q22.3 1.72 4.6E-02 IFIH1 2q24 1.72 1.9E-02
10 UCK2 11q13 1.71 4.3E-02 SYNGR2 17q25.3 1.71 2.3E-02 OAS3 12q24.2 1.70 3.1E-02 SFN 1p36.11 1.70 3.9E-02 ADAM8 10q26.3 1.69 3.8E-02 MTHFD2 2p13.1 1.68 4.7E-02 IFI16 1q22 1.67 3.1E-02 STAT1 2q32.2 1.67 4.9E-02 KRT75 12q13 1.67 1.9E-02 NME1 17q21.3 1.67 5.0E-03 GOT1 10q24.1-q25.1 1.65 3.4E-02 ZWINT 10q21-q22 1.65 9.2E-03 PPIF 10q22-q23 1.63 3.9E-02 BIRC5 17q25 1.62 3.3E-02 HSD17B1 17q11-q21 1.62 4.8E-02 PLA2G4C 19q13.3 1.62 1.7E-02 TYMP 22q13.33 1.61 8.1E-03 F12 5q33-qter 1.60 3.8E-02 PGD 1p36.3-p36.13 1.60 5.3E-03 KPNA2 17q24.2 1.59 4.9E-02 OASL 12q24.2 1.58 2.1E-02 CTPS 1p34.1 1.58 1.1E-02 AACS 12q24.31 1.58 2.9E-02 ANKRD5 20pter-q11.23 1.58 3.9E-02 FRK 6q21-q22.3 1.58 1.9E-02 PRC1 15q26.1 1.57 3.6E-02 PKM2 15q22 1.57 2.6E-02 GPI 19q13.1 1.56 1.9E-02 IFI44 1p31.1 1.56 4.3E-02 MRPL42 12q22 1.56 3.9E-03 MCCC2 5q12-q13 1.56 9.7E-03 C7orf10 7p14.1 1.56 1.2E-02 SCO2 22q13.33 1.55 3.9E-03 IDH2 15q26.1 1.55 3.6E-02 ENTPD3 3p21.3 1.55 2.4E-02 TPI1 12p13 1.55 1.0E-02 TPST2 22q12.1 1.55 4.2E-02 MAD2L1 4q27 1.54 5.0E-02 SQRDL 15q15 1.53 1.3E-02 MAP3K14 17q21 1.53 2.9E-02 FOLH1 11p11.2 1.53 1.7E-02 RGS16 1q25-q31 1.52 2.9E-02 DDX60 4q32.3 1.52 2.1E-02 PCCB 3q21-q22 1.51 9.7E-03 DLK2 6p21.1 -1.51 1.3E-02 MARCKS 6q22.2 -1.51 2.2E-02 ZNF702 19q13.41 -1.51 2.4E-02 CLCNKA 1p36 -1.51 5.8E-03 CYBRD1 2q31.1 -1.52 4.4E-02 FAM110B 8q12.1 -1.52 3.7E-02 C5orf23 5p13.3 -1.52 3.9E-03
11 DISC1 1q42.1 -1.52 3.9E-03 TNNT2 1q32 -1.52 2.5E-02 WDFY3 4q21.23 -1.52 3.5E-02 FRMD4A 10p13 -1.52 3.6E-02 CDR2 16p12.3 -1.53 4.5E-02 CENTD1 4p14 -1.53 1.6E-02 CCDC68 18q21 -1.53 1.1E-02 SMYD2 1q41 -1.53 3.8E-02 OSBPL1A 18q11.1 -1.54 3.6E-02 EPB41L2 6q23 -1.54 1.2E-02 TARDBP 1p36.22 -1.54 4.2E-02 MAGEH1 Xp11.21 -1.55 2.9E-02 CRLF1 19p12 -1.55 4.9E-02 ZNF529 19q13.41 -1.55 4.2E-02 GFRA3 5q31.1-q31.3 -1.56 1.2E-02 AMT 3p21.2-p21.1 -1.56 3.2E-02 OBSL1 2q35 -1.57 4.5E-02 PYGL 14q21-q22 -1.57 3.3E-02 GYPC 2q14-q21 -1.58 3.0E-02 ENC1 5q12-q13.3 -1.58 4.8E-02 B3GNT1 11q13.1 -1.58 1.9E-02 RGL1 1q25.3 -1.58 5.0E-03 NISCH 3p21.1 -1.59 2.7E-02 SFRS18 6q16.3 -1.59 1.8E-02 DIXDC1 11q23.1 -1.59 3.5E-03 SERPINB9 6p25 -1.59 4.0E-02 SLC16A5 17q25.1 -1.59 1.2E-02 FZD1 7q21 -1.60 3.6E-02 GOLGA4 3p22-p21.3 -1.60 1.6E-02 MEG3 14q32 -1.61 4.5E-02 NDUFC2 11q14.1 -1.61 3.1E-02 VIM 10p13 -1.62 1.8E-02 RGS5 1q23.1 -1.62 4.8E-02 ZNF167 3p22.3-p21.1 -1.63 3.6E-02 SGSH 17q25.3 -1.63 1.3E-02 TGM2 20q12 -1.63 3.1E-02 MAN1C1 1p35 -1.64 4.0E-02 RECK 9p13.3 -1.65 3.6E-02 SEMA3F 3p21.3 -1.65 3.6E-02 LTBP3 11q13.1 -1.66 2.6E-02 CDC14A 1p21 -1.66 1.5E-02 PLK2 5q12.1-q13.2 -1.66 4.0E-02 ROCK2 2p24 -1.67 4.8E-03 FBXO9 6p12.3-p11.2 -1.67 1.4E-02 C3orf63 3p14.3 -1.67 1.9E-03 SIAH1 16q12 -1.69 1.3E-02 KIAA1305 14q12 -1.69 3.1E-02 COL6A2 21q22.3 -1.70 2.3E-02 IQGAP2 5q13.3 -1.70 2.0E-02 FRY 13q13.1 -1.70 3.0E-02 WWC2 4q35.1 -1.71 3.6E-02
12 THSD4 15q23 -1.72 5.9E-04 NUDT4 12q21 -1.72 1.0E-02 NTF3 12p13 -1.72 1.2E-02 PFTK1 7q21-q22 -1.72 4.2E-02 ADH1C 22q11.23 -1.73 3.8E-02 EDAR 2q11-q13 -1.73 3.7E-02 FOLR1 11q13.3-q14.1 -1.73 1.3E-02 PDXK 21q22.3 -1.74 4.0E-02 ESR1 6q25.1 -1.74 3.8E-02 SNCA 4q21 -1.75 1.9E-02 GULP1 2q32.3-q33 -1.75 2.1E-02 GPR177 1p31.3 -1.75 4.8E-02 FAM13A1 4q22.1 -1.76 5.3E-03 ABLIM1 10q25 -1.76 2.0E-02 ABCC10 6p21.1 -1.77 1.0E-02 CTDSPL 3p21.3 -1.77 1.2E-02 LMO2 11p13 -1.77 4.3E-02 TNIK 3q26.2-q26.31 -1.78 2.8E-02 PDE5A 4q25-q27 -1.78 1.3E-02 NPR3 5p14-p13 -1.78 3.6E-04 CDKN1C 11p15.5 -1.78 2.4E-02 KAZALD1 10q24.31 -1.79 5.0E-03 DST 6p12.1 -1.80 1.6E-02 NEDD4 15q -1.80 4.1E-02 EFEMP2 11q13.1 -1.80 3.5E-02 CRIM1 2p21 -1.80 5.0E-03 PRH1 12p13.2 -1.82 4.7E-02 LAMA2 6q22-q23 -1.83 3.1E-02 ANKRD6 q14.2-q16.1 -1.83 3.3E-02 PLD1 3q26 -1.83 4.3E-02 FERMT2 14q22.2 -1.84 3.6E-02 ZNF423 16q12 -1.84 1.3E-02 SNED1 2q37.3 -1.85 2.1E-02 ID3 1p36.13-p36.12 -1.85 3.9E-02 THSD7A 7p21.3 -1.85 4.2E-02 PTPRN2 7q36 -1.86 1.8E-02 NFAT5 16q22.1 -1.87 1.5E-02 FHL1 Xq26 -1.88 3.2E-02 XYLT1 16p12.3 -1.89 1.6E-02 ADARB1 21q22.3 -1.91 5.0E-03 EPHA4 2q36.1 -1.95 4.0E-02 CDH6 5p15.1-p14 -1.95 8.7E-03 TSPAN4 11p15.5 -1.97 1.5E-02 ZNF667 19q13.43 -1.98 2.2E-02 PROM1 4p15.32 -1.98 3.4E-02 ITM2C 2q37 -1.98 3.9E-03 C10orf56 10q22.3 -1.99 1.8E-02 SPRY1 4q28.1 -2.01 2.2E-02 DKFZP586H2123 11p13 -2.01 2.1E-02 DOCK4 7q31.1 -2.01 2.4E-02 BCAM 19q13.2 -2.01 3.6E-02
13 RICH2 17p12 -2.02 2.3E-02 BEX4 Xq22.1-q22.3 -2.02 3.1E-02 TGFBR2 3p22 -2.02 1.1E-02 C5orf4 5q31-q32 -2.03 1.6E-02 TENC1 12q13.13 -2.03 3.9E-03 ISLR 15q23-q24 -2.04 1.9E-02 TRHDE 12q15-q21 -2.06 2.4E-02 JAM3 11q25 -2.06 6.0E-03 AKR1C1 10p15-p14 -2.07 2.2E-02 ZNF415 19q13.41 -2.07 3.8E-02 NELL1 11p15.2-p15.1 -2.07 3.5E-03 CAP2 6p22.3 -2.08 1.8E-02 PKNOX2 11q -2.09 2.2E-02 TRPC1 3q22-q24 -2.11 1.2E-02 EFHD1 2q37.1 -2.12 1.1E-02 QKI 6q26-q27 -2.13 1.4E-02 AKR1C2 10p15-p14 -2.13 4.7E-02 MN1 22q12.1 -2.16 3.7E-02 ADORA2B 17p12-p11.2 -2.17 4.1E-02 MFAP4 17p11.2 -2.18 5.0E-03 LOC286191 8q13.3 -2.19 1.2E-02 METTL7A 12q13.13 -2.19 5.0E-03 LRIG1 3p14 -2.19 4.2E-02 C10orf116 10q23.2 -2.20 2.1E-02 ADAMTS3 4q13.3 -2.21 1.0E-02 FBXL7 5p15.1 -2.21 1.4E-02 SERPINF1 17p13.1 -2.21 1.2E-02 SYT17 16p12.3 -2.23 1.2E-02 TMEM47 Xp11.4 -2.26 1.8E-02 VGLL3 3p12.1 -2.28 2.7E-02 TMEM204 16p13.3 -2.35 2.3E-02 GPRASP1 Xq22.1 -2.35 1.4E-02 TGM1 14q11.2 -2.37 1.3E-02 ITIH5 10p14 -2.37 1.4E-02 PON3 7q21.3 -2.38 5.7E-03 CPE 4q32.3 -2.39 4.8E-02 GREM2 1q43 -2.40 4.8E-02 ST8SIA1 12p12.1-p11.2 -2.43 3.9E-03 VLDLR 9p24 -2.43 1.8E-02 FBN2 5q23-q31 -2.44 2.8E-02 FAM107A 3p21.1 -2.44 4.5E-02 FN1 2q34 -2.47 3.7E-02 LRRC2 3p21.31 -2.52 4.2E-02 GAS2 11p14.3-p15.2 -2.55 1.6E-02 TSPAN12 7q31.31 -2.57 2.4E-02 KIAA0644 7p15.1 -2.58 9.1E-03 AKAP12 6q24-q25 -2.58 1.4E-02 EDNRA 4q31.23 -2.63 3.5E-02 CLU 8p21-p12 -2.73 1.1E-02 GPM6A 4q34 -2.74 9.7E-03 NRP1 10p12 -2.75 1.1E-02
14 SOBP 6q21 -2.77 9.7E-03 FLRT2 14q24-q32 -2.81 4.5E-02 VEGFC 4q34.1-q34.3 -2.81 3.3E-03 ADCY2 5p15.3 -2.84 1.0E-02 CLIC5 6p21.1-p12.1 -2.87 1.4E-03 GPR88 1p21.3 -2.91 4.2E-02 SAMD4A 14q22.2 -3.02 4.3E-03 PEG3 19q13.4 -3.08 1.9E-02 FRZB 2qter -3.17 3.3E-02 ID4 6p22-p21 -3.20 3.5E-02 DKK2 4q25 -3.27 3.9E-03 COL9A3 20q13.3 -3.29 5.3E-03 CTGF 6q23.1 -3.31 3.6E-02 SEMA3E 7q21.11 -3.34 1.9E-03 CXCL1 4q21 -3.34 8.9E-03 SLPI 20q12 -3.36 4.9E-02 IGFBP6 12q13 -3.50 8.9E-03 SLITRK5 13q31.2 -3.53 5.0E-03 SGCE 7q21-q22 -3.59 2.1E-02 ST6GALNAC5 1p31.1 -3.64 3.7E-04 FLRT3 20p11 -3.81 1.0E-02 DLK1 14q32 -3.86 3.1E-02 PCDH9 13q14.3-q21.1 -3.94 3.6E-04 EDN3 20q13.2-q13.3 -3.99 1.8E-02 PEG10 7q21 -4.02 2.2E-02 LEPR 1p31 -4.58 1.6E-04 CXCL6 4q21 -4.98 1.8E-03 TDGF1 3p21.31 -4.99 3.7E-02
15 Supplemental Table 7: Recurrent copy number alterations in thymic carcinomas.
Chromosome Cytoband Genes Average copy number
3 p14.1 FAM19A1 -2.02 6 q13 KHDEC1, EIF3EP, DPPA5, OOEP, -1.46 DDX43, MTO1, EEF1A1, SLC17A5 6 q21 CDC2L6, AMD1, GTF3C6, BXDC1 -1.46 6 q27 PDE10A -2.45 17 p13.3 RABEP1 -1.47
Multiple regions that overlap with CNVs reported in the Database of Genomic Variants (DGV hg18, Build 36) are not listed here.
16 Supplemental Table 8: Characteristics of samples used for the direct comparison of the genomic profiles of thymic squamous cell carcinoma (n=7) and lung primary squamous cell carcinoma
(n=6).
Tumor Pathology ID Type Stage Grade CD5 expression
Thymic carcinomas
39 SCC 2 moderate positive 40 SCC 4 high positive 41 SCC 3 moderate positive 42 SCC 3 moderate negative 43 SCC 2 high negative 44 SCC 3 high negative 45 SCC 3 moderate positive
Lung carcinomas
LSCC1 SCC 2 moderate negative LSCC2 SCC 3 high negative LSCC3 SCC 2 moderate negative LSCC4 SCC 2 high negative LSCC5 SCC 3 moderate negative LSCC6 SCC 3 high negative
17